Mol Cell Biol, January 1998, p. 58-68, Vol. 18, No. 1
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Section of Molecular and Cellular Biology and Department of Chemistry, University of California, Davis, Davis, California 95616,1 and Department of Cancer Biology, The Cleveland Clinic Research Institute, Cleveland, Ohio 441952
Received 11 July 1997/Returned for modification 14 August 1997/Accepted 13 October 1997
| |
ABSTRACT |
|---|
|
|
|---|
Cell stress, viral infection, and translational inhibition increase the abundance of human Alu RNA, suggesting that the level of these transcripts is sensitive to the translational state of the cell. To determine whether Alu RNA functions in translational homeostasis, we investigated its role in the regulation of double-stranded RNA-activated kinase PKR. We found that overexpression of Alu RNA by cotransient transfection increased the expression of a reporter construct, which is consistent with an inhibitory effect on PKR. Alu RNA formed stable, discrete complexes with PKR in vitro, bound PKR in vivo, and antagonized PKR activation both in vitro and in vivo. Alu RNAs produced by either overexpression or exposure of cells to heat shock bound PKR, whereas transiently overexpressed Alu RNA antagonized virus-induced activation of PKR in vivo. Cycloheximide treatment of cells decreased PKR activity, coincident with an increase in Alu RNA. These observations suggest that the increased levels of Alu RNAs caused by cellular exposure to different stresses regulate protein synthesis by antagonizing PKR activation. This provides a functional role for mammalian short interspersed elements, prototypical junk DNA.
| |
INTRODUCTION |
|---|
|
|
|---|
Selfish DNA sequences are hypothesized to be neutral or nearly neutral parasites. However, repetitive, human Alu elements cause deleterious mutations both by retrotranspositional insertion and by unequal, homologous recombination (40). Accordingly, there may be some compensating selective advantage, if not a normal physiological role, for maintaining Alus within the human lineage. Among various possibilities, Alu transcripts may provide this selective advantage.
Despite the presence of nearly one million Alus, most of which have internal promoter elements for RNA polymerase III (Pol III), Alu RNA transcripts are very scarce in cultured human cells (29, 43). Pol III proceeds through an Alu template until a fortuitous terminator, consisting of four or more T residues, is encountered within the 3' flanking sequence. These primary full-length Alu (flAlu) RNAs contain the dimeric repeat structure that is typical of consensus Alu elements and have a cytoplasmic lifetime of about 30 min (6, 39, 44). A fraction of flAlu RNA is processed into more stable, small cytoplasmic Alu (scAlu) RNA, which corresponds to the left monomer of the dimeric structure (32). There are about 500 copies of flAlu and scAlu RNAs in uninduced HeLa cells (29).
An infection of human cells by either adenovirus, human immunodeficiency virus, or herpes simplex virus dramatically increases the abundance of flAlu RNA (19, 20, 36). In the case of adenovirus, virus-encoded gene products increase the rate of Alu transcription (36). In addition, cell stress (whether by heat shock or other treatments) and translational inhibition by cycloheximide cause transient increases in the abundance of flAlu RNA (28). Cell stress and cycloheximide also increase the abundance of mouse and rabbit short interspersed element (SINE) transcripts, indicating that this response is evolutionarily conserved (28). Although these treatments increase the level of flAlu RNA, they increase only slightly the abundance of scAlu RNA, which is posttranscriptionally regulated (28).
One common feature of cell stress, viral infection, and translational inhibition is altered protein synthesis. Considering heat shock as one example of cell stress, protein synthesis is first inhibited, subsequently restored during cell recovery to engage expression of newly synthesized heat shock protein mRNAs, and later switched to restore expression of the pre-heat shock mRNA cohort (12). Mechanisms that regulate translational initiation are the primary effectors of these changes.
Viral infection affects translational initiation by several different
pathways, including activation of double-stranded RNA (dsRNA)-regulated
protein kinase PKR (8, 33, 41). Viral dsRNAs induce PKR
autophosphorylation and kinase activation, leading to phosphorylation
of the
subunit of eukaryotic initiation factor 2 (eIF-2
) and
subsequent repression of host cell protein synthesis (9,
34). As a counter measure, small highly structured
virus-encoded RNAs, such as adenovirus VAI RNA, competitively
bind PKR, blocking its autophosphorylation and autoactivation
(22, 41). High concentrations of activator dsRNAs,
such as human immunodeficiency virus type 1 TAR RNA, can inhibit PKR
activity (17, 30) as can a number of virus-encoded proteins
(21).
The effects of cell stress, particularly heat shock, upon translational
initiation are complex. Upon heat shock, eIF-2
is initially
phosphorylated to block protein synthesis by hemin-regulated initiation
factor-2 kinase, which is unresponsive to dsRNA (8, 10). The
role of PKR during heat shock is unknown, but it first becomes
associated with an insoluble cytosolic fraction and subsequently reenters the soluble fraction during recovery (11). During
heat shock recovery, the level of eIF-2
phosphorylation decreases as
protein synthesis is restored (12).
Given the increase in Alu RNA caused by cell stress, inhibition of protein synthesis with cycloheximide, and viral infection and the agonistic and antagonistic effects of dsRNAs upon PKR activity, we investigated the effects of Alu RNA on the expression of a reporter gene and PKR activation as well as the changes in PKR activity caused by these cellular treatments.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Expression and induction of Alu RNAs. Human 293 cells were cultured and transfected by the calcium phosphate method as previously described and harvested either 24 or 48 h later for analysis (6, 18). Clones for transfection included a luciferase reporter; a previously described flAlu RNA-overexpressing clone, XAT (6); and a clone, XAL, which overproduces left Alu RNA monomers (i.e., scAlu-like RNA). This clone contains the 7SL RNA promoter elements and the left Alu monomer from clone XAT, followed by five T residues, beginning at Alu consensus position 119 (39). Equivalent amounts of DNA were transfected in all experiments by adding additional pUC DNA. Cloned genes expressing VAI RNA, 5S rRNA, and 7SL RNA were also used in transfection assays (3, 24, 27).
RNA was analyzed by primer extension with reverse transcriptase and primers to detect 7SL RNA, flAlu RNA, 5S rRNA, and scAlu RNAs as previously described (6). The 7SL RNA primer (ATGCCGAACTTAGTGCGG) gives a 128-nucleotide (nt) primer extension product. Primer Alu 71 (GGTTTCACCGTGTTAGCCA) is directed toward the left Alu monomer, giving a 107-nt primer extension product for both scAlu and flAlu RNAs. Primer Alu 21-mer (GCGATCTCGGCTCACTGCAAG) gives a 238-nt product for flAlu RNA and two additional products. Alu 21-mer also misprimes transcripts from clone XAT, giving a shorter (210-nt) product that is diagnostic for XAT transcripts. Additionally, this primer gives a longer (350-nt) primer extension product, corresponding to an endogenous mRNA that evidently contains an Alu element (29). Primers for VAI RNA (AAAAGGAGCGCTCCCCCGTT) and 5S rRNA (AAAAAGCCTACAGCACCCGGTA) give 159- and 120-nt primer extension products, respectively. Heat shock, cycloheximide addition, and adenovirus infection of 293 cells were performed according to previous protocols, with exceptional details described in the text (28, 36). In particular, we employed a significantly lower multiplicity of infection (1 to 5 PFU per cell) in this study.Preparation of recombinant PKR.
PKR was cloned into
expression vector pET-15b (Novagen) and bacterially expressed as a
hexahistidine-tagged fusion protein as described previously
(33). Cell culture, cell lysis and extraction, and protein
purification by nickel-agarose affinity column chromatography and by
gel filtration fast-performance liquid chromatography were carried out
as previously described (34) with the following modifications. The gel filtration chromatograph was developed in 20 mM
sodium phosphate buffer (pH 7.0) containing 200 mM NaCl and 1 mM EDTA.
The PKR fraction was loaded on a 2-ml bed volume SP Sepharose FF
ion-exchange column (Pharmacia), washed with the same buffer, and
eluted in buffer containing 300 mM NaCl. The eluent was concentrated to
approximately 0.3 mg/ml with a disposable ultrafiltration device
(Ultrafree-CL; Millipore) and stored in small aliquots at
80°C
until used. Protein concentrations were estimated by Coomassie staining
of sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis gels
and by spectrophotometric absorbance with a protein extinction
coefficient derived from a purified enzymatically inactive mutant form
of PKR, PKR[K296R] (4, 5). The final protein preparation
was judged to be free of nucleic acid contamination by UV
spectrophotometry.
Coimmunoprecipitation assays of PKR-Alu RNA complexes. 293 cells (treated with either heat shock or cycloheximide, infected with adenovirus, or transiently cotransfected with Alu expression vectors) were harvested at the indicated times. Cell extracts were reacted with either HL 71/10 monoclonal antibody against PKR (15) or normal mouse immunoglobulin G in buffer I (0.15 M NaCl, 0.4% Nonidet P-40 [NP-40], 20 mM VRC [Bethesda Research Laboratories], 10 mM Tris-HCl [pH 7.6], 0.2 mM phenylmethylsulfonyl fluoride, 1 µg [each] of aprotinin, leupeptin, and pepstatin per ml) on ice for 30 min. Protein A agarose (20 µl; Santa Cruz Biotechnology) was added and incubated with gentle shaking at 4°C for another 3 h (23). After being washed in buffer II (0.15 M KCl, 10 mM Tris-HCl [pH 7.6], 0.2 mM EDTA, 20% glycerol, 0.125% NP-40, 0.2 mM phenylmethylsulfonyl fluoride, 1 µg [each] of aprotinin, leupeptin, and pepstatin per ml), immunoprecipitates were resuspended in RNA lysis buffer (0.14 M NaCl, 0.5% NP-40, 0.5 mM EDTA, 10 mM Tris-HCl [pH 7.6]), extracted with phenol-chloroform, and precipitated with ethanol. RNAs were assayed by primer extension as described above.
RNA electrophoretic mobility shift assays.
Plasmids
containing Alu, tRNA, and VAI sequences driven by the T7 promoter
(pT7flAlu, pT7tRNA, and pT7VAI, respectively) were constructed by PCR
amplification from clone XAT (6), the Xenopus tRNAMet gene (24), and the VAI gene
(2), respectively, followed by directional cloning into
pGEM3Z (Promega). The sequences of the primers used to create each
construct were as follows: forward primer 628 (5'-AAAGAATTCGGCCGGGCGCGGTGGT-3') and reverse primer 629 (5'-AAAGGATCCGAGACGGAGTCTCGCT-3') for pT7fluAlu, forward
primer XltRNAmeteco.f (5'-TCCGAATTCAGCAGAGTGGCGCAGC-3') and
reverse primer XltRNAbam.r (5'-TCTGGATCCTAGCAGAGGATGGTTTCG-3')
for pT7tRNA, and forward primer VAIeco.f
(5'-GCAGAATTCGGGCACTCTTCCGTGGTCTG-3') and reverse primer
VAIxba.r (5'-GCATCTAGAGGAGCGCTCCCCCGTTGTCT-3') for pT7VAI.
The identities of these constructs were verified by sequencing. After
purification by banding in CsCl-ethidium bromide gradients, plasmids
were linearized by cleavage with BamHI (pT7flAlu and
pT7tRNA) or XbaI (pT7VAI), isolated as a band from an
agarose gel, and purified with Gene Clean (Bio 101). After
transcription with T7 RNA polymerase and with
[
-32P]UTP as the labeled substrate, RNA was purified
by DNase treatment, extraction with phenol-chloroform-isoamyl alcohol,
and precipitation with ethanol. The RNA concentration was determined by
scintillation counting.
PKR autophosphorylation assays.
Recombinant PKR (0.33 µg)
was preincubated at 30°C with various RNAs for 6 min in reaction
buffer (55 mM KCl, 5 mM Tris-HCl [pH 7.6], 10% glycerol, 2 mM
MgCl2, 1 mM MnCl2, 0.1 mM EDTA)
(23). Transcripts synthesized by T7 RNA polymerase as
described above were subjected to an additional step of gel
purification for use in these assays. Poly(I) · poly(C) (3 ng/µl [final concentration]) and 5 µCi of
[
-32P]ATP with unlabeled ATP to a 1.5 µM final
concentration were added in a final reaction volume of 20 µl, and the
mixture was incubated for 25 min at 30°C. Twenty microliters of
Laemmli's buffer was added, and samples were boiled for 5 min,
resolved on an SDS-8% polyacrylamide gel, and analyzed by
autoradiography and by phosphorimager analysis.
Assay of PKR activity. Human 293 cells were transiently transfected for 48 h prior to being harvested with genes for various small RNAs or equivalent amounts of plasmid DNA. In addition, cells were subjected to either heat shock, cycloheximide treatment, or viral infection as indicated in the text. In studies of viral infection, cells were infected with 1 to 5 PFU of either wild-type adenovirus or adenovirus dl720 (Ad720) or were mock infected 20 h prior to being harvested. Ad720 has defective VAI and VAII RNA genes (9). At 17 h prior to being harvested, cells were treated with 1,000 U of interferon (Sigma) per ml. PKR was purified with either a commercial PKR antibody (Santa Cruz) or a previously described PKR antibody (4) by the immunoprecipitation procedure described above and resuspended in buffer III (10 mM Tris-HCl [pH 7.6], 100 mM KCl, 20% glycerol, 0.2 mM EDTA). The authenticity of PKR precipitated by the commercial antibody was verified by Western analysis with a well-characterized polyclonal antibody (4). PKR activity was assayed as described above, except that 75 mM KCl was employed. The level of PKR was measured by Western blotting.
| |
RESULTS |
|---|
|
|
|---|
Overexpression of Alu RNAs increases protein synthesis. Previously, we developed a flAlu RNA overexpression vector (clone XAT) consisting of the 5' flanking sequence of the 7SL RNA gene linked to an Alu element with an efficient terminator (6). Subsequently, we developed a system (clone XAL) to overexpress left monomers of this Alu element (scAlu-like RNA) by placing an efficient terminator, consisting of five consecutive T residues, immediately adjacent to the left Alu monomer in clone XAT (29a). Upon transient transfection into 293 cells, clone XAL produces very high levels of long-lived 118-nt left monomer scAlu RNA transcripts.
flAlu and scAlu-like RNA overexpression vectors were transiently cotransfected with a luciferase reporter construct to test the effects of Alu transcripts on protein synthesis (Fig. 1A). As controls, equivalent amounts of plasmid pUC, a cloned VAI RNA gene, and a cloned 7SL RNA gene were also transiently cotransfected with the reporter. Compared to the pUC control, overexpression of scAlu-like RNA and 7SL RNA led to modest but consistent increases in luciferase activity. In contrast, flAlu RNA and VAI RNA provided significantly greater stimulation of luciferase activity (ca. 10- to 16-fold in replicate trials for cells transfected with 10 µg of the flAlu overexpression clone) (Fig. 1A and data not shown). The very different effects of scAlu-like and flAlu RNAs on luciferase activity provided a negative control for this experiment. We routinely observed much higher levels of scAlu-like RNA compared to those of flAlu RNA in overexpression assays (data not shown) (see Fig. 7). However, scAlu-like RNA had relatively modest effects upon luciferase activity. scAlu-like RNA effectively served as a defective Alu mutant, providing a negative control for this and subsequent experiments.
|
|
PKR binds flAlu RNA in vivo. To determine whether Alu RNAs interact with PKR in vivo, the association of overexpressed flAlu RNA with PKR was assayed by immunoaffinity binding of PKR and by primer extension of Alu RNAs with reverse transcriptase (Fig. 3A). As negative and positive controls, we tested the binding of PKR to 7SL RNA and overexpressed VAI RNA, respectively. As a further control for possible effects due to the transfection procedure, we also employed cells which had been transfected with the 7SL RNA gene, although we did not attempt to distinguish between endogenous and overexpressed exogenous 7SL RNAs. None of these three RNAs precipitated in a mock control (Fig. 3A, lanes 6 through 8). Both overexpressed VAI and flAlu RNAs immunoprecipitated with PKR, but there was no detectable interaction between 7SL RNA and PKR (Fig. 3A, lanes 9 through 11). Although we have not examined whether our procedures result in quantitative precipitation of PKR, we calculate that 0.4% of flAlu RNA coprecipitated with PKR in this experiment.
|
FlAlu RNA forms stable PKR complexes. The association of flAlu RNA with PKR may result from direct interaction or may be mediated by other factors. Gel mobility shift assays were employed to detect possible complexes between PKR and flAlu RNA. PKR forms two discrete complexes, C1 and C2, with flAlu RNA (Fig. 4). As the PKR concentration increased, the abundance of the lower-mobility complex, C2, increased relative to that of the higher-mobility complex, C1 (Fig. 4).
|
|
Alu RNA antagonizes PKR autophosphorylation. Since flAlu RNA forms complexes with PKR, we tested its effects on PKR autophosphorylation in vitro. flAlu RNA at concentrations of 50 fg/µl to 15 ng/µl did not stimulate PKR autophosphorylation in vitro (data not shown). Therefore, we next examined its possible antagonism of PKR activation in the presence of dsRNA.
Low concentrations of poly(I) · poly(C) induce PKR autophosphorylation, whereas high concentrations are inhibitory (14, 23). In preliminary experiments, the optimal concentration of poly(I) · poly(C) was found to be 3 ng/µl (Fig. 6, lanes 7 and 10). In the absence of dsRNA, PKR exhibited no kinase activity (Fig. 6, lanes 8 and 9). Very low concentrations (e.g., 0.1 ng/µl [corresponding to about 1 nM]) of either flAlu RNA or VAI RNA partially inhibited (60% inhibition) PKR autophosphorylation in the presence of poly(I) · poly(C) (Fig. 6, lanes 1 and 4). Either of these RNAs at a concentration of 3 ng/µl (ca. 30 nM) caused a fourfold decrease in kinase activity (Fig. 6, lanes 3 and 6). Thus, VAI RNA and flAlu RNA were equally potent PKR antagonists in vitro (Fig. 6, lanes 1 through 6). Consistent with these results, 10 nM VAI RNA has been previously observed to inhibit PKR activation (15); therefore, our results for both the inhibitory activity of VAI RNA and the dissociation constant of its PKR gel shift complexes agree with previous determinations. tRNA does not antagonize PKR activation (35). Discounting 30% fluctuations in activity, we also observed that tRNA was a relatively ineffective PKR antagonist (Fig. 6, lanes 9 through 14). For example, the level of PKR activity in the presence of 50 ng of tRNA per ml (Fig. 6, lane 14) was 76% of the control level (lane 10).
|
flAlu RNA antagonizes PKR activity in vivo. Presumably, any RNA with a sufficient secondary structure may antagonize PKR activation in vitro (31). We therefore tested the effects of flAlu RNA on virus-induced PKR activation in vivo (Fig. 7). Adenovirus infection of 293 cells decreased the activity of PKR (Fig. 7A, lanes 1 and 2). As assayed by Western blotting, the level of PKR in this and subsequent experiments was relatively constant and thus not responsible for differences in its activity (Fig. 7B). In contrast to wild-type virus, infection with Ad720 (which has a deleted VAI RNA gene [9]) increased PKR activity (Fig. 7A, lanes 2 and 3). As previously observed, virus-induced activation of PKR can be inhibited by transient coexpression of VAI RNA (1) (Fig. 7A, lanes 4 and 5). VAI RNA overexpression in this experiment was confirmed by primer extension analysis (Fig. 7C).
|
|
Cycloheximide treatment decreases PKR activity. The role of PKR and its activation in response to viral infection is well understood. Since exposing cells to cycloheximide and cell stress also increases the accumulation of flAlu RNA, we investigated whether these treatments, like viral infection, affect PKR activity.
The addition of cycloheximide caused a decrease in PKR activity and, in agreement with our previous results (6), an increase in the abundance of flAlu RNA (Fig. 9). The level of PKR protein was unchanged during the time course of this experiment (Fig. 9B), indicating that kinase deactivation was responsible for the decrease in PKR activity. Both the increase in Alu RNA and the decrease in PKR activity began within 20 min of cycloheximide addition (Fig. 9A). Since cycloheximide-induced flAlu transcripts bound PKR (Fig. 3B) and since overexpressed flAlu RNA antagonized PKR activation (Fig. 7), we hypothesize that flAlu RNA is at least partially responsible for this initial decrease in PKR activity. However, 4 h after the addition of cycloheximide, the level of PKR activity was still low, but short-lived flAlu RNA returned to basal levels (Fig. 9). While factors other than flAlu RNA may be responsible for this continuing repression of PKR activity, as discussed above, PKR may form kinetically stable complexes with RNA antagonists, thereby inhibiting its kinase activity even after the RNA returns to basal level.
|
| |
DISCUSSION |
|---|
|
|
|---|
The rapid, dramatic increases in flAlu RNA in response to viral infection, cell stress, and translational inhibition have raised the possibility that these transcripts serve a physiological role (19, 20, 28, 36). Since each of these treatments also affects protein synthesis, we tested the effects of flAlu RNA on translation by using the expression of a reporter gene. Overexpression of flAlu RNA significantly increased the expression of a luciferase reporter. Negative controls, particularly one employing scAlu RNA, indicated that the stimulated expression of this reporter was not an artifact of RNA overexpression but was attributable to the specific activity of flAlu RNA. Furthermore, the levels of Alu overexpression required to cause an increase in luciferase were comparable to the levels of flAlu RNA induced by cell stress and viral infection, suggesting that endogenous levels of flAlu RNA have similar effects on translational expression. Similarly, levels of flAlu RNA overexpression comparable to those induced by cell stress and viral infection also caused a decrease in PKR activity, suggesting a mechanism for the effects of flAlu RNA on translational expression.
Viral infection and cell stress alter translation by multiple and
redundant pathways, including pathways which initially increase and
subsequently decrease eIF-2
phosphorylation, thereby first repressing and then derepressing translational initiation (12, 41). Significantly, in both cases, dephosphorylation of eIF-2
to reactivate translational initiation parallels the appearance of
entirely new mRNA cohorts encoding viral or heat shock proteins. Inhibition of translational elongation has previously been reported to
decrease eIF2
phosphorylation (42). In agreement with
that result, we observed that cycloheximide treatment caused a very rapid decrease in PKR activity, which may lead to a decrease in eIF-2
phosphorylation. Presumably, an increase in translational initiation would be an initial, regulated cellular response to a
decreased rate of translational elongation. In any event, PKR activity
was altered by each of these three cellular treatments, which also
increase the level of flAlu RNA.
We further observed that flAlu RNA bound PKR both in vitro and in vivo. In gel mobility shift assays, Alu RNA formed discrete complexes with PKR. The relationship of these complexes to either the binding of PKR to Alu RNA in vivo or the inhibition of PKR by Alu RNA is uncertain. However, under competitive binding conditions, preformed flAlu RNA complexes were relatively stable compared to those formed by VAI RNA, a well-studied PKR antagonist. Presumably, any RNA with a sufficient secondary structure could bind to PKR in vitro (7, 31), but many such RNAs, in the form of stable ribonucleoprotein structures, would not be available for PKR binding in vivo. In agreement with this suggestion, both VAI RNA and flAlu RNA bound PKR in vivo, but we did not observe any interaction between PKR and 7SL RNA, which is far more abundant than is flAlu RNA. As a component of fully formed, functional signal recognition particles (SRPs), 7SL RNA would be protected from PKR binding. The most active PKR inhibitors, as exemplified by VAI RNA, may be highly structured RNAs which do not serve functions that require being tightly sequestered in ribonucleoprotein structures. flAlu RNA is known to bind only the two smallest SRP proteins, presumably making it accessible to PKR in vivo.
flAlu RNA was equally as effective as was VAI RNA in antagonizing the activation of PKR in vitro; more importantly, overexpressed flAlu RNA also antagonized virus-induced activation of PKR in vivo. Interestingly, overexpressed flAlu RNA antagonized PKR activation to almost the same degree as did far higher concentrations of VAI RNA, leading us to conclude that flAlu RNA is indeed a potent PKR inhibitor. Higher levels of overexpressed scAlu RNA did not cause this inhibition, showing that the antagonism of PKR by flAlu RNA is not an artifact of gross overexpression but depends upon the structure of flAlu RNA.
These observations suggest that endogenous flAlu RNA affects translational expression by inhibiting PKR activation. We have not yet tested this possibility directly. However, cell stress, cycloheximide treatment, and viral infection changed PKR activity, which presumably modulates changes in protein synthesis caused by these same treatments. We also observed a rather simple dose-response relationship between the abundance of exogenously expressed flAlu RNA and the levels of both transiently coexpressed luciferase activity and PKR activity. Furthermore, the increased levels of flAlu RNA caused by viral infection, translational inhibition, and cell stress were similar to the levels of flAlu RNA overexpression that stimulated expression of the luciferase reporter and concomitantly decreased PKR activity. Thus, we consider it a possibility that increases in flAlu RNA caused by these three cellular treatments affect PKR activity and consequently protein synthesis.
As a host defense against viral infection, PKR is activated by dsRNA to
phosphorylate eIF-2
, thereby blocking protein synthesis (8,
41). PKR is also an important signal transducer for interferon and cytokine induction of gene expression through regulation of transcription factors NF-
B and IRF-1 (25, 26). Viral
counterstrategies to block PKR activation include the synthesis of
massive quantities of small RNAs, such as VAI RNA in the case of
adenovirus, to antagonize PKR's activation (8, 22, 41). In
the most thoroughly studied case of adenovirus, viral gene products
direct the increase in Alu transcription after infection
(36). By binding PKR and antagonizing its activation, these
induced flAlu transcripts may provide another viral defense against PKR
activation by the host. There are already many known viral strategies
to counter host defenses, and the existence of yet another is not
surprising (41). Of course, VAI RNA encoded by adenovirus
accumulates to a much higher level than does short-lived flAlu RNA and
would therefore be expected to serve as a far more effective PKR
antagonist. However, virus-encoded pathways are often deleterious to
the host cell. A cellular PKR antagonist would not need to achieve the
level of PKR antagonism provided by VAI RNA. It is noteworthy that VAI
deletion mutants, although impaired, remain viable, indicating that
there are redundant pathways to overcome host defenses (41).
Although the physiological function of flAlu RNA cannot be to enhance
viral infectivity, viruses typically co-opt normal cellular regulatory
mechanisms.
As discussed above, a decrease in PKR activity is plausibly an initial cellular response to the inhibition of translational elongation caused by drugs such as cycloheximide. More than 20 years ago, Reichman and Penman identified a factor, termed an activator, which stimulates translational initiation (37). They demonstrated that this activator is an RNA with a half-life of about 1 h, which is approximately the short lifetime of flAlu RNA (6, 16). Like flAlu RNA, activator RNA is induced by both heat shock and cycloheximide treatment of cells. Comparing the results of Goldstein et al. (16) to those of Liu et al. (28), the transient increases in both activator RNA and flAlu RNA levels in response to cycloheximide are virtually identical. We suspect that flAlu RNA is this translational activator. Retrospectively, the antagonism of PKR activation by the increased levels of flAlu RNA caused by cycloheximide treatment provides a mechanistic explanation for the observed biochemical activity of activator RNA upon translational initiation.
Hemin-regulated initiation factor-2 kinase, a PKR homolog,
phosphorylates eIF-2
in response to heat shock, but PKR itself has
no known role in the heat shock response (10). During
long-term heat shock, PKR changes from a soluble form to an insoluble
form (11). We observed transient increases in PKR activity
during heat shock recovery. However, the kinetic relationship of these changes in PKR activity to transient increases in flAlu RNA abundance during heat shock recovery is not evident. At present, any proposed function that PKR may serve during the heat shock response would be
entirely speculative; therefore, identifying the effects that flAlu RNA
may cause by acting on PKR during this period is even more problematic.
However, complex changes in translational expression occur during both
heat shock and heat shock recovery and, in part, these changes are
regulated by changes in eIF-2
phosphorylation (12).
Consequently, PKR and its regulators are almost certainly involved in
the heat shock response. As suggested above, activator RNA may be a PKR
regulator which is induced by heat shock (6, 16).
Ideally, the possibility that Alu RNA fulfills a physiological role would be tested by genetics. Because of their extraordinary copy number, Alu RNAs are not amenable to classical genetic tests. In Tetrahymena spp., a small, Pol III-transcribed RNA rapidly accumulates after heat shock and is required for the establishment of thermal tolerance (13). Interestingly, this transcript, like human Alu RNAs, is related to 7SL RNA. We do not know whether there is any relationship between the function of this gene and the present observations concerning flAlu RNA. However, there are several intriguing parallels between these two systems and certainly the Tetrahymena results provide strong precedence for the functionality of small heat shock-induced RNAs.
This proposed role for human Alu RNA potentially explains some unusual evolutionary features of mammalian SINEs. (i) There is no homology between human Alu RNAs and many other mammalian SINEs, such as rabbit SINEs (39, 44). Either SINEs are functionless or their function(s) does not depend upon sequence but upon some other, higher-order structure. However, entirely nonhomologous mammalian SINE RNAs could antagonize PKR since the binding of PKR to duplex RNA regions does not depend strongly on the sequence but rather requires a minimum number of base pairs of sufficient base pair fidelity (8, 31). Interestingly, the dimeric structure of human Alu elements may make their transcripts unusually potent PKR antagonists since each flAlu RNA potentially binds two molecules of PKR. The results from gel shift assays support this intriguing possibility. (ii) Individual mammalian SINEs are weakly promoted; therefore, their expression is easily repressed (6, 39). Nevertheless, the extremely large number of SINEs guarantees that many elements are always in active chromatin domains, thereby permitting a robust transcriptional response in all cell types despite the weakness of their individual promoters (6, 28). (iii) The short lifetime of SINE transcripts, which lack other normal cellular functions, makes them ideally suited to signal PKR. The abundance of a long-lived RNA serving an essential constitutive function could not be rapidly and significantly increased without disrupting that function.
Although an exact physiological role for Alu RNA and more generally mammalian SINE RNAs remains to be determined, overexpressed Alu transcripts stimulate translation and almost certainly do so by antagonizing PKR activation. Adaptation of these effects to regulate translational expression could provide a significant selective advantage for the maintenance of SINEs within the mammalian genome. The induction of Alu RNAs by cell stress and other treatments and the association between Alu RNA and PKR suggest that this potential selective advantage is being exploited.
| |
ACKNOWLEDGMENTS |
|---|
We thank John Hershey for critical interest and advice. We also thank Wen-Man Liu for designing, testing, and providing clone XAL.
This research was supported in part by USPHS grant GM21346 and the Agriculture Experiment Station, University of California, Davis (C.W.S.) and USPHS grant AI 34039 (B.R.G.W.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Section of Molecular and Cellular Biology and Department of Chemistry, University of California, Davis, Davis, CA 95616. Phone: (916) 752-9029. Fax: (916) 752-3085. E-mail: cwschmid{at}ucdavis.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Akusjarvi, G.,
C. Svensson, and O. Nygard.
1987.
A mechanism by which adenovirus virus-associated RNAI controls translation in a transient-expression assay.
Mol. Cell. Biol.
7:549-551 |
| 2. |
Barber, G. N.,
M. Wambach,
M. L. Wong,
T. E. Dever,
A. G. Hinnebusch, and M. G. Katze.
1993.
Translational regulation by the interferon-induced double-stranded-RNA-activated 68-kDa protein kinase.
Proc. Natl. Acad. Sci. USA
90:4621-4625 |
| 3. |
Bredow, S.,
D. Surig,
J. Muller,
H. Kleinert, and B. J. Benecke.
1990.
Activating-transcription-factor (ATF) regulates human 7SL RNA transcription by RNA polymerase III in vivo and in vitro.
Nucleic Acids Res.
18:6779-6784 |
| 4. |
Carpick, B. W.,
V. Graziano,
D. Schneider,
R. K. Maitra,
X. Lee, and B. R. G. Williams.
1997.
Characterization of the solution complex between the interferon-induced double-stranded RNA-activated protein kinase and HIV-1 trans-activating region RNA.
J. Biol. Chem.
272:9510-9516 |
| 5. | Chong, K., K. Schappert, J. Friesen, T. Donahue, A. Meurs, A. G. Hovanessian, and B. R. G. Williams. 1992. Expression of the human p68 kinase in yeast reveals a growth inhibiting phenotype and functional homology to the translational regulator GCN2. EMBO J. 11:1553-1562[Medline]. |
| 6. |
Chu, W.-M.,
W.-M. Liu, and C. W. Schmid.
1995.
RNA polymerase III promoter and terminator elements affect Alu transcription.
Nucleic Acids Res.
23:1750-1757 |
| 7. |
Clarke, P. A.,
M. Schwemmle,
J. Schickinger,
K. Hilse, and M. Clemens.
1991.
Binding of Epstein-Barr virus small RNA EBER-1 to the double-stranded RNA-activated protein kinase DAI.
Nucleic Acids Res.
19:243-248 |
| 8. | Clemens, M. J. 1996. Protein kinases that phosphorylate eIF2 and eIF2B and their role in eukaryotic cell translational control, p. 139-172. In J. W. B. Hershey, M. B. Mathews, and N. Sonenburg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 9. |
Davies, M. V.,
M. Futrado,
J. N. Hershey,
B. Thimmappaya, and R. J. Kaufman.
1989.
Complementation of adenovirus-associated RNA I gene deletion by expression of a mutant eukaryotic translation initiation factor.
Proc. Natl. Acad. Sci. USA
86:9163-9167 |
| 10. |
De Benedetti, A., and C. Baglioni.
1986.
Activation of hemin-regulated initiation factor-2 kinase in heat-shocked HeLa cells.
J. Biol. Chem.
261:338-342 |
| 11. |
Dubois, M. F.,
J. Galabru,
P. Lebon,
B. Safer, and A. G. Hovanessian.
1989.
Reduced activity of the interferon-induced double-stranded RNA-dependent protein kinase during a heat shock stress.
J. Biol. Chem.
264:12165-12171 |
| 12. | Duncan, R. F. 1996. Translational control during heat shock, p. 271-293. In J. W. B. Hershey, M. B. Mathews, and N. Sonenburg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 13. |
Fung, P. A.,
J. Gaertig,
M. A. Gorovsky, and R. L. Hallberg.
1995.
Requirement of a small cytoplasmic RNA for the establishment of thermotolerance.
Science
268:1036-1039 |
| 14. |
Galabru, J., and A. Hovanessian.
1987.
Autophosphorylation of the protein kinase dependent on double stranded RNA.
J. Biol. Chem.
262:15538-15544 |
| 15. | Galabru, J., M. G. Katze, N. Robert, and A. G. Hovanessian. 1989. The binding of double-stranded RNA and adenovirus VAI RNA to the interferon-induced kinase. Eur. J. Biochem. 178:581-589[Medline]. |
| 16. |
Goldstein, E. S.,
M. E. Reichman, and S. Penman.
1974.
The regulation of protein synthesis in mammalian cells. VI. Soluble and polyribosome associated components in controlling in vitro polypeptide initiation in HeLa cells.
Proc. Natl. Acad. Sci. USA
71:4752-4756 |
| 17. |
Gunnery, S. A.,
A. P. Rice,
H. D. Robertson, and M. B. Mathews.
1990.
Tat-responsive region RNA of human immunodeficiency virus 1 can prevent activation of the double-stranded-RNA-activated protein kinase.
Proc. Natl. Acad. Sci. USA
87:8687-8691 |
| 18. | Hickman, M. A., R. W. Malone, K. Lehman-Bruinsma, T. Sih, D. Knoell, F. C. Szoka, R. Walzem, D. M. Carlson, and J. S. Powell. 1994. Gene expression following direct injection of DNA into liver. Hum. Gene Ther. 5:1477-1483[Medline]. |
| 19. | Jang, K. L., and D. S. Latchman. 1992. The herpes simplex virus immediate-early protein ICP27 stimulates the transcription of cellular Alu repeated sequences by increasing the activity of transcription factor TFIIIC. Biochem. J. 284:667-673. |
| 20. | Jang, K. L., M. K. Collins, and D. S. Latchman. 1992. The human immunodeficiency virus tat protein increases the transcription of human Alu repeated sequences by increasing the activity of the cellular transcription factor TFIIIC. J. Acquired Immune Defic. Syndr. 5:1142-1147. |
| 21. | Katze, M. G. 1992. The war against the interferon-induced dsRNA-activated protein kinase: can viruses win? J. Interferon Res. 12:241-248[Medline]. |
| 22. | Katze, M. G., D. DeCorato, B. Safer, J. Galabru, and A. G. Hovanessian. 1987. Adenovirus VAI RNA complexes with the 68,000 Mr protein kinase to regulate its autophosphorylation and activity. EMBO J. 6:689-697[Medline]. |
| 23. |
Katze, M. G.,
M. Wambach,
M.-L. Wong,
M. Garfinkel,
E. Meurs,
K. Chong,
B. R. G. Williams,
A. G. Hovanessian, and G. N. Barber.
1991.
Functional expression and RNA binding analysis of the interferon-induced, double-stranded RNA-activated, 68,000-Mr protein kinase in a cell-free system.
Mol. Cell. Biol.
11:5497-5505 |
| 24. |
Koski, R. A., and S. G. Clarkson.
1982.
Synthesis and mutation of Xenopus laevis methionine tRNA gene transcription homologous cell-free extracts.
J. Biol. Chem.
257:4514 |
| 25. |
Kumar, A.,
J. Hague,
J. Lacaste,
J. Hiscott, and B. R. G. Williams.
1994.
The dsRNA-dependent protein kinase, PKR, activates transcription factor NF- B by binding IkB.
Proc. Natl. Acad. Sci. USA
9:6288-6292.
|
| 26. |
Kumar, A.,
Y.-L. Yang,
V. Flati,
S. Der,
S. Kadereit,
J. Hague,
A. Deb,
L. Reis,
C. Weismann, and B. R. G. Williams.
1997.
Deficient cytokine signaling in mouse embryo fibroblasts with a targeted deletion in the PKR gene: role of IRF-1 and NF B.
EMBO J.
16:406-416[Medline].
|
| 27. | Little, R., and M. Bratten. 1989. Genomic organization of human 5S rDNA and sequence of one tandem repeat. Genomics 4:376-383[Medline]. |
| 28. |
Liu, W.-M.,
W.-M. Chu,
P. V. Choudary, and C. W. Schmid.
1995.
Cell stress and translational inhibitors transiently increase the abundance of mammalian SINE transcripts.
Nucleic Acids Res.
23:1758-1765 |
| 29. |
Liu, W.-M.,
R. J. Maraia,
C. M. Rubin, and C. W. Schmid.
1994.
Alu transcripts: cytoplasmic localization and regulation of DNA methylation.
Nucleic Acids Res.
22:1087-1095 |
| 29a. | Liu, W.-M., and C. W. Schmid. Unpublished data. |
| 30. | Maitra, R. K., N. A. J. McMillan, S. Desai, J. McSwiggen, A. G. Hovanessian, G. Sen, B. R. G. Williams, and R. H. Silverman. 1994. HIV-1 TAR RNA has an intrinsic ability to activate interferon-inducible enzymes. Virology 204:823-827[Medline]. |
| 31. |
Manche, L.,
S. R. Green,
C. Schmedt, and M. B. Mathews.
1992.
Interactions between double-stranded RNA regulators and the protein kinase DAI.
Mol. Cell. Biol.
12:5238-5248 |
| 32. |
Maraia, R. J.,
C. T. Driscoll,
T. Bilyeu,
K. Hsu, and G. J. Darlington.
1993.
Multiple dispersed loci produce small cytoplasmic Alu RNA.
Mol. Cell. Biol.
13:4233-4241 |
| 33. | McMillan, N. A. J., and B. R. G. Williams. 1996. Structure and function of the interferon-induced protein kinase PKR and related enzymes, p. 225-253. In M. J. Clemens (ed.), Structure and function of the interferon-induced protein kinase, PKR, and related enzymes in protein phosphorylation in cell growth regulation. Harwood Academic Publishers, Amsterdam, The Netherlands. |
| 34. |
Murtha-Riel, P.,
M. V. Davies,
B. J. Scherer,
S. Y. Choi,
J. W. Hershey, and R. J. Kaufman.
1993.
Expression of a phosphorylation-resistant eukaryotic initiation factor 2 alpha-subunit mitigates heat shock inhibition of protein synthesis.
J. Biol. Chem.
268:12946-12951 |
| 35. | O'Malley, R. P., T. M. Mariano, J. Siekierka, and M. M. Mathews. 1986. A mechanism for the control of protein synthesis by adenovirus VA RNAI. Cell 44:391-400[Medline]. |
| 36. |
Panning, B., and J. R. Smiley.
1993.
Activation of RNA polymerase III transcription of human Alu repetitive elements by adenovirus type 5: requirement for the E1b 58-kilodaton protein and the products of E4 open reading frames 3 and 6.
Mol. Cell. Biol.
13:3231-3244 |
| 37. |
Reichman, M., and S. Penman.
1973.
Stimulation of polypeptide initiation in vitro after protein synthesis inhibition in vivo in HeLa cells.
Proc. Natl. Acad. Sci. USA
70:2678-2682 |
| 38. | Schmedt, C., S. R. Gree, L. Manche, D. R. Taylor, Y. Ma, and M. B. Mathews. 1995. Functional characterization of the RNA-binding domain and motif of the double stranded RNA-dependent protein kinase DAI (PKR). J. Mol. Biol. 249:29-44[Medline]. |
| 39. | Schmid, C. W., and R. Maraia. 1992. Transcriptional regulation and transpositional selection of active SINE sequences. Curr. Opin. Genet. Dev. 2:874-882[Medline]. |
| 40. | Schmid, C. W. 1996. Alu: structure, origin, evolution, significance and function of one-tenth of human DNA. Prog. Nucleic Acid Res. Mol. Biol. 53:283-319[Medline]. |
| 41. | Schneider, R. J. 1996. Adenovirus and vaccinia virus translational control, p. 575-606. In J. W. B. Hershey, M. B. Mathews, and N. Sonenburg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 42. |
Scorsone, K. A.,
R. Panniers,
A. G. Rowlands, and E. C. Henshaw.
1987.
Phosphorylation of eukaryotic initiation factor 2 during physiological stresses which affect protein synthesis.
J. Biol. Chem.
262:14538-14541 |
| 43. | Sinnett, D., C. Richer, J. M. Deragon, and D. Labuda. 1992. Alu RNA transcripts in human embryonal carcinoma cells. Model of post-transcriptional selection of master sequences. J. Mol. Biol. 226:689-706[Medline]. |
| 44. | Weiner, A. M., P. L. Deininger, and A. Efstratiadis. 1986. Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55:631-661[Medline]. |
This article has been cited by other articles: