This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aronow, B J
Right arrow Articles by Wiginton, D A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aronow, B J
Right arrow Articles by Wiginton, D A

 Previous Article  |  Next Article 

Mol Cell Biol. 1992 September; 12(9): 4170-4185

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

B J Aronow, R N Silbiger, M R Dusing, J L Stock, K L Yager, S S Potter, J J Hutton and D A Wiginton

Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati Children's Hospital, Ohio 45229.

ABSTRACT

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Mol Cell Biol. 1992 September; 12(9): 4170-4185




This article has been cited by other articles:

  • Maier, E. A., Dusing, M. R., Wiginton, D. A. (2006). Temporal Regulation of Enhancer Function in Intestinal Epithelium: A ROLE FOR ONECUT FACTORS. J. Biol. Chem. 281: 32263-32271 [Abstract] [Full Text]  
  • Hiroki, T., Song, Y.-H., Liebhaber, S. A., Cooke, N. E. (2006). The human vitamin D-binding protein gene contains locus control determinants sufficient for autonomous activation in hepatic chromatin.. Nucleic Acids Res 34: 2154-2165 [Abstract] [Full Text]  
  • Harrow, F., Ortiz, B. D. (2005). The TCR{alpha} Locus Control Region Specifies Thymic, But Not Peripheral, Patterns of TCR{alpha} Gene Expression. J. Immunol. 175: 6659-6667 [Abstract] [Full Text]  
  • Dusing, M. R., Florence, E. A., Wiginton, D. A. (2003). High-level activation by a duodenum-specific enhancer requires functional GATA binding sites. Am. J. Physiol. Gastrointest. Liver Physiol. 284: G1053-G1065 [Abstract] [Full Text]  
  • Li, Q., Peterson, K. R., Fang, X., Stamatoyannopoulos, G. (2002). Locus control regions. Blood 100: 3077-3086 [Abstract] [Full Text]  
  • Jin, Z.-X., Kishi, H., Wei, X.-C., Matsuda, T., Saito, S., Muraguchi, A. (2002). Lymphoid Enhancer-Binding Factor-1 Binds and Activates the Recombination-Activating Gene-2 Promoter Together with c-Myb and Pax-5 in Immature B Cells. J. Immunol. 169: 3783-3792 [Abstract] [Full Text]  
  • Jegga, A. G., Sherwood, S. P., Carman, J. W., Pinski, A. T., Phillips, J. L., Pestian, J. P., Aronow, B. J. (2002). Detection and Visualization of Compositionally Similar cis-Regulatory Element Clusters in Orthologous and Coordinately Controlled Genes. Genome Res 12: 1408-1417 [Abstract] [Full Text]  
  • Li, Y., Okuno, Y., Zhang, P., Radomska, H. S., Chen, H.-m., Iwasaki, H., Akashi, K., Klemsz, M. J., McKercher, S. R., Maki, R. A., Tenen, D. G. (2001). Regulation of the PU.1 gene by distal elements. Blood 98: 2958-2965 [Abstract] [Full Text]  
  • Reizis, B., Leder, P. (2001). The Upstream Enhancer Is Necessary and Sufficient for the Expression of the Pre-T Cell Receptor {alpha} Gene in Immature T Lymphocytes. JEM 194: 979-990 [Abstract] [Full Text]  
  • Adams, K., Ackerly, H., Cunningham, K., Dunnick, W. (2000). A DNase I hypersensitive site near the murine {gamma}1 switch region contributes to insertion site independence of transgenes and modulates the amount of transcripts induced by CD40 ligation. Int Immunol 12: 1705-1713 [Abstract] [Full Text]  
  • Dusing, M. R., Brickner, A. G., Lowe, S. Y., Cohen, M. B., Wiginton, D. A. (2000). A duodenum-specific enhancer regulates expression along three axes in the small intestine. Am. J. Physiol. Gastrointest. Liver Physiol. 279: G1080-G1093 [Abstract] [Full Text]  
  • Heydemann, A., Warming, S., Clendenin, C., Sigrist, K., Hjorth, J. P., Simon, M. C. (2000). A minimal c-fes cassette directs myeloid-specific expression in transgenic mice. Blood 96: 3040-3048 [Abstract] [Full Text]  
  • Barndt, R., Dai, M.-F., Zhuang, Y. (1999). A Novel Role for HEB Downstream or Parallel to the Pre-TCR Signaling Pathway During {alpha}{beta} Thymopoiesis. J. Immunol. 163: 3331-3343 [Abstract] [Full Text]  
  • Lewis, A. L., Xia, Y., Datta, S. K., McMillin, J., Kellems, R. E. (1999). Combinatorial Interactions Regulate Cardiac Expression of the Murine Adenylosuccinate Synthetase 1 Gene. J. Biol. Chem. 274: 14188-14197 [Abstract] [Full Text]  
  • Bulger, M., von Doorninck, J. H., Saitoh, N., Telling, A., Farrell, C., Bender, M. A., Felsenfeld, G., Axel, R., Groudine, M. (1999). Conservation of sequence and structure flanking the mouse and human beta -globin loci: The beta -globin genes are embedded within an array of odorant receptor genes. Proc. Natl. Acad. Sci. USA 96: 5129-5134 [Abstract] [Full Text]  
  • Xu, P. A., Winston, J. H., Datta, S. K., Kellems, R. E. (1999). Regulation of Forestomach-specific Expression of the Murine Adenosine Deaminase Gene. J. Biol. Chem. 274: 10316-10323 [Abstract] [Full Text]  
  • Ahmed, M., Taylor, W., Smith, P. R., Becker, M. A. (1999). Accelerated Transcription of PRPS1 in X-linked Overactivity of Normal Human Phosphoribosylpyrophosphate Synthetase. J. Biol. Chem. 274: 7482-7488 [Abstract] [Full Text]  
  • Pinto, D., Robine, S., Jaisser, F., Marjou, F. E., Louvard, D. (1999). Regulatory Sequences of the Mouse Villin Gene That Efficiently Drive Transgenic Expression in Immature and Differentiated Epithelial Cells of Small and Large Intestines. J. Biol. Chem. 274: 6476-6482 [Abstract] [Full Text]  
  • Ortiz, B. D., Cado, D., Winoto, A. (1999). A New Element within the T-Cell Receptor alpha  Locus Required for Tissue-Specific Locus Control Region Activity. Mol. Cell. Biol. 19: 1901-1909 [Abstract] [Full Text]  
  • Vassilopoulos, G., Navas, P. A., Skarpidi, E., Peterson, K. R., Lowrey, C. H., Papayannopoulou, T., Stamatoyannopoulos, G. (1999). Correct Function of the Locus Control Region May Require Passage Through a Nonerythroid Cellular Environment. Blood 93: 703-712 [Abstract] [Full Text]  
  • Xie, W., Duan, R., Safe, S. (1999). Estrogen Induces Adenosine Deaminase Gene Expression in MCF-7 Human Breast Cancer Cells: Role of Estrogen Receptor-Sp1 Interactions. Endocrinology 140: 219-227 [Abstract] [Full Text]  
  • Chen, C.-C., Rivera, A., Ron, N., Sutkowski, N., Dougherty, J. P., Ron, Y. (1998). Long-Term Contribution to the Myeloid Compartment by Lineage-Committed Stem Cells. Blood 92: 3210-3217 [Abstract] [Full Text]  
  • Rohrer, J., Ellen Conley, M. (1998). Transcriptional Regulatory Elements Within the First Intron of Bruton's Tyrosine Kinase. Blood 91: 214-221 [Abstract] [Full Text]  
  • Scholz, H., Bossone, S. A., Cohen, H. T., Akella, U., Strauss, W. M., Sukhatme, V. P. (1997). A Far Upstream Cis-element Is Required for Wilms' Tumor-1 (WT1) Gene Expression in Renal Cell Culture. J. Biol. Chem. 272: 32836-32846 [Abstract] [Full Text]  
  • Neznanov, N., Umezawa, A., Oshima, R. G. (1997). A Regulatory Element within a Coding Exon Modulates Keratin 18 Gene Expression in Transgenic Mice. J. Biol. Chem. 272: 27549-27557 [Abstract] [Full Text]  
  • Dusing, M. R., Brickner, A. G., Thomas, M. B., Wiginton, D. A. (1997). Regulation of Duodenal Specific Expression of the Human Adenosine Deaminase Gene. J. Biol. Chem. 272: 26634-26642 [Abstract] [Full Text]  
  • Lauzurica, P., Zhong, X.-P., Krangel, M. S., Roberts, J. L. (1997). Regulation of T Cell Receptor {delta} Gene Rearrangement by CBF/PEBP2. JEM 185: 1193-1202 [Abstract] [Full Text]  
  • Oeltjen, J. C., Malley, T. M., Muzny, D. M., Miller, W., Gibbs, R. A., Belmont, J. W. (1997). Large-Scale Comparative Sequence Analysis of the Human and Murine Bruton's Tyrosine Kinase Loci Reveals Conserved Regulatory Domains. Genome Res 7: 315-329 [Abstract] [Full Text]  
  • Shi, D., Winston, J. H., Blackburn, M. R., Datta, S. K., Hanten, G., Kellems, R. E. (1997). Diverse Genetic Regulatory Motifs Required for Murine Adenosine Deaminase Gene Expression in the Placenta. J. Biol. Chem. 272: 2334-2341 [Abstract] [Full Text]  
  • Englander, E. W., Howard, B. H. (1995). Nucleosome Positioning by Human Alu Elements in Chromatin. J. Biol. Chem. 270: 10091-10096 [Abstract] [Full Text]  
  • Forrester, W., van Genderen, C, Jenuwein, T, Grosschedl, R (1994). Dependence of enhancer-mediated transcription of the immunoglobulin mu gene on nuclear matrix attachment regions. Science 265: 1221-1225 [Abstract]  
  • Porter, S., Meyer, C. (1994). A distal tyrosinase upstream element stimulates gene expression in neural-crest-derived melanocytes of transgenic mice: position-independent and mosaic expression. Development 120: 2103-2111 [Abstract]  


Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»