INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Transcription of class III genes involves multiple interactions between promoter elements, auxiliary transcription factors, and RNA polymerase III (Pol III). Prototypical class III genes, like tRNA and 5S RNA genes, have intragenic promoter elements or internal control regions, differing in this way from class I and class II genes. The internal control regions of tRNA genes are composed of two sequence elements, termed the A and B blocks, that are separated by variable distances (31 to 93 bp in the 273 tRNA genes of Saccharomyces cerevisiae). The process of gene activation has been much investigated in vitro with purified components, especially in the yeast system (19, 25, 61). Two multisubunit factors, transcription factor IIIB (TFIIIB) and TFIIIC, are required for transcription of yeast tRNA genes. Transcription complex assembly is initiated by the binding of TFIIIC to the A and B block elements. Through its interaction with the B block, which functions to some extent in a distance- and orientation-independent manner (11), TFIIIC behaves as an enhancer binding factor and relieves repression by chromatin (10). Via A block binding, TFIIIC recruits TFIIIB at an upstream position and hence indirectly influences start site selection (4, 24, 26, 27). TFIIIB-DNA complexes stripped of TFIIIC are competent and sufficient to direct correct initiation and multiple rounds of transcription by Pol III (26).

Yeast TFIIIC ( factor) is a large, multisubunit protein of about 550 to 600 kDa. It is made of two large domains with distinct DNA binding specificities, Tau A (A) and Tau B (B), that can be visualized by electron microscopy in a free or DNA-bound form (11, 47). The chromatographic separation of A and B has never been observed, but limited proteolysis releases the B domain which retains B block binding specificity (40). Affinity-purified TFIIIC consistently contains six polypeptides of 138, 131, 95, 91, 60, and 55 kDa (3, 17, 42). An additional polypeptide of 75 kDa has been noted occasionally in highly purified TFIIIC fractions. The TFIIIC subunit status of the three largest polypeptides is well established, based on gene cloning (33, 38, 41, 53), mutagenesis (34, 44, 48, 60), protein-DNA cross-linking (3, 9, 17) and coimmunoprecipitation (13, 41) experiments. The 138 subunit resides in the B domain and interacts with DNA at the level of the B block (3, 17). A mutation in the 138 subunit, encoded by TFC3, decreased TFIIIC-tRNA gene (DNA) binding affinity and also affected 5S RNA synthesis in vitro (34). All three components of TFIIIB (TATA binding protein [TBP], TFIIIB70/BRF1, and TFIIIB90/B"), when overexpressed, were found to suppress this defect in vivo (34, 46). 131 is the TFIIIC subunit that can be cross-linked to the most upstream position within the TFIIIB binding site, at the level of the start site and further downstream (3, 4). It interacts with TFIIIB70/BRF1 and with TFIIIB90/B" (12, 28, 46) and therefore presumably ensures TFIIIB assembly on the DNA. Indeed, mutations in 131 influence the level of active TFIIIB or the rate of TFIIIB recruitment (44). 95 is thought to be responsible for A block recognition (3, 17, 53). Little is known about the other TFIIIC-associated polypeptides. Site-specific DNA-protein cross-linking indicated that the 91-kDa component is located at the 3' end of 5S RNA or tRNA^Tyr genes (9) and that the 55-kDa protein lies in the vicinity of the A block, close to 95 (3, 4).

Human TFIIIC activity has been partially characterized but appears to be more complex than yeast TFIIIC activity. Human TFIIIC separates into two protein fractions, TFIIIC1 and TFIIIC2 (57, 62). TFIIIC2 is comprised of five subunits (, , , , and ) of 230, 110, 100, 80, and 60 kDa, respectively (29, 57, 63); it binds to the B block element tightly (7, 15, 62) and thus appears to be similar to yeast TFIIIC. However, unlike yeast TFIIIC, this multiprotein complex is deficient in A block binding and transcription factor activities, both of which require the TFIIIC1 fraction. The polypeptide composition of TFIIIC1 and its role in promoter recognition and TFIIIB assembly are still unclear (14, 57). Intriguingly, the TFIIIC1 fraction extends the footprint of TFIIIC2 to and beyond the A block as well as to downstream sequences over the termination region (57, 62), to which it can bind by itself (57). The complexity of human TFIIIC thus makes it difficult to draw a simple correlation with yeast TFIIIC, inasmuch as the two largest subunits of TFIIIC2, TFIIIC and TFIIIC (30, 35, 51), show no significant sequence similarity to any of the three cloned subunits of TFIIIC (138, 131, and 95).

In the present work, we have pursued the characterization of TFIIIC components by cloning a yeast gene, termed TFC6, which encodes the 91-kDa polypeptide (91). We show that 91 is an essential subunit of TFIIIC that cooperates with 138 for DNA binding.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

DNA constructions and yeast strains. Two oligonucleotides (Ol 1 [5'TCTTCCTCTAGTTCGACCCG] and Ol 2 [5'ATTTAGGATCCCTTCTTCTCC]) were used to amplify the open reading frame (ORF) and surrounding sequences of the TFC6 gene by PCR. The resulting 3,400-bp S. cerevisiae genomic DNA fragment was cloned into a pGEM-T vector (Promega) to obtain pGEM128. Yeast centromeric and multicopy pYc91 and pYµ91 plasmids were obtained by cloning the pGEM128 KpnI-SpeI fragment harboring the TFC6 gene into Ycplac33 and YEplac112 vectors (20), respectively.

Disruption of TFC6. The whole TFC6 ORF was disrupted by the direct-deletion method (6). Two 57-mer oligonucleotides were used to amplify by PCR a DNA fragment containing the HIS3 gene and stop modules flanked by TFC6 promoter and terminator sequences. The 1,078-bp PCR-amplified fragment was directly used to transform the strain YNN281 × YNN282 (22). The structure of the diploid His3⁺ disruptants (called YNNRA1) was verified by PCR analysis. YNNRA1 was transformed with pYc91, and after sporulation and dissection, a His⁺ spore containing pYc91 was chosen to give YNRA2. TFC6 disruption was performed in the same way in strain D135-g2 × SRY15-5d.

Purification of TFIIIC. TFIIIC was purified as previously described (23). Briefly, for preparative electrophoresis, HA-tagged-95-containing TFIIIC was purified from 1,300 g of cells. Three hundred to 400 pmol of tDNA affinity-purified factor was resolved on a sodium dodecyl sulfate (SDS)-8% polyacrylamide gel and stained with Coomassie blue. A gel slice containing the 91-kDa (91) polypeptide was incubated with proteinase K or trypsin, and four polypeptides, isolated by reversed-phase high-pressure liquid chromatography, were microsequenced (34). TFIIIC containing the HA-tagged 91 subunit was purified from 20 g of YNRA3 cells by three chromatographic steps, i.e., Ultrogel-heparin, DEAE-Sephadex, and tDNA affinity chromatography, as previously described (23).

Expression and purification of recombinant His-HA-91. Recombinant TFC6 protein (rTFC6p or r91) fused at its N terminus to six histidines and to the HA epitope was obtained from Escherichia coli BL21(DE3)(pLysS) transformed with the plasmid pET91. Cell culture, protein induction and crude extract preparation were performed essentially as described previously (46) except that buffer A10 (20 mM HEPES [pH 7.5], 500 mM NaCl, 10% glycerol, 10 mM imidazole) was used as the lysis buffer. Crude cell extract containing r91 was recovered after centrifugation at 145,000 × g for 45 min at 4°C and subjected to fast protein liquid chromatography in a 1-ml Ni²⁺-charged HiTrap chelating (Pharmacia) column. Proteins were eluted by a linear gradient of 53.5 to 300 mM imidazole. The peak of r91 was eluted at ~100 mM imidazole. Fractions containing the recombinant protein were pooled and further purified with the Smart System. The Ni²⁺ eluate was diluted with buffer B0 (20 mM Tris-HCl [pH 8], 0.5 mM EDTA, 10 mM -mercaptoethanol, 10% glycerol) to a salt concentration equivalent to 100 mM ammonium sulfate and applied on a 100-µl heparin HyperD (BioSepra) column. Proteins were eluted with buffer B600 (600 mM ammonium sulfate in B0 buffer) and loaded on a Superdex 75 column previously equilibrated in buffer B300 (300 mM ammonium sulfate in B0 buffer). The concentration and purity of r91 were estimated to be about 1 to 5 ng/µl and more than 95%, respectively, by visual analysis of a silver-stained SDS-polyacrylamide gel.

Anti-91 polyclonal antibodies. Partially purified r91 was loaded on a preparative SDS-8% polyacrylamide gel, and the band containing the 91-kDa protein was excised and injected into mice for antibody production. A total of 40 µg of purified protein was injected in four injections at 3-week intervals. The mice were then inoculated with ascite cells, and three batches of about 5 to 10 ml each of ascitic fluid were collected. To purify anti-91 antibodies, immunoglobulins were adsorbed on a 300-µl protein A-Sepharose column and eluted with 0.1 M glycine, pH 3. Fractions (250 µl) were collected in tubes containing 25 µl of 1 M Tris-HCl, pH 8. The protein concentration (~0.6 µg/µl) was estimated by Bradford analysis (8). Control ascitic fluid was treated similarly to give control antibodies.

DNA binding and in vitro transcription assays. Unless otherwise indicated, TFIIIC-tDNA interaction was monitored by gel retardation analysis as described previously (34), using either Ultrogel-heparin or DNA-affinity purified TFIIIC fractions. B-tDNA interaction was observed after limited proteolysis of TFIIIC-tDNA complexes. After 10 min of incubation at 25°C, 10 ng of -chymotrypsin (Sigma) was added to the TFIIIC-tDNA^Glu complex mixture and further incubated at 25°C for 10 min. Chymotrypsin digestion was stopped by addition of 1 ng of aprotinin (Sigma).

In vivo UAS_G-U6 chimeric transcription system. UAS_G-U6 RNA gene constructs were as described previously (39). The GAL4-(1-147)-91, GAL4-(AD)-91, GAL4-(1-147)-95, and GAL4-(AD)-95 fusions were expressed from the plasmids pAS91, pACT91, pAS95, and pACT95, respectively. pACT91 and pAS91 were constructed as described above. pACT95 and pAS95 were obtained by cloning a BglII fragment of a mutagenized form of TFC1 into BamHI-digested pACTII and pAS1-CYH2 vectors. Transformation of strain YPH500, RNA extraction, and Northern blot analysis were performed as described previously (39).

Isolation of tfc3-G349E suppressors and genetic methods. An overnight liquid culture of the thermosensitive D135-3c strain (MAT tfc3-G349E [see Table 1 for the complete genotype]) was plated (10⁶ cells/plate) on yeast extract-peptone-dextrose, UV irradiated with a Vilbert Lourmat lamp for 10 or 20 s at 254 nm (4 W/m²), and incubated in the dark at 37°C for 3 days (32). Survival was about 70 and 40%, respectively, as determined by cell plating efficiency. The efficiency of mutagenesis was estimated by measuring the frequency of CAN^r (canavanine-resistant) mutants, which was 1.2 × 10⁴ cells. Viable colonies were reisolated at 37°C and backcrossed with the MATa tfc3-G349E strain D135-2c to determine their dominance and the monogenic character of suppression. Fifteen clones were retained for further characterization as described in Results.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Identification, cloning, and disruption of the TFC6 gene. The 91-kDa polypeptide present in affinity-purified yeast TFIIIC (91) was isolated by preparative SDS-polyacrylamide electrophoresis (SDS-PAGE). The gel-purified protein was digested with proteinase K or with trypsin, and the amino acid sequences of four peptides (underlined in Fig. 1A) were determined. When compared to the National Center for Biotechnology Information nonredundant database, all of these peptide sequences were found to be contained in a protein encoded by a 2,019-bp ORF located on chromosome IV of S. cerevisiae (Fig. 1A). This gene, identified as YDR362C by the group of Mark Johnston, was renamed TFC6. Two remarkable regions were found in the predicted sequence of TFC6p (Fig. 1B): the N-terminal part (amino acids 7 to 180) contains a highly acidic region between two basic domains, and the central part contains a cluster of 13 cysteine and histidine residues (amino acids 328 to 411) that potentially binds zinc ions. However, TFC6p showed no similarity to any protein sequence in the EMBL/GenBank data bank or to current versions of the Schizosaccharomyces pombe and Caenorhabditis elegans genomic sequences. A direct comparison of TFC6p with the two largest subunits of human TFIIIC2, TFIIIC and -, (30, 35, 51), by direct pairwise sequence alignment (43) also revealed no significant homology.

View larger version (67K): [in this window] [in a new window]   FIG. 1.   Sequence analysis of TFC6 and characterization of anti-91 antibodies. (A) Deduced amino acid sequence of TFC6. The four microsequenced peptides used for database searching are underlined (GenBank no. U28372). The TFC6 mutation, E330K, responsible for tfc3-G349E suppression is boxed. (B) Amino acid analysis of 91. The acidic-basic map shows the position of acidic (A) (D, short bars; E, long bars), and basic (B) (R, long bars; K, short bars; H, smallest bars) amino acids. In the Cys-His map, histidine and cysteine residues are plotted as long and short bars, respectively. (C) Characterization of anti-91 antibodies by Western blotting. Lane 1, the polypeptide content of a tDNA affinity-purified TFIIIC fraction was analyzed in a silver-stained SDS-8% polyacrylamide gel. (Lanes 2 and 3, ~100 ng of TFIIIC (lane 2) and ~20 ng of purified rTFC6p (r91) (lane 3) were subjected to SDS-PAGE, electroblotted to a nitrocellulose membrane, and probed with anti-91 antibodies. Immune complexes were visualized with an ECL kit (Amersham). The positions of 91- and 75-kDa proteins are indicated. The amino acid sequence, acidic-basic map, and Cys-His map are printouts from DNA Strider 1.2 software (37).

tfc6-::HIS3

tfc6-::HIS3/TFC6

tfc6-::HIS3

GAL4(1-147)-91 activates transcription of a B block-deficient U6 RNA gene. To gain some insight into the function of the TFC6 polypeptide and assess its involvement in Pol III transcription in vivo, we used a chimeric system in which a B block-deficient U6 RNA gene (SNR6) can be reactivated by fusing the GAL4 DNA binding domain (amino acids 1 to 147) to a subunit of TFIIIC (or TFIIIB) (39). In this system, the extent of SNR6 gene activation depends on the presence of GAL4 binding sites (UAS_G) at appropriate locations. If TFC6 indeed encoded a subunit of TFIIIC, one would expect that the GAL4(1-147)-91 fusion would anchor TFIIIC on the UAS_G sequence and activate transcription of UAS_G-U6 RNA genes, as in the case of GAL4(1-147)-138 or -131 (39). The experimental scheme is shown in Fig. 2A. All genes carry a 24-bp insertion at position +73 to discriminate the transcripts in Northern blots from endogenous U6 RNA. As shown in Fig. 2B, GAL4(1-147)-91 activated transcription of UAS_G-U6 RNA genes that harbored UAS_G sequences at positions 67, +88 (within the transcribed sequence), and +238 (within the destroyed B block). Similar activation levels were obtained with fusion of GAL4(1-147) to the 95-kDa subunit of TFIIIC (95) (Fig. 2B, lanes 5 to 8). In previous work, we reported that a GAL4(1-147)-95 fusion was incapable of reactivating the UAS_G-U6 RNA templates (39). In fact, we found that the plasmid construct used at that time had a stop codon between the GAL4(1-147) and 95 ORFs that prevented the formation of a hybrid protein. (This mutation went unnoticed because the plasmid was able to complement the deletion of the 95 gene [39].) Only a faint background signal was obtained when 91 or 95 was fused to the GAL4 activation domain or when the cells were transformed with the expression vector (results not shown). These results indicated that TFC6 encoded a component of the Pol III transcription system.

View larger version (36K): [in this window] [in a new window]   FIG. 2.   Activation of the UASG-U6 RNA templates by GAL4(1-147)-91 and GAL4(1-147)-95. (A) Diagram of UASG-U6 RNA gene activation by GAL4(1-147)-91. Each template was named according to the position of the upstream activating sequences (UASG) in each B block-deficient U6 template. TFIIIC is a chimeric  factor whose wild-type 91 subunit has been replaced by the GAL4(1-147)-91 fusion protein. Chimeric TFIIIC binds the U6 template through the UASG sites, and this allows the factor to bind the A box of the SNR6 gene. TFIIIC then recruits TFIIIB, which directs transcription by Poly III. (B) The UASG-U6 RNA transcripts (U6 maxi2 and U6 maxi1) and the endogenous U6 RNA from cells transformed with pAS91 (lanes 1 to 4) or pAS95 (lanes 5 to 8) were monitored by Northern blot analysis and autoradiography. The UASG binding domain (amino acids 1 to 147) of GAL4 is fused to 91 in pAS91 or to 95 in pAS95.

TFC6 encodes the 91-kDa subunit of yeast TFIIIC. In an early attempt to demonstrate that the 91-kDa polypeptide was a subunit of TFIIIC, we modified the TFC6 gene to fuse the HA epitope at the N-terminal position of the protein (plasmid pYCt91-HA [see Materials and Methods]). The modified gene was functional, since it could replace the wild-type gene in a plasmid shuffling assay in which pYCt91-HA was exchanged for the centromeric plasmid pYc91 (CEN URA3 TFC6). This plasmid exchange, which was done in strain YNRA2, generated strain YNRA3, which lacks the chromosomal copy of TFC6 but survives by expressing the HA-tagged polypeptide (Table 1). We confirmed with Western blots that the HA-tagged TFC6-encoded protein (purified from YNRA3) coeluted with TFIIIC activity throughout three successive chromatographic steps. However, anti-HA monoclonal antibodies did not alter the migration of TFIIIC-tDNA₃^Glu complexes in gel shift assays and did not interfere with complex formation (results not shown). This negative result was in sharp contrast to those of similar experiments that demonstrated that 138, 131, and 95 were part of TFIIIC (13, 33, 38). The possibility remained, however, that the HA epitope was not accessible to antibodies within TFIIIC-tDNA complex. Therefore, the same experiment was repeated with mouse polyclonal antibodies raised against the recombinant 91-kDa polypeptide. As shown in Fig. 3, these antibodies retarded the migration of preformed TFIIIC-tDNA complexes (lanes 5 to 7), while antibodies from preimmune serum had no effect (lane 8). This experiment confirmed the status of 91 as a subunit of TFIIIC.

View larger version (77K): [in this window] [in a new window]   FIG. 3.   TFC6 encodes a subunit of factor . DNA affinity-purified factor TFIIIC was complexed with the tRNA3Glu gene, and, when indicated, the complex was digested with 10 ng of -chymotrypsin for 10 min at 25°C to generate the fast-migrating complex B-tDNA. Complexes were then incubated with increasing amounts of polyclonal antibodies directed against 91 for 45 min at 25°C. Protein-tDNA complexes were analyzed by electrophoresis. , position of -tDNA complexes; -IgG, band retarded upon antibody binding; B, protease-resistant domain of TFIIIC bound to tDNA. Lanes 1 to 8, no protease; lanes 9 to 12, -chymotrypsin treatment. Lane 1, no TFIIIC factor, lanes 2 and 9, no antibody, lanes 2 to 7 and 9 to 12, anti-91 immunoglobulin G (IgG). Lane 8, control mouse antibodies.

A dominant mutation (TFC6-E330K) suppresses the tfc3-G349E mutation affecting the 138 subunit. tsv 115 is a recessive, UV-induced, thermosensitive mutation in the TFC3 gene that causes a G349E substitution in the subunit 138 (21, 34). This mutation is referred to in this paper as tfc3-G349E. It affects both the level of TFIIIC and its affinity for tDNA (34). A screen for suppressor mutants (see Materials and Methods) yielded 15 colonies that had regained the ability to grow at 37°C after UV mutagenesis of strain D135-3c (MAT tfc3-G349E). Backcrosses to D135-2c (MATa tfc3-G349E) showed that these suppressors were all due to dominant mutations with a monogenic 2:2 segregation. Further crosses showed that four of them were genetically linked to tfc3-G349E. The remaining 11 extragenic suppressors were classified into six distinct linkage groups (presumably corresponding to one gene per group) by crossing them to each other and measuring the frequency of temperature-sensitive (i.e., nonsuppressed) tfc3-G349E segregants in the offspring. One representative of each group was crossed to the tester strain SRY15-5d (MATa ura3-52 trp4 leu2-3 ade2 tfc3-G349E) bearing the trp4 marker, which maps very close to TFC6 (these genes are separated by about 12 kb on chromosome IV). Two suppressor mutations were found to map very close to TFC6 as shown by their linkage to trp4. To demonstrate that they were allelic to TFC6, we constructed diploid strains that are homozygous for tfc3-G349E and heterozygous for trp4 and for the suppressor allele, and we introduced the tfc6-::HIS3 deletion in these diploids by standard gene disruption. About half of the disruptants regained the temperature-sensitive character of the nonsuppressed tfc3-G349E allele, indicating that they had lost suppression upon inactivation of the TFC6 copy brought by the suppressor strain. The lethal tfc6-::HIS3 deletion cosegregated with the closely linked trp4 marker present in the suppressor strain.

TFC6-E330K alleviates the DNA binding defect of mutant TFIIIC harboring the temperature-sensitive mutation tfc3-G349E. To examine the effect of the TFC6-E330K suppressor in vitro, TFIIIC was partially purified from wild-type, tfc3-G349E, and suppressor strains and tested under the same conditions in DNA binding and transcription assays (Fig. 4). The DNA binding activity of mutant TFIIIC harboring the tfc3-G349E mutation is very sensitive to mild heat treatments and is inhibited at moderate salt concentrations (36) (Fig. 4). The mutant factor lost most of its DNA binding activity after 10 min of preincubation at 30°C and was totally inactivated at 35°C, in contrast with the wild-type factor preparation, which resisted up to 40°C. Remarkably, the double-mutant form of TFIIIC (tfc3-G349E/TFC6-E330K) had an intermediate behavior and retained a significant level of DNA binding activity at 35°C (Fig. 4A and B). Mutant, wild-type, and suppressor TFIIIC-tDNA complex formation also showed different salt sensitivities at 25°C. With the same amount of protein fraction used in all three cases, the optimal salt concentration for complex formation with the tRNA₃^Glu gene was 135 mM KCl. At 175 mM KCl, complex formation with wild-type, suppressor, and mutant factors dropped to 80, 30, and 18% of their maximal values, respectively. At 205 mM KCl, this residual binding activity was further decreased to 15, 3, and <1%, respectively (results not shown). These observations strongly suggested that the 91 subunit somehow contributed to TFIIIC-DNA binding.

View larger version (40K): [in this window] [in a new window]   FIG. 4.   Temperature sensitivities of mutant, suppressor, and wild-type TFIIIC. Ultrogel-heparin-purified mutant (Mut) (tfc3-G349E) (), suppressor (Sup) (tfc3-G349E/TFC6-E330K) (), and wild-type (WT) () TFIIIC fractions (~0.7 µg in 2 µl) were preincubated in standard binding or transcription buffer at the indicated temperatures for 10 min before their DNA binding or in vitro transcription activity was tested. (A) DNA binding activities of TFIIIC mutants. TFIIIC fractions were incubated with a tRNA3Glu gene probe at 25°C for 15 min, and the complexes were analyzed by gel retardation electrophoresis. (B) Complex formation was quantified in a PhosphorImager and is shown as the percentage of complexes formed after preincubation at 20°C. (C and D) Transcription activities of TFIIIC mutants. The tRNA3Leu gene from plasmid pGE2 was transcribed in vitro at 25°C for 45 min in the presence of TFIIIC, recombinant TFIIIB70 and TBP, B", and Pol III. Transcripts were separated in a polyacrylamide gel (C) and quantified in a PhosphorImager (D). In panel D, data are shown as percentages of tRNA3Leu synthesis after preincubation of TFIIIC at 25°C.

View larger version (87K): [in this window] [in a new window]   FIG. 5.   Nucleic acid binding activity of r91 protein. About 2 ng of highly purified r91 protein was incubated with the different nucleic acid probes in 15-µl mixtures containing 20 mM Tris-HCl (pH 8.0), 120 mM KCl, 20 µg of bovine serum albumin, 10% glycerol, 10 to 20 fmol (10,000 cpm) of 32P-5'-end-labelled nucleic acid probe, and, when indicated, 2.5 mM MgCl2. After 15 min of incubation at 25°C, r91-nucleic acid complexes were separated from free DNA or tRNA by nondenaturing electrophoresis on an 8% polyacrylamide gel. The nucleic acid probes were 20 fmol of native spleen tRNAMet (tRNA) (lanes 1 to 3), 20 fmol of 200-nucleotide-long single-stranded tRNA3Glu gene (ssDNA) (lanes 4 to 6), and 10 fmol of 200-bp double-stranded tRNA3Glu gene (ds DNA) (lanes 7 to 9). The arrowhead indicates the r91-tRNAMet complex, and arrows point to the r91-single-stranded tDNA complexes.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Yeast TFIIIC is a multisubunit transcription factor that displays a remarkable adaptation to multiple DNA sequences and protein targets, leading to the formation of stable preinitiation complexes. Pursuing the analysis of this factor, we report here the isolation and characterization of TFC6, the gene encoding the 91-kDa polypeptide of TFIIIC, and present biochemical and genetic evidence that 91 is an essential subunit of TFIIIC which participates with 138 in TFIIIC-DNA interaction.

91 is an essential subunit of TFIIIC. Highly purified preparations of TFIIIC obtained in different laboratories consistently contained a 91-kDa polypeptide which was initially disregarded as a potential TFIIIC subunit because it was weakly stained by silver and was present in variable ratios with respect to other subunits (3, 17, 42). Nevertheless, it comigrated with TFIIIC components in nondenaturing gel electrophoresis (3, 16, 17, 42), coimmunoprecipitated with 138, 131, and 95 subunits in absence of target DNA (13), and, most remarkably, was specifically located at the 3' end of the 5S RNA genes in TFIIIC-TFIIIA-DNA complexes (9). We isolated the gene encoding 91 by using the amino acid sequence information obtained from the gel-purified polypeptide. Mouse polyclonal antibodies directed to the recombinant protein supershifted TFIIIC-tDNA complexes in gel shift assays, thus confirming the stable association of 91 within the factor-DNA complexes in vitro. To assess the implication of 91 in class III gene activation in vivo, we used a chimeric system in which a B block-deficient SNR6 gene harboring GAL4 binding sequences (UAS_G) is reactivated when the cells express the 138 or 131 subunit of TFIIIC fused to the GAL4 DNA binding domain (39). Similarly, expression of the GAL4(1-147)-91 fusion activated UAS_G-containing SNR6 genes to various extents, depending on the position of the UAS_G sequences. This result indicated that 91 contributed to the formation of the preinitiation complexes in vivo by anchoring TFIIIC on the UAS_G template and confirmed its status as a subunit of TFIIIC. The fact that TFIIIC remained functional (i.e., able to properly assemble TFIIIB) in vivo when anchored on the DNA through either one of four distinct subunits (138, 131, 95, and 91) illustrates the extraordinary flexibility of the TFIIIC-SNR6 interaction.

91 cooperates with 138 in TFIIIC-tDNA complexes. Starting from the tfc3-G349E mutation, which alters 138 and affects TFIIIC-DNA binding, we isolated a suppressor mutation causing an E330K substitution in 91 that restored cell growth at nonpermissive temperatures. This genetic interaction between 138 and 91 suggested that 91 contributes to DNA binding along with 138. Indeed, the double-mutant form of TFIIIC (tfc3-G349E/TFC6-E330K) has significantly improved DNA binding and transcription activities compared to the single-mutant TFIIIC (tfc3-G349E). This observation suggested that 91 stabilized the 138-DNA interaction. Whether 91 participates directly in DNA binding remains an open question. The sequencing of 91 did not shed much light on the possible function of the polypeptide, but the central cluster of 13 Cys and His residues suggests a metal binding site and a possible role in DNA binding. The suppressor mutation itself lies in the Cys-His cluster. It was previously noted that the formation of TFIIIC-tDNA and B-tDNA complexes was inhibited by the zinc chelator 1,10-phenanthroline, while EDTA had no effect (17). Since no obvious zinc binding domain has been detected in the yeast TFIIIC subunits cloned so far (138, 131, and 95, 91 could be the target of the chelator.

Relationship between yeast TFIIIC and human TFIIIC. Four subunits of yeast TFIIIC (138, 131, 95, and 91) have now been cloned. No significant sequence similarity was found between 138 or 91 and other protein sequences in current data banks, including the known subunits of human TFIIIC2, TFIIIC and - (30, 35, 51). The B block binding subunit, TFIIIC, being almost twice as large as 138, may conceivably correspond to a fusion of two or more polypeptides, but this appears to be unlikely as TFIIIC shows no significant similarity to 91, 138, or the two smallest subunits of yeast TFIIIC, 60 and 55 (36). This evolutionary divergence need not mean that the basic mechanisms of Pol III gene activation are different in yeast and human cells. It remains possible that 91 (or even 138) has a human counterpart in TFIIIC2 components yet to be cloned or in the TFIIIC1 fraction, which extends the footprint of TFIIIC2 to downstream sequences over the termination region (57). It is nevertheless remarkable that 131 (the TFIIIB-assembling subunit of TFIIIC) and 95 are, instead, evolutionarily conserved, as shown by the existence of sequence homologs in the C. elegans genome, in data banks of human cDNA (131), and in the S. pombe genome (95). Human homologs of these polypeptides presumably belong to TFIIIC2 (57). There is also a clear sequence similarity between the human TFIIIB90 and yeast TFIIIB70/BRF1 (56). Furthermore, a functional interchangeability of human and yeast TFIIIB components was recently demonstrated in vitro, pointing to the existence of a human homolog of yeast TFIIIB90/B" (54). Finally, the yeast Pol III subunits (C34 and C31) involved in TFIIIB recognition and chain initiation (2, 28, 31, 55, 59) are conserved in human Pol III (58). Thus, the complex protein-protein interactions involved in TFIIIB assembly and Pol III recruitment have clearly been conserved among eucaryotes, while the recruitment of TFIIIC on the B block element may involve fairly divergent polypeptide structures.