This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, T.
Right arrow Articles by Lim, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, T.
Right arrow Articles by Lim, L.

 Previous Article  |  Next Article 

Mol Cell Biol, January 1998, p. 130-140, Vol. 18, No. 1
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Myotonic Dystrophy Kinase-Related Cdc42-Binding Kinase Acts as a Cdc42 Effector in Promoting Cytoskeletal Reorganization

Thomas Leung,1 Xiang-Qun Chen,1 Ivan Tan,1 Edward Manser,1 and Louis Lim1,2,*

Glaxo-IMCB Group, Institute of Molecular & Cell Biology, National University of Singapore, Kent Ridge, Singapore 119260, Singapore,1 and Institute of Neurology, London WC1N 1PJ, United Kingdom2

Received 19 June 1997/Returned for modification 11 August 1997/Accepted 14 October 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The Rho GTPases play distinctive roles in cytoskeletal reorganization associated with growth and differentiation. The Cdc42/Rac-binding p21-activated kinase (PAK) and Rho-binding kinase (ROK) act as morphological effectors for these GTPases. We have isolated two related novel brain kinases whose p21-binding domains resemble that of PAK whereas the kinase domains resemble that of myotonic dystrophy kinase-related ROK. These ~190-kDa myotonic dystrophy kinase-related Cdc42-binding kinases (MRCKs) preferentially phosphorylate nonmuscle myosin light chain at serine 19, which is known to be crucial for activating actin-myosin contractility. The p21-binding domain binds GTP-Cdc42 but not GDP-Cdc42. The multidomain structure includes a cysteine-rich motif resembling those of protein kinase C and n-chimaerin and a putative pleckstrin homology domain. MRCKalpha and Cdc42V12 colocalize, particularly at the cell periphery in transfected HeLa cells. Microinjection of plasmid encoding MRCKalpha resulted in actin and myosin reorganization. Expression of kinase-dead MRCKalpha blocked Cdc42V12-dependent formation of focal complexes and peripheral microspikes. This was not due to possible sequestration of the p21, as a kinase-dead MRCKalpha mutant defective in Cdc42 binding was an equally effective blocker. Coinjection of MRCKalpha plasmid with Cdc42 plasmid, at concentrations where Cdc42 plasmid by itself elicited no effect, led to the formation of the peripheral structures associated with a Cdc42-induced morphological phenotype. These Cdc42-type effects were not promoted upon coinjection with plasmids of kinase-dead or Cdc42-binding-deficient MRCKalpha mutants. These results suggest that MRCKalpha may act as a downstream effector of Cdc42 in cytoskeletal reorganization.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The Ras-related p21 Rho subfamily GTPases are implicated in actin reorganization, although the exact mechanisms involved remain largely obscure (48). In Swiss 3T3 fibroblasts, introduction of Cdc42 into cells resulted in filopodial formation (24, 41), while Rac1 and RhoA give rise to lamellipodia and stress fibers, respectively (43, 44). Apart from cell morphology, the Rho p21s are also involved in processes such as cell growth, cytokinesis, activation of transcription factors, and cell cycle progression (13, 14, 39, 40, 42). An important step toward understanding the biochemical mechanisms by which these p21s exert their diverse cellular effects is to identify and characterize interacting proteins which mediate the actions of a particular p21. To date, a large number of proteins which interact with Rho p21s have been reported. These include regulatory proteins such as GTPase-activating proteins, guanine nucleotide exchange factors, guanine nucleotide dissociation inhibitors and an increasing number of kinases and nonkinases (32, 48). Most of these molecules have multidomain structures (10, 26, 32), suggesting the existence of a wide range of multimolecular complexes in regulating signalling pathways underlying cell morphology and other related cellular activities. Such complexity has been shown in lower organisms such as Saccharomyces cerevisiae in which normal polarized cell growth and cell shape changes are accomplished by the interaction of Cdc42p with several proteins, including Cdc24 (a guanine nucleotide exchange factor), Ste20p kinase, and actin-binding protein (28, 52). In mammalian cells, input from other signalling pathways can also be implicated in the p21 functions; e.g., phosphatidylinositol 3-kinase can mediate signalling from Ras to Rac1 (45).

In searching for potential targets of the p21 Rho family, we and others have identified p21-activated kinases (PAKs) which specifically interact with GTP-Cdc42/Rac1 (36) and the RhoA-binding kinases (ROKs) (19, 30, 31, 38). Interaction of PAK with p21 in vitro results in kinase activation (36, 37). This novel activation process has led us and others to postulate that the yeast homolog of mammalian PAK, Ste20p, may act downstream of Cdc42p in the heterotrimeric G-protein-coupled yeast pheromone Kss1/Fus3 mitogen-activated protein kinase pathway (47, 54). Similarly, mammalian Cdc42 and Rac1 have also been found to have nuclear signalling roles through the JNK/SAPK mitogen-activated protein kinase pathway (13, 39). Several reports have also implicated PAKs in these events (5, 8, 53), suggesting a parallel conservation of components in these signalling events among eukaryotes. In mammalian cells, expression of various constitutively active forms of alpha PAK results in disassembly of focal complexes and stress fiber dissolution, suggesting that these kinases also have morphological roles (34). ROKs also have effects on morphology, with their overexpression enhancing the formation of stress fibers and focal adhesion complexes (1, 20, 30). This effect of ROKs may be mediated by their inhibition of myosin phosphatase through specific phosphorylation of its myosin-binding subunit, which increases the phosphorylation state of myosin light chain (23). Alternatively, ROKs may also activate myosin through direct phosphorylation of myosin light chain (2). These results suggest that a diverse network of p21 targets, in particular kinases, is involved in both nuclear and cytoskeletal control (32). The use of mutants of Rac1 and Cdc42Hs has also revealed different pathways utilizing distinctive effectors for morphological as well as transcriptional activation (21, 27, 51).

Apart from PAKs, the p21 binding assay has revealed the presence of multiple proteins of 180 to 200 kDa in a variety of rat tissues which bind Cdc42Hs/Rac1 (36). We have purified several ~180-kDa Cdc42/Rac1-binding proteins from rat brain and liver which turned out to be identical to IQGAP isoforms isolated by others (18, 25). We now report the isolation and characterization of MRCKs, a novel family of ~190-kDa serine/threonine kinases highly related to the myotonic dystrophy kinase (7, 15) and ROKs (19, 30, 31, 38), which interact strongly with the GTP-bound form of Cdc42. These kinases also contain a cysteine-rich domain capable of binding to phorbol ester and a putative pleckstrin homology (PH) domain. The possible involvement of these kinases as Cdc42 effectors in cytoskeletal reorganization is also presented.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Screening and expression of MRCKalpha and -beta . A lambda gt11 human brain cDNA library (Clontech) was used for expression screening with [gamma -32P]GTP-glutathione S-transferase (GST)-Cdc42Hs as previously described (35). The 373-bp positive cDNA clone encoding the 124-amino-acid residues and its deleted and mutated derivatives were subcloned into pGEX vectors for expression and p21 binding analysis. For isolating the full-length clones, a rat brain lambda ZAP cDNA library (Stratagene) was used. The full-length MRCKalpha was derived from an 8-kb cDNA clone containing the entire coding sequence. The MRCKbeta sequence was derived from three overlapping clones. Full-length MRCKalpha (see below) was subcloned into pBAK-GST vector for expression in the baculovirus system (Clontech). The GST fusion protein was purified through a glutathione-Sepharose column and used for kinase assays with various substrates. For expression in mammalian cells, MRCKalpha was subcloned from pBluescript SK vector into either plasmid pXJ40-HA or plasmid pXJ40-FLAG (34). A BamHI/PstI-digested PCR product of the 5' end corresponding to the N-terminal kinase domain was obtained by using a 5' primer (5'CGGGATCCAACATGTCTGGAGAAGTGCG3') and a 3' primer (5'-CTCTGCGAAGCTCCTG-3') and ligated to the BamHI/PstI-cut pXJ40 vector to generate the kinase domain construct MRCKalpha 1-473. Full-length MRCKalpha 1-1732 was obtained by replacing a BstXI/KpnI fragment of this subclone by a longer 6-kb BstXI/KpnI fragment from the full-length SK vector. For MRCKDelta PH, an in-frame deletion of an EcoRV/NheI (blunted) fragment (residues 1117 to 1181) was made. For mutagenesis, a two-step PCR protocol (34) with VENT polymerase (New England Biolabs) was used. The p21-binding-defective mutant (MRCKalpha H1579A,H1582A) was obtained with primers GTTAAAATTAGTTGGG-3'/T3 and 5'-GCCATAGCAGCATGGGTCCTGGACCTG-3'/T7, and the kinase-dead mutant (MRCKalpha K106A) was obtained with primers 5'GCCATGGCAAATACTTTATC3'/T7 and 5'GCCATGGCAATTCTGAACAAGTGG3'/T3, by using suitable MRCKalpha subclones in pBluescript SK vector, and the final constructs were fully sequenced. Expression of the correct-size proteins was confirmed with a TNT in vitro translation kit (Promega) (data not shown) and expression in COS-7 cells (Fig. 3D). All other constructs used have been previously described (30, 34).

RNA and protein analysis. Total RNA (20 µg) from rat tissues and cells obtained by a guanidinium thiocyanate method was used to hybridize to either a 2.4-kb EcoRI fragment of MRCKalpha (nucleotides 3088 to 5474) or a 3-kb StuI fragment of MRCKbeta (nucleotides 1966 to 4932). For Western blot analysis and p21 binding, 150 µg of protein from each tissue was used to probe either with the affinity-purified mouse polyclonal antibodies against human MRCKalpha or with [gamma -32P]GTP-Cdc42. Nucleotide-dependent binding was carried out exactly as specified in reference 31, with GST-Cdc42 from a GST-2TK vector. For the kinase assay, myelin basic protein, histone H1, and GST-myosin light chain 2 (MLC-2) were used as substrates. The latter was obtained by PCR of a human brain cDNA preparation by using primers 5'-CAGGATCCATGTCGAGCAAAAGAAC-3' and 5'-CTGAATTCAGTCATCTTTGTCTTTGG-3' (16). The PCR product was digested with BamHI-EcoRI and subcloned into pGEX4T3. Phosphorylated protein bands after transfer onto polyvinylidene difluoride filters were subjected to phosphoamino acid analysis (36) or complete Lys-C digestion. A single phosphorylation peak obtained from high-pressure liquid chromatography was analyzed by peptide sequencing with simultaneously radioactive detection of each residue. For detecting kinase activity of MRCKalpha in overexpressed COS-7 cells, transfected cells were extracted with lysis buffer containing 25 mM HEPES (pH 7.3), 0.3 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 20 mM sodium beta -glycerophosphate, 1 mM sodium vanadate, 0.5% Triton X-100, 5% glycerol, and freshly added 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 5 µg each of aprotinin and pepstatin per ml. Clarified extracts (0.5 mg) were passed through 40-µl columns of beads preloaded with anti-hemagglutinin (HA) monoclonal antibody (MAb) 12CA5. After washing with lysis buffer and kinase buffer containing 50 mM HEPES (pH 7.3), 50 mM KCl, 10 mM beta -glycerophosphate, 10 mM MgCl2, 2 mM MnCl2, and 0.05% Triton X-100, kinase reactions were carried out for 20 min at 30°C with 0.1 mg of GST-MLC-2 per ml and 10 µM [gamma -32P]ATP. The reaction was stopped by adding 50 µl of 2× sodium dodecyl sulfate sample buffer. After a brief spin in an Eppendorf tube, the reaction mixture was run on a 10% polyacrylamide gel and transferred onto a nitrocellulose filter for radioactive imaging and subsequent detection of expressed proteins by a rabbit anti-HA antibody (BabCo). 32P phosphorylation of MLC-2 was quantified with a Molecular Dynamics PhosphorImager.

Transfection and microinjection. COS-7 cells and HeLa cells maintained in 10% fetal bovine serum were transfected essentially as described previously (30) except that DOSPR (5 µl/ml; Boehringer Mannheim) was used. For immunoprecipitation experiments, cells grown in a 100-mm-diameter dish were transfected and incubated for 16 h before harvest. For immunofluorescence studies, HeLa cells were plated onto glass chamber slides (Nunc), transfected in the presence of 5% serum, and fixed after 16 h of incubation. For microinjection, HeLa cells maintained in minimal essential medium in the presence or absence of 10% fetal bovine serum were used. Subconfluent cells plated on coverslips for 48 h were microinjected with different constructs (50 ng/µl except where indicated otherwise), by using an Eppendorf micromanipulator system. Two to four hours after injection, cells were fixed with 4% paraformaldehyde and incubated in phosphate-buffered saline-0.5% Triton X-100 for 2 h at 25°C with the combination of various primary antibodies at the following dilutions: anti-HA (12CA5) or anti-FLAG (IBI) MAb, 5 µg/ml; antivinculin MAb (hVIN-1; Sigma), 1:300; antipaxillin MAb (Transduction Laboratories), 2 µg/ml; anti-myosin light chain MAb (Sigma), 1:100. Fluorescein isothiocyanate-conjugated second antibodies (1:100; Sigma) and rhodamine-conjugated second antibodies (1:50; Boehringer Mannheim) were incubated for 1 h at 25°C. To visualize polymerized actin, cells were stained with rhodamine-conjugated phalloidin (1 µg/ml; Sigma) for 1 h at room temperature. Stained cells were analyzed with an MRC600 confocal imager adapted to a Zeiss Axioplan microscope. For phase-contrast microscopy, cells after injection were viewed under a Zeiss Axiovert microscope with a temperature-controlled stage, and phase-contrast views were taken at various time intervals.

Nucleotide sequence accession numbers. The GenBank accession numbers are AF021935 (MRCKalpha ) and AF021936 (MRCKbeta ).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Identification of a novel Cdc42Hs-binding domain by expression screening. Using expression screening with [gamma -32P]GTP-Cdc42, we obtained a partial cDNA from a human brain cDNA library. This cDNA fragment, a shorter AseI/EcoRI-deleted fragment, and a PCR fragment flanking the putative p21-binding site when expressed as GST fusion proteins all bound GTPgamma S-Cdc42 but not GDP-Cdc42 (Fig. 1A and B). Double mutation of the conserved histidines led to abolition of binding. Weak binding was also observed to GTP-Rac1 but not to GTP-RhoA (data not shown). The binding domain is conserved in the two rat isoforms isolated from further screening and resembles other p21-binding motifs of this class (9, 36) (Fig. 1C) but not the RhoA-binding sequence of ROK or protein kinase N (PKN) (3, 30, 50).


View larger version (43K):
[in this window]
[in a new window]
  		FIG. 1.   Identification of a family of Cdc42Hs-binding proteins. (A) Deduced amino acid sequence of a human brain partial cDNA clone isolated by expression screening with [gamma -32P]GTP-Cdc42. GST fusion proteins were made with wild-type (construct 1), deleted (constructs 2 and 3), or mutated (construct 4) variants. In construct 4, two histidines (underlined) were mutated to alanine. Binding of [gamma -32P]GTP-Cdc42 was performed as described previously (35). (B) Nucleotide-dependent binding by two related rat Cdc42-binding proteins. Nitrocellulose filters with 50 ng of GST fusion protein containing the binding domain of human MRCKalpha (residues 1 to 124; lane 1), rat MRCKbeta (residues 1569 to 1690; lane 2), and alpha PAK (residues 67 to 150; lane 3) were assayed for binding with a 32P-phosphorylated Cdc42Hs (from pGEX-2TK) exchanged with either GTPgamma S or GDP (31). (C) Consensus sequence of Cdc42-binding motifs of different proteins (9).

Identification of MRCKs. Two related full-length cDNAs were isolated upon subsequent screening of a rat brain cDNA library. The N termini of the predicted proteins (Fig. 2A) begin with a kinase domain (Fig. 2B) exhibiting 68% identity to the human myotonic dystrophy kinase. These kinases were designated MRCKalpha and -beta . The kinase domains were followed by an extended alpha -helix, with coiled-coil features (residues 450 to 950 in MRCKalpha ) and a highly conserved region (residues 810 to 860 in MRCKalpha ) which has some homology to nonmuscle myosin heavy chain and rat nestin (29). Both isoforms of ~190 kDa contain the p21-binding motif near the C-terminus, with the domain organization of these kinases being quite different from that of ROKalpha (Fig. 2A). A cysteine-rich domain (Fig. 2D) and a pleckstrin-like domain (Fig. 2C) occur between the kinase domain and the p21-binding motif.


View larger version (0K):
[in this window]
[in a new window]
 

View larger version (71K):
[in this window]
[in a new window]
  		FIG. 2.   Sequence of a family of Ser/Thr kinases containing a Cdc42-binding domain and other functional domains. (A) Deduced amino acid sequences of rat MRCKalpha and MRCKbeta . Regions in boldface represent, in order, kinase, cysteine-rich (CR), PH, and p21 GTPase-binding (GBD) domains. In MRCKalpha , the region underlined is identical, apart from an initial Lright-arrowV, to the human sequence shown in Fig. 1A. Domain organization of MRCKs, myotonic dystrophy kinase (DMK), and ROKalpha , along with percent identities of related domains, is also shown. (B) Kinase domains of MRCKalpha , MRCKbeta , myotonic dystrophy kinase (DMK), and ROKalpha . (C) PH domains in MRCKalpha , MRCKbeta , ROKalpha , and pleckstrin N terminus (Pleck N). Amino acids identical to the most commonly occurring consensus sequence in PH domains (in boldface and uppercase) are marked with asterisks. (D) Cysteine-rich domains of MRCKs, PKCalpha , and n-chimaerin (n-CHIM). Conserved residues (17) are indicated by asterisks.

Biochemical characterization of MRCKs. The expression of these p190 kinases was examined in protein extracts by Cdc42-GTP binding and Western blot analysis using polyclonal antibodies against the p21-binding domain of human MRCKalpha . As reported previously, major Cdc42 binding occurs in regions from around 180 to 200 and 62 to 68 kDa; the latter corresponds to PAK isoforms (36). The larger Cdc42-binding proteins probably include MRCKalpha and -beta . Western analysis revealed 180- to 200-kDa proteins, present at higher levels in the brain and kidney (Fig. 3A). High levels of immunoreactivity were detected in lung, in the pellet fraction (data not shown). The Cdc42-binding pattern did not correlate well with p180-200 immunoreactivity in different tissues, possibly because of the presence of other MRCK isoforms or Cdc42-binding proteins such as IQGAPs, which have similar molecular sizes (18, 25). On Northern blot analysis, the 10-kb MRCKalpha mRNA was highly enriched in the brain and lung and present in lower levels in other tissues (Fig. 3B). MRCKbeta mRNA was expressed in all tissues examined and at highest levels in lung and kidney. Both mRNAs were also expressed in epithelial HeLa cells (data not shown).


View larger version (45K):
[in this window]
[in a new window]
  		FIG. 3.   Expression and biochemical characterization of MRCKs. (A) Expression of MRCK in tissues and cultured cells. (a) Soluble protein extracts from various rat tissues and cells were separated by polyacrylamide gel electrophoresis and transferred to nitrocellulose filters for Western analysis using antibodies against the Cdc42-binding domain of human MRCKalpha (C-terminal 124 residues). (b) A similar blot showing Cdc42 binding. The arrowhead indicates the positions of the immunoreactive and Cdc42-binding regions. (B) Northern (mRNA) blot from rat tissues (Clontech) hybridized to the 32P-labeled MRCKalpha and MRCKbeta cDNA probes. (C) Kinase activity toward different substrates. GST-MLC-2, GST-MRCKalpha p21-binding domain hBF-1 (residues 1 to 124; Fig. 1), histone H1, and myelin basic protein (MBP) were used as substrates in a kinase assay with purified MRCKalpha expressed in baculovirus as a GST fusion protein. The 33P-labeled bands corresponding to the Coomassie blue-stained substrate proteins are marked with asterisks, and the autophosphorylated GST-MRCKalpha band is indicated by an arrowhead. The sequence at the bottom shows the Lys-C peptide with the serine 19 (asterisk) phosphorylation site in MLC-2. (D) Kinase activities in transfected cells. COS-7 cells were transfected with vector pXJ40HA or with a vector containing MRCKalpha alone, MRCKalpha in combination with Cdc42V12, or kinase-inactive MRCKalpha K106A. Tagged proteins were immunoprecipitated (IP) with anti-HA antibody, and kinase activity (lower panel) was assayed with [gamma -33P]ATP as described elsewhere (36).

MRCKalpha when expressed as a GST fusion protein was found to phosphorylate serine/threonine residues of several substrates, including myelin basic protein, histone H1, and its own binding domain (hBF-1) in vitro, but was especially active toward nonmuscle myosin regulatory light chain (MLC-2), the latter being phosphorylated at serine 19 (Fig. 3C). Immunoprecipitated HA-MRCKalpha did not exhibit elevated activity when cotransfected with Cdc42V12 (Fig. 3D). Similar results were obtained with the recombinant full-length GST-MRCKalpha (data not shown), indicating that interaction with Cdc42 was not essential for kinase activation. The mutant MRCKalpha K106A, with a substitution of the critical lysine in the kinase domain, exhibited no detectable kinase activity.

The cysteine-rich domain in both isoforms resembles those of PKC and chimaerins and was capable of binding to [3H]phorbol myristic acetate in a lipid-dependent manner (data not shown).

Cellular localization of MRCKalpha and the effect of Cdc42V12. In transfected HeLa cells, expressed FLAG-MRCKalpha showed a dispersed punctate cytoplasmic distribution and a more intense staining along the cell periphery, especially at the leading edge and cell-cell junction. Cotransfection with Cdc42V12 led to a typical Cdc42-type morphology, and MRCKalpha was found to colocalize with Cdc42V12, particularly at the cell-cell junction and periphery, which contained numerous protrusions (Fig. 4, left panels). As PH domains can interact with lipids and the cytoskeleton, we also studied the effects of MRCKDelta PH, a construct with the PH domain deleted. Cells transfected with MRCKalpha Delta PH plasmid showed a more even cytoplasmic distribution of the kinase. When cotransfected with Cdc42V12, both MRCKalpha Delta PH and p21 remained largely dispersed within the cytoplasm, and the typical Cdc42-type morphology was not produced (Fig. 4, right panels). These results suggest that the PH domain is important for the correct localization of MRCKalpha and that MRCKalpha may be associated with producing a Cdc42 phenotype since the MRCKalpha Delta PH mutant blocked production of this phenotype (possibly acting as a dominant-negative mutant).


View larger version (82K):
[in this window]
[in a new window]
  		FIG. 4.   Cellular localization of MRCKalpha and the effects of Cdc42V12. HeLa cells grown in minimal essential medium with 10% fetal bovine serum were transfected with pXJ40-FLAG plasmids encoding either MRCKalpha alone or MRCKalpha Delta PH (the latter with the PH domain deleted). Cells were fixed with 4% paraformaldehyde and stained with anti-FLAG antibody after 16 h. For cotransfection experiments, plasmid encoding FLAG-tagged MRCKalpha or MRCKalpha Delta PH was cotransfected with plasmid encoding HA-tagged Cdc42V12. Cells were fixed and doubly stained with antibodies against FLAG for MRCKalpha and HA for Cdc42V12.

Microinjection of MRCKalpha affects cellular structures. To investigate whether MRCKalpha had a direct effect on morphology, we microinjected HeLa cells with plasmids encoding MRCKalpha and various derivatives. Expression of wild-type MRCKalpha enhanced the formation of stress fibers, some of which exhibited a crisscross pattern (Fig. 5a and b). The kinase domain alone (which is constitutively active) elicited gross changes in actin- and myosin-containing structures involving marked actin condensation (Fig. 5e and f). Some increase in focal complexes were seen (Fig. 5g), but microtubules were unaffected (Fig. 5h). The action of MRCKalpha in promoting formation of stress fibers was reminiscent of the action of the related ROKalpha . However, MRCKalpha notably differed from ROKalpha in that its kinase-dead mutant (MRCKalpha K106A) did not promote dissolution of existing stress fibers (Fig. 5c and d). The MRCKalpha promotion of stress fibers was also not affected by the dominant-negative ROKalpha K112A (not shown, being very similar to Fig. 5a and b), indicating that MRCKalpha did not act via ROKalpha . These results show that although overexpressed MRCKalpha can mimic some effects of ROK through the presence of a kinase domain which is highly homologous among a family of diverse proteins, MRCKalpha appears to have a role different from that of the Rho-binding ROK.


View larger version (101K):
[in this window]
[in a new window]
  		FIG. 5.   MRCKalpha affects the organization of cellular structures. HeLa cells grown on coverslips were microinjected with a plasmid encoding HA-tagged wild-type MRCKalpha (a and b), kinase-dead MRCKalpha K106A (c and d), or kinase domain alone (e to h). Two hours after incubation, cells were fixed and stained with anti-HA antibody (a and c) or doubly stained with phalloidin (b, d, and e) or antibodies against myosin light chain (f), vinculin (g), or tubulin (h). Arrows indicate the injected cells located by HA staining (not shown in panels e to h). Bar = 10 µm.

MRCKalpha modulates Cdc42-dependent morphology. We then examined whether MRCKalpha could have a role in the morphological effects promoted by Cdc42. In HeLa cells, these morphological effects include microspike formation and production of stellate peripheral focal complexes readily observed 2 h after injection of Cdc42V12 plasmid (50 ng/µl) (Fig. 6A, panels c and d). When these cells were first injected with plasmid encoding kinase-dead MRCKalpha K106A (using this as a putative dominant-negative mutant) 3 h before the injection of Cdc42V12, these morphological effects were not seen. This blocking effect of the kinase-dead MRCKalpha K106A mutant was not due to its possible sequestration of Cdc42V12, since prior expression of the kinase-dead and Cdc42-binding-deficient MRCKalpha K106A,H1579,H1582A mutant was as effective in inhibiting the morphological action of Cdc42V12 (Fig. 6A, panels a and b). This MRCKalpha mutant had no effect on RacV12-induced focal complexes or cell spreading (Fig. 6A, panels e to h), showing that it specifically affected Cdc42 actions.


View larger version (62K):
[in this window]
[in a new window]
 

View larger version (82K):
[in this window]
[in a new window]
  		FIG. 6.   MRCKalpha potentiates the effects of Cdc42 on microspike formation. (A) Kinase-dead MRCKalpha blocks Cdc42-mediated effects on focal complexes and morphology. Serum-starved HeLa cells were injected with plasmid encoding FLAG-tagged kinase-dead/p21-binding-deficient mutant MRCKalpha K106A,H1579A,H1581A (50 ng/µl); 3 h later, these preinjected cells (a, b, e, and f) and uninjected control cells (c, d, g, and h) were injected with plasmid pXJ40-HA (50 ng/µl) encoding Cdc42V12 (a to d) or Rac1V12 (e to h). Cells were fixed and stained with antibodies against FLAG (a and e), HA (c and g), or paxillin (b, d, f, and h) after incubating for 2 h. Essentially similar results were obtained with kinase-dead MRCKalpha K106A. (B) Morphological effect of expression of MRCKalpha and limiting amounts of Cdc42. HeLa cells grown in serum-containing medium were injected with plasmids encoding FLAG-tagged Cdc42 (5 ng/µl) together with plasmid encoding either HA-tagged wild-type MRCKalpha (a), MRCKalpha K106A (b), p21-binding-defective MRCKalpha H1579A,H1582A (c), or ROKalpha (d) at 50 ng/µl. Cells incubated for 2 h were fixed and stained with anti-HA antibody. Bar = 10 µm. (C) Time-lapse phase-contrast microscopy of HeLa cells coinjected with plasmids encoding MRCKalpha and Cdc42 as in panel B. Morphological changes in a typical coinjected cell are shown up to 4 h after the coinjection. Cells 4 h after injection with plasmids encoding MRCKalpha (50 ng/µl) alone, Cdc42 (5 ng/µl) alone, or Cdc42V12 (50 ng/µl) are included for comparison.

We next investigated the functional relationship of MRCKalpha to its p21 partner Cdc42, adopting an approach similar to one recently used to study the effects of POR1, a Rac1-binding protein, on cytoskeletal reorganization (49). We first established that injection of low concentrations (5 ng/µl) of wild-type Cdc42 plasmid was phenotypically ineffective in inducing morphological changes in HeLa cells and subsequently coinjected MRCKalpha and Cdc42 plasmids. This led to an enhanced formation of cellular extensions and microspikes with a marked redistribution of MRCKalpha to cortical regions, especially at the tip of the former structures (Fig. 6B, panel a). Coinjection of Cdc42 plasmid with plasmids encoding kinase-dead MRCKalpha K106A, Cdc42-binding-deficient MRCKalpha H1579A/H1582A, and ROKalpha (Fig. 6B, panels b to d) led to no such enhanced formation of peripheral structures. These results indicate that both kinase and Cdc42-binding domains of MRCKalpha are required for its effects on Cdc42 functions.

Injected cells were then subjected to time-lapse analysis. When injected with a low concentration (5 ng/µl) of Cdc42 plasmid, cells showed very little change even after 4 h. Higher concentrations (50 ng/µl) of activated Cdc42V12 plasmid led to the appearance of short microspikes (Fig. 6C, bottom row). When MRCKalpha plasmid was coinjected with low concentrations of Cdc42 plasmid (by itself ineffective), cellular protrusions including microspikes appeared within 90 min after the coinjection, with the peripheral regions undergoing continual retraction and extension over several hours (Fig. 6C, top row). These dynamic and protracted changes resulted in cells displaying extended cytoplasmic tracts 4 h after injection (Fig. 6C, left lower panel). The morphology contrasts sharply with that of control cells injected with plasmids encoding either MRCKalpha or Cdc42 on their own examined at this time interval.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We and others have recently reported the isolation of Rho-binding serine/threonine kinases (ROKs) which act downstream of Rho (1, 2, 19, 20, 23, 30, 31). The isolation of another family of ROK-related kinases with Cdc42 and weak Rac1 binding (MRCKs) strengthens the notion that functionally related members of these kinases are adapted to different switches for diverse biological activities. These multidomain kinases show some similarity in domain organization, with coiled-coil alpha -helix, cysteine-rich, and PH domains, although the exact arrangements differ. They also share substrates. Like ROKalpha , MRCKalpha readily phosphorylates MLC-2 predominantly at serine 19. Phosphorylation of this residue has been reported to be essential for the activation of myosin in vitro (6, 22) and its subsequent effect on the actin-myosin contractile apparatus which has been suggested to underlie the formation of stress fibers and focal adhesion complexes (12). With MRCKalpha , the exact relationship of its kinase activity to its morphological action remains to be established. It is plausible that phosphorylation of myosin(s) is a common feature of these different kinases and that the site of action will determine the appropriate morphological activity, with selectivity being imparted by specific p21-binding domains.

MRCKalpha has a characteristic cellular localization which is different from that of ROKalpha . In general, ROKalpha is distributed evenly in the cytoplasm and concentrated in the cell periphery only upon translocation by transfected RhoA (31). MRCKalpha is stained in punctate structures in the cytoplasm, with more intense staining at the periphery of transfected cells, particularly at the leading edge and cell-cell junction. This localization may in part be due to nonkinase regulatory domains such as the PH domain, since its deletion resulted in a more even cellular distribution. The PH domain of the Ras exchange factor Sos had been shown to play a role in targeting the protein to the cell periphery and leading edge of motile cells, in response to serum stimulation (11). Similarly, the N-terminal PH domain of pleckstrin is required for its membrane localization and induction of membrane projections which is regulated by its phosphorylation (33). Although the families of ROKs and MRCKs contain PH domains, these are not identical, and it would be interesting to determine whether and how the different PH domains influence membrane localization.

Not unexpectedly given the similarity in the kinase domain, overexpression of ROKs and MRCKs can result in overlapping morphological activities under certain experimental conditions. Introduction of plasmids for either ROKalpha or MRCKalpha led to enhanced formation of stress fibers and focal complexes, which require their kinase activity (Fig. 5 and references 1, 20, and 30). However, while the kinase-dead (dominant-negative) ROKalpha mutant effected dissolution of stress fibers and focal adhesion complexes, in keeping with ROK's role downstream of Rho, kinase-dead MRCKalpha did not affect these Rho-dependent structures. This finding strongly indicates that the functional role of MRCKs is different from that of ROKs. Several lines of evidence from the work presented here suggest that MRCKalpha is associated with Cdc42 functions. First, Cdc42 colocalizes with MRCKalpha on cotransfection. Second, introduction of the kinase-dead MRCKalpha blocks the morphological effects of Cdc42V12. Third, coexpression of MRCKalpha with limiting concentrations of wild-type Cdc42 (which elicits no effect on its own) promoted the formation of dynamic peripheral structures including microspikes and filopodia. The formation of these structures require Cdc42 mediation (24, 41).

The relationship of MRCK to the other Cdc42-binding kinase PAK clearly warrants further investigation. alpha PAK disassembles stress fibers and focal adhesion complexes in HeLa cells when activated (34). It has been suggested that this disassembly may facilitate (or be necessary for) the formation of the Cdc42-dependent peripheral structures perhaps because of shared components or cytomechanical needs, reflecting opposing roles of ROK and PAK (32). In cells injected with activated PAK, dissolution of the Rho-mediated structures is followed eventually by massive cell contraction, with long retraction fibers being visible 90 to 120 min after injection (34). In the present study, coexpression of limiting concentrations of Cdc42 with MRCKalpha led to pronounced microspike activity and restructuring of peripheral portions of the cell, involving continual retraction and protrusion over an extended time (4 h). Rather than the final overall cell contraction observed with PAK, this restructuring resulted in marked expansion of some parts of the cytoplasm. This finding suggests that MRCK and PAK activities may need to be coordinated in normal cells displaying Cdc42-mediated effects. (It is possible that the Cdc42-binding nonkinases such as the Wiskott-Aldrich syndrome protein [4, 46] are also involved.) MRCK, unlike PAK (34), does not appear to be involved in Rac-induced activities (Fig. 6) which can occur subsequent to Cdc42 activation (24, 41). Certainly, the occurrence of different kinase domains with related p21-binding domains within MRCK and PAK, and conversely of similar kinase domains with different p21-binding domains within MRCK and ROK, may well serve to allow the Rho family effectors to engage in cross talk essential for integration of the wide repertoire of cellular activities mediated by these p21s.

    ACKNOWLEDGMENTS

We thank Teo Hsiang Ling for expert technical assistance, Robin Philps for phosphopeptide microsequencing, and Francis Leong for photographic reproduction.

This work was supported by the Glaxo Singapore Research Fund.

    FOOTNOTES

* Corresponding author. Mailing address: Glaxo-IMCB Group, Institute of Molecular & Cell Biology, National University of Singapore, Kent Ridge, Singapore 119260. Phone: (65) 874-6167. Fax: (65) 774-0742. E-mail: L.Lim{at}ion.ucl.ac.uk.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Amano, M., K. Chihara, K. Kimura, Y. Fukata, N. Nakamura, N. Matsuura, and K. Kaibuchi. 1997. Formation of actin stress fibers and focal adhesions enhanced by Rho-kinase. Science 275:1308-1311[Abstract/Free Full Text].
2. Amano, M., M. Ito, K. Kimura, Y. Fukata, K. Chihara, T. Nakano, Y. Matsuura, and K. Kaibuchi. 1996. Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase). J. Biol. Chem. 271:20246-20249[Abstract/Free Full Text].
3. Amano, M., H. Mukai, Y. Ono, K. Chihara, T. Matsui, Y. Hamajima, K. Okawa, A. Iwamatsu, and K. Kaibuchi. 1996. Identification of a putative target for Rho as the serine-threonine kinase protein kinase N. Science 271:648-650[Abstract].
4. Aspenstrom, P., U. Lindberg, and A. Hall. 1995. Two GTPases, Cdc42 and Rac, bind directly to a protein implicated in the immunodeficiency disorder Wiskott-Aldrich syndrome. Curr. Biol. 6:70-75.
5. Bragodia, S., B. Derijard, R. J. Davis, and R. A. Cerione. 1995. Cdc42 and PAK-mediated signalling leads to JNK and p38 mitogen-activated protein kinase activation. J. Biol. Chem. 270:27995-27998[Abstract/Free Full Text].
6. Bresnick, A. R., V. L. Wolff-Long, O. Baumann, and T. D. Pollard. 1995. Phosphorylation on threonine-18 of the regulatory light chain dissociates the ATPase and motor properties of smooth muscle myosin II. Biochemistry 34:12576-12583[Medline].
7. Brook, J. D., M. E. McCurrach, H. G. Harley, A. J. Buckler, D. Church, H. Aburatani, K. Hunter, V. P. Stanton, J.-P. Thirion, T. Hudson, R. Sohn, B. Zemelman, R. G. Snell, S. A. Rundle, S. Crow, J. Davies, P. Shelbourne, J. Buxton, C. Jones, V. Juvonen, K. Johnson, P. S. Harper, D. J. Shaw, and D. E. Housman. 1992. Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 68:799-808[Medline].
8. Brown, J. L., L. Stowers, M. Baer, J. A. Trejo, S. Coughlin, and J. Chant. 1996. Human Ste20 homologue hPAK1 links GTPases to the JNK MAP kinase pathway. Curr. Biol. 6:598-605[Medline].
9. Burbelo, P. D., D. Drechsel, and A. Hall. 1995. A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rac GTPases. J. Biol. Chem. 270:29071-29074[Abstract/Free Full Text].
10. Cerione, R. A., and Y. Zheng. 1996. The Dbl family of oncogenes. Curr. Opin. Cell Biol. 8:216-222[Medline].
11. Chen, R. H., S. Corbalan-Garcia, and D. Bar-Sagi. 1997. The role of the PH domain in the signal-dependent membrane targeting of Sos. EMBO J. 16:1351-1359[Medline].
12. Chrzanowska-Wodnicka, M., and K. Burridge. 1996. Rho-stimulated contractility drives the formation of stress fibers and focal adhesions. J. Cell Biol. 133:1403-1415[Abstract/Free Full Text].
13. Coso, O. A., M. Chiariello, J.-C. Yu, H. Teramoto, P. Crespo, N. Xu, T. Miki, and J. S. Gutkind. 1995. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signalling pathway. Cell 81:1137-1146[Medline].
14. Drechsel, D. N., A. A. Hyman, A. Hall, and M. Glotzer. 1997. A requirement for Rho and Cdc42 during cytokinesis in Xenopus embryos. Curr. Biol. 7:12-23[Medline].
15. Fu, Y.-H., A. Pizzuti, R. G. Fenwick, Jr., J. King, S. Rajnarayan, P. W. Dunne, J. Dubel, G. A. Nasser, T. Ashizawa, P. de Jong, B. Wieringa, R. Korneluk, M. B. Perryman, H. F. Epstein, and C. T. Caskey. 1992. An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science 255:1256-1258[Abstract/Free Full Text].
16. Grant, J. W., R. Q. Zhong, O. M. McEwen, and S. L. Church. 1990. Human nonsarcomeric 20,000 Da myosin regulatory light chain cDNA. Nucleic Acids Res. 18:5892[Free Full Text].
17. Hall, C., C. Monfries, P. Smith, H. H. Lim, R. Kozma, S. Ahmed, V. Vanniasingham, T. Leung, and L. Lim. 1990. Novel human brain cDNA encoding a 34,000 Mr protein, n-chimaerin, related to both the regulatory domain of protein kinase C and BCR, the product of the breakpoint cluster region gene. J. Mol. Biol. 211:11-16[Medline].
18. Hart, M. J., M. G. Callow, B. Souza, and P. Polakis. 1996. IQGAP1, a calmodulin binding protein with a rasGAP-related domain, is a potential effector for Cdc42Hs. EMBO J. 15:2997-3005[Medline].
19. Ishizaki, T., M. Maekawa, K. Fujisawa, K. Okawa, A. Iwamatsu, A. Fujita, N. Watanabe, Y. Saito, A. Kakizuka, N. Morii, and S. Narumiya. 1996. The small GTP-binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic dystrophy kinase. EMBO J. 15:1885-1893[Medline].
20. Ishizaki, T., M. Naito, K. Fujisawa, M. Maekawa, N. Watanabe, Y. Saito, and S. Narumiya. 1997. p160ROCK, a Rho-associated coiled-coil forming protein kinase, works downstream of Rho and induces focal adhesions. FEBS Lett. 404:118-124[Medline].
21. Joneson, T., M. McDonough, D. Bar-Sagi, and L. Van Aelst. 1996. Rac regulation of actin polymerization and proliferation by a pathway distinct from Jun kinase. Science 274:1374-1376[Abstract/Free Full Text].
22. Kamisoyama, H., Y. Araki, and M. Ikebe. 1994. Mutagenesis of the phosphorylation site (serine 19) of smooth muscle myosin regulatory light chain and its effects on the properties of myosin. Biochemistry 33:840-847[Medline].
23. Kimura, K., M. Ito, M. Amano, K. Chihara, Y. Fukata, M. Nakafuku, B. Yamamori, J. Feng, T. Nakano, K. Okawa, A. Iwamatsu, and K. Kaibuchi. 1996. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273:245-248[Abstract].
24. Kozma, R., S. Ahmed, A. Best, and L. Lim. 1995. The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Mol. Cell. Biol. 15:1942-1952[Abstract/Free Full Text].
25. Kuroda, S., M. Fukata, K. Kobayashi, M. Nakafuku, N. Nomura, A. Iwamatsu, and K. Kaibuchi. 1996. Identification of IQGAP as a putative target for the small GTPases Cdc42 and Rac1. J. Biol. Chem. 271:23363-23367[Abstract/Free Full Text].
26. Lamarche, N., and A. Hall. 1994. GAPs for rho-related GTPases. Trends Genet. 10:436-440[Medline].
27. Lamarche, N., N. Tapon, L. Stowers, P. D. Burbelo, P. Aspenstrom, T. Bridges, J. Chant, and A. Hall. 1996. Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade. Cell 87:519-529[Medline].
28. Leeuw, T., A. Fourest-Lieuvin, C. Wu, J. Chenevert, K. Clark, M. Whiteway, D. Y. Thomas, and E. Leberer. 1995. Pheromone response in yeast: association of Bem1p with proteins of the MAP kinase cascade and actin. Science 270:1210-1213[Abstract/Free Full Text].
29. Lendahl, U., L. B. Zimmerman, and R. D. McKay. 1990. CNS stem cells express a new class of intermediate filament protein. Cell 60:585-595[Medline].
30. Leung, T., X.-Q. Chen, E. Manser, and L. Lim. 1996. The p160 RhoA-binding kinase ROKalpha is a member of a kinase family and is involved in the reorganization of the cytoskeleton. Mol. Cell. Biol. 16:5313-5327[Abstract/Free Full Text].
31. Leung, T., E. Manser, L. Tan, and L. Lim. 1995. A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes. J. Biol. Chem. 270:29051-29054[Abstract/Free Full Text].
32. Lim, L., E. Manser, T. Leung, and C. Hall. 1996. Regulation of phosphorylation pathways by p21 GTPases: the p21 Ras-related Rho subfamily and its role in phosphorylation signalling pathways. Eur. J. Biochem. 242:171-185[Medline].
33. Ma, A. D., L. F. Brass, and C. S. Abrams. 1997. Pleckstrin associates with plasma membranes and induces the formation of membrane projections: requirements for phosphorylation and the NH2-terminal PH domain. J. Cell Biol. 136:1071-1079[Abstract/Free Full Text].
34. Manser, E., H.-Y. Huang, T.-H. Loo, X.-Q. Chen, J.-M. Dong, T. Leung, and L. Lim. 1997. Expression of constitutively active alpha PAK reveals effects of the kinase on actin and focal complexes. Mol. Cell. Biol. 17:1129-1143[Abstract/Free Full Text].
35. Manser, E., T. Leung, H. Salihuddin, L. Tan, and L. Lim. 1993. A non-receptor tyrosine kinase that inhibits the GTPase activity of p21cdc42. Nature (London) 363:364-367[Medline].
36. Manser, E., T. Leung, H. Salihuddin, Z.-S. Zhao, and L. Lim. 1994. A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature (London) 367:40-46[Medline].
37. Martin, G. A., G. Bollag, F. McCormick, and A. Abo. 1995. A novel serine kinase activated by Rac1/Cdc42Hs-dependent autophosphorylation is related to PAK65 and Ste20. EMBO J. 14:1970-1978[Medline].
38. Matsui, T., M. Amano, T. Yamamoto, K. Chihara, M. Nakafuku, M. Ito, T. Nakano, K. Okawa, A. Iwamatsu, and K. Kaibuchi. 1996. Rho-associated kinase, a novel serine threonine kinase, as a putative target for the small GTP-binding protein Rho. EMBO J. 15:2208-2216[Medline].
39. Minden, A., A. Lin, F. X. Claret, A. Abo, and M. Karin. 1995. Selective activation of the JNK signalling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell 81:1147-1157[Medline].
40. Molnar, A., A. M. Theodoras, L. I. Zon, and J. M. Kyriakis. 1997. Cdc42Hs, but not Rac1, inhibits serum-stimulated cell cycle progression at G1/S through a mechanism requiring p38/RK. J. Biol. Chem. 272:13229-13235[Abstract/Free Full Text].
41. Nobes, C. D., and A. Hall. 1995. Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibres, lamellipodia and filopodia. Cell 81:53-62[Medline].
42. Qiu, R.-G., A. Abo, F. McCormick, and M. Symons. 1997. Cdc42 regulates anchorage-independent growth and is necessary for Ras transformation. Mol. Cell. Biol. 17:3449-3458[Abstract/Free Full Text].
43. Ridley, A. J., and A. Hall. 1992. The small GTP-binding protein Rho regulates the assembly of focal adhesions and actin stress fibres in response to growth factors. Cell 70:389-399[Medline].
44. Ridley, A. J., H. F. Paterson, C. L. Johnston, D. Diekmann, and A. Hall. 1992. The small GTP-binding protein Rac regulates growth factor-induced membrane ruffling. Cell 70:401-410[Medline].
45. Rodriguez-Viciana, P., P. H. Warne, A. Khwaja, B. M. Marte, D. Pappin, P. Das, M. D. Waterfield, A. Ridley, and J. Downward. 1997. Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell 89:457-467[Medline].
46. Symons, M., J. M. J. Derry, B. Karlak, S. Jiang, V. Lemahieu, F. McCormick, U. Francke, and A. Abo. 1996. Wiskott-Aldrich Syndrome protein, a novel effector for the GTPase Cdc42Hs, is implicated in actin polymerization. Cell 84:723-734[Medline].
47. Symons, M., J. M. J. Derry, B. Souza, J. R. Pringle, A. Abo, and S. I. Reed. 1995. Role for the Rho-family GTPase Cdc42 in yeast mating pheromone signal pathway. Nature (London) 376:702-705[Medline].
48. Tapon, N., and A. Hall. 1997. Rho, Rac and Cdc42 GTPases regulate the organization of the actin cytoskeleton. Curr. Opin. Cell Biol. 9:86-92[Medline].
49. Van Aelst, L., T. Joneson, and D. Bar-Sagi. 1996. Identification of a novel Rac1-interacting protein involved in membrane ruffling. EMBO J. 15:3778-3786[Medline].
50. Watanabe, G., Y. Saito, P. Madaule, T. Ishizake, K. Fujisawa, N. Morri, H. Mukai, Y. Ono, A. Kakizuka, and S. Narumiya. 1996. Protein kinase N (PKN) and PKN-related protein Rhophilin as targets of the small GTPase Rho. Science 271:645-648[Abstract].
51. Westwick, J. K., Q. T. Lambert, G. J. Clark, M. Symons, L. Van Aelst, R. G. Pestell, and C. J. Der. 1997. Rac regulation of transformation, gene expression, and actin polymerization by multiple, PAK-independent pathways. Mol. Cell. Biol. 17:1324-1335[Abstract/Free Full Text].
52. Wittenberg, C., and S. I. Reed. 1996. Plugging it in: signalling circuits and the yeast cell cycle. Curr. Opin. Cell Biol. 8:223-230[Medline].
53. Zhang, S., J. Han, M. A. Sells, J. Chernoff, U. G. Knaus, R. J. Ulevitch, and G. M. Bokoch. 1995. Rho family GTPases regulate p38 mitogen-activated protein kinase through the downstream mediator Pak1. J. Biol. Chem. 270:23934-23936[Abstract/Free Full Text].
54. Zhao, Z.-S., T. Leung, E. Manser, and L. Lim. 1995. Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24. Mol. Cell. Biol. 15:5246-5257[Abstract/Free Full Text].

Mol Cell Biol, January 1998, p. 130-140, Vol. 18, No. 1
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Hsu, R.-M., Tsai, M.-H., Hsieh, Y.-J., Lyu, P.-C., Yu, J.-S. (2010). Identification of MYO18A as a Novel Interacting Partner of the PAK2/{beta}PIX/GIT1 Complex and Its Potential Function in Modulating Epithelial Cell Migration. Mol. Biol. Cell 21: 287-301 [Abstract] [Full Text]  
  • Tripathi, B. K., Zelenka, P. S. (2009). Cdk5-Dependent Regulation of Rho Activity, Cytoskeletal Contraction, and Epithelial Cell Migration via Suppression of Src and p190RhoGAP. Mol. Cell. Biol. 29: 6488-6499 [Abstract] [Full Text]  
  • Fisher, K. E., Sacharidou, A., Stratman, A. N., Mayo, A. M., Fisher, S. B., Mahan, R. D., Davis, M. J., Davis, G. E. (2009). MT1-MMP- and Cdc42-dependent signaling co-regulate cell invasion and tunnel formation in 3D collagen matrices. J. Cell Sci. 122: 4558-4569 [Abstract] [Full Text]  
  • Gally, C., Wissler, F., Zahreddine, H., Quintin, S., Landmann, F., Labouesse, M. (2009). Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development 136: 3109-3119 [Abstract] [Full Text]  
  • Wen, W., Liu, W., Yan, J., Zhang, M. (2008). Structure Basis and Unconventional Lipid Membrane Binding Properties of the PH-C1 Tandem of Rho Kinases. J. Biol. Chem. 283: 26263-26273 [Abstract] [Full Text]  
  • Choi, S. H., Czifra, G., Kedei, N., Lewin, N. E., Lazar, J., Pu, Y., Marquez, V. E., Blumberg, P. M. (2008). Characterization of the Interaction of Phorbol Esters with the C1 Domain of MRCK (Myotonic Dystrophy Kinase-related Cdc42 Binding Kinase) {alpha}/{beta}. J. Biol. Chem. 283: 10543-10549 [Abstract] [Full Text]  
  • Black, S. A. Jr., Trackman, P. C. (2008). Transforming Growth Factor-{beta}1 (TGF{beta}1) Stimulates Connective Tissue Growth Factor (CCN2/CTGF) Expression in Human Gingival Fibroblasts through a RhoA-independent, Rac1/Cdc42-dependent Mechanism: STATINS WITH FORSKOLIN BLOCK TGF{beta}1-INDUCED CCN2/CTGF EXPRESSION. J. Biol. Chem. 283: 10835-10847 [Abstract] [Full Text]  
  • Prag, S., Parsons, M., Keppler, M. D., Ameer-Beg, S. M., Barber, P., Hunt, J., Beavil, A. J., Calvert, R., Arpin, M., Vojnovic, B., Ng, T. (2007). Activated Ezrin Promotes Cell Migration through Recruitment of the GEF Dbl to Lipid Rafts and Preferential Downstream Activation of Cdc42. Mol. Biol. Cell 18: 2935-2948 [Abstract] [Full Text]  
  • Lefort, K., Mandinova, A., Ostano, P., Kolev, V., Calpini, V., Kolfschoten, I., Devgan, V., Lieb, J., Raffoul, W., Hohl, D., Neel, V., Garlick, J., Chiorino, G., Dotto, G. P. (2007). Notch1 is a p53 target gene involved in human keratinocyte tumor suppression through negative regulation of ROCK1/2 and MRCK{alpha} kinases. Genes Dev. 21: 562-577 [Abstract] [Full Text]  
  • Watanabe, T., Hosoya, H., Yonemura, S. (2007). Regulation of Myosin II Dynamics by Phosphorylation and Dephosphorylation of Its Light Chain in Epithelial Cells. Mol. Biol. Cell 18: 605-616 [Abstract] [Full Text]  
  • Lin, Q., Yang, W., Baird, D., Feng, Q., Cerione, R. A. (2006). Identification of a DOCK180-related Guanine Nucleotide Exchange Factor That Is Capable of Mediating a Positive Feedback Activation of Cdc42. J. Biol. Chem. 281: 35253-35262 [Abstract] [Full Text]  
  • Yong, J., Tan, I., Lim, L., Leung, T. (2006). Phosphorylation of Myosin Phosphatase Targeting Subunit 3 (MYPT3) and Regulation of Protein Phosphatase 1 by Protein Kinase A. J. Biol. Chem. 281: 31202-31211 [Abstract] [Full Text]  
  • Schmelzle, K., Kane, S., Gridley, S., Lienhard, G. E., White, F. M. (2006). Temporal dynamics of tyrosine phosphorylation in insulin signaling.. Diabetes 55: 2171-2179 [Abstract] [Full Text]  
  • Garcia, P., Ucurum, Z., Bucher, R., Svergun, D. I., Huber, T., Lustig, A., Konarev, P. V., Marino, M., Mayans, O. (2006). Molecular insights into the self-assembly mechanism of dystrophia myotonica kinase. FASEB J. 20: 1142-1151 [Abstract] [Full Text]  
  • Chaigne-Delalande, B., Deuve, L., Reuzeau, E., Basoni, C., Lafarge, D., Varon, C., Tatin, F., Anies, G., Garand, R., Kramer, I., Genot, E. (2006). RhoGTPases and p53 Are Involved in the Morphological Appearance and Interferon-{alpha} Response of Hairy Cells. Am. J. Pathol. 168: 562-573 [Abstract] [Full Text]  
  • Kaliman, P., Catalucci, D., Lam, J. T., Kondo, R., Gutierrez, J. C. P., Reddy, S., Palacin, M., Zorzano, A., Chien, K. R., Ruiz-Lozano, P. (2005). Myotonic Dystrophy Protein Kinase Phosphorylates Phospholamban and Regulates Calcium Uptake in Cardiomyocyte Sarcoplasmic Reticulum. J. Biol. Chem. 280: 8016-8021 [Abstract] [Full Text]  
  • Yin, L., Bennani-Baiti, N., Powell, C. T. (2005). Phorbol Ester-induced Apoptosis of C4-2 Cells Requires Both a Unique and a Redundant Protein Kinase C Signaling Pathway. J. Biol. Chem. 280: 5533-5541 [Abstract] [Full Text]  
  • van Herpen, R. E. M. A., Oude Ophuis, R. J. A., Wijers, M., Bennink, M. B., van de Loo, F. A. J., Fransen, J., Wieringa, B., Wansink, D. G. (2005). Divergent Mitochondrial and Endoplasmic Reticulum Association of DMPK Splice Isoforms Depends on Unique Sequence Arrangements in Tail Anchors. Mol. Cell. Biol. 25: 1402-1414 [Abstract] [Full Text]  
  • Lieberman, S. M., Takaki, T., Han, B., Santamaria, P., Serreze, D. V., DiLorenzo, T. P. (2004). Individual Nonobese Diabetic Mice Exhibit Unique Patterns of CD8+ T Cell Reactivity to Three Islet Antigens, Including the Newly Identified Widely Expressed Dystrophia Myotonica Kinase. J. Immunol. 173: 6727-6734 [Abstract] [Full Text]  
  • Naim, V., Imarisio, S., Di Cunto, F., Gatti, M., Bonaccorsi, S. (2004). Drosophila Citron Kinase Is Required for the Final Steps of Cytokinesis. Mol. Biol. Cell 15: 5053-5063 [Abstract] [Full Text]  
  • Ng, Y., Tan, I., Lim, L., Leung, T. (2004). Expression of the Human Myotonic Dystrophy Kinase-related Cdc42-binding Kinase {gamma} Is Regulated by Promoter DNA Methylation and Sp1 Binding. J. Biol. Chem. 279: 34156-34164 [Abstract] [Full Text]  
  • Spence, H.J., Chen, Y.-J., Batchelor, C.L., Higginson, J.R., Suila, H., Carpen, O., Winder, S.J. (2004). Ezrin-dependent regulation of the actin cytoskeleton by {beta}-dystroglycan. Hum Mol Genet 13: 1657-1668 [Abstract] [Full Text]  
  • Gu, Y., Lin, Q., Childress, C., Yang, W. (2004). Identification of the Region in Cdc42 That Confers the Binding Specificity to Activated Cdc42-associated Kinase. J. Biol. Chem. 279: 30507-30513 [Abstract] [Full Text]  
  • CEULEMANS, H., BOLLEN, M. (2004). Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button. Physiol. Rev. 84: 1-39 [Abstract] [Full Text]  
  • Wansink, D. G., van Herpen, R. E. M. A., Coerwinkel-Driessen, M. M., Groenen, P. J. T. A., Hemmings, B. A., Wieringa, B. (2003). Alternative Splicing Controls Myotonic Dystrophy Protein Kinase Structure, Enzymatic Activity, and Subcellular Localization. Mol. Cell. Biol. 23: 5489-5501 [Abstract] [Full Text]  
  • Masuda-Robens, J. M., Kutney, S. N., Qi, H., Chou, M. M. (2003). The TRE17 Oncogene Encodes a Component of a Novel Effector Pathway for Rho GTPases Cdc42 and Rac1 and Stimulates Actin Remodeling. Mol. Cell. Biol. 23: 2151-2161 [Abstract] [Full Text]  
  • Cunto, F. D., Imarisio, S., Camera, P., Boitani, C., Altruda, F., Silengo, L. (2003). Essential role of citron kinase in cytokinesis of spermatogenic precursors. J. Cell Sci. 115: 4819-4826 [Abstract] [Full Text]  
  • Cai, D., Felekkis, K. N., Near, R. I., O'Neill, G. M., van Seventer, J. M., Golemis, E. A., Lerner, A. (2003). The GDP Exchange Factor AND-34 Is Expressed in B Cells, Associates With HEF1, and Activates Cdc42. J. Immunol. 170: 969-978 [Abstract] [Full Text]  
  • Sahai, E. (2002). p53 Moves Into Control of Cell Morphology. Mol. Interv. 2: 286-289 [Abstract] [Full Text]  
  • Chen, X.-q., Tan, I., Ng, C. H., Hall, C., Lim, L., Leung, T. (2002). Characterization of RhoA-binding Kinase ROKalpha Implication of the Pleckstrin Homology Domain in ROKalpha Function Using Region-specific Antibodies. J. Biol. Chem. 277: 12680-12688 [Abstract] [Full Text]  
  • ORLANDO, R. A., TAKEDA, T., ZAK, B., SCHMIEDER, S., BENOIT, V. M., MCQUISTAN, T., FURTHMAYR, H., FARQUHAR, M. G. (2001). The Glomerular Epithelial Cell Anti-Adhesin Podocalyxin Associates with the Actin Cytoskeleton through Interactions with Ezrin. J. Am. Soc. Nephrol. 12: 1589-1598 [Abstract] [Full Text]  
  • Tan, I., Seow, K. T., Lim, L., Leung, T. (2001). Intermolecular and Intramolecular Interactions Regulate Catalytic Activity of Myotonic Dystrophy Kinase-Related Cdc42-Binding Kinase {alpha}. Mol. Cell. Biol. 21: 2767-2778 [Abstract] [Full Text]  
  • van Nieuw Amerongen, G. P., van Hinsbergh, V. W.M. (2001). Cytoskeletal Effects of Rho-Like Small Guanine Nucleotide-Binding Proteins in the Vascular System. Arterioscler. Thromb. Vasc. Bio. 21: 300-311 [Abstract] [Full Text]  
  • Govind, S., Kozma, R., Monfries, C., Lim, L., Ahmed, S. (2001). Cdc42hs Facilitates Cytoskeletal Reorganization and Neurite Outgrowth by Localizing the 58-Kd Insulin Receptor Substrate to Filamentous Actin. JCB 152: 579-594 [Abstract] [Full Text]  
  • Koh, C.-G., Manser, E., Zhao, Z.-S., Ng, C.-P., Lim, L. (2001). {beta}1PIX, the PAK-interacting exchange factor, requires localization via a coiled-coil region to promote microvillus-like structures and membrane ruffles. J. Cell Sci. 114: 4239-4251 [Abstract] [Full Text]  
  • Wojciak-Stothard, B, Potempa, S, Eichholtz, T, Ridley, A. (2001). 9Rgr; and Rac but not Cdc42 regulate endothelial cell permeability. J. Cell Sci. 114: 1343-1355 [Abstract]  
  • Takai, Y., Sasaki, T., Matozaki, T. (2001). Small GTP-Binding Proteins. Physiol. Rev. 81: 153-208 [Abstract] [Full Text]  
  • Piekny, A. J., Wissmann, A., Mains, P. E. (2000). Embryonic Morphogenesis in Caenorhabditis elegans Integrates the Activity of LET-502 Rho-Binding Kinase, MEL-11 Myosin Phosphatase, DAF-2 Insulin Receptor and FEM-2 PP2c Phosphatase. Genetics 156: 1671-1689 [Abstract] [Full Text]  
  • Wu, G., Li, H., Yang, Z. (2000). Arabidopsis RopGAPs Are a Novel Family of Rho GTPase-Activating Proteins that Require the Cdc42/Rac-Interactive Binding Motif for Rop-Specific GTPase Stimulation. Plant Physiol. 124: 1625-1636 [Abstract] [Full Text]  
  • Kaufmann, W. E., MacDonald, S. M., Altamura, C. R. (2000). Dendritic Cytoskeletal Protein Expression in Mental Retardation: An Immunohistochemical Study of the Neocortex in Rett Syndrome. Cereb Cortex 10: 992-1004 [Abstract] [Full Text]  
  • Lam, L.T., Pham, Y.C.N., Man, N. t., Morris, G.E. (2000). Characterization of a monoclonal antibody panel shows that the myotonic dystrophy protein kinase, DMPK, is expressed almost exclusively in muscle and heart. Hum Mol Genet 9: 2167-2173 [Abstract] [Full Text]  
  • Zhao, Z.-s., Manser, E., Loo, T.-H., Lim, L. (2000). Coupling of PAK-Interacting Exchange Factor PIX to GIT1 Promotes Focal Complex Disassembly. Mol. Cell. Biol. 20: 6354-6363 [Abstract] [Full Text]  
  • Zallen, J. A., Peckol, E. L., Tobin, D. M., Bargmann, C. I. (2000). Neuronal Cell Shape and Neurite Initiation Are Regulated by the Ndr Kinase SAX-1, a Member of the Orb6/COT-1/Warts Serine/Threonine Kinase Family. Mol. Biol. Cell 11: 3177-3190 [Abstract] [Full Text]  
  • Groenen, P. J.T.A., Wansink, D. G., Coerwinkel, M., van den Broek, W., Jansen, G., Wieringa, B. (2000). Constitutive and regulated modes of splicing produce six major myotonic dystrophy protein kinase (DMPK) isoforms with distinct properties. Hum Mol Genet 9: 605-616 [Abstract] [Full Text]  
  • Aoki, H., Hayashi, J., Moriyama, M., Arakawa, Y., Hino, O. (2000). Hepatitis C Virus Core Protein Interacts with 14-3-3 Protein and Activates the Kinase Raf-1. J. Virol. 74: 1736-1741 [Abstract] [Full Text]  
  • Sabourin, L. A., Seale, P., Wagner, J., Rudnicki, M. A. (2000). Caspase 3 Cleavage of the Ste20-Related Kinase SLK Releases and Activates an Apoptosis-Inducing Kinase Domain and an Actin-Disassembling Region. Mol. Cell. Biol. 20: 684-696 [Abstract] [Full Text]  
  • Sarner, S., Kozma, R., Ahmed, S., Lim, L. (2000). Phosphatidylinositol 3-Kinase, Cdc42, and Rac1 Act Downstream of Ras in Integrin-Dependent Neurite Outgrowth in N1E-115 Neuroblastoma Cells. Mol. Cell. Biol. 20: 158-172 [Abstract] [Full Text]  
  • Sumi, T., Matsumoto, K., Takai, Y., Nakamura, T. (1999). Cofilin Phosphorylation and Actin Cytoskeletal Dynamics Regulated by Rho- and Cdc42-Activated Lim-Kinase 2. JCB 147: 1519-1532 [Abstract] [Full Text]  
  • Low, B. C., Lim, Y. P., Lim, J., Wong, E. S. M., Guy, G. R. (1999). Tyrosine Phosphorylation of the Bcl-2-associated Protein BNIP-2 by Fibroblast Growth Factor Receptor-1 Prevents Its Binding to Cdc42GAP and Cdc42. J. Biol. Chem. 274: 33123-33130 [Abstract] [Full Text]  
  • Amano, M., Chihara, K., Nakamura, N., Kaneko, T., Matsuura, Y., Kaibuchi, K. (1999). The COOH Terminus of Rho-kinase Negatively Regulates Rho-kinase Activity. J. Biol. Chem. 274: 32418-32424 [Abstract] [Full Text]  
  • Joberty, G., Perlungher, R. R., Macara, I. G. (1999). The Borgs, a New Family of Cdc42 and TC10 GTPase-Interacting Proteins. Mol. Cell. Biol. 19: 6585-6597 [Abstract] [Full Text]  
  • Fukata, M., Kuroda, S., Nakagawa, M., Kawajiri, A., Itoh, N., Shoji, I., Matsuura, Y., Yonehara, S., Fujisawa, H., Kikuchi, A., Kaibuchi, K. (1999). Cdc42 and Rac1 Regulate the Interaction of IQGAP1 with beta -Catenin. J. Biol. Chem. 274: 26044-26050 [Abstract] [Full Text]  
  • Bauer, M., Retzer, M., Wilde, J. I., Maschberger, P., Essler, M., Aepfelbacher, M., Watson, S. P., Siess, W. (1999). Dichotomous Regulation of Myosin Phosphorylation and Shape Change by Rho-Kinase and Calcium in Intact Human Platelets. Blood 94: 1665-1672 [Abstract] [Full Text]  
  • Burbelo, P. D., Snow, D. M., Bahou, W., Spiegel, S. (1999). MSE55, a Cdc42 effector protein, induces long cellular extensions in fibroblasts. Proc. Natl. Acad. Sci. USA 96: 9083-9088 [Abstract] [Full Text]  
  • Chen, X.-Q., Tan, I., Leung, T., Lim, L. (1999). The Myotonic Dystrophy Kinase-related Cdc42-binding Kinase Is Involved in the Regulation of Neurite Outgrowth in PC12 Cells. J. Biol. Chem. 274: 19901-19905 [Abstract] [Full Text]  
  • Fukata, Y., Oshiro, N., Kinoshita, N., Kawano, Y., Matsuoka, Y., Bennett, V., Matsuura, Y., Kaibuchi, K. (1999). Phosphorylation of Adducin by Rho-Kinase Plays a Crucial Role in Cell Motility. JCB 145: 347-361 [Abstract] [Full Text]  
  • Johnson, D. I. (1999). Cdc42: An Essential Rho-Type GTPase Controlling Eukaryotic Cell Polarity. Microbiol. Mol. Biol. Rev. 63: 54-105 [Abstract] [Full Text]  
  • Fukata, M, Nakagawa, M, Kuroda, S, Kaibuchi, K (1999). Cell adhesion and Rho small GTPases. J. Cell Sci. 112: 4491-4500 [Abstract]  
  • Zhang, W., Vazquez, L., Apperson, M., Kennedy, M. B. (1999). Citron Binds to PSD-95 at Glutamatergic Synapses on Inhibitory Neurons in the Hippocampus. J. Neurosci. 19: 96-108 [Abstract] [Full Text]  
  • Oshiro, N., Fukata, Y., Kaibuchi, K. (1998). Phosphorylation of Moesin by Rho-associated Kinase (Rho-kinase) Plays a Crucial Role in the Formation of Microvilli-like Structures. J. Biol. Chem. 273: 34663-34666 [Abstract] [Full Text]  
  • Yasui, Y., Amano, M., Nagata, K.-i., Inagaki, N., Nakamura, H., Saya, H., Kaibuchi, K., Inagaki, M. (1998). Roles of Rho-associated Kinase in Cytokinesis; Mutations in Rho-associated Kinase Phosphorylation Sites Impair Cytokinetic Segregation of Glial Filaments. JCB 143: 1249-1258 [Abstract] [Full Text]  
  • Sin, W.-C., Chen, X.-Q., Leung, T., Lim, L. (1998). RhoA-Binding Kinase alpha  Translocation Is Facilitated by the Collapse of the Vimentin Intermediate Filament Network. Mol. Cell. Biol. 18: 6325-6339 [Abstract] [Full Text]  
  • Zhao, Z.-S., Manser, E., Chen, X.-Q., Chong, C., Leung, T., Lim, L. (1998). A Conserved Negative Regulatory Region in alpha PAK: Inhibition of PAK Kinases Reveals Their Morphological Roles Downstream of Cdc42 and Rac1. Mol. Cell. Biol. 18: 2153-2163 [Abstract] [Full Text]  
  • Sumi, T., Matsumoto, K., Shibuya, A., Nakamura, T. (2001). Activation of LIM Kinases by Myotonic Dystrophy Kinase-related Cdc42-binding Kinase alpha. J. Biol. Chem. 276: 23092-23096 [Abstract] [Full Text]  
  • Arimura, N., Inagaki, N., Chihara, K., Menager, C., Nakamura, N., Amano, M., Iwamatsu, A., Goshima, Y., Kaibuchi, K. (2000). Phosphorylation of Collapsin Response Mediator Protein-2 by Rho-kinase. EVIDENCE FOR TWO SEPARATE SIGNALING PATHWAYS FOR GROWTH CONE COLLAPSE. J. Biol. Chem. 275: 23973-23980 [Abstract] [Full Text]  
  • Pirone, D. M., Fukuhara, S., Gutkind, J. S., Burbelo, P. D. (2000). SPECs, Small Binding Proteins for Cdc42. J. Biol. Chem. 275: 22650-22656 [Abstract] [Full Text]  
  • Chong, C., Tan, L., Lim, L., Manser, E. (2001). The Mechanism of PAK Activation. AUTOPHOSPHORYLATION EVENTS IN BOTH REGULATORY AND KINASE DOMAINS CONTROL ACTIVITY. J. Biol. Chem. 276: 17347-17353 [Abstract] [Full Text]  
  • Tan, I., Ng, C. H., Lim, L., Leung, T. (2001). Phosphorylation of a Novel Myosin Binding Subunit of Protein Phosphatase 1 Reveals a Conserved Mechanism in the Regulation of Actin Cytoskeleton. J. Biol. Chem. 276: 21209-21216 [Abstract] [Full Text]  
  • Reeder, M. K., Serebriiskii, I. G., Golemis, E. A., Chernoff, J. (2001). Analysis of Small GTPase Signaling Pathways Using p21-activated Kinase Mutants That Selectively Couple to Cdc42. J. Biol. Chem. 276: 40606-40613 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, T.
Right arrow Articles by Lim, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, T.
Right arrow Articles by Lim, L.

Copyright © 2010 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»