INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Sequences within exons in addition to splice sites have emerged in the last several years as powerful determinants of splicing efficiency (2, 13, 24). Of these sequences, the purine-rich exon enhancers containing the generic core sequence (GAR)_n (R = G or A) (42) have received the most attention (4, 6, 9, 17, 20, 23, 25, 32, 41-43). Even short purine-rich enhancers can have major effects on the efficiency of exon inclusion. Most characterized purine-rich enhancers reside in alternative exons and have been shown to be essential sequence elements for exon inclusion, usually via the activation of weak 3' splice sites (2, 14, 26). Exon enhancers are often interchangeable in their ability to activate weak 3' splice sites, not only between genes (8, 17, 20, 36, 41-43), but also between species (13), suggesting that either most enhancers bind the same factors or the bound factors have interchangeable activities.

Purine-rich enhancers bind to members of the arginine-serine-rich class of splicing factors (29, 44), the S/R proteins (reviewed in references 10 and 24). Different enhancers demonstrate binding preferences for individual members of this family of proteins (20, 23, 25, 31-34, 41). These preferences correlate with the ability of different S/R proteins to affect in vitro splicing of enhancer-containing exons. Raising the in vivo level of S/R proteins via expression of cDNAs coding for individual members of the family has been shown to increase inclusion of an exon containing a purine-rich enhancer (3, 39). Furthermore, disruption of the gene coding for one S/R protein, ASF/SF2, has been demonstrated to be lethal in cultured cells (40). Cumulatively, the available data suggests that individual purine-rich enhancers bind a preferred subset of S/R proteins during exon recognition.

Although purine-rich enhancers are frequently associated with cassette exons, they have not been routinely associated with splicing choices involving alternative recognition of competing splice sites within a single exon. The only two reported examples of enhancers regulating this latter type of alternative splicing occur in the caldesmon gene (12, 16, 17) and the Drosophila fruitless gene (28). Exon 5 of the caldesmon gene is a large internal exon containing two competing 5' splice sites. An extensive region of purine repeats, consisting of five copies of a 32-nucleotide purine-rich repeat, resides between the two splice sites. In vivo, the purine elements are necessary for maximal exon inclusion and proper regulation of splice site choice (15). A monomer repeat unit is sufficient to mediate both exon inclusion and 5' splice site regulation. The caldesmon regulatory sequence has properties of both an enhancer and a silencer in that it stimulates inclusion of an exon without itself being included in the spliced product RNA. In a heterologous exon without competing splice sites, the caldesmon enhancer behaves as a simple splicing enhancer (15), suggesting that it is best considered a complicated member of the purine-rich exon enhancer family despite its activation of an upstream 5' splice site.

Here, we compare the caldesmon enhancer to a more standard purine-rich enhancer from the chicken cardiac troponin T (cTNT) gene and report the surprising result that the two enhancers direct different splicing events both in vivo and in vitro when positioned between two competing 5' splice sites in an internal exon. This difference is observed despite considerable sequence similarity in the two enhancers. The caldesmon 32-nucleotide enhancer stimulated usage of the upstream, exon-internal 5' splice site, whereas the 30-nucleotide cTNT enhancer stimulated usage of the downstream, exon-terminal site. The two enhancers directed opposite choices both in vivo in a modified internal exon from the caldesmon gene and in vitro in an artificial exon containing strong constitutive splice sites derived from adenovirus. In the absence of any enhancer or in the presence of nonspecific exon sequences, both 5' splice sites in the tested internal exons were utilized, indicating that both enhancers modulated default splice site utilization, albeit in opposite directions. The sequences responsible for the differences in 5' splice site specificity were localized to a short region near the 3' end of the enhancers in which the sequence of both enhancers diverged from a simple GAR repeat. Although this short region determined splice site selectivity, it was not sufficient; other sequences within both enhancers were also necessary for enhancer function. These results emphasize the multipartite nature of exon enhancers and suggest considerable complexity in the nature of recognition of exon enhancers by splicing factors. Perhaps most importantly, our results show that regions of an enhancer important for 5' splice site selectivity may not be the same sequence required for 3' splice site activation, indicating that the activity of an enhancer can be environmentally determined.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

In vivo and in vitro constructs. The in vivo constructs used were based on a mini-gene containing the caldesmon alternative exon. In this mini-gene, the natural human caldesmon exon 5 and its adjoining intron sequences replaced exon 2 of the mouse metallothionein II gene driven by the Rous sarcoma virus (RSV) promoter. This mini-gene directs exon 5 inclusion via the exon-internal 5' splice site in most cell lines tested (15). The basic mini-gene contained the natural caldesmon exon 5, in which the region between the two 5' splice sites (687 nucleotides) within the exon contained the natural purine-rich enhancer consisting of five copies of the 32-nucleotide repeat (see Fig. 1A). Derivatives in which 357 nucleotides containing all copies of the purine-rich repeat between the two 5' splice sites in exon 5 were replaced with 48 to 52 nucleotides of heterologous sequence were constructed. These sequences consist of one copy of the caldesmon 32-nucleotide repeat, one copy of the natural exon sequences (30 nucleotides [see sequence in Fig. 1B]) from exon 5 of the chicken cTNT gene, one copy of an "up-mutant" (25) of the cTNT exon 5 enhancer (sequence AAGAGGAAGAAGAAGAAGAGGAAGAC-GACG), and a neutral cDNA sequence (GTTATGCTCGTTATGCGCGTTATGCTCGTTATGGTCG).

In vivo RNA determination. RNA splicing phenotypes were derived for whole-cell RNA by the use of a low-cycle reverse transcription-PCR (RT-PCR) described and quantified previously (15). PCR primers were from exon 3 of the metallothionein mini-gene backbone and from the RSV promoter region of exon 1. This primer pair could not amplify endogenous metallothionein mRNA. The identities of spliced products were verified by direct sequencing of RT-PCR products as described previously (15).

In vitro splicing. In vitro splicing assays (25 µl) using HeLa nuclear extract were performed as described previously (25, 27). Maximal observation of differential phenotypes of the utilized enhancers took place with final concentrations of 2.0 mM MgCl₂ and 1% polyethylene glycol. Splicing reaction products were quantified with a Molecular Dynamics PhosphorImager. The exon-internal splice site efficiencies were calculated as percent internal splice site usage [IS/(IS + TS), where IS is the exon-internal splice site and TS is the exon-terminal splice site]. Each reported efficiency represents the mean of at least four independent experiments with calculated standard deviations (as shown in Tables 1 and 2).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

The caldesmon and cTNT enhancers regulate in vivo 5' splice site selection and stimulate exon inclusion. It has been shown previously that the purine-rich sequences residing between the two competing 5' splice sites within alternative exon 5 of the caldesmon gene (Fig. 1A) are necessary for both exon inclusion and modulation of 5' splice site utilization (15). In their presence, the exon-internal 5' splice site (site upstream of the enhancer) is dominantly used; in their absence or when they are replaced by nonspecific cDNA sequences, exon inclusion levels fall and RNA is produced by using both 5' splice sites. Therefore, the exon 5 enhancer both stimulates exon inclusion via a positive effect and regulates inclusion via recognition of a 5' splice site positioned upstream of the enhancer. This form of splice site activation effectively positions the enhancer outside the exon whose inclusion is being stimulated. The enhancer must be within an exon to be effective in modulating 5' splice site choice (15), indicating that it can be considered an exon element even though it stimulates usage of an upstream 5' splice site.

View larger version (25K): [in this window] [in a new window]   FIG. 1.   Caldesmon and cTNT enhancers regulate in vivo 5' splice site selection and stimulate exon inclusion. (A) Diagram of the alternative exons (black boxes) of the human caldesmon and chicken cTNT genes containing the purine-rich enhancers studied (circle and triangle, respectively). The two purine-regions in each enhancer (gray boxes) and the enhancer-specific sequences that separate the two purine-rich regions (italic) are indicated. An up-mutant of cTNT that promotes exon inclusion of cTNT exon 5 more efficiently than the wild-type element (25) (triangle with plus sign). Five copies of the 32-nucleotide caldesmon enhancer from the natural exon are shown (five circles). (B) RT-PCR analysis of spliced RNA produced upon transfection of CHO cells with mini-genes containing the indicated enhancer sequences placed between the competing 5' splice sites of the natural caldesmon exon 5, diagrammed below the gel. The 5' splice site upstream of the enhancer is termed the exon-internal site (IS), and the 5' splice site downstream of the enhancer is termed the exon-terminal site (TS). For the constructs used in lanes 2 to 6, 357 nucleotides of exon including the natural enhancer were replaced with 48 to 52 nucleotides of heterologous sequence. RNA phenotypes were assessed by low-cycle quantitative RT-PCR (15) using PCR primers located in the exons flanking the alternative exon. The internal exon utilized in lane 1 is the natural caldesmon exon and is not drawn to scale. Product RNA resulting from use of the exon-terminal site in this construct is not observed (15) and would be much larger than the spliced RNAs produced in the other constructs. The constructs in lanes 2 to 6 had internal exons that did not significantly differ in length; therefore, the PCR products produced from each of these constructs resulting from usage of the exon-terminal 5' splice site were indistinguishable in length in the gel system used. These constructs have significantly shorter second exons than the natural caldesmon gene. Shortening reduces the dependence of the exon on the enhancer for inclusion and permits examination of effects on splice site specificity only. The construct (lane 2) in which the natural enhancer was deleted (no element) produced PCR products of 973, 643, and 240 nucleotides resulting from exon inclusion via the exon-terminal splice site, exon inclusion via the exon-internal splice site, and exon skipping, respectively. The constructs containing a single copy of the caldesmon enhancer (lane 3), nonspecific sequences (lane 4), cTNT enhancer (lane 5), or improved cTNT enhancer containing a purine spacer (lane 6) produced PCR products of 1,111 to 1,115, 643, and 240 nucleotides resulting from exon inclusion via the exon-terminal splice site, exon inclusion via the exon-internal splice site, and exon skipping, respectively. The identities of individual RNA species within each band were confirmed by sequencing of PCR products.

The caldesmon and cTNT enhancers differentially regulate in vitro utilization of competing identical strong 5' splice sites. The alternative exon tested in Fig. 1 is derived from the natural caldesmon exon from which the caldesmon enhancer was isolated. This exon is heterologous to the cTNT enhancer. To test both enhancers in a heterologous environment and to determine whether the two enhancers regulate 5' splice site choice in vitro, we utilized a three-exon in vitro precursor RNA containing a middle exon with two 5' splice sites. The precursor, diagrammed in Fig. 2, was constructed from adenovirus sequences (27, 35) and contains identical 5' splice sites (i.e., the two 5' splice sites within exon 2 are identical and identical to the 5' splice site in exon 1). Similarly, the 3' splice sites in exons 2 and 3 are identical. Therefore, any observed preferential splice site utilization cannot be due to inherent differences between the competing splice sites. The design of the test constructs was chosen to place the enhancers within an internal exon between competing 5' splice sites. Use of an internal exon insulates the enhancers from exon definition effects caused by cap-binding proteins (11) and places the tested enhancers in an exon environment structured similarly to the alternative caldesmon exon. Use of a strong adenovirus precursor RNA provided enhancer-independent removal of intron 1 to permit assessment of the ability of the sequences to regulate 5' splice site recognition without an accompanying requirement for activation of an upstream 3' splice site.

View larger version (34K): [in this window] [in a new window]   FIG. 2.   Caldesmon and cTNT enhancers promote differential utilization of identical flanking 5' splice sites in an in vitro precursor RNA. (A) Pathway of splicing of two intron precursor RNAs with a second exon containing two 5' splice sites flanking either the caldesmon or the cTNT enhancer. The precursor contains duplicated splice sites derived from adenovirus exon 2. The diagram indicates the preferred path of splicing exhibited by all in vitro precursors used in this study in which intron 1 is removed prior to intron 2. nt, nucleotides; IS and TS, exon-internal and exon-terminal sites, respectively. (B) Denaturing 8 and 5% acrylamide gels of 45-min reaction products enhance visualization of lariat species. Note that if a pathway in which intron 2 was removed first via the exon-internal 5' splice site had been used, a diagnostic product band of 363 nt would have been produced. A similar pathway of initial intron 2 removal using the exon-terminal 5' splice site would produce a diagnostic released exon 1 band of 485 nt. Neither of these bands was observed, indicating little processing by a pathway removing intron 2 before intron 1. Therefore, all splicing via the alternative 5' splice sites in exon 2 can be visualized in the product bands TS and IS. Lanes M, HpaII-digested pBR322, which is the marker for all subsequent figures. Band sizes are indicated in nucleotides. (C) The caldesmon enhancer (circle), cTNT enhancer (triangle), improved cTNT enhancer (triangle with plus sign), or nonspecific sequence (striped box) was placed in the in vitro precursor RNA diagrammed below the gel. Splicing reactions were performed for 0, 25, or 45 min under standard conditions. Products resulting from intron 1 removal, double splicing using the exon-terminal 5' splice site (TS), or double splicing using the exon-internal 5' splice site (IS) are indicated.

Specificity of the caldesmon enhancer requires the entire enhancer monomer. Both the caldesmon and the cTNT enhancers have multipartite structures in which two segments of purine-rich sequence are separated by a spacer sequence. Previous work indicated that the cTNT enhancer functions to stimulate exon inclusion in its natural environment primarily through the upstream purine-rich region (25). To determine whether the multipartite nature of the caldesmon enhancer was required for its ability to regulate 5' splice site choice, versions of the in vitro precursor RNA used in the experiment whose results are shown in Fig. 2 in which the monomer 32-nucleotide caldesmon enhancer was replaced by either the right or the left half of the enhancer (16 nucleotides each) were prepared (Fig. 3). This splitting of the enhancer created a 5'-half enhancer containing only purines and a 3'-half enhancer containing both purines and pyrimidines.

View larger version (43K): [in this window] [in a new window]   FIG. 3.   Specificity of the caldesmon enhancer requires the entire enhancer monomer. Precursor RNAs similar to those diagrammed in Fig. 2 containing the entire caldesmon enhancer, the 5' half of the enhancer (nucleotides 1 to 16 of the sequence shown in Fig. 1A), or the 3' half of the enhancer (nucleotides 17 to 32 of the sequence shown in Fig. 1A) were prepared. Reaction products resulting from splicing using the exon-internal (IS) or exon-terminal (TS) 5' splice site are indicated. The gel used for this experiment has a different cross-linking ratio than that in Fig. 2, causing lariat species to migrate just above the TS band representing double splicing using the terminal 5' splice site.

Splice site specificity of the caldesmon and cTNT enhancers requires all regions of each enhancer and is strongly influenced by sequences in the 3'-terminal segment. To determine which sequences within each enhancer are required for 5' splice site selectivity, each enhancer was arbitrarily divided into three domains. As shown in Fig. 4A, domain 1 is a 5' purine-rich region with a simple (GAR)₃ sequence, domain 2 is a region that is variable in sequence and length in the two enhancers, and domain 3 begins with (GAR)₂ and terminates with 5 to 7 nucleotides of enhancer-specific sequence. Chimeric enhancers were created by interchanging each of the three domains between the two enhancers. Swapping any of the three regions between the enhancers produced an alteration in 5' splice site utilization. The magnitude of the effect was different for individual regions. Table 1 lists the chimeras created for this study and indicates the percentage of splicing via utilization of the exon-internal 5' splice site of exon 2 for each construct.

View larger version (53K): [in this window] [in a new window]   FIG. 4.   Sequences within domain 3 of the enhancers provide 5' splice site specificity. (A) The caldesmon and cTNT sequences were divided into three domains as diagrammed for the purpose of domain interchange experiments. Purine repeats of the sequence GAR are indicated (shaded). Each domain is represented by a black (caldesmon) or white (cTNT) box (heterologous sequence is represented by a striped box in panel C). (B to D) In vitro splicing of precursor RNAs containing wild-type or chimeric enhancers. Reactions were performed for 45 min. Reaction products are identified as for Fig. 2. Sizes are indicated in nucleotides. In panel C, several different chimeras containing alternate domain 2 were made to control for differences in length of domain 2 between the two enhancers. When caldesmon domain 2 sequences were inserted into the cTNT enhancer, either the entire domain (12 nucleotides) (lane 5) or 5' or 3' half-domains (6 nucleotides each [boxes L and R]) (lanes 7 and 8) were used. When cTNT domain 2 sequences were inserted into the caldesmon enhancer, either one copy (6 nucleotides, represented by one white box) or two copies (two white boxes) were used.

Short enhancer-specific sequences at the 3' end of the cTNT and caldesmon enhancers provide splice site specificity. To identify the nucleotides within domain 3 that are important for enhancer specificity, domain 3 was further subdivided into two domains (3A and 3B) (Fig. 5 and Table 2). Domain 3A consists of two GAR repeats, and domain 3B contains 5 to 7 nucleotides of enhancer-specific sequence. It seemed unlikely, given the sequence similarity in domain 3A between the two enhancers, that specificity determinants were present in this domain. Therefore, analysis concentrated on domain 3B. Domain 3B is quite short, consisting of 5 nucleotides (AGGCA) in the caldesmon enhancer and 7 nucleotides (GACGACG) in the cTNT enhancer. Mutations were made within domain 3B, and the mutants were analyzed for specificity and overall splicing efficiency (Fig. 5).

View larger version (57K): [in this window] [in a new window]   FIG. 5.   Sequences within domain 3B dictate 5' splice site specificity. For this experiment, the two enhancers were considered to contain four domains. Compared to the domains identified in Fig. 4, the extra domain arises by subdivision of domain 3 into domain 3A, which contains the first 6 nucleotides of domain 3, with the sequence (GAR)2 and domain 38, which contains the terminal enhancer-specific. Caldesmon (black boxes) and cTNT (white boxes) domains are indicated. One mutant enhancer was prepared by replacing domain 3B of the caldesmon enhancer with domain 3B from the cTNT enhancer (lane 3). Two point mutations were made by altering the two C's in the cTNT domain 3B to U's (UU) (lane 4) or deleting both C's (XX) (lane 5). Splicing reactions were performed for 45 min. Product RNAs are identified as for Fig. 2. Quantification of the indicated product RNAs is shown beneath the gel. The amounts of products are shown in arbitrary PhosphorImager units as a percentage of total RNA precursor and products, normalized for uridine content.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Exon splicing enhancers have been shown to be important elements in the efficiency of exon recognition (2, 14, 26). One major class of exon enhancers are the purine-rich enhancers, exemplified by the caldesmon and cTNT enhancers compared in this study (4, 5, 8, 9, 15, 20, 22, 25, 31-34, 36, 38, 41-43). The caldesmon and cTNT enhancers are similar in both sequence and length, consisting of two blocks of purine repeats interdigitated with enhancer-specific sequences. Both enhancers stimulate splicing of a single-intron heterologous pre-mRNA (15, 42). However, when placed between two competing 5' splice sites in an internal exon bearing two sites, the enhancers demonstrated opposite phenotypes. Both increased exon inclusion levels in vivo compared to exons lacking an enhancer; however, the two enhancers directed inclusion by different 5' splice sites within the alternative exon. Both shifted the 5' splice site usage pattern away from the roughly equal usage of the two 5' splice sites observed in the absence of an enhancer between the sites. The caldesmon enhancer caused usage of the exon-internal 5' splice site, the site upstream of the enhancer, both in the natural caldesmon exon and in a heterologous exon containing strong adenovirus-derived constitutive 5' splice sites. In contrast, the cTNT enhancer caused usage of the exon-terminal 5' splice site, the site downstream of the enhancer, in both the caldesmon exon and the adenovirus exon. Thus, despite their sequence similarity, the presence of the two enhancers resulted in opposite splice site choices. These results suggest that subtle differences in exon sequence can strongly affect splicing choices.

Multipartite enhancer structure. Analysis of the domains within each enhancer that are important for function indicated that each enhancer could be considered as a tetrapartite sequence made up of a 5' domain consisting of a simple purine repeat, (GAR)₃; a second domain of enhancer-specific sequence and length; a third domain consisting of (GAR)₂; and a fourth differentiating short domain with the sequence AGGCA (caldesmon) or GACGACG (cTNT). Full-length enhancers were required for specificity. However, interchange of regions 1 and 2 had only 10 to 30% effect on splice site specificity, indicating that although these regions of the enhancer are necessary, the sequence differences between domains 1 and 2 played a minor role in specificity. It should be noted, however, that the two enhancers are very similar in domain 1.

Positive versus negative regulation. The caldesmon exon enhancer is a very unusual splicing regulatory sequence in that it causes recognition of a 5' splice site lying upstream of the enhancer within the exon containing the enhancer. Thus, the enhancer does not become incorporated into product RNA resulting from usage of the upstream splice site. This raises the question of whether the enhancer functions to cause alternative splice site recognition via activation of the upstream splice site or repression of the downstream splice site. Although some aspects of repression are certainly possible, we have no evidence suggesting that the enhancer is inhibitory to 5' splice site recognition. Placement of the enhancer in a weak exon activates splicing when the exon is 3' terminal (15) or internal (unpublished data). In these contexts, however, the caldesmon enhancer is never as powerful as the cTNT enhancer.

Regulation of 5' splice sites by enhancers. Exon enhancers have usually been shown to affect exon inclusion by activating weak 3' splice sites, via the interaction of enhancer-bound S/R proteins and the 35-kDa subunit of U2AF. In the constructs examined in this study, the enhancers regulate 5' splice site utilization, presumably through an effect on the binding of U1 snRNPs. Indeed, exon enhancers can replace a 5' splice site during early exon recognition and have been shown to activate U1 snRNP binding in reconstituted in vitro reactions (19, 31). Furthermore, S/R proteins have recently been shown to provide 5' splice site recognition in the absence of U1 snRNPs (7, 37).

Enhancer-binding proteins. The sequences present in the specificity domains of each enhancer suggest little about the identity of the proteins binding to these sequences and affecting 5' splice site specificity. Neither represents a sequence selected by iterative selection as a preferred binding site for a known S/R protein. The cTNT enhancer had been shown to bind SRp75, SRp55, SRp40, and ASF/SF2 in vitro, but not SC35 (25). Binding of these proteins, however, was strongly affected by sequences within domains 1 and 2 of the cTNT enhancer. Preliminary in vitro experiments with the caldesmon enhancer indicate that it binds SC35 better than SRp40. In addition, both enhancers can be UV cross-linked to unique proteins with molecular weights not characteristic of known S/R proteins.