Department of Biochemistry and Molecular
Biology, University of Illinois at Chicago, Chicago, Illinois 60612
Received 17 September 1997/Returned for modification 17 October
1997/Accepted 23 October 1997
The transcription factor E2F1 is believed to be involved in the
regulated expression of the DNA replication genes. To gain insights
into the transcriptional activation function of E2F1, we looked for
proteins in HeLa nuclear extracts that bind to the activation domain of
E2F1. Here we show that DDB, a putative DNA repair protein, associates
with the activation domain of E2F1. DDB was identified as a
heterodimeric protein (48 and 127 kDa) that binds to UV-damaged DNA. We
show that the UV-damaged-DNA binding activity from HeLa nuclear
extracts can associate with the activation domain of E2F1. Moreover,
the 48-kDa subunit of DDB, synthesized in vitro, binds to a fusion
protein of E2F1 depending on the C-terminal activation domain. The
interaction between DDB and E2F1 can also be detected by
coimmunoprecipitation experiments. Immunoprecipitation of an
epitope-tagged DDB from cell extracts resulted in the coprecipitation
of E2F1. In a reciprocal experiment, immunoprecipitates of E2F1 were
found to contain DDB. Fractionation of HeLa nuclear extracts also
revealed a significant overlap in the elution profiles of E2F1 and DDB.
For instance, DDB, which does not bind to the E2F sites, was enriched
in the high-salt fractions containing E2F1 during chromatography
through an E2F-specific DNA affinity column. We also observed evidence
for a functional interaction between DDB and E2F1 in living
cells. For instance, expression of DDB specifically stimulated
E2F1-activated transcription. In addition, the
transcriptional activation function of a heterologous transcription
factor containing the activation domain of E2F1 was stimulated by
coexpression of DDB. Moreover, DDB expression could overcome the
retinoblastoma protein (Rb)-mediated inhibition of E2F1-activated
transcription. The results suggest that this damaged-DNA
binding protein can function as a transcriptional partner of
E2F1. We speculate that the damaged-DNA binding function of DDB,
besides repair, might serve as a negative regulator of E2F1-activated
transcription, as damaged DNA will sequester DDB and make it
unavailable for E2F1. Furthermore, the binding of DDB to damaged
DNA might be involved in downregulating the replication genes
during growth arrest induced by damaged DNA.
 |
INTRODUCTION |
E2F1 is the most-studied member of
the E2F family of transcription factors. E2F1 binds the consensus E2F
site (TTTCGCGC) as a heterodimer in conjunction with DP1,
and it stimulates transcription both in vitro and in vivo (3, 13,
20-22, 31). Several genes that are essential for DNA replication
and S-phase entry have been shown to be transcriptionally activated by
overexpression of E2F1. Included are genes expressing dihydrofolate
reductase (4, 26, 56), ribonucleotide reductase, PCNA, DNA
polymerase
, thymidine kinase, cyclin E, cyclin A, and E2F1, as well
as cdc2 (8, 42, 44). This is consistent with the observation that overexpression of E2F1 induces quiescent cells to enter S phase
(2, 30).
The activity and levels of E2F1 are regulated very tightly during the
progression of the cell cycle. Expression of E2F1 increases late in
G1 phase (56). It has been shown that the E2F
sites in the E2F1 promoter are responsible for its cell cycle-regulated expression (26, 29). The activity of E2F1 is regulated by cell cycle-regulatory proteins such as the retinoblastoma protein (Rb)
and cyclin A. The transcriptional activation domain of E2F1 at the
C-terminal region contains a binding site for the Rb tumor suppressor
protein (21, 31). E2F1 was cloned based on its ability to
interact with Rb (21, 31). It is generally believed that
binding of Rb to the C-terminal activation domain of E2F1 converts an
activator to a repressor (20, 54, 65, 66). Both in vitro and
in vivo studies have confirmed the notion that Rb binding leads to a
reduction in E2F1-activated transcription (1, 13, 24). The
N-terminal region of E2F1 contains a consensus cyclin A-binding motif
(37, 38, 67). It has been shown that, in vitro, binding of
cyclin A-cdk2 to E2F1 results in the phosphorylation of the DP1 subunit
(13). DP1 phosphorylated in this manner is unable to remain
associated with E2F1, which leads to a loss in the DNA binding activity
of E2F1 (13, 37, 38, 67). The binding of cyclin A-cdk2 to
E2F1 is important for progression through S phase, as mutation in the
cyclin A-binding site causes an arrest in S phase followed by apoptosis
(38).
The elaborate regulatory mechanisms imposed upon E2F1 emphasize the
importance of E2F1 and related factors in cell cycle progression. Because E2F1 is a transcription factor, it is likely that it exerts most of its biological function by altering the expression of target
genes. Therefore, an analysis of the protein partners that participate
in E2F1-activated transcription will be important in understanding the
molecular mechanism underlying the cell cycle-regulatory function of
E2F1. It is noteworthy that in several E2F1-activated genes, the
E2F-binding sites overlap with the transcription initiation site. It is
possible that in these circumstances E2F1 acts as a
transcriptional-initiator protein. Studies on the transcription activation domain of E2F1 indicated that it could interact with the
basal transcription factor TATA-binding protein in vitro
(18). Studies by the same group of researchers also provided
indirect evidence for a role of the transcriptional-coactivator protein p300 in the mechanism by which E2F1 activates transcription
(60).
We observed that the UV-damaged-DNA binding (DDB) protein associates
with the activation domain of E2F1. DDB was originally identified as a
cellular activity that binds UV-damaged DNA (7, 27, 33, 50,
61). DDB activity was also found to be missing in cells from a
subset (20%) of xeroderma pigmentosum complementation group E (XP-E)
patients (7). The DDB activity is associated with a
heterodimer of two polypeptides, which migrate in sodium dodecyl
sulfate (SDS)-polyacrylamide gels as 41-kDa (p48DDB) and 127-kDa
(p125DDB) species (12, 28, 33, 43). Moreover, microinjection
of the DDB proteins complements the repair deficiencies in XP-E cell
strains lacking the DDB activity (34). Interestingly, p125DDB was also cloned by yeast two-hybrid screening as a protein that
interacts with the hepatitis B virus X protein, which is a potent
activator of transcription (40). However, a role for DDB in
hepatitis B virus X protein-mediated transcriptional activation has yet
to be established.
Here we show that the DDB activity in HeLa cell nuclear extracts can
bind to the activation domain of E2F1. During fractionation of the
extracts through ion-exchange columns and DNA affinity columns, a
significant portion of E2F1 copurifies with the DDB activity. Using
recombinant proteins, we show that the p48DDB subunit efficiently
interacts with the activation domain of E2F1. We also provide evidence
that E2F1 coimmunoprecipitates with p48DDB. In transient
transfection assays, expression of DDB (the heterodimer of p48DDB
and p125DDB) specifically stimulates E2F1-activated transcription. The transactivation function of a Gal4 fusion protein containing the activation domain of E2F1 was also stimulated by the
expression of DDB. Moreover, coexpression of DDB overcomes Rb
repression of E2F1-activated transcription. These results are consistent with the notion that DDB is a part of the mechanism by which
E2F1 activates transcription.
 |
MATERIALS AND METHODS |
Cell culture.
HeLa cells were grown in suspension in spinner
bottles (Bellco). Cell volume was doubled when cell density reached
106/ml. All other cells were grown on 10-cm dishes in
Dulbecco modified Eagle medium supplemented with 10% fetal bovine
serum in a 5% CO2-supplemented atmosphere.
Binding of HeLa nuclear proteins to GST fusion proteins
containing the activation domain of E2F1.
HeLa cell nuclear
extracts were prepared according to a previously described procedure
(9). After dialysis for 12 to 16 h, the extracts were
subjected to centrifugation at 100,000 × g for 60 min.
The supernatant was used for binding experiments. Thirty milliliters of
extracts (200 mg) were incubated with 0.5 ml of glutathione
(GSH)-Sepharose beads containing 5 mg of glutathione S-transferase (GST) or a GST fusion protein containing the
C-terminal activation domain of E2F1. The incubation was carried out on
a nutator for 30 min at 4°C. The beads were then collected by
centrifugation. The beads were washed extensively with buffer
containing 150 mM NaCl, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 0.5%
Nonidet P-40 (NP-40). The bound proteins were eluted with the same
buffer containing 1% SDS.
Immunoexpression screening of cDNA library.
A Uni-ZAP human
primary fibroblast cDNA library [oligo(dT) primed] was screened by
using a polyclonal antiserum according to a previously described
procedure (50a).
Assay of the E2F-binding and DDB activity.
E2F-DNA binding
assays were carried out as described previously (55). DDB
assays were carried out essentially by the method of Hwang and Chu
(27). Briefly, a pyrimidine-rich, 148-bp DNA fragment
(HindIII/PvuII) of the bacterial
chloramphenicol gene was cut out for use as a probe. This fragment was
labeled with [
-32P]dATP by using the Klenow fragment
of DNA polymerase I, and then it was subjected to UV irradiation at
10,000 J/m2. Samples were then assayed for DDB activity by
electrophoretic mobility shift assay. Reaction mixtures consisted of
buffer U (12 mM HEPES [pH 7.9], 60 mM KCl, 5 mM MgCl2,
0.6 mM EDTA, 1 mM dithiothreitol [DTT], 12% glycerol) with 0.2 ng of
the probe (described above) and 1 µg of salmon sperm DNA as a
nonspecific competitor in a total volume of 30 µl. Competitions were
performed with 20 ng of unlabeled chloramphenicol acetyltransferase
(CAT)-DNA fragment, either untreated or treated with UV radiation
(10,000 J/m2). Reaction mixtures were incubated for 20 min
at room temperature. Eight microliters was then loaded onto a 4%
nondenaturing polyacrylamide gel in TGE buffer (50 mM Tris [pH
8.5], 380 mM glycine, 2 mM EDTA) and resolved for 2.5 h at 300 V
at 4°C.
Fractionation of HeLa nuclear extracts.
Nuclear extract was
prepared from HeLa cells as described previously (68). Four
hundred milligrams of extract was fractionated on a 40-ml
heparin-Sepharose column (Sigma), equilibrated in buffer HE (20 mM
HEPES [pH 7.9], 0.2 mM DTT, 0.1 mM phenylmethylsulfonyl fluoride
[PMSF], 0.1 mM EDTA, 10% glycerol) containing 0.1 M KCl. The column
was then washed in buffer HE containing 0.1 M KCl and was eluted first
in a 0.25 M KCl step, followed by a 10-bed volume gradient from 0.25 to
0.75 M KCl in buffer HE. Fractions active in the E2F-DNA binding assay
were pooled, dialyzed against buffer QE (20 mM Tris [pH 7.5], 0.2 mM
DTT, 0.1 mM PMSF, 0.1 mM EDTA, 10% glycerol, 0.1% NP-40) containing
0.1 M KCl, and subjected to Q-Sepharose chromatography. The Q-Sepharose
column was eluted in a 10-bed volume buffer QE gradient (0.1 to 0.55 M
KCl). Fractions were analyzed for E2F activity, and peak fractions were
pooled and dialyzed against buffer AE (20 mM HEPES [pH 7.9], 0.2 mM
DTT, 0.1 mM PMSF, 0.1 mM EDTA, 10% glycerol, 0.1% NP-40) containing 0.1 M KCl. E2F and mutant DNA affinity columns were prepared according to the method of Chellappan et al. (6). One-milliliter
affinity columns were loaded in the presence of 50 µg of salmon sperm
DNA to prevent binding of nonspecific DNA-binding proteins. Following washing in buffer AE containing 0.1 M KCl, the columns were eluted in
steps of 0.3 and 0.6 M KCl in buffer AE.
Recombinant plasmids.
pGEX-E2F1(356-437) was created by PCR
amplification of E2F1 cDNA encoding residues 356 to 437. The fragment
was cloned into the pGEX-2T vector (Pharmacia) by using the
BamHI and EcoRI restriction site-engineered PCR
product. PGEX-E2F1(1-437), pGEX-E2F1(1-417), and pGEX-E2F1(1-363) were
created by subcloning the inserts from pBS(RSV)GAL4-E2F1(1-437),
-(1-417), and -(1-363), respectively (15). Inserts were cut
at the 3' end with XbaI, blunt ended, and then cut at the 5'
end with BamHI. The inserts were then cloned into pGEX5X-3
cut with BamHI and SmaI. pT7-125 and pT7-48 were created by PCR amplification of p125 and p48 cDNA (kind gifts of G. Chu
and S. Linn, respectively). KpnI (5') and XbaI
(3') restriction sites and T7 tag (5') sequences (57) were
engineered into the primers to facilitate cloning. Sequences of primers
are as follows: p125 upstream primer,
ggggtaccaccatggctagcatgactggtggacagcaaatgggtatgtcgtacaactacgtg; p48 upstream primer,
ggggtaccaccatggctagcatgactggtggacagcaaatgggtatggctcccaagaaacgc; p125 downstream primer,
ggtctagaggatccgagttagctcct; p48 downstream primer,
ggtctagacttccgtgctctggcttc. PCR fragments were then cloned into pCDNA3 (Invitrogen) cut with KpnI and XbaI.
Immunoprecipitation and Western blot.
Cells were harvested
after DNA transfection. The harvested cells were washed twice with
phosphate-buffered saline, and were suspended in lysis buffer (60 µl
for cells from one 100-mm-diameter dish) that contained 20 mM HEPES (pH
7.9), 400 mM NaCl, 1 mM EDTA, 0.1% NP-40, 1 mM DTT, 0.5 mM PMSF, and
10% glycerol. After incubation at 4°C for 30 min, the lysates were
centrifuged at 13,000 × g for 10 min. The supernatants were
used for the immunoprecipitation experiments.
Agarose-linked T7 antibody (Novagen) and protein A-Sepharose-bound
hemagglutinin (HA) antibody (Santa Cruz) were further cross-linked by
using dimethylpimelimidate (DMP). The antibody-containing beads were washed with 0.2 M Na-borate (pH 9.0) and resuspended in 1 ml of
Na-borate containing 5 mg of DMP/ml. The incubation with DMP was
carried out at room temperature for 30 min. The beads were then washed
with 0.2 M ethanolamine (pH 8.0), followed by blocking with
ethanolamine (0.2 M; pH 8.0) for 2 h at room temperature. The
beads were then washed with buffer W (20 mM Tris-HCl [pH 7.8], 100 mM
NaCl, 0.1% NP-40, 1 mM EDTA) and used in immunoprecipitation experiments.
Cell lysates (0.5 mg) were incubated with beads containing covalently
bound antibodies for 2 h at 4°C. The beads were then collected
by centrifugation. Precipitates were washed three times with 1 ml of
buffer W. The bound proteins were subjected to Western blot analysis.
Western blotting was performed by using anti-rabbit and anti-mouse Fab
fragments conjugated to horseradish peroxidase (Amersham) and Pierce
Supersignal detection reagents according to the manufacturers'
instructions.
DNA transfection and CAT assays.
Transient transfections
were carried out by the calcium phosphate method as previously
described (41). Twenty micrograms of DNA was used per
100-mm-diameter plate. Each experiment was controlled for transfection
efficiency by including 1 µg of pCMV-
-galactosidase in each
transfection and then normalizing for
-galactosidase activity. CAT
assays were performed by the xylene extraction method of Seed and Sheen
(53).
 |
RESULTS |
DDB activity associates with the activation domain of E2F1.
To
identify proteins that associate with the activation domain of E2F1, a
GST fusion protein containing the activation domain of E2F1 immobilized
onto GSH-Sepharose beads was used to affinity select proteins from
HeLa-cell nuclear extracts as described in Materials and Methods.
Briefly, HeLa nuclear extracts (9) were dialyzed overnight
followed by centrifugation at 100,000 × g for 1 h. The supernatant was incubated with beads containing the activation domain of E2F1. After an extensive wash, proteins bound to the beads
were eluted with buffer containing 1% SDS. A comparison of proteins
bound to GST and GST-E2F1(363-437) is shown in Fig. 1A. Three polypeptides of 350 to 400, 127, and 40 to 45 kDa (Fig. 1) were very reproducibly observed to be
enriched by the activation domain of E2F1. We decided to analyze the
127-kDa polypeptide because the purified preparation of
GST-E2F1(363-437) fusion protein often contained a contaminant protein
of 45 kDa. SDS gel-purified 127-kDa polypeptide was used to raise
rabbit antiserum. The antiserum recognized multiple polypeptides,
including a 127-kDa polypeptide, in HeLa nuclear extract (data not
shown). Expression screening of a human fibroblast cDNA library using
an antiserum that recognized the 127-kDa polypeptide resulted in
isolation of five different cDNA clones. Partial DNA sequencing
revealed that three clones corresponded to uncharacterized genes, and
one clone corresponded to fibulin (data not shown). Clone SH1
corresponded to the 127-kDa subunit of the DDB activity (12,
28). A comparison of DNA sequences from the 5' and 3' ends of
clone SH1 with DDB1 (p125DDB) is shown in Fig. 1B. The 5' end of clone
SH1 corresponded to the coding region of p125DDB, whereas the 3' end of
SH1 corresponded to the 3' end of p125DDB. Because that was the only
clone that corresponded to a 127-kDa protein, we carried out a detailed
analysis of the DDB activity for its ability to interact with E2F1.

View larger version (21K):
[in this window]
[in a new window]

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Identification of HeLa nuclear proteins that
associate with the activation domain of E2F1. HeLa nuclear extracts
(0.2 g/30 ml) were incubated with GSH-Sepharose beads (0.5 ml)
containing 5 mg of either GST alone or GST fused with the activation
domain of E2F1 [GST-E2F1(363-437)] as described in Materials and
Methods. After a wash, the bound proteins were eluted with 0.5 ml of
buffer containing 1% SDS. Fifty microliters of the eluted material was
subjected to SDS-8% polyacrylamide gel electrophoresis
followed by staining with silver reagents. Results from a typical
experiment are shown. Bands indicated with arrows were seen more
reproducibly than the others. (B) The 5' and 3' ends of clone SH1 are
homologous to DDB1, which encodes the 127-kDa subunit of DDB(p125DDB).
A comparison of DNA sequences from the 5' and the 3' ends of clone SH1
with the sequences of DDB1 cDNA is shown. Numbers represent nucleotide
positions in DDB1 cDNA.
|
|
First, we assayed for the presence of the DDB activity in the E2F1
affinity-selected protein fractions from HeLa nuclear extract. A
specific gel retardation assay for DDB described by Hwang and Chu was
used (27). Briefly, a 148-bp DNA fragment derived from the
bacterial CAT gene cDNA was labeled in the presence of
[
-32P]dATP and Klenow enzyme. The labeled DNA was
subjected to UV irradiation (10,000 J/m2). The
UV-irradiated, labeled DNA was used as a probe in a gel retardation
assay as described in Materials and Methods. GST-E2F1 bound to
GSH-Sepharose beads was incubated with HeLa nuclear extracts. After a
thorough wash of the beads with buffer containing 20 mM Tris · HCl, 150 mM NaCl, 0.5% NP-40, and 1 mM EDTA, the bound proteins were
eluted with the same buffer containing 1 M KCl. An aliquot of the
protein fraction bound to GST-E2F1 or GST alone was analyzed for the
presence of DDB. We observed that a significant part of the DDB
activity in the loading material (approximately 30%) was specifically
retained by the GST-E2F1-containing beads (Fig.
2, left panel). The GST beads, on the
other hand, did not retain any detectable amount of DDB. Consistent
with a previous report (27), we observed two gel-shifted
complexes of DDB, which were specifically competed by UV-irradiated
DNA. To further investigate whether the binding involved the activation
domain of E2F1, binding of DDB to C-terminal deletion mutants was
compared. The activation domain of E2F1 has been mapped to residues 363 to 437 (21, 31). We observed that a deletion mutant lacking
the activation domain [E2F1(1-363)] was severely impaired in binding
to DDB (Fig. 2, left panel). Moreover, a fusion protein containing the
activation domain alone was able to bind DDB (Fig. 2, right panel),
suggesting that the activation domain is involved in binding to DDB.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
DDB associates with the activation domain of E2F1. GST
fusion proteins (200 µg) containing full-length E2F1 (GST-E2F1), a
mutant E2F1 [GST-E2F1(1-363)] harboring a C-terminal deletion that
deletes the activation domain, or a mutant E2F1 containing only the
activation domain [GST-E2F1(363-437)] were immobilized onto
GSH-Sepharose beads. Beads containing the E2F1 proteins were incubated
with HeLa nuclear extracts (Nuc. Ext.; 0.1 mg) for 30 min at 4°C.
Beads were collected by centrifugation and extensively washed with
buffer containing 150 mM NaCl, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, and
0.5% NP-40. The bound proteins were eluted with buffer containing 1 M
KCl. An aliquot of the eluted material was subjected to a DDB assay as
described in Materials and Methods. Where indicated, unlabeled probe
DNA (20 ng) before (Non-UV Comp.) or after (UV Comp.) UV treatment was
included in the reaction mixtures. Numbers above lanes in the right
panel represent assays of subsequent elutions.
|
|
The DDB activity was shown to purify with two polypeptides: a 41-kDa
(p48DDB) and a 127-kDa (p125DDB) polypeptide (12, 28, 33,
43). pCDNA3 clones containing the cDNAs corresponding to the two
polypeptides were used to obtain 35S-labeled proteins in
reticulocyte lysates. The 35S-labeled p48DDB and p125DDB
proteins were used to assay for their ability to bind GST fusion
proteins containing E2F1 or two C-terminal deletion mutants of E2F1 in
GST pull-down assays. As can be seen in Fig.
3, the p48DDB subunit quantitatively
bound to E2F1, whereas only a trace of p125DDB bound to E2F1 under the
assay conditions. Moreover, it was clear that the binding of p48DDB to
E2F1 depended upon the activation domain of E2F1, because the
C-terminal mutant [E2F1(1-363)] lacking the activation domain failed
to bind p48DDB (Fig. 3B).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
The recombinant p48 subunit of DDB associates with the
activation domain of E2F1. The p48 and the p125 subunits of DDB were
transcribed and translated in vitro by using T7 RNA polymerase and
reticulocyte lysate. The translation was performed in the presence of
[35S]methionine. The translated products (2 µl) were
incubated with 1 µg of the indicated GST fusion proteins containing
full-length E2F1 (A) or C-terminal deletions (B). GSH-Sepharose beads
(10 µl) were added to each of the incubation mixtures, followed by
incubation on a nutator for 30 min at 4°C. The beads were collected
by centrifugation and were extensively washed with buffer NETN. The
bound proteins were eluted with SDS gel loading buffer and were
subjected to SDS-10% polyacrylamide gel electrophoresis
followed by autoradiography.
|
|
Because DDB activity, but not recombinant p125DDB, interacted with
E2F1, we wanted to confirm that p48DDB is indeed a part of DDB activity
and that it interacts with p125DDB. Bacterially produced recombinant
p48DDB and p125DDB were inactive in binding to UV-irradiated DNA (data
not shown). We investigated whether overexpression of p48DDB in
mammalian cells increases DDB activity in the cell extracts. An HA
epitope-tagged p48DDB was expressed in the NIH 3T3 mouse fibroblast
cell line. These cells contain a low level of endogenous DDB. Extracts
of the HA-p48DDB-transfected cells were assayed for DDB activity. A
plasmid expressing another HA-tagged protein, HA-hnRNP K, was used as a
control (39). Clearly, the extracts from the
HA-p48DDB-transfected cells contained a much higher level of DDB
activity (Fig. 4A). Moreover, addition of
a monoclonal antibody against HA in the DNA-binding reaction produced a
supershifted complex (Fig. 4A). To obtain further evidence, the
extracts of the transfected cells were also immunoprecipitated with HA
antibody. The immunoprecipitated proteins were released by incubation
with the HA-tagged peptide and were subjected to DDB assay. The
immunoprecipitates from HA-p48DDB-transfected cell extracts contained
DDB activity (Fig. 4B). These results are consistent with those of a
recent study by Nichols et al. (43), which demonstrated that
p48DDB is a part of DDB activity. To confirm that p48DDB interacts with
p125DDB, 35S-labeled p125DDB was incubated with bacterially
produced T7 epitope-tagged (57) p48DDB. A monoclonal
antibody against the T7 epitope coimmunoprecipitated 35S-labeled p125DDB from a mixture of T7-p48DDB and
35S-labeled p125DDB (Fig. 4C). These results are consistent
with those of previous studies which indicated that p48DDB and p125DDB are components of DDB activity (12, 28, 33, 43). Taken together, these results also suggest that the p48DDB subunit of DDB
interacts with the activation domain of E2F1. It is possible that
p125DDB interacts with E2F1 through p48DDB, and that could be the
reason why it was pulled down by GST-E2F1. However, we cannot rule out
the possibility that a posttranslationally modified p125DDB also
interacts with the activation domain of E2F1.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
p48DDB is a component of DDB activity. (A) NIH 3T3 cells
were transfected with plasmids expressing HA-tagged hnRNP K or p48DDB.
Extracts (10 µg) of the transfected cells were subjected to a DDB
assay as described in Materials and Methods. Where indicated, 1 µg of
a monoclonal antibody against HA (HA-ab) or T7 (Control-ab) was added
in the reaction mixture. (B) Extracts from NIH 3T3 cells transfected
with HA-p48DDB or HA-hnRNP K expression plasmid were immunoprecipitated
(IP) with a monoclonal antibody against HA. The immunoprecipitated
proteins were released by incubation with 1 mg of HA-tagged peptide/ml.
An aliquot of the released proteins was subjected to a DDB assay as
described in Materials and Methods. (C) 35S-labeled p125DDB
(without an epitope tag) was incubated with bacterially produced and
partially purified T7-tagged p48DDB (see Materials and Methods). The
incubation mixture was immunoprecipitated with a monoclonal antibody
against T7 epitope (T7-ab). The immunoprecipitated material was
analyzed by SDS-polyacrylamide gel electrophoresis and
autoradiography.
|
|
Evidence for an in vivo interaction between E2F1 and DDB.
To
obtain evidence for an in vivo interaction between DDB and E2F1, we
looked for a coimmunoprecipitation of E2F1 with p48DDB and p125DDB. The
coimmunoprecipitation experiments were performed with U2OS osteosarcoma
and C33A cervical-carcinoma cells. We obtained very similar results
with the two cell lines (data not shown). The data from U2OS cells are
shown. Cells were transfected with plasmids expressing HA-tagged E2F1
and T7 epitope-tagged subunits of DDB (p48DDB and p125DDB). The
extracts of the transfected cells were subjected to immunoprecipitation
with antibodies against the epitopes. In order to immunoprecipitate
p48DDB and p125DDB, an agarose-linked monoclonal antibody against the
T7 epitope (Novagen) that was further cross-linked as described in
Materials and Methods was used. The immunoprecipitates were washed and
eluted with SDS gel loading buffer as described in Materials and
Methods. The eluted proteins were subjected to a Western blot assay to
detect the presence of E2F1. The blot was probed with a monoclonal
antibody against E2F1. As can be seen in Fig.
5 (left panel), the T7 epitope antibody
specifically coprecipitated E2F1 from the extracts of cells expressing
T7-DDB. Extracts of cells expressing both subunits of DDB consistently
exhibited a higher level of coprecipitation of E2F1 than did extracts
of cells expressing the individual subunits of DDB. This was also
observed in the reciprocal experiment in which the extracts were
immunoprecipitated with the HA antibody to precipitate HA-E2F1. The HA
antibody was cross-linked to protein A-Sepharose beads as described in
Materials and Methods. A Western blot assay of the HA immunoprecipitate
with T7 antibody detected the presence of p48DDB only when the extracts
from cells expressing both subunits were used (Fig. 5, right panel). In
other experiments, we did detect coprecipitation of T7-p48DDB with HA
antibody from cells expressing HA-E2F1 and T7-p48DDB; however, that was
consistently much less compared to those extracts containing both
subunits of DDB (data not shown). It is also noteworthy that cells
expressing the T7 epitope-tagged p125DDB subunit alone exhibited
detectable coprecipitation of E2F1 with the T7 antibody (Fig. 5, left
panel). However, we were unable to detect coprecipitation of p125DDB
with the HA antibody in a reproducible manner. It is likely that the interaction of p125DDB is sensitive to the washing steps during immunoprecipitation. Nevertheless, the coimmunoprecipitation of p48DDB
with E2F1 provided evidence for an in vivo interaction between E2F1 and
DDB.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Coimmunoprecipitation of DDB with E2F1. U2OS cells were
transfected with a plasmid expressing HA-tagged E2F1 (4 µg) alone or
in combination with plasmids expressing T7-tagged p48DDB (4 µg),
p125DDB (8 µg), or a combination of the two. Extracts (0.5 mg) from
transfected cells were immunoprecipitated (IP) with T7 antibody (T7-ab)
covalently linked to agarose beads as described in Materials and
Methods. The immunoprecipitates were analyzed by Western blotting with
E2F1 antibody (E2F1-ab; left panel). Extracts (0.5 mg) were also
immunoprecipitated with HA antibody (HA-ab) covalently linked to
protein A-Sepharose beads. The precipitates obtained with HA antibody
were analyzed for the presence of DDB by using a Western blot assay and
the T7 antibody (right panel).
|
|
To obtain further evidence for an in vivo interaction between E2F1 and
DDB activity, we investigated copurification of the two during
fractionation of cell extracts. The procedure for purification of the
E2F-DNA binding activity from HeLa cell nuclear extracts has been
described before (68). Therefore, we fractionated HeLa nuclear extracts and looked for copurification of E2F1 and DDB. The
column fractions were assayed for DDB and E2F1 or E2F-DNA binding
activity. Extracts were subjected to heparin-agarose chromatography and
Q-Sepharose chromatography, and the columns were eluted with KCl
gradients (68). A significant part of the DDB activity
coeluted with the E2F-DNA binding activity from both columns (data not shown). Approximately 35% of the total DDB activity in the HeLa nuclear extracts was enriched in the Q-Sepharose fractions containing the E2F-DNA binding activity (data not shown). The Q-Sepharose-purified E2F-containing fractions were subjected to an E2F-specific DNA affinity
chromatography. E2Fs can be brought to a high degree of purity
(approximately 1,000-fold purification) by using E2F site-containing
DNA affinity columns (68). We generated two affinity resins:
one containing an oligomeric wild-type E2F-cognate element, and another
containing an oligomeric mutant E2F-cognate element. The monomeric
wild-type sequence corresponded to 40 bp between
30 and
70 of the
adenovirus E2 promoter (49), whereas the mutant contained
substitutions of the CGCG sequences within the E2F consensus with AAAA
in the same 40-bp DNA. The resins were prepared side by side, and care
was taken to avoid exposure to UV light. Because we planned to compare
binding, care was also taken to obtain approximately equal levels of
cross-linking to the activated Sepharose resin (see Materials and
Methods).
The Q-Sepharose fractions containing the bulk of the E2F activity were
pooled and dialyzed, and equal amounts were subjected to the two DNA
affinity columns. The columns were eluted successively by 0.1, 0.3, and
0.6 M KCl. The column fractions were assayed for E2F activity and DDB
activity. For each of the elutions, the bulk of the activities were
detected in one column volume. The fractions from each of the elutions
were pooled, and an assay is shown in Fig.
6. A gel retardation assay was used to
show the elution profile of the DDB activity from the two columns (Fig. 6, left panel), and a Western blot assay was used to show the elution
of E2F1 from the two columns (Fig. 6, right panel). As expected, a
significant portion of E2F1 in the loading material was specifically
eluted from the wild-type column during the 0.6 M KCl elution, even
after a five-column volume wash with buffer containing 0.3 M KCl. The
0.6 M eluate from the mutant column, on the other hand, contained very
little E2F1. Interestingly, DDB activity exhibited an elution profile
very similar to that of E2F1 from the wild-type E2F affinity column. As
was the case with E2F1, a significant part of the DDB activity was
eluted only during a 0.6 M KCl elution of the wild-type E2F
site-containing column. This result was reproduced by using affinity
resins made in three different batches (data not shown). Because we did
not detect any E2F site-specific DNA binding by DDB (data not shown), these results are consistent with the notion that the high-affinity binding of DDB to the wild-type E2F site-containing resin is due to its
interaction with E2F1. The 0.3 M eluate from the mutant E2F
site-containing column contained higher amounts of E2F1 than of DDB. It
is possible that nonspecific DNA binding by E2F1 destabilizes the
interaction between E2F1 and DDB during chromatography through the
mutant E2F column. This is not surprising, because nonspecific DNA
binding might alter conformation or involve regions of E2F1 that are
important for a stable interaction with DDB.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 6.
Copurification of DDB and E2F1 through an E2F-DNA
affinity column. HeLa nuclear extracts were fractionated through a
heparin-agarose and a Q-Sepharose column as described in Materials and
Methods (also in reference 68). The Q-Sepharose
fractions containing the E2F and DDB activities were subjected to
chromatography through a wild-type E2F-DNA or a mutant E2F-DNA
affinity column. The columns were eluted successively with 0.1 (Flow),
0.3, and 0.6 M KCl-containing buffer. Fractions from each elution that
were active for E2F-DNA binding activity were pooled. Aliquots of the
pooled fractions were assayed for DDB in gel retardation assays as
described in Materials and Methods (A). The fractions were also assayed
for E2F1 by a Western blot assay using a monoclonal antibody against
E2F1 (B). The blot was developed with enhanced chemiluminescence.
|
|
Expression of DDB specifically stimulates E2F1-activated
transcription and overcomes Rb inhibition of E2F1-activated
transcription.
In order to investigate the functional significance
of the interaction between E2F1 and DDB, the effect of DDB on
E2F1-activated transcription was studied. In order to avoid a negative
regulation of Rb, an Rb
/
cell line, C33A, was employed
to carry out the transcription studies. Several reporter CAT genes,
including one with a naturally occurring E2F1-regulated promoter, were
used (Fig. 7A). E2F1 is an autoregulated
gene, and it contains E2F1-binding sites near its transcription
initiation sites (26, 29). We observed that the expression
of DDB stimulated transcription from the E2F1 promoter (Fig. 7B). The
simian virus 40 early promoter and a Gal4 site-containing promoter were
unaffected by the expression of DDB under similar assay conditions
(Fig. 7B). Consistent with the findings of previous studies (26,
29), expression of E2F1 stimulated transcription from the E2F1
promoter-containing reporter gene (Fig. 7B). In addition, coexpression
of Rb reduced the E2F1-activated transcription of this reporter gene
(Fig. 7B). More interestingly, we observed that the coexpression of DDB
with E2F1 reproducibly produced much greater stimulation of the E2F1
site-containing reporter gene. The extent of stimulation obtained by
the simultaneous expression of E2F1 and DDB (16- to 18-fold) was
consistently greater than what was expected from an additive effect (5- and 6-fold), suggesting that E2F1 and DDB could cooperate to stimulate
transcription from an E2F1-regulated promoter.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
DDB cooperates with E2F1 to stimulate transcription from
E2F1-regulated promoters and overcomes Rb inhibition. (A) Schematic
diagram of the reporter genes used in transcription studies. E2F1-CAT
and FC( 58)/E2F-CAT contain E2F-binding sites in their promoter
regions. (B) C33A cells were transfected with the indicated reporter
genes (5 µg). Where indicated, the transfection mixture also
contained plasmids expressing E2F1 (0.5 µg), the DDB subunits (5 µg
each), a combination of E2F1 (0.5 µg) and DDB (5 µg each), or
Gal4-HNF3 (1 µg). A plasmid expressing the Rb gene (2 µg) was also
included in the indicated transfection mixtures. DNA transfection was
carried out by the Ca-phosphate precipitation method as described in
Materials and Methods. A plasmid expressing -galactosidase was
included to control for the transfection efficiencies. Averages of fold
activation of the CAT gene activity from three independent experiments
are shown. (C) C33A cells were transfected with the indicated CAT
reporter genes [FC( 58)/E2F-CAT or FC( 58)/CRE-CAT] (1 µg) along
with plasmids expressing E2F1 (0.25 µg) alone, DDB (2 µg each)
alone, or a combination of E2F1 (0.25 µg) and DDB (2 µg each). A
plasmid expressing -galactosidase was included to control for the
transfection efficiencies. Averages of fold activation of the CAT gene
activity from three independent experiments are shown. SV40, simian
virus 40.
|
|
The cooperation between E2F1 and DDB was also observed in studies with
a chimeric promoter, FC(
58)/E2F, that contains E2F sites as the only
upstream elements (39). This promoter is much weaker than
the E2F1 promoter, and expression of E2F1 or DDB alone had very little
effect (Fig. 7C). However, coexpression of E2F1 and DDB caused a
significant stimulation of transcription (Fig. 7C). The stimulatory
effect is not nonspecific, because a comparable promoter containing CRE
sites instead of E2F sites was not stimulated by the coexpression of
E2F1 and DDB. The C-terminal activation domain of E2F1 has been shown
to be involved in the degradation of E2F1 by the ubiquitin-proteasome
pathway (25). Because DDB binds to this activation domain,
the transcriptional stimulatory effect could be a result of
stabilization of the E2F1 protein. Although we cannot rule out a
stabilization effect of DDB, we were unable to detect any significant
alteration of the steady-state level of the E2F1 protein by the
coexpression of DDB (data not shown).
DDB, like Rb, interacts with the activation domain of E2F1. Therefore,
we investigated the effects of coexpression of DDB on Rb inhibition.
Expression of Rb inhibited E2F1-activated transcription from the
E2F1-CAT reporter gene (Fig. 7B). Coexpression of DDB efficiently
overcame the Rb repression of E2F1-activated transcription (Fig. 7B),
suggesting the possibility that Rb and DDB compete for overlapping
sites within the activation domain of E2F1. DDB, E2F1, and Rb proteins
were expressed by using the cytomegalovirus promoter, and expression of
DDB did not alter the steady-state levels of E2F1 and Rb (data not
shown).
To confirm that the transcriptional stimulatory activity of DDB depends
on an interaction with the activation domain of E2F1, we used Gal4
fusion constructs containing E2F1 or E2F1 mutants harboring deletions
in the C-terminal activation domain and a reporter CAT gene containing
five Gal4-binding sites (Fig. 8A). The
DNA transfection mixtures also contained a plasmid that expresses
-galactosidase to control for the transfection efficiencies. Averages of the transfection results from six independent experiments are summarized in Fig. 8B. As reported by others (47),
transcriptional activation by E2F1 was dependent upon the activation
domain in the C-terminal region. The construct Gal4-E2F1(1-363)
exhibited reduced transcriptional stimulatory activity compared to the
wild-type E2F1 construct (Fig. 8B). More interestingly, coexpression of p48DDB and p125DDB reproducibly stimulated transcription activated by
the wild-type and the E2F1(1-417) constructs. The extent of stimulation
varied between three- and fivefold and was reproducible. To see whether
the activation domain of E2F1 alone could support the stimulatory
effects of DDB, a Gal4 fusion construct [Gal4-E2F1(363-437)] containing the E2F1 residues between 363 and 437 was also analyzed in
transfection assays. A Gal4-HNF3 construct was used as a control for
specificity. Coexpression of DDB resulted in stimulation of transcription driven by the Gal4-E2F1(363-437) fusion protein but not
in stimulation of transcription driven by the Gal4-HNF3 fusion protein
(Fig. 8C). Coexpression of any one subunit of DDB had no reproducible
effect. Moreover, expression of a fusion protein of Gal4-p48DDB in
conjunction with p125DDB had no detectable effect on the reporter gene
containing Gal4-binding sites (data not shown), suggesting that DDB
needs to interact with the E2F1 activation domain in order to carry out
its stimulatory function. Taken together, these results clearly suggest
a role of DDB in the transcriptional-activation function of E2F1.

View larger version (17K):
[in this window]
[in a new window]

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 8.
Transcriptional stimulatory function of DDB depends upon
an interaction with the activation domain of E2F1. (A) Schematic
diagram of the Gal4 fusion constructs and the Gal4 site-containing gene
used in transfection studies. (B) A plasmid (0.5 µg) expressing Gal4
fused with wild-type E2F1 or with one of the indicated C-terminal
deletion mutants was cotransfected with DDB expression constructs (5 µg of each of the plasmids expressing p48DDB and p125DDB) and the
Gal4-binding site-containing reporter gene (5 µg) into C33A cells by
using the Ca-phosphate precipitation method as described in Materials
and Methods. A plasmid expressing -galactosidase was included to
control for the transfection efficiencies. The CAT gene activity was
measured by a previously described procedure, and the results were
normalized on the basis of the -galactosidase values. Averages of
fold activation from six independent experiments are shown. (C) A
plasmid (1 µg) expressing Gal4 fused with the E2F1 activation domain
[Gal4-E2F1(363-437)] or the transcription factor HNF3 (Gal4-HNF3) was
transfected into C33A cells along with the indicated amounts of the DDB
expression plasmids and the Gal4 site-containing reporter genes. A
plasmid expressing -galactosidase was included to control for the
transfection efficiencies. Averages of fold activation of the
normalized CAT gene activity from six independent experiments are
shown.
|
|
 |
DISCUSSION |
The transcriptional-activation function of E2F1 is important for
the expression of several genes that are essential for DNA replication
and cell cycle progression (8, 42, 44, 56). The activation
domain of E2F1 is also a target of the tumor suppressor Rb (15,
20). Therefore, analysis of the protein partners of the E2F1
activation domain will be important in understanding the mechanism by
which E2F1 stimulates the expression of cell cycle-regulated genes.
Moreover, these studies will potentially provide further insights into
the mechanism of Rb repression. To this end, we have shown that DDB
protein interacts with the activation domain of E2F1 and stimulates
E2F1-activated transcription.
DDB was identified as an activity that binds UV-damaged DNA. UV
irradiation causes formation of cyclobutane dimers in pyrimidines within DNA. In normal human cells, these dimers are efficiently removed
and repaired. Patients suffering from xeroderma pigmentosum are
deficient in repairing the damage induced by UV irradiation. The
deficiency arises from defects in the enzymes involved in the DNA
repair process. Several complementation groups of xeroderma pigmentosum
(XP) have been characterized. Two groups identified DDB activity as a
potential candidate for the complementation group XP-E because 20% of
XP-E patients were found to lack DDB activity (7). Moreover,
microinjections of purified DDB protein could complement the repair
defect in cells lacking DDB activity (34). However, these
results were contradicted by another study which indicated that the
replication factor RP-A complements in vitro repair deficiencies of
XP-E patients (32). Experiments carried out in this study
raised questions about any role of DDB activity in the nucleotide
excision repair process (32). p48DDB and p125DDB were found
in highly purified preparations of DDB activity from HeLa cell extracts
(12, 28, 33, 43). However, it is not clear whether these two
proteins are sufficient for the activity because the recombinant
proteins, made in bacteria or synthesized in vitro, are inactive in
binding to UV-damaged DNA (data not shown). Consistent with the
observation of Nichols et al. (43), we observed that
expression of p48DDB or p125DDB in mammalian cells resulted in an
increase in DDB activity (Fig. 4 and data not shown). Moreover, we
observed evidence for an interaction between p48DDB and p125DDB (Fig.
4). Thus, this study also confirmed the notion that p48DDB and p125DDB
are components of DDB activity. E2F1 is not an essential component of
the DDB activity because purification of DDB from HeLa nuclear extracts
through a damaged-DNA affinity column produced active DDB that is free
of E2F1 (data not shown).
We observed that DDB activity, as well as the p48DDB subunit of DDB
activity, could interact with the activation domain of E2F1. p48DDB is
interesting because it possesses an extensive sequence homology with a
48-kDa Rb-binding protein (46), which is also a subunit of
the chromatin assembly factor CAF-1 (62). p48DDB, like the
48-kDa Rb-binding protein, contains the WD motif (data not shown)
(Protein Motifs database), which has been shown to be involved in
protein-protein interaction (36). Thus, it is not surprising
that the p48DDB subunit of DDB activity is able to interact with E2F1.
The homology with the 48-kDa subunit of the chromatin assembly factor
CAF-1 may also reflect a role for p48DDB in altering chromatin
structure, which might be important in the mechanism by which DDB
protein stimulates E2F1-activated transcription.
p48DDB and p125DDB were the only proteins that copurified with DDB
activity (12, 28, 33, 43). Therefore, it is likely that
these proteins are involved in repairing UV-damaged DNA. The
observation that these putative repair proteins associate with the
activation domain of E2F1 and stimulate E2F1-activated transcription is
not without precedence because there are examples of repair proteins
playing a role in RNA polymerase II transcription. For example, the
basal transcription factor TFIIH has been shown to copurify with the
repair proteins ERCC2 (XPD-complementing activity) and ERCC3
(XPB-complementing activity) (10, 11, 14, 16, 51, 52, 58,
63). ERCC2 and ERCC3 possess DNA helicase activity and are
believed to be involved in nucleotide excision repair (10, 11, 16,
17, 19, 51). These proteins were also shown to be functional
subunits of the transcription factor TFIIH because addition of specific
antibodies against these DNA repair proteins inhibited activity of
TFIIH in mRNA transcription (10). These observations are
also consistent with the fact that transcriptionally active genes are
repaired more efficiently than inactive genes (19). Cells
from patients suffering from the hereditary disease Cockayne syndrome
are defective in the repair of transcriptionally active genes
(references 23 and 51 and references therein). Interestingly, the Cockayne syndrome genes, CS-A
and CS-B, have been shown to encode for proteins that might be involved
in RNA polymerase II transcription (23). In this context it
is noteworthy that p125DDB was also shown to interact with the
hepatitis B virus X transcriptional-transactivator protein (40).
The interactions of putative repair proteins with the activation domain
of E2F1 is also interesting in light of the observation that this
transcription factor is involved in the expression of genes essential
for DNA replication and cell division (8, 42, 44, 56).
Several of these genes, such as dhfr and c-myc,
have been shown to be efficiently repaired after DNA damage by UV
irradiation (45, 48, 59). And survival of mammalian cells
after UV irradiation correlates with the repair of these essential
genes (5). Moreover, for the dhfr gene (which is
an E2F1-regulated gene), it was shown that the transcribed strand is
repaired more efficiently than the nontranscribed strand
(48). It is therefore tempting to speculate that E2F1
recruits DDB to carry out two functions: repairing of the template DNA
and activation of transcription. It is possible that during initiation
E2F1 recruits DDB, which becomes a part of the elongation complex, and
that once a damage site is encountered, DDB stimulates assembly of
repair complexes. Clearly, further studies will be required to test
this hypothesis.
It is also possible that DDB activity plays a regulatory role in
UV-damaged cells. It was shown that cells exposed to UV irradiation are
arrested at G1 phase (reference 35 and
references therein). It is possible that DDB plays a role in this
UV-induced growth arrest. Damaged DNA might sequester DDB and make it
unavailable for the E2F1-activated transcription. This would reduce
expression of genes necessary for progression through the S phase. It
is generally believed that p53 plays a major role in growth arrest induced by UV irradiation (35, 64). p53-mediated growth
arrest involves an increased synthesis of p21Cip1 followed by
accumulation of the underphosphorylated, active Rb (35). The
active form of Rb generates repressor complexes with the E2F family
factors, which would shut down expression of genes necessary for
progression into S phase. Other regulatory mechanisms may be present to
control the activity of the transcriptional partner of the E2F family of factors. Sequestration of an essential partner by damaged DNA itself
would be an extremely efficient regulation in this regard.
We thank Stuart Linn (University of California, Berkeley) and
Gilbert Chu (Stanford University) for the DDB cDNA clones. We also
thank W. Kaelin, Jr. (Dana-Farber Cancer Institute) for the Gal4-E2F1
constructs and R. Costa (University of Illinois at Chicago) for the
Gal4-HNF3 construct. The E2F1-CAT reporter gene plasmid was a kind gift
of J. R. Nevins (Howard Hughes Medical Institute, Duke University
Medical Center). We are also grateful to D. M. Livingston
(Dana-Farber Cancer Institute) for the E2F1-cDNA.
This work was supported by a grant from the American Cancer Society
(ACS BE-219A) to P.R.
| 1.
|
Arroyo, M., and P. Raychaudhuri.
1992.
Retinoblastoma-repression of E2F-dependent transcription depends on the ability of the retinoblastoma protein to interact with E2F and is abrogated by the adenovirus E1A oncoprotein.
Nucleic Acids Res.
20:5947-5954[Abstract/Free Full Text].
|
| 2.
|
Asano, M.,
J. R. Nevins, and R. P. Wharton.
1996.
Ectopic E2F expression induces S phase and apoptosis in Drosophila imaginal discs.
Genes Dev.
10:1422-1432[Abstract/Free Full Text].
|
| 3.
|
Bandara, L. R.,
E. W. Lam,
T. S. Sorensen,
M. Zamanian,
R. Girling, and N. B. La Thangue.
1994.
DP-1: a cell cycle-regulated and phosphorylated component of transcription factor DRTF1/E2F which is functionally important for recognition by pRb and the adenovirus E4 orf 6/7 protein.
EMBO J.
13:3104-3114[Medline].
|
| 4.
|
Blake, M., and J. C. Azizkhan.
1989.
Transcription factor E2F is required for efficient expression of the hamster dihydrofolate reductase gene in vitro and in vivo.
Mol. Cell. Biol.
9:4994-5002[Abstract/Free Full Text].
|
| 5.
|
Bohr, V. A.,
D. S. Okumoto, and P. C. Hanawalt.
1986.
Survival of UV-irradiated mammalian cells correlates with efficient DNA repair in an essential gene.
Proc. Natl. Acad. Sci. USA
83:3830-3833[Abstract/Free Full Text].
|
| 6.
|
Chellappan, S. P.,
S. Hiebert,
M. Mudryj,
J. M. Horowitz, and J. R. Nevins.
1991.
The E2F transcription factor is a cellular target for the RB protein.
Cell
65:1053-1061[Medline].
|
| 7.
|
Chu, G., and E. Chang.
1988.
Xeroderma pigmentosum group E cells lack a nuclear factor that binds to damaged DNA.
Science
242:564-567[Abstract/Free Full Text].
|
| 8.
|
DeGregori, J.,
T. Kowalik, and J. R. Nevins.
1995.
Cellular targets for activation by the E2F1 transcription factor include DNA synthesis- and G1/S-regulatory genes.
Mol. Cell. Biol.
15:4215-4224[Abstract].
|
| 9.
|
Dignam, J. D.,
R. M. Lebovitz, and R. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 10.
|
Drapkin, R.,
J. T. Reardon,
A. Ansari,
J. C. Huang,
L. Zawel,
K. Ahn,
A. Sancar, and D. Reinberg.
1994.
Dual role of TFIIH in DNA excision repair and in transcription by RNA polymerase II.
Nature
368:769-772[Medline].
|
| 11.
|
Drapkin, R.,
A. Sancar, and D. Reinberg.
1994.
Where transcription meets repair.
Cell
77:9-12[Medline].
|
| 12.
|
Dualan, R.,
T. Brody,
S. Keeney,
A. F. Nichols,
A. Admon, and S. Linn.
1995.
Chromosomal localization and cDNA cloning of the genes (DDB1 and DDB2) for the p127 and p48 subunits of a human damage-specific DNA binding protein.
Genomics
29:62-69[Medline].
|
| 13.
|
Dynlacht, B. D.,
O. Flores,
J. A. Lees, and E. Harlow.
1994.
Differential regulation of E2F transactivation by cyclin/cdk2 complexes.
Genes Dev.
8:1772-1786[Abstract/Free Full Text].
|
| 14.
|
Feaver, W. J.,
J. Q. Svejstrup,
L. Bardwell,
A. J. Bardwell,
S. Buratowski,
K. D. Gulyas,
T. F. Donahue,
E. C. Friedberg, and R. D. Kornberg.
1993.
Dual roles of a multiprotein complex from S. cerevisiae in transcription and DNA repair.
Cell
75:1379-1387[Medline].
|
| 15.
|
Flemington, E. K.,
S. H. Speck, and W. G. Kaelin, Jr.
1993.
E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product.
Proc. Natl. Acad. Sci. USA
90:6914-6918[Abstract/Free Full Text].
|
| 16.
|
Friedberg, E. C.
1996.
Relationships between DNA repair and transcription.
Annu. Rev. Biochem.
65:15-42[Medline].
|
| 17.
|
Habraken, Y.,
P. Sung,
S. Prakash, and L. Prakash.
1996.
Transcription factor TFIIH and DNA endonuclease Rad2 constitute yeast nucleotide excision repair factor 3: implications for nucleotide excision repair and Cockayne syndrome.
Proc. Natl. Acad. Sci. USA
93:10718-10722[Abstract/Free Full Text].
|
| 18.
|
Hagemeier, C.,
A. Cook, and T. Kouzarides.
1993.
The retinoblastoma protein binds E2F residues required for activation in vivo and TBP binding in vitro.
Nucleic Acids Res.
21:4998-5004[Abstract/Free Full Text].
|
| 19.
|
Hanawalt, P. C.
1994.
Transcription-coupled repair and human disease.
Science
266:1957-1958[Free Full Text].
|
| 20.
|
Helin, K.,
E. Harlow, and A. Fattaey.
1993.
Inhibition of E2F-1 transactivation by direct binding of the retinoblastoma protein.
Mol. Cell. Biol.
13:6501-6508[Abstract/Free Full Text].
|
| 21.
|
Helin, K.,
J. A. Lees,
M. Vidal,
N. Dyson,
E. Harlow, and A. Fattaey.
1992.
A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F.
Cell
70:337-350[Medline].
|
| 22.
|
Helin, K.,
C. L. Wu,
A. R. Fattaey,
J. A. Lees,
B. D. Dynlacht,
C. Ngwu, and E. Harlow.
1993.
Heterodimerization of the transcription factors E2F-1 and DP-1 leads to cooperative trans-activation.
Genes Dev.
7:1850-1861[Abstract/Free Full Text].
|
| 23.
|
Henning, K. A.,
L. Li,
N. Iyer,
L. D. McDaniel,
M. S. Reagan,
R. Legerski,
R. A. Schultz,
M. Stefanini,
A. R. Lehmann,
L. V. Mayne, and E. C. Friedberg.
1995.
The Cockayne syndrome group A gene encodes a WD repeat protein that interacts with CSB protein and a subunit of RNA polymerase II TFIIH.
Cell
82:555-564[Medline].
|
| 24.
|
Hiebert, S. W.,
S. P. Chellappan,
J. M. Horowitz, and J. R. Nevins.
1992.
The interaction of RB with E2F coincides with an inhibition of the transcriptional activity of E2F.
Genes Dev.
6:177-185[Abstract/Free Full Text].
|
| 25.
|
Hofmann, F.,
F. Martelli,
D. M. Livingston, and Z. Wang.
1996.
The retinoblastoma gene product protects E2F1 from degradation by the ubiquitin-proteasome pathway.
Genes Dev.
10:2949-2959[Abstract/Free Full Text].
|
| 26.
|
Hsiao, K. M.,
S. L. McMahon, and P. J. Farnham.
1994.
Multiple DNA elements are required for the growth regulation of the mouse E2F1 promoter.
Genes Dev.
8:1526-1537[Abstract/Free Full Text].
|
| 27.
|
Hwang, B. J., and G. Chu.
1993.
Purification and characterization of a human protein that binds to damaged DNA.
Biochemistry
32:1657-1666[Medline].
|
| 28.
|
Hwang, B. J.,
J. C. Liao, and G. Chu.
1996.
Isolation of a cDNA encoding a UV-damaged DNA binding factor defective in xeroderma pigmentosum group E cells.
Mutat. Res.
362:105-117[Medline].
|
| 29.
|
Johnson, D. G.,
K. Ohtani, and J. R. Nevins.
1994.
Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression.
Genes Dev.
8:1514-1525[Abstract/Free Full Text].
|
| 30.
|
Johnson, D. G.,
J. K. Schwarz,
W. D. Cress, and J. R. Nevins.
1993.
Expression of transcription factor E2F1 induces quiescent cells to enter S phase.
Nature
365:349-352[Medline].
|
| 31.
|
Kaelin, W. G., Jr.,
W. Krek,
W. R. Sellers,
J. A. DeCaprio,
F. Ajchenbaum,
C. S. Fuchs,
T. Chittenden,
Y. Li,
P. J. Farnham,
M. A. Blanar, et al.
1992.
Expression cloning of a cDNA encoding a retinoblastoma-binding protein with E2F-like properties.
Cell
70:351-364[Medline].
|
| 32.
|
Kazantsev, A.,
D. Mu,
A. F. Nichols,
X. Zhao,
S. Linn, and A. Sancar.
1996.
Functional complementation of xeroderma pigmentosum complementation group E by replication protein A in an in vitro system.
Proc. Natl. Acad. Sci. USA
93:5014-5018[Abstract/Free Full Text].
|
| 33.
|
Keeney, S.,
G. J. Chang, and S. Linn.
1993.
Characterization of a human DNA damage binding protein implicated in xeroderma pigmentosum E.
J. Biol. Chem.
268:21293-21300[Abstract/Free Full Text].
|
| 34.
|
Keeney, S.,
A. P. Eker,
T. Brody,
W. Vermeulen,
D. Bootsma,
J. H. Hoeijmakers, and S. Linn.
1994.
Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein.
Proc. Natl. Acad. Sci. USA
91:4053-4056[Abstract/Free Full Text].
|
| 35.
|
Ko, L. J., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-1072[Free Full Text].
|
| 36.
|
Komachi, K.,
M. J. Redd, and A. D. Johnson.
1994.
The WD repeats of Tup1 interact with the homeo domain protein alpha 2.
Genes Dev.
8:2857-2867[Abstract/Free Full Text].
|
| 37.
|
Krek, W.,
M. E. Ewen,
S. Shirodkar,
Z. Arany,
W. G. Kaelin, Jr., and D. M. Livingston.
1994.
Negative regulation of the growth-promoting transcription factor E2F-1 by a stably bound cyclin A-dependent protein kinase.
Cell
78:161-172[Medline].
|
| 38.
|
Krek, W.,
G. Xu, and D. M. Livingston.
1995.
Cyclin A-kinase regulation of E2F-1 DNA binding function underlies suppression of an S phase checkpoint.
Cell
83:1149-1158[Medline].
|
| 39.
|
Lee, M. H.,
S. Mori, and P. Raychaudhuri.
1996.
trans-Activation by the hnRNP K protein involves an increase in RNA synthesis from the reporter genes.
J. Biol. Chem.
271:3420-3427[Abstract/Free Full Text].
|
| 40.
|
Lee, T. H.,
S. J. Elledge, and J. S. Butel.
1995.
Hepatitis B virus X protein interacts with a probable cellular DNA repair protein.
J. Virol.
69:1107-1114[Abstract].
|
| 41.
|
Morosov, A.,
W. C. Phelps, and P. Raychaudhuri.
1994.
Activation of the c-fos gene by the HPV16 oncoproteins depends upon the cAMP-response element at 60.
J. Biol. Chem.
269:18434-18440[Abstract/Free Full Text].
|
| 42.
|
Nevins, J. R.
1992.
A link between the Rb tumor suppressor protein and viral oncoproteins.
Science
258:424-429[Abstract/Free Full Text].
|
| 43.
|
Nichols, A. F.,
P. Ong, and S. Linn.
1996.
Mutations specific to the xeroderma pigmentosum group E Ddb phenotype.
J. Biol. Chem.
271:24317-24320[Abstract/Free Full Text].
|
| 44.
|
Ohtani, K.,
J. DeGregori, and J. R. Nevins.
1995.
Regulation of the cyclin E gene by transcription factor E2F1.
Proc. Natl. Acad. Sci. USA
92:12146-12150[Abstract/Free Full Text].
|
| 45.
|
Petersen, L. N.,
D. K. Orren, and V. A. Bohr.
1995.
Gene-specific and strand-specific DNA repair in the G1 and G2 phases of the cell cycle.
Mol. Cell. Biol.
15:3731-3737[Abstract].
|
| 46.
|
Qian, Y.-W.,
Y.-C. J. Wang,
R. E. J. Hollinsworth,
D. Jones,
N. Ling, and E. Y.-H. P. Lee.
1993.
A retinoblastoma-binding protein related to a negative regulator of Ras in yeast.
Nature
364:648-652[Medline].
|
| 47.
|
Qin, X. Q.,
D. M. Livingston,
M. Ewen,
W. R. Sellers,
Z. Arany, and W. G. Kaelin, Jr.
1995.
The transcription factor E2F-1 is a downstream target of RB action.
Mol. Cell. Biol.
15:742-755[Abstract].
|
| 48.
|
Rampino, N. J., and V. A. Bohr.
1994.
Rapid gene-specific repair of cisplatin lesions at the human DUG/DHFR locus comprising the divergent upstream gene and dihydrofolate reductase gene during early G1 phase of the cell cycle assayed by using the exonucleolytic activity of T4 DNA polymerase.
Proc. Natl. Acad. Sci. USA
91:10977-10981[Abstract/Free Full Text]. (Erratum, 92:5249, 1995.)
|
| 49.
|
Raychaudhuri, P.,
S. Bagchi,
S. D. Neill, and J. R. Nevins.
1990.
Activation of the E2F transcription factor in adenovirus-infected cells involves E1A-dependent stimulation of DNA-binding activity and induction of cooperative binding mediated by an E4 gene product.
J. Virol.
64:2702-2710[Abstract/Free Full Text].
|
| 50.
|
Reardon, J. T.,
A. F. Nichols,
S. Keeney,
C. A. Smith,
J. S. Taylor,
S. Linn, and A. Sancar.
1993.
Comparative analysis of binding of human damaged DNA-binding protein (XPE) and Escherichia coli damage recognition protein (UvrA) to the major ultraviolet photoproducts: T[c,s]T, T[t,s]T, T[6-4]T, and T[Dewar]T.
J. Biol. Chem.
268:21301-21308[Abstract/Free Full Text].
|
| 50a.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 51.
|
Sancar, A.
1996.
DNA excision repair.
Annu. Rev. Biochem.
65:43-81[Medline].
|
| 52.
|
Schaeffer, L.,
R. Roy,
S. Humbert,
V. Moncollin,
W. Vermeulen,
J. H. Hoeijmakers,
P. Chambon, and J. M. Egly.
1993.
DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor.
Science
260:58-63[Abstract/Free Full Text].
|
| 53.
|
Seed, B., and J. Y. Sheen.
1988.
A simple phase-extraction assay for chloramphenicol acetyltransferase activity.
Gene
67:271-277[Medline].
|
| 54.
|
Sellers, W. R.,
J. W. Rodgers, and W. G. Kaelin, Jr.
1995.
A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites.
Proc. Natl. Acad. Sci. USA
92:11544-11548[Abstract/Free Full Text].
|
| 55.
|
Shiyanov, P.,
S. Bagchi,
G. Adami,
J. Kokontis,
N. Hay,
M. Arroyo,
A. Morozov, and P. Raychaudhuri.
1996.
p21 disrupts the interaction between cdk2 and the E2F-p130 complex.
Mol. Cell. Biol.
16:737-744[Abstract].
|
| 56.
|
Slansky, J. E.,
Y. Li,
W. G. Kaelin, and P. J. Farnham.
1993.
A protein synthesis-dependent increase in E2F1 mRNA correlates with growth regulation of the dihydrofolate reductase promoter.
Mol. Cell. Biol.
13:1610-1618[Abstract/Free Full Text]. (Erratum, 13:7201.)
|
| 57.
|
Studier, F. W., and A. H. Rosenberg.
1981.
Genetic and physical mapping of the late region of bacteriophage T7 DNA by use of cloned fragments of T7 DNA.
J. Mol. Biol.
153:503-525[Medline].
|
| 58.
|
Svejstrup, J. Q.,
Z. Wang,
W. J. Feaver,
X. Wu,
D. A. Bushnell,
T. F. Donahue,
E. C. Friedberg, and R. D. Kornberg.
1995.
Different forms of TFIIH for transcription and DNA repair: holo-TFIIH and a nucleotide excision repairosome.
Cell
80:21-82[Medline].
|
| 59.
|
Tang, M. S.,
A. Pao, and X. S. Zhang.
1994.
Repair of benzo(a)pyrene diol epoxide- and UV-induced DNA damage in dihydrofolate reductase and adenine phosphoribosyltransferase genes of CHO cells.
J. Biol. Chem.
269:12749-12754[Abstract/Free Full Text].
|
| 60.
|
Trouche, D., and T. Kouzarides.
1996.
E2F1 and E1A(12S) have a homologous activation domain regulated by RB and CBP.
Proc. Natl. Acad. Sci. USA
93:1439-1442[Abstract/Free Full Text].
|
| 61.
|
van Assendelft, G. B.,
E. M. Rigney, and I. D. Hickson.
1993.
Purification of a HeLa cell nuclear protein that binds selectively to DNA irradiated with ultra-violet light.
Nucleic Acids Res.
21:3399-3404[Abstract/Free Full Text].
|
| 62.
|
Verreault, A.,
P. D. Kaufman,
R. Kobayashi, and B. Stillman.
1996.
Nucleosome assembly by a complex of CAF-1 and acetylated histones H3/H4.
Cell
87:95-104[Medline].
|
| 63.
|
Wang, Z.,
J. Q. Svejstrup,
W. J. Feaver,
X. Wu,
R. D. Kornberg, and E. C. Friedberg.
1994.
Transcription factor b (TFIIH) is required during nucleotide-excision repair in yeast.
Nature
368:74-76[Medline].
|
| 64.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
|