Previous Article | Next Article 
Mol Cell Biol, January 1998, p. 58-68, Vol. 18, No. 1
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Potential Alu Function: Regulation of the Activity
of Double-Stranded RNA-Activated Kinase PKR
Wen-Ming
Chu,1
Ruth
Ballard,1
Bruce W.
Carpick,2
Bryan R. G.
Williams,2 and
Carl W.
Schmid1,*
Section of Molecular and Cellular Biology and
Department of Chemistry, University of California, Davis, Davis,
California 95616,1 and
Department of
Cancer Biology, The Cleveland Clinic Research Institute, Cleveland,
Ohio 441952
Received 11 July 1997/Returned for modification 14 August
1997/Accepted 13 October 1997
 |
ABSTRACT |
Cell stress, viral infection, and translational inhibition increase
the abundance of human Alu RNA, suggesting that the level of these
transcripts is sensitive to the translational state of the cell. To
determine whether Alu RNA functions in translational homeostasis, we
investigated its role in the regulation of double-stranded RNA-activated kinase PKR. We found that overexpression of Alu RNA by
cotransient transfection increased the expression of a reporter
construct, which is consistent with an inhibitory effect on PKR. Alu
RNA formed stable, discrete complexes with PKR in vitro, bound PKR in
vivo, and antagonized PKR activation both in vitro and in vivo. Alu
RNAs produced by either overexpression or exposure of cells to heat
shock bound PKR, whereas transiently overexpressed Alu RNA antagonized
virus-induced activation of PKR in vivo. Cycloheximide treatment of
cells decreased PKR activity, coincident with an increase in Alu RNA.
These observations suggest that the increased levels of Alu RNAs caused
by cellular exposure to different stresses regulate protein synthesis
by antagonizing PKR activation. This provides a functional role for
mammalian short interspersed elements, prototypical junk DNA.
 |
INTRODUCTION |
Selfish DNA sequences are
hypothesized to be neutral or nearly neutral parasites. However,
repetitive, human Alu elements cause deleterious mutations both by
retrotranspositional insertion and by unequal, homologous recombination
(40). Accordingly, there may be some compensating selective
advantage, if not a normal physiological role, for maintaining Alus
within the human lineage. Among various possibilities, Alu transcripts
may provide this selective advantage.
Despite the presence of nearly one million Alus, most of which have
internal promoter elements for RNA polymerase III (Pol III), Alu RNA
transcripts are very scarce in cultured human cells (29,
43). Pol III proceeds through an Alu template until a fortuitous
terminator, consisting of four or more T residues, is encountered
within the 3' flanking sequence. These primary full-length Alu (flAlu)
RNAs contain the dimeric repeat structure that is typical of consensus
Alu elements and have a cytoplasmic lifetime of about 30 min (6,
39, 44). A fraction of flAlu RNA is processed into more stable,
small cytoplasmic Alu (scAlu) RNA, which corresponds to the left
monomer of the dimeric structure (32). There are about 500 copies of flAlu and scAlu RNAs in uninduced HeLa cells (29).
An infection of human cells by either adenovirus, human
immunodeficiency virus, or herpes simplex virus dramatically increases the abundance of flAlu RNA (19, 20, 36). In the case of adenovirus, virus-encoded gene products increase the rate of Alu transcription (36). In addition, cell stress (whether by
heat shock or other treatments) and translational inhibition by
cycloheximide cause transient increases in the abundance of flAlu RNA
(28). Cell stress and cycloheximide also increase the
abundance of mouse and rabbit short interspersed element (SINE)
transcripts, indicating that this response is evolutionarily conserved
(28). Although these treatments increase the level of flAlu
RNA, they increase only slightly the abundance of scAlu RNA, which is
posttranscriptionally regulated (28).
One common feature of cell stress, viral infection, and translational
inhibition is altered protein synthesis. Considering heat shock as one
example of cell stress, protein synthesis is first inhibited,
subsequently restored during cell recovery to engage expression of
newly synthesized heat shock protein mRNAs, and later switched to
restore expression of the pre-heat shock mRNA cohort (12).
Mechanisms that regulate translational initiation are the
primary effectors of these changes.
Viral infection affects translational initiation by several different
pathways, including activation of double-stranded RNA (dsRNA)-regulated
protein kinase PKR (8, 33, 41). Viral dsRNAs induce PKR
autophosphorylation and kinase activation, leading to phosphorylation
of the
subunit of eukaryotic initiation factor 2 (eIF-2
) and
subsequent repression of host cell protein synthesis (9,
34). As a counter measure, small highly structured
virus-encoded RNAs, such as adenovirus VAI RNA, competitively
bind PKR, blocking its autophosphorylation and autoactivation
(22, 41). High concentrations of activator dsRNAs,
such as human immunodeficiency virus type 1 TAR RNA, can inhibit PKR
activity (17, 30) as can a number of virus-encoded proteins
(21).
The effects of cell stress, particularly heat shock, upon translational
initiation are complex. Upon heat shock, eIF-2
is initially
phosphorylated to block protein synthesis by hemin-regulated initiation
factor-2 kinase, which is unresponsive to dsRNA (8, 10). The
role of PKR during heat shock is unknown, but it first becomes
associated with an insoluble cytosolic fraction and subsequently reenters the soluble fraction during recovery (11). During
heat shock recovery, the level of eIF-2
phosphorylation decreases as
protein synthesis is restored (12).
Given the increase in Alu RNA caused by cell stress, inhibition of
protein synthesis with cycloheximide, and viral infection and the
agonistic and antagonistic effects of dsRNAs upon PKR activity, we
investigated the effects of Alu RNA on the expression of a reporter
gene and PKR activation as well as the changes in PKR activity caused
by these cellular treatments.
 |
MATERIALS AND METHODS |
Expression and induction of Alu RNAs.
Human 293 cells were
cultured and transfected by the calcium phosphate method as previously
described and harvested either 24 or 48 h later for analysis
(6, 18). Clones for transfection included a luciferase
reporter; a previously described flAlu RNA-overexpressing clone, XAT
(6); and a clone, XAL, which overproduces left Alu RNA
monomers (i.e., scAlu-like RNA). This clone contains the 7SL RNA
promoter elements and the left Alu monomer from clone XAT, followed by
five T residues, beginning at Alu consensus position 119 (39). Equivalent amounts of DNA were transfected in all experiments by adding additional pUC DNA. Cloned genes expressing VAI
RNA, 5S rRNA, and 7SL RNA were also used in transfection assays (3, 24, 27).
RNA was analyzed by primer extension with reverse transcriptase and
primers to detect 7SL RNA, flAlu RNA, 5S rRNA, and scAlu RNAs as
previously described (6). The 7SL RNA primer
(ATGCCGAACTTAGTGCGG) gives a 128-nucleotide (nt) primer
extension product. Primer Alu 71 (GGTTTCACCGTGTTAGCCA) is
directed toward the left Alu monomer, giving a 107-nt primer extension
product for both scAlu and flAlu RNAs. Primer Alu 21-mer
(GCGATCTCGGCTCACTGCAAG) gives a 238-nt product for flAlu RNA
and two additional products. Alu 21-mer also misprimes transcripts from
clone XAT, giving a shorter (210-nt) product that is diagnostic for XAT
transcripts. Additionally, this primer gives a longer (350-nt) primer
extension product, corresponding to an endogenous mRNA that evidently
contains an Alu element (29). Primers for VAI RNA
(AAAAGGAGCGCTCCCCCGTT) and 5S rRNA
(AAAAAGCCTACAGCACCCGGTA) give 159- and 120-nt primer extension products, respectively. Heat shock, cycloheximide addition, and adenovirus infection of 293 cells were performed according to
previous protocols, with exceptional details described in the text
(28, 36). In particular, we employed a significantly lower
multiplicity of infection (1 to 5 PFU per cell) in this study.
Preparation of recombinant PKR.
PKR was cloned into
expression vector pET-15b (Novagen) and bacterially expressed as a
hexahistidine-tagged fusion protein as described previously
(33). Cell culture, cell lysis and extraction, and protein
purification by nickel-agarose affinity column chromatography and by
gel filtration fast-performance liquid chromatography were carried out
as previously described (34) with the following modifications. The gel filtration chromatograph was developed in 20 mM
sodium phosphate buffer (pH 7.0) containing 200 mM NaCl and 1 mM EDTA.
The PKR fraction was loaded on a 2-ml bed volume SP Sepharose FF
ion-exchange column (Pharmacia), washed with the same buffer, and
eluted in buffer containing 300 mM NaCl. The eluent was concentrated to
approximately 0.3 mg/ml with a disposable ultrafiltration device
(Ultrafree-CL; Millipore) and stored in small aliquots at
80°C
until used. Protein concentrations were estimated by Coomassie staining
of sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis gels
and by spectrophotometric absorbance with a protein extinction
coefficient derived from a purified enzymatically inactive mutant form
of PKR, PKR[K296R] (4, 5). The final protein preparation
was judged to be free of nucleic acid contamination by UV
spectrophotometry.
Coimmunoprecipitation assays of PKR-Alu RNA complexes.
293
cells (treated with either heat shock or cycloheximide, infected with
adenovirus, or transiently cotransfected with Alu expression vectors)
were harvested at the indicated times. Cell extracts were reacted with
either HL 71/10 monoclonal antibody against PKR (15) or
normal mouse immunoglobulin G in buffer I (0.15 M NaCl, 0.4% Nonidet
P-40 [NP-40], 20 mM VRC [Bethesda Research Laboratories], 10 mM
Tris-HCl [pH 7.6], 0.2 mM phenylmethylsulfonyl fluoride, 1 µg
[each] of aprotinin, leupeptin, and pepstatin per ml) on ice for 30 min. Protein A agarose (20 µl; Santa Cruz Biotechnology) was added
and incubated with gentle shaking at 4°C for another 3 h
(23). After being washed in buffer II (0.15 M KCl, 10 mM Tris-HCl [pH 7.6], 0.2 mM EDTA, 20% glycerol, 0.125% NP-40, 0.2 mM
phenylmethylsulfonyl fluoride, 1 µg [each] of aprotinin, leupeptin, and pepstatin per ml), immunoprecipitates were resuspended in RNA lysis
buffer (0.14 M NaCl, 0.5% NP-40, 0.5 mM EDTA, 10 mM Tris-HCl [pH
7.6]), extracted with phenol-chloroform, and precipitated with
ethanol. RNAs were assayed by primer extension as described above.
RNA electrophoretic mobility shift assays.
Plasmids
containing Alu, tRNA, and VAI sequences driven by the T7 promoter
(pT7flAlu, pT7tRNA, and pT7VAI, respectively) were constructed by PCR
amplification from clone XAT (6), the Xenopus tRNAMet gene (24), and the VAI gene
(2), respectively, followed by directional cloning into
pGEM3Z (Promega). The sequences of the primers used to create each
construct were as follows: forward primer 628 (5'-AAAGAATTCGGCCGGGCGCGGTGGT-3') and reverse primer 629 (5'-AAAGGATCCGAGACGGAGTCTCGCT-3') for pT7fluAlu, forward
primer XltRNAmeteco.f (5'-TCCGAATTCAGCAGAGTGGCGCAGC-3') and
reverse primer XltRNAbam.r (5'-TCTGGATCCTAGCAGAGGATGGTTTCG-3')
for pT7tRNA, and forward primer VAIeco.f
(5'-GCAGAATTCGGGCACTCTTCCGTGGTCTG-3') and reverse primer
VAIxba.r (5'-GCATCTAGAGGAGCGCTCCCCCGTTGTCT-3') for pT7VAI.
The identities of these constructs were verified by sequencing. After
purification by banding in CsCl-ethidium bromide gradients, plasmids
were linearized by cleavage with BamHI (pT7flAlu and
pT7tRNA) or XbaI (pT7VAI), isolated as a band from an
agarose gel, and purified with Gene Clean (Bio 101). After
transcription with T7 RNA polymerase and with
[
-32P]UTP as the labeled substrate, RNA was purified
by DNase treatment, extraction with phenol-chloroform-isoamyl alcohol,
and precipitation with ethanol. The RNA concentration was determined by
scintillation counting.
For binding assays, PKR[K296R] at the indicated concentrations was
incubated with 0.2 ng of labeled transcript in a reaction
buffer
consisting of 50 mM KCl, 5 mM MgCl
2, 15 mM HEPES-KOH (pH
7.4), 1 mM dithiothreitol, 1 mM Pefabloc SC (Boehringer Mannheim),
0.1 mg of bovine serum albumin per ml, 6 U of RNAguard (Pharmacia)
per ml,
and 1.0 µg (each) of pepstatin, leupeptin, and aprotinin
per ml.
After binding for 20 min at room temperature, dye-glycerol
was added
and reactions were analyzed by electrophoresis through
nondenaturing
5% polyacrylamide gels (bisacrylamide/acrylamide
ratio, 1:29) run in
1× Tris-borate-EDTA. Quantitation was performed
by using a Fuji Bas
1000 phosphorimager and MacBas software.
For competition binding assays, labeled transcripts were preincubated
with PKR for 5 min at room temperature. After preincubation,
unlabeled
competitor RNA was added, and samples were incubated
for an additional
15 min. Dye-glycerol was added, and samples
were analyzed as described
above.
PKR autophosphorylation assays.
Recombinant PKR (0.33 µg)
was preincubated at 30°C with various RNAs for 6 min in reaction
buffer (55 mM KCl, 5 mM Tris-HCl [pH 7.6], 10% glycerol, 2 mM
MgCl2, 1 mM MnCl2, 0.1 mM EDTA)
(23). Transcripts synthesized by T7 RNA polymerase as
described above were subjected to an additional step of gel
purification for use in these assays. Poly(I) · poly(C) (3 ng/µl [final concentration]) and 5 µCi of
[
-32P]ATP with unlabeled ATP to a 1.5 µM final
concentration were added in a final reaction volume of 20 µl, and the
mixture was incubated for 25 min at 30°C. Twenty microliters of
Laemmli's buffer was added, and samples were boiled for 5 min,
resolved on an SDS-8% polyacrylamide gel, and analyzed by
autoradiography and by phosphorimager analysis.
Assay of PKR activity.
Human 293 cells were transiently
transfected for 48 h prior to being harvested with genes for
various small RNAs or equivalent amounts of plasmid DNA. In addition,
cells were subjected to either heat shock, cycloheximide treatment, or
viral infection as indicated in the text. In studies of viral
infection, cells were infected with 1 to 5 PFU of either wild-type
adenovirus or adenovirus dl720 (Ad720) or were mock infected
20 h prior to being harvested. Ad720 has defective VAI and VAII
RNA genes (9). At 17 h prior to being harvested, cells
were treated with 1,000 U of interferon (Sigma) per ml. PKR was
purified with either a commercial PKR antibody (Santa Cruz) or a
previously described PKR antibody (4) by the
immunoprecipitation procedure described above and resuspended in buffer
III (10 mM Tris-HCl [pH 7.6], 100 mM KCl, 20% glycerol, 0.2 mM
EDTA). The authenticity of PKR precipitated by the commercial antibody
was verified by Western analysis with a well-characterized polyclonal
antibody (4). PKR activity was assayed as described above,
except that 75 mM KCl was employed. The level of PKR was measured by
Western blotting.
 |
RESULTS |
Overexpression of Alu RNAs increases protein synthesis.
Previously, we developed a flAlu RNA overexpression vector (clone XAT)
consisting of the 5' flanking sequence of the 7SL RNA gene linked to an
Alu element with an efficient terminator (6). Subsequently,
we developed a system (clone XAL) to overexpress left monomers of this
Alu element (scAlu-like RNA) by placing an efficient terminator,
consisting of five consecutive T residues, immediately adjacent to the
left Alu monomer in clone XAT (29a). Upon transient
transfection into 293 cells, clone XAL produces very high levels of
long-lived 118-nt left monomer scAlu RNA transcripts.
flAlu and scAlu-like RNA overexpression vectors were transiently
cotransfected with a luciferase reporter construct to test
the effects
of Alu transcripts on protein synthesis (Fig.
1A).
As controls, equivalent amounts of
plasmid pUC, a cloned VAI RNA
gene, and a cloned 7SL RNA gene were also
transiently cotransfected
with the reporter. Compared to the pUC
control, overexpression
of scAlu-like RNA and 7SL RNA led to modest but
consistent increases
in luciferase activity. In contrast, flAlu RNA and
VAI RNA provided
significantly greater stimulation of luciferase
activity (ca.
10- to 16-fold in replicate trials for cells transfected
with
10 µg of the flAlu overexpression clone) (Fig.
1A and data not
shown). The very different effects of scAlu-like and flAlu RNAs
on
luciferase activity provided a negative control for this experiment.
We
routinely observed much higher levels of scAlu-like RNA compared
to
those of flAlu RNA in overexpression assays (data not shown)
(see Fig.
7). However, scAlu-like RNA had relatively modest effects
upon
luciferase activity. scAlu-like RNA effectively served as
a defective
Alu mutant, providing a negative control for this
and subsequent
experiments.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Effects of Alu RNAs on a transiently coexpressed
reporter gene. (A) 293 cells were transiently cotransfected with a
luciferase reporter gene (0.1 µg) and the indicated quantity of a
clone overexpressing 7SL, scAlu-like, flAlu (clone XAT), or VAI RNA or
plasmid pUC for a 293 cell control and with additional pUC DNA to
provide a total of 40 µg of DNA for each sample. Luciferase
activities were assayed at 24 h after transfection and are
reported in arbitrary luminosity units. (B) The amounts of luciferase
mRNA were assayed by primer extension in cells transfected with 0.1, 2.5, and 10 µg of clones overexpressing the indicated RNA.
|
|
Differences in luciferase activity may result from differences in
either transcriptional or translational activity. As assayed
by primer
extension, luciferase mRNA accumulated to similar levels
in these
transfection assays (Fig.
1B). By phosphorimager analysis,
the levels
of luciferase mRNA in control 293 cells and cells overexpressing
flAlu
RNA were virtually identical. We therefore conclude that
flAlu RNA,
like VAI, increases luciferase activity by increasing
the translational
activity of its mRNA.
While the results are reproducible, such transient-overexpression
experiments must be cautiously interpreted. As reported
below, PKR is
implicated in the effects that Alu RNA has upon
protein expression.
Since PKR negatively regulates its own expression
(
2),
complex changes in cell physiology may occur during the
time span
employed for transient-transfection assays.
The effects of flAlu RNA on the luciferase reporter may be an artifact
of its gross overexpression. In this event, the level
of overexpressed
flAlu RNA required to increase expression of
the reporter gene would
greatly exceed naturally occurring levels
of endogenous flAlu RNA. We
therefore compared the levels of exogenous
and endogenous flAlu RNAs
(Fig.
2). In agreement with the results
shown in Fig.
1, overexpression of flAlu RNA increased expression
of
the luciferase reporter gene nearly fivefold over the range
of
transfected XAT DNA investigated (Fig.
2). The level of overexpressed
flAlu RNA was determined by primer extension relative to the abundance
of 7SL RNA to control for RNA loading. The abundance of flAlu
RNA
increased about fivefold over the experimental range investigated
(Fig.
2). Moreover, there was an excellent correlation between
increasing
levels of flAlu RNA and luciferase activity (Fig.
2).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 2.
Cotransfection of the luciferase reporter gene and the
flAlu RNA-overexpressing clone XAT was performed as described in the
legend to Fig. 1, except that cells were harvested at 48 h after
transfection. The level of luciferase activity (expressed in arbitrary
luminosity units) is shown. Primer extension (insert) was used to assay
for the abundances of both Alu RNA and 7SL RNA for 293 control cells
(lane 1); cells transfected with 0.5, 2.5, 5.0, and 1.25 µg of clone
XAT (lanes 2 through 5, respectively); cells infected with adenovirus
for 24 h (lane 6); cells treated with 100 µg of cycloheximide
per ml for 4 h (lane 7); and cells recovering for 2 h from
heat shock (lane 8). The primers for flAlu and 7SL RNAs were mixed at a
ratio of 30 to 1. The abundance of flAlu RNA (circles), relative to
that of 7SL RNA, was determined by phosphorimager analysis of the
corresponding primer extension products. The positions of 7SL and Alu
primer extension products are indicated; the diffuse intermediate band
is an artifact that is occasionally observed for the 7SL primer.
|
|
We also observed two- to threefold increases of flAlu RNA in cells that
either were treated with cycloheximide, were recovering
from heat
shock, or were infected with adenovirus (Fig.
2). The
endogenous levels
of flAlu RNA induced by these cellular treatments
were similar to the
levels that increased expression of the reporter
gene. In interpreting
this experiment, the remarkable efficiency
with which Pol III-directed
templates are expressed in a majority
of transfected cells should be
noted (
1). Apparently, endogenous
flAlu RNA can achieve the
levels required to stimulate translational
expression. Since
overexpression of flAlu RNA and VAI RNA, a known
PKR antagonist
(
22), had similar effects upon luciferase activity
(Fig.
1),
these RNAs may increase translation through a similar
mechanism.
PKR binds flAlu RNA in vivo.
To determine whether Alu RNAs
interact with PKR in vivo, the association of overexpressed flAlu RNA
with PKR was assayed by immunoaffinity binding of PKR and by primer
extension of Alu RNAs with reverse transcriptase (Fig.
3A). As negative and positive controls,
we tested the binding of PKR to 7SL RNA and overexpressed VAI RNA,
respectively. As a further control for possible effects due to the
transfection procedure, we also employed cells which had been
transfected with the 7SL RNA gene, although we did not attempt to
distinguish between endogenous and overexpressed exogenous 7SL RNAs.
None of these three RNAs precipitated in a mock control (Fig. 3A, lanes
6 through 8). Both overexpressed VAI and flAlu RNAs immunoprecipitated
with PKR, but there was no detectable interaction between 7SL RNA and
PKR (Fig. 3A, lanes 9 through 11). Although we have not examined
whether our procedures result in quantitative precipitation of PKR, we
calculate that 0.4% of flAlu RNA coprecipitated with PKR in this
experiment.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
Coimmunoprecipitation of Alu RNAs with PKR. PKR
was immunoprecipitated with monoclonal antibody against PKR or normal
mouse immunoglobulin G by absorption upon protein A-Sepharose,
resulting in supernatant (Sup), immunoprecipitation (IP), and control
(Mock) fractions, which were assayed by primer extension. (A) Cells
were transiently transfected with clones (10 µg) XAT (lanes 1, 5, 8, and 11), 7SL (lanes 2, 3, 6, and 9) and VAI (lanes 4, 7, and 10). The
resulting samples were assayed with the specific primer directed toward
the corresponding RNA, except for lane 1, in which we employed a
mixture of Alu, 7SL, and VAI RNA primers. The relative amounts of
primers employed for the supernatant fractions were adjusted in the
Alu/VAI/7SL ratio of 30:3:1 to provide comparable cDNA products, except
for lane 3, in which the 7SL primer was used at the same concentration
as was the Alu primer. Equal amounts of the three primers were used to
assay the mock and immunoprecipitation fractions. Equal amounts of RNA
(20 µg) were assayed in supernatant fractions, except for lane 3, in
which 0.66 µg of RNA was assayed. The total mock and
immunoprecipitation fractions were assayed. (B) Using 7SL/Alu primer
mixture ratios of 1:30 for supernatants (Sup) and 1:1 for
immunoprecipitates, primer extension was performed with control 293 cells (lanes 1 and 9) and cells infected with adenovirus mutant Ad720
at 1 to 5 PFU per cell (lanes 2 and 10), treated with 100 µg of
cycloheximide per ml for 4 h (lane 3 and 11), or recovering for
2 h from heat shock (lane 4 and 12), as well as cells transfected
with pUC alone (lanes 5 and 13) and XAT (2.5 [lanes 6 and 14], 5 [lanes 7 and 15], and 10 [lanes 8 and 16] µg). All transfections
were adjusted to 10 µg with pUC. For supernatant fractions (lanes 1 through 8), 10 µg of RNA was assayed. The entire immunoprecipitate
was assayed for lanes 9 through 12, but the immunoprecipitates for
transfected samples (lanes 13 through 16) were divided for primer
extension analysis (70%) and PKR assays (30%) as described in the
legend to Fig. 8. Because of this difference and the number of cells
employed, the immunoprecipitates for transfected samples (lanes 13 through 16) corresponded to 35% of the material examined for
endogenous samples (lanes 9 through 12). Phosphorimager determinations
of the relative abundances of flAlu RNA in supernatant fractions, with
the intensities of 7SL RNA bands used as internal controls for RNA
loading, are cited in the text.
|
|
Since overexpression of Alu RNAs from transiently transfected templates
may artifactually cause PKR to bind Alu RNA, we tested
the binding of
PKR to endogenous flAlu RNA (Fig.
3B). To compare
the effect of flAlu
RNA overexpression on PKR activity, we also
repeated the
immunoprecipitation of overexpressed flAlu RNA with
part of the
resulting immunoprecipitate for primer extension analysis
(Fig.
3B,
lanes 13 through 16) and part for assays of PKR activity
(see Fig.
8).
As previously reported, the abundance of flAlu RNA
increased in cells
infected with virus (4.2-fold; Fig.
3B, lane
2), treated with
cycloheximide (2.4-fold; lane 3), or recovering
from heat shock
(4.3-fold; lane 4). We also observed a 2.0- to
4.3-fold increase in
flAlu RNA upon overexpression (Fig.
3B, lanes
5 through 8); therefore,
the range of overexpression examined
here is comparable to the
increases induced by these cellular
insults. In contrast to 7SL RNA,
endogenous flAlu RNAs coimmunoprecipitated
with PKR (Fig.
3B, lanes 9 through 12). The low signals of bound
Alu RNA (Fig.
3B, lanes 9 through
16) cannot be accurately quantitated
against the lane-specific
background. However, we qualitatively
observe that higher levels of
either endogenous or exogenous flAlu
RNA generally resulted in higher
levels of association with PKR
(Fig.
3B; compare lanes 2 and 10, lanes
4 and 12, and lanes 8
and 16). The slight increase in flAlu caused by
cycloheximide
in this particular experiment (Fig.
3B, lanes 1 and 3)
did not
cause a convincing increase in PKR binding relative to that of
the control (lanes 9 and 11).
FlAlu RNA forms stable PKR complexes.
The association of flAlu
RNA with PKR may result from direct interaction or may be mediated by
other factors. Gel mobility shift assays were employed to detect
possible complexes between PKR and flAlu RNA. PKR forms two discrete
complexes, C1 and C2, with flAlu RNA (Fig.
4). As the PKR concentration increased,
the abundance of the lower-mobility complex, C2, increased relative to
that of the higher-mobility complex, C1 (Fig. 4).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 4.
Gel mobility shift assays of PKR-flAlu RNA complexes.
Labeled flAlu RNA was incubated with the indicated amounts of
PKR[K296R] and assayed by gel electrophoresis. The positions of free
probe, high- (C1) and low (C2)-mobility complexes, and wells are
indicated. Phosphorimager analysis was used to measure the amounts of
free RNA and complexes; the dissociation constant of complex C1 was
0.26 µM. As discussed in the text, the dissociation constant for C2
was model dependent. Assuming that C2 results from occupancy of two PKR
binding sites within flAlu RNA, the estimated dissociation constant for
the PKR complexes associated with each site was 0.24 µM.
|
|
The observed mobility shift patterns for flAlu RNA can be interpreted
as resulting from either protein oligomerization, the
binding of
protein to multiple sites in the dimeric sequence of
flAlu RNA, or a
combination of both. If we assumed that C1 and
C2 consist of one and
two PKRs bound to flAlu RNA, respectively,
then the dissociation
constant for each of these two sites was
estimated to be 0.25 µM.
This suggests that the dimeric sequence
within flAlu RNA contains two
indistinguishable and independent
PKR binding sites (Fig.
4), a very
attractive possibility. However,
PKR is in equilibrium between
monomeric and dimeric forms, and
the addition of dsRNA shifts this
equilibrium toward the protein
dimeric state, presumably by stabilizing
the dimer (
4). Thus,
the C2 complex may instead result from
the stabilization of the
PKR dimer at higher protein concentrations.
VAI RNA and tRNA also formed discrete complexes with PKR (Fig.
5, lanes 6 and 11). The T7-synthesized
VAI RNA used in this
study contains additional polylinker sequence,
which may alter
its structure and association with PKR. However, in
excellent
agreement with a previous determination (
38), the
dissociation
constant for the major PKR-VAI RNA complex was 0.3 µM
(Fig.
5,
lane 11, and data not shown). Thus, the stabilities of the Alu
RNA and VAI RNA mobility shift complexes with PKR were virtually
identical. Like flAlu RNA, VAI RNA also formed higher-order PKR
complexes (Fig.
5). The PKR-tRNA complex was only slightly less
stable,
having a dissociation constant of 0.6 µM (Fig.
5, lane
6, and data
not shown).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
Competition by VAI RNA against PKR-RNA gel shift
complexes. Labeled RNAs (ca. 0.2 ng or about 0.1 nM [final
concentration]) were preincubated with 250 nM PKR [K296R] for 5 min
and then incubated for an additional 15 min with different
concentrations of unlabeled VAI RNA (2.5 nM [lanes 2, 7, and 12], 25 nM [lanes 3, 8, and 13], 250 nM [lanes 4, 9, and 14], and 2.5 mM
[lanes 5, 10, and 15]) or without VAI RNA competitor ( ; lanes 1, 6, and 11). Mobility shift complexes were analyzed on 5% nondenaturing
polyacrylamide gels. The positions of wells (W), free probe (F), and
complexes (C) are indicated. The mobilities of the three probes in the
absence of PKR were examined in separate control experiments.
|
|
Although the dissociation constants for complexes with these three RNAs
were very similar, competition assays with preformed
complexes revealed
a significant difference between the binding
of PKR to flAlu RNA and
binding to either tRNA or VAI RNA (Fig.
5). Complexes with a
radiolabeled RNA tracer were preformed for
5 min before the addition of
unlabeled competitor RNA (VAI RNA
in this example), after which the
mixture was incubated for an
additional 15 min. Preliminary gel
mobility shift assays indicated
that 5 min is sufficient to completely
preform these complexes,
as the observed dissociation constant remained
unchanged during
incubation for 45 min. In addition, competition
occurred within
5 min after the addition of unlabeled competitor so the
amount
of complex was not changed by competitive incubation for at
least
0.5 h. VAI RNA at a concentration of 25 nM was sufficient to
displace
both tRNA and labeled VAI RNA from preformed PKR complexes
(Fig.
5, lanes 8 and 13). In contrast, the PKR-flAlu RNA complex
resisted
competition by 2,500 nM VAI RNA (Fig.
5, lane 5). In otherwise
identical experiments with either flAlu RNA, B1 RNA, or poly(I)
· poly(C) as the unlabeled competitor, we obtained results similar
to
those shown in Fig.
5 (data not shown). Thus, the PKR-flAlu
complex is
stable at competitor concentrations which eliminate
tRNA and VAI RNA
complexes.
Since the dissociation constants observed for the PKR complexes formed
with these RNAs were rather similar, these results
are surprising.
Among several possibilities, the flAlu-PKR complex
may be kinetically
more stable than are complexes formed with
tRNA and VAI RNAs. As
precedence for this possibility, preformed
VAI RNA-PKR and poly(I)
· poly(C)-PKR complexes are kinetically
resistant to competition by
poly(I) · poly(C) (
15). We strongly
favor this
kinetic interpretation since we also observed that
preformed flAlu-PKR
complexes resisted competition by unlabeled
flAlu RNA. However, PKR has
high- and low-affinity binding sites
(
15); therefore,
complex formation and competition for these
RNAs may occur at different
sites. While the difficult question
of whether this difference is
kinetically or thermodynamically
determined remains to be decisively
resolved, PKR-flAlu RNA complexes
were more stable than were the
complexes that PKR formed with
either tRNA or VAI RNA (Fig.
5).
Alu RNA antagonizes PKR autophosphorylation.
Since flAlu RNA
forms complexes with PKR, we tested its effects on PKR
autophosphorylation in vitro. flAlu RNA at concentrations of 50 fg/µl
to 15 ng/µl did not stimulate PKR autophosphorylation in vitro (data
not shown). Therefore, we next examined its possible antagonism of PKR
activation in the presence of dsRNA.
Low concentrations of poly(I) · poly(C) induce PKR
autophosphorylation, whereas high concentrations are inhibitory
(
14,
23). In preliminary experiments, the optimal
concentration of
poly(I) · poly(C) was found to be 3 ng/µl
(Fig.
6, lanes 7 and
10). In the absence
of dsRNA, PKR exhibited no kinase activity
(Fig.
6, lanes 8 and 9).
Very low concentrations (e.g., 0.1 ng/µl
[corresponding to about 1 nM]) of either flAlu RNA or VAI RNA
partially inhibited (60%
inhibition) PKR autophosphorylation in
the presence of poly(I) · poly(C) (Fig.
6, lanes 1 and 4). Either
of these RNAs at a
concentration of 3 ng/µl (ca. 30 nM) caused
a fourfold decrease in
kinase activity (Fig.
6, lanes 3 and 6).
Thus, VAI RNA and flAlu RNA
were equally potent PKR antagonists
in vitro (Fig.
6, lanes 1 through
6). Consistent with these results,
10 nM VAI RNA has been previously
observed to inhibit PKR activation
(
15); therefore, our
results for both the inhibitory activity
of VAI RNA and the
dissociation constant of its PKR gel shift
complexes agree with
previous determinations. tRNA does not antagonize
PKR activation
(
35). Discounting 30% fluctuations in activity,
we also
observed that tRNA was a relatively ineffective PKR antagonist
(Fig.
6,
lanes 9 through 14). For example, the level of PKR activity
in the
presence of 50 ng of tRNA per ml (Fig.
6, lane 14) was
76% of the
control level (lane 10).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 6.
flAlu RNA inhibits PKR autophosphorylation in vitro.
Recombinant PKR (16 ng/µl) was preincubated with either flAlu RNA
(0.1, 0.5, and 3 ng/µl [lanes 1 through 3, respectively]), VAI RNA
(0.1, 0.5, and 3 ng/µl [lanes 4 through 6, respectively]), yeast
tRNA (0.1, 0.5, 3, and 50 ng/µl [lanes 11 through 14, respectively]), or buffer (lanes 7 through 10) at 30°C for 6 min.
Subsequently, poly(I) · poly(C) (poly I.C.) at 3 ng/µl (lanes
1 through 7 and 10 through 14) and labeled ATP (all lanes) were added
to initiate phosphorylation. Samples were then incubated for 25 min and
assayed by SDS-polyacrylamide gel electrophoresis.
|
|
The concentration of PKR employed in these autophosphorylation
experiments (240 nM) was comparable to the dissociation constants
observed for gel shift complexes. However, the inhibitory effect
provided by 1 to 30 nM either flAlu RNA or VAI RNA was significantly
greater than would be expected from the formation of discrete
complexes
with a stoichiometry of only one or two PKR molecules
for each RNA, as
observed in gel shift assays. PKR has at least
two RNA binding sites,
and it has previously been suggested that
one site is involved in
activation and the other is involved in
inhibition of PKR kinase
activity (
15). PKR also binds unstructured,
synthetic
single-stranded RNAs (
15). Consequently, small RNAs,
such as
Alu and VAI, which contain highly structured regions interspersed
with
relatively less structured regions may form higher-order
PKR complexes
in addition to discrete gel shift complexes. Aggregates
form when
highly purified PKR is titrated with saturating amounts
of dsRNA,
leading to the suggestion that this phenomenon represents
a mechanism
for inhibiting PKR with small structured RNAs (
4).
A second
possibility is that flAlu and VAI RNAs exert their inhibitory
effects
through direct competition with poly(I) · poly(C) binding
to the
dsRNA binding domains of PKR and that both the activating
and
inhibitory concentrations of dsRNA are much lower than the
PKR
concentration.
flAlu RNA antagonizes PKR activity in vivo.
Presumably, any
RNA with a sufficient secondary structure may antagonize PKR activation
in vitro (31). We therefore tested the effects of flAlu RNA
on virus-induced PKR activation in vivo (Fig.
7). Adenovirus infection of 293 cells
decreased the activity of PKR (Fig. 7A, lanes 1 and 2). As assayed by
Western blotting, the level of PKR in this and subsequent experiments
was relatively constant and thus not responsible for differences in its
activity (Fig. 7B). In contrast to wild-type virus, infection with
Ad720 (which has a deleted VAI RNA gene [9]) increased
PKR activity (Fig. 7A, lanes 2 and 3). As previously observed,
virus-induced activation of PKR can be inhibited by transient
coexpression of VAI RNA (1) (Fig. 7A, lanes 4 and 5). VAI
RNA overexpression in this experiment was confirmed by primer extension
analysis (Fig. 7C).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
flAlu RNA inhibits virus-induced PKR activation in vivo.
Human 293 cells were transiently transfected for 48 h with 5 or 15 µg of cloned genes to express various small RNA genes (lanes 4 through 13) or with plasmid DNA (lanes 1 through 3). The type of
small-RNA gene employed in each transfection is noted above the
corresponding lane. Twenty hours prior to being harvested, cells were
mock infected (293; lane 2) or infected with 1 to 5 PFU of either
adenovirus (adv; lane 1) or mutant Ad720 (720; lanes 3 through 13).
Seventeen hours prior to being harvested, cells were treated with
interferon (1,000 U/ml). (A) PKR activity was assayed by in vitro
autophosphorylation. (B) PKR protein levels were determined by Western
analysis. No PKR activity or PKR protein was detected in a mock
precipitation control (lane not shown). (C) Primer extension analysis
was employed to assay the levels of expression of various small RNAs in
control cells (293), cells infected with mutant Ad720 (720), and cells
transfected with either 5 or 15 µg of cloned genes for various small
RNAs. The relative amounts of RNA (2 µg is 1×) used in these primer
extension assays are indicated.
|
|
flAlu RNA overexpression also inhibited virus-induced activation of PKR
(Fig.
7A, lanes 6 and 7). Presumably, endogenous levels
of flAlu
stimulated by viral infection (Fig.
7C) are insufficient
to completely
counter virus-induced activation of PKR. In a comparison
of the levels
of VAI RNA and flAlu RNA overexpression (Fig.
7C),
relatively low
levels of Alu RNA antagonized PKR to almost the
same degree as did much
higher levels (ca. 50-fold) of the positive
control, VAI RNA. As judged
by this comparison, flAlu RNA is a
potent PKR antagonist in vivo.
Overexpression of scAlu, 7SL, and
5S RNAs provided negative controls
for this experiment. scAlu
RNA had little or no effect on PKR activity,
even when it was
expressed at very high levels (approximately the
levels of VAI
RNA overexpression employed in these experiments) (Fig.
7A, lanes
8 and 9, and C). This result was consistent with the previous
observation that scAlu overexpression had little effect on the
expression of the cotransfected luciferase reporter gene (Fig.
1).
Again, scAlu essentially provided a defective Alu mutant control
for
possible nonspecific effects of flAlu RNA overexpression.
The
transfection of either the 7SL RNA or 5S RNA gene had no effect
on PKR
activity in this assay (Fig.
7A, lanes 10 through 13).
The expression
of these two RNAs from their exogenous genes is
difficult to document
against their very high levels of endogenous
expression (Fig.
7C).
Nonetheless, we observed less 7SL RNA and
5S RNA in Ad720-infected
cells than in control 293 cells; upon
transient transfection, these
levels increased. Thus, in contrast
to the positive results for VAI and
flAlu RNAs, overexpression
of scAlu RNA or expression of exogenous 5S
and 7SL RNAs did not
significantly antagonize virus-induced PKR
activation.
The effects of flAlu RNA upon PKR activity may result from unnaturally
high levels of overexpression. Previously, we compared
the expression
levels and PKR binding of endogenous and exogenous
flAlu RNAs (Fig.
3B). That comparison provided an opportunity
to observe the effects of
physiologically relevant levels of flAlu
RNA expression and PKR binding
on PKR activity in vivo. PKR activity
decreased in a dose-dependent
manner with the level of flAlu overexpression
(Fig.
8A). Higher levels of overexpression
caused a three- to
fourfold decrease in PKR activity (Fig.
8A, lanes 3 and 4), but
even the lowest level of overexpression tested caused a
slight
decrease in PKR activity (lane 2). As previously discussed, the
amount of flAlu RNA associated with PKR apparently increased with
the
level of flAlu RNA expression (Fig.
3B). Thus, these data
suggest a
correlation among the level of flAlu RNA, its association
with PKR, and
its effects on PKR activity. Of particular significance,
this decrease
in PKR activity (Fig.
8A) was observed at overexpression
levels (two-
to fourfold) corresponding to the two- to fourfold
increases in
endogenous levels of flAlu RNA that resulted from
various cellular
insults (Fig.
3B). These observations for PKR
activity (Fig.
8A)
complemented the earlier observation that physiologically
relevant
levels of flAlu RNA overexpression also increased luciferase
reporter
expression in a dose-dependent manner (Fig.
2).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 8.
Effects of flAlu RNA overexpression on PKR activity. (A)
Aliquots of immunoprecipitates from cells transfected with clone XAT as
described in the legend to Fig. 3B were tested for PKR
autophosphorylation. Immunoprecipitated samples were from 293 cells
transfected with pUC (293; lane 1) and with 2.5, 5, and 10 µg of
clone XAT (Alu; lanes 2 through 4, respectively). By phosphorimager
analysis, the levels of PKR activity were 82% (lane 2) and 26% (lanes
3 and 4) of the activity in the control (lane 1). (B) The levels of PKR
in the same immunoprecipitates were tested by Western analysis with a
previously described antibody (4). The samples were from 293 cells transfected with pUC as a control (293; lane 3) and with 2.5, 5, and 10 µg of clone XAT (Alu; lanes 4 through 6, respectively). As
additional controls, cells overexpressing recombinant PKR (Rec; lane 2)
and a mock immunoprecipitation (Mock; lane 1) were examined. By using a
lower percentage of acrylamide and running the gel longer, a doublet
band of PKR was revealed as discussed in the text.
|
|
Western analysis showed that the level of PKR was approximately
constant (Fig.
8B, lanes 3 through 6), indicating again that
the effect
of flAlu RNA on PKR activity results from a decrease
in its activation.
The higher-resolution conditions used in this
experiment resolved a
closely spaced doublet of PKR bands (Fig.
8B, lane 3). Presumably, this
doublet resulted from different
degrees of phosphorylation;
interestingly, the slower-mobility
band decreased in intensity (Fig.
8B, lanes 4 through 6) in parallel
with the decrease in PKR activity
caused by flAlu RNA overexpression
(Fig.
8A).
Cycloheximide treatment decreases PKR activity.
The role of
PKR and its activation in response to viral infection is well
understood. Since exposing cells to cycloheximide and cell stress also
increases the accumulation of flAlu RNA, we investigated whether these
treatments, like viral infection, affect PKR activity.
The addition of cycloheximide caused a decrease in PKR activity and, in
agreement with our previous results (
6), an increase
in the
abundance of flAlu RNA (Fig.
9). The
level of PKR protein
was unchanged during the time course of this
experiment (Fig.
9B), indicating that kinase deactivation was
responsible for the
decrease in PKR activity. Both the increase in Alu
RNA and the
decrease in PKR activity began within 20 min of
cycloheximide
addition (Fig.
9A). Since cycloheximide-induced flAlu
transcripts
bound PKR (Fig.
3B) and since overexpressed flAlu RNA
antagonized
PKR activation (Fig.
7), we hypothesize that flAlu RNA is
at least
partially responsible for this initial decrease in PKR
activity.
However, 4 h after the addition of cycloheximide, the
level of
PKR activity was still low, but short-lived flAlu RNA returned
to basal levels (Fig.
9). While factors other than flAlu RNA may
be
responsible for this continuing repression of PKR activity,
as
discussed above, PKR may form kinetically stable complexes
with RNA
antagonists, thereby inhibiting its kinase activity even
after the RNA
returns to basal level.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 9.
Effects of cycloheximide on PKR activity and flAlu RNA.
293 cells incubated for 17 h with 1,000 U of interferon per ml
were exposed to cycloheximide (100 µg/ml) for the indicated times and
then assayed for PKR autophosphorylation activity (A) and the level of
PKR protein by Western analysis (B). (C) The abundances of flAlu RNA in
the same samples were analyzed by primer extension at the indicated
times. 20', 20 min.
|
|
 |
DISCUSSION |
The rapid, dramatic increases in flAlu RNA in response to viral
infection, cell stress, and translational inhibition have raised the
possibility that these transcripts serve a physiological role (19,
20, 28, 36). Since each of these treatments also affects protein
synthesis, we tested the effects of flAlu RNA on translation by using
the expression of a reporter gene. Overexpression of flAlu RNA
significantly increased the expression of a luciferase reporter.
Negative controls, particularly one employing scAlu RNA, indicated that
the stimulated expression of this reporter was not an artifact of RNA
overexpression but was attributable to the specific activity of flAlu
RNA. Furthermore, the levels of Alu overexpression required to cause an
increase in luciferase were comparable to the levels of flAlu RNA
induced by cell stress and viral infection, suggesting that endogenous levels of flAlu RNA have similar effects on translational expression. Similarly, levels of flAlu RNA overexpression comparable to those induced by cell stress and viral infection also caused a decrease in
PKR activity, suggesting a mechanism for the effects of flAlu RNA on
translational expression.
Viral infection and cell stress alter translation by multiple and
redundant pathways, including pathways which initially increase and
subsequently decrease eIF-2
phosphorylation, thereby first repressing and then derepressing translational initiation (12, 41). Significantly, in both cases, dephosphorylation of eIF-2
to reactivate translational initiation parallels the appearance of
entirely new mRNA cohorts encoding viral or heat shock proteins. Inhibition of translational elongation has previously been reported to
decrease eIF2
phosphorylation (42). In agreement with
that result, we observed that cycloheximide treatment caused a very rapid decrease in PKR activity, which may lead to a decrease in eIF-2
phosphorylation. Presumably, an increase in translational initiation would be an initial, regulated cellular response to a
decreased rate of translational elongation. In any event, PKR activity
was altered by each of these three cellular treatments, which also
increase the level of flAlu RNA.
We further observed that flAlu RNA bound PKR both in vitro and in vivo.
In gel mobility shift assays, Alu RNA formed discrete complexes with
PKR. The relationship of these complexes to either the binding of PKR
to Alu RNA in vivo or the inhibition of PKR by Alu RNA is uncertain.
However, under competitive binding conditions, preformed flAlu RNA
complexes were relatively stable compared to those formed by VAI RNA, a
well-studied PKR antagonist. Presumably, any RNA with a sufficient
secondary structure could bind to PKR in vitro (7, 31), but
many such RNAs, in the form of stable ribonucleoprotein structures,
would not be available for PKR binding in vivo. In agreement with this
suggestion, both VAI RNA and flAlu RNA bound PKR in vivo, but we did
not observe any interaction between PKR and 7SL RNA, which is far more
abundant than is flAlu RNA. As a component of fully formed, functional
signal recognition particles (SRPs), 7SL RNA would be protected from
PKR binding. The most active PKR inhibitors, as exemplified by VAI RNA,
may be highly structured RNAs which do not serve functions that require being tightly sequestered in ribonucleoprotein structures. flAlu RNA is
known to bind only the two smallest SRP proteins, presumably making it
accessible to PKR in vivo.
flAlu RNA was equally as effective as was VAI RNA in antagonizing the
activation of PKR in vitro; more importantly, overexpressed flAlu RNA
also antagonized virus-induced activation of PKR in vivo.
Interestingly, overexpressed flAlu RNA antagonized PKR activation to
almost the same degree as did far higher concentrations of VAI RNA,
leading us to conclude that flAlu RNA is indeed a potent PKR inhibitor.
Higher levels of overexpressed scAlu RNA did not cause this inhibition,
showing that the antagonism of PKR by flAlu RNA is not an artifact of
gross overexpression but depends upon the structure of flAlu RNA.
These observations suggest that endogenous flAlu RNA affects
translational expression by inhibiting PKR activation. We have not yet
tested this possibility directly. However, cell stress, cycloheximide
treatment, and viral infection changed PKR activity, which presumably
modulates changes in protein synthesis caused by these same treatments.
We also observed a rather simple dose-response relationship between the
abundance of exogenously expressed flAlu RNA and the levels of both
transiently coexpressed luciferase activity and PKR activity.
Furthermore, the increased levels of flAlu RNA caused by viral
infection, translational inhibition, and cell stress were similar to
the levels of flAlu RNA overexpression that stimulated expression of
the luciferase reporter and concomitantly decreased PKR activity. Thus,
we consider it a possibility that increases in flAlu RNA caused by
these three cellular treatments affect PKR activity and consequently
protein synthesis.
As a host defense against viral infection, PKR is activated by dsRNA to
phosphorylate eIF-2
, thereby blocking protein synthesis (8,
41). PKR is also an important signal transducer for interferon and cytokine induction of gene expression through regulation of transcription factors NF-
B and IRF-1 (25, 26). Viral
counterstrategies to block PKR activation include the synthesis of
massive quantities of small RNAs, such as VAI RNA in the case of
adenovirus, to antagonize PKR's activation (8, 22, 41). In
the most thoroughly studied case of adenovirus, viral gene products
direct the increase in Alu transcription after infection
(36). By binding PKR and antagonizing its activation, these
induced flAlu transcripts may provide another viral defense against PKR
activation by the host. There are already many known viral strategies
to counter host defenses, and the existence of yet another is not
surprising (41). Of course, VAI RNA encoded by adenovirus
accumulates to a much higher level than does short-lived flAlu RNA and
would therefore be expected to serve as a far more effective PKR
antagonist. However, virus-encoded pathways are often deleterious to
the host cell. A cellular PKR antagonist would not need to achieve the
level of PKR antagonism provided by VAI RNA. It is noteworthy that VAI
deletion mutants, although impaired, remain viable, indicating that
there are redundant pathways to overcome host defenses (41).
Although the physiological function of flAlu RNA cannot be to enhance
viral infectivity, viruses typically co-opt normal cellular regulatory
mechanisms.
As discussed above, a decrease in PKR activity is plausibly an initial
cellular response to the inhibition of translational elongation caused
by drugs such as cycloheximide. More than 20 years ago, Reichman and
Penman identified a factor, termed an activator, which stimulates
translational initiation (37). They demonstrated that this
activator is an RNA with a half-life of about 1 h, which is
approximately the short lifetime of flAlu RNA (6, 16). Like
flAlu RNA, activator RNA is induced by both heat shock and
cycloheximide treatment of cells. Comparing the results of Goldstein et
al. (16) to those of Liu et al. (28), the
transient increases in both activator RNA and flAlu RNA levels in
response to cycloheximide are virtually identical. We suspect that
flAlu RNA is this translational activator. Retrospectively, the
antagonism of PKR activation by the increased levels of flAlu RNA
caused by cycloheximide treatment provides a mechanistic explanation for the observed biochemical activity of activator RNA upon
translational initiation.
Hemin-regulated initiation factor-2 kinase, a PKR homolog,
phosphorylates eIF-2
in response to heat shock, but PKR itself has
no known role in the heat shock response (10). During
long-term heat shock, PKR changes from a soluble form to an insoluble
form (11). We observed transient increases in PKR activity
during heat shock recovery. However, the kinetic relationship of these changes in PKR activity to transient increases in flAlu RNA abundance during heat shock recovery is not evident. At present, any proposed function that PKR may serve during the heat shock response would be
entirely speculative; therefore, identifying the effects that flAlu RNA
may cause by acting on PKR during this period is even more problematic.
However, complex changes in translational expression occur during both
heat shock and heat shock recovery and, in part, these changes are
regulated by changes in eIF-2
phosphorylation (12).
Consequently, PKR and its regulators are almost certainly involved in
the heat shock response. As suggested above, activator RNA may be a PKR
regulator which is induced by heat shock (6, 16).
Ideally, the possibility that Alu RNA fulfills a physiological role
would be tested by genetics. Because of their extraordinary copy
number, Alu RNAs are not amenable to classical genetic tests. In
Tetrahymena spp., a small, Pol III-transcribed RNA rapidly accumulates
after heat shock and is required for the establishment of thermal
tolerance (13). Interestingly, this transcript, like human
Alu RNAs, is related to 7SL RNA. We do not know whether there is any
relationship between the function of this gene and the present
observations concerning flAlu RNA. However, there are several
intriguing parallels between these two systems and certainly the
Tetrahymena results provide strong precedence for the functionality of
small heat shock-induced RNAs.
This proposed role for human Alu RNA potentially explains some unusual
evolutionary features of mammalian SINEs. (i) There is no homology
between human Alu RNAs and many other mammalian SINEs, such as rabbit
SINEs (39, 44). Either SINEs are functionless or their
function(s) does not depend upon sequence but upon some other,
higher-order structure. However, entirely nonhomologous mammalian SINE
RNAs could antagonize PKR since the binding of PKR to duplex RNA
regions does not depend strongly on the sequence but rather requires a
minimum number of base pairs of sufficient base pair fidelity (8,
31). Interestingly, the dimeric structure of human Alu elements
may make their transcripts unusually potent PKR antagonists since each
flAlu RNA potentially binds two molecules of PKR. The results from gel
shift assays support this intriguing possibility. (ii) Individual
mammalian SINEs are weakly promoted; therefore, their expression is
easily repressed (6, 39). Nevertheless, the extremely large
number of SINEs guarantees that many elements are always in active
chromatin domains, thereby permitting a robust transcriptional response
in all cell types despite the weakness of their individual promoters
(6, 28). (iii) The short lifetime of SINE transcripts, which
lack other normal cellular functions, makes them ideally suited to
signal PKR. The abundance of a long-lived RNA serving an essential
constitutive function could not be rapidly and significantly increased
without disrupting that function.
Although an exact physiological role for Alu RNA and more generally
mammalian SINE RNAs remains to be determined, overexpressed Alu
transcripts stimulate translation and almost certainly do so by
antagonizing PKR activation. Adaptation of these effects to regulate
translational expression could provide a significant selective
advantage for the maintenance of SINEs within the mammalian genome. The
induction of Alu RNAs by cell stress and other treatments and the
association between Alu RNA and PKR suggest that this potential
selective advantage is being exploited.
 |
ACKNOWLEDGMENTS |
We thank John Hershey for critical interest and advice. We also
thank Wen-Man Liu for designing, testing, and providing clone XAL.
This research was supported in part by USPHS grant GM21346 and the
Agriculture Experiment Station, University of California, Davis
(C.W.S.) and USPHS grant AI 34039 (B.R.G.W.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Section of
Molecular and Cellular Biology and Department of Chemistry, University
of California, Davis, Davis, CA 95616. Phone: (916) 752-9029. Fax: (916) 752-3085. E-mail: cwschmid{at}ucdavis.edu.
 |
REFERENCES |
| 1.
|
Akusjarvi, G.,
C. Svensson, and O. Nygard.
1987.
A mechanism by which adenovirus virus-associated RNAI controls translation in a transient-expression assay.
Mol. Cell. Biol.
7:549-551[Abstract/Free Full Text].
|
| 2.
|
Barber, G. N.,
M. Wambach,
M. L. Wong,
T. E. Dever,
A. G. Hinnebusch, and M. G. Katze.
1993.
Translational regulation by the interferon-induced double-stranded-RNA-activated 68-kDa protein kinase.
Proc. Natl. Acad. Sci. USA
90:4621-4625[Abstract/Free Full Text].
|
| 3.
|
Bredow, S.,
D. Surig,
J. Muller,
H. Kleinert, and B. J. Benecke.
1990.
Activating-transcription-factor (ATF) regulates human 7SL RNA transcription by RNA polymerase III in vivo and in vitro.
Nucleic Acids Res.
18:6779-6784[Abstract/Free Full Text].
|
| 4.
|
Carpick, B. W.,
V. Graziano,
D. Schneider,
R. K. Maitra,
X. Lee, and B. R. G. Williams.
1997.
Characterization of the solution complex between the interferon-induced double-stranded RNA-activated protein kinase and HIV-1 trans-activating region RNA.
J. Biol. Chem.
272:9510-9516[Abstract/Free Full Text].
|
| 5.
|
Chong, K.,
K. Schappert,
J. Friesen,
T. Donahue,
A. Meurs,
A. G. Hovanessian, and B. R. G. Williams.
1992.
Expression of the human p68 kinase in yeast reveals a growth inhibiting phenotype and functional homology to the translational regulator GCN2.
EMBO J.
11:1553-1562[Medline].
|
| 6.
|
Chu, W.-M.,
W.-M. Liu, and C. W. Schmid.
1995.
RNA polymerase III promoter and terminator elements affect Alu transcription.
Nucleic Acids Res.
23:1750-1757[Abstract/Free Full Text].
|
| 7.
|
Clarke, P. A.,
M. Schwemmle,
J. Schickinger,
K. Hilse, and M. Clemens.
1991.
Binding of Epstein-Barr virus small RNA EBER-1 to the double-stranded RNA-activated protein kinase DAI.
Nucleic Acids Res.
19:243-248[Abstract/Free Full Text].
|
| 8.
|
Clemens, M. J.
1996.
Protein kinases that phosphorylate eIF2 and eIF2B and their role in eukaryotic cell translational control, p. 139-172. In
J. W. B. Hershey, M. B. Mathews, and N. Sonenburg (ed.), Translational control.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 9.
|
Davies, M. V.,
M. Futrado,
J. N. Hershey,
B. Thimmappaya, and R. J. Kaufman.
1989.
Complementation of adenovirus-associated RNA I gene deletion by expression of a mutant eukaryotic translation initiation factor.
Proc. Natl. Acad. Sci. USA
86:9163-9167[Abstract/Free Full Text].
|
| 10.
|
De Benedetti, A., and C. Baglioni.
1986.
Activation of hemin-regulated initiation factor-2 kinase in heat-shocked HeLa cells.
J. Biol. Chem.
261:338-342[Abstract/Free Full Text].
|
| 11.
|
Dubois, M. F.,
J. Galabru,
P. Lebon,
B. Safer, and A. G. Hovanessian.
1989.
Reduced activity of the interferon-induced double-stranded RNA-dependent protein kinase during a heat shock stress.
J. Biol. Chem.
264:12165-12171[Abstract/Free Full Text].
|
| 12.
|
Duncan, R. F.
1996.
Translational control during heat shock, p. 271-293. In
J. W. B. Hershey, M. B. Mathews, and N. Sonenburg (ed.), Translational control.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 13.
|
Fung, P. A.,
J. Gaertig,
M. A. Gorovsky, and R. L. Hallberg.
1995.
Requirement of a small cytoplasmic RNA for the establishment of thermotolerance.
Science
268:1036-1039[Abstract/Free Full Text].
|
| 14.
|
Galabru, J., and A. Hovanessian.
1987.
Autophosphorylation of the protein kinase dependent on double stranded RNA.
J. Biol. Chem.
262:15538-15544[Abstract/Free Full Text].
|
| 15.
|
Galabru, J.,
M. G. Katze,
N. Robert, and A. G. Hovanessian.
1989.
The binding of double-stranded RNA and adenovirus VAI RNA to the interferon-induced kinase.
Eur. J. Biochem.
178:581-589[Medline].
|
| 16.
|
Goldstein, E. S.,
M. E. Reichman, and S. Penman.
1974.
The regulation of protein synthesis in mammalian cells. VI. Soluble and polyribosome associated components in controlling in vitro polypeptide initiation in HeLa cells.
Proc. Natl. Acad. Sci. USA
71:4752-4756[Abstract/Free Full Text].
|
| 17.
|
Gunnery, S. A.,
A. P. Rice,
H. D. Robertson, and M. B. Mathews.
1990.
Tat-responsive region RNA of human immunodeficiency virus 1 can prevent activation of the double-stranded-RNA-activated protein kinase.
Proc. Natl. Acad. Sci. USA
87:8687-8691[Abstract/Free Full Text].
|
| 18.
|
Hickman, M. A.,
R. W. Malone,
K. Lehman-Bruinsma,
T. Sih,
D. Knoell,
F. C. Szoka,
R. Walzem,
D. M. Carlson, and J. S. Powell.
1994.
Gene expression following direct injection of DNA into liver.
Hum. Gene Ther.
5:1477-1483[Medline].
|
| 19.
|
Jang, K. L., and D. S. Latchman.
1992.
The herpes simplex virus immediate-early protein ICP27 stimulates the transcription of cellular Alu repeated sequences by increasing the activity of transcription factor TFIIIC.
Biochem. J.
284:667-673.
|
| 20.
|
Jang, K. L.,
M. K. Collins, and D. S. Latchman.
1992.
The human immunodeficiency virus tat protein increases the transcription of human Alu repeated sequences by increasing the activity of the cellular transcription factor TFIIIC.
J. Acquired Immune Defic. Syndr.
5:1142-1147.
|
| 21.
|
Katze, M. G.
1992.
The war against the interferon-induced dsRNA-activated protein kinase: can viruses win?
J. Interferon Res.
12:241-248[Medline].
|
| 22.
|
Katze, M. G.,
D. DeCorato,
B. Safer,
J. Galabru, and A. G. Hovanessian.
1987.
Adenovirus VAI RNA complexes with the 68,000 Mr protein kinase to regulate its autophosphorylation and activity.
EMBO J.
6:689-697[Medline].
|
| 23.
|
Katze, M. G.,
M. Wambach,
M.-L. Wong,
M. Garfinkel,
E. Meurs,
K. Chong,
B. R. G. Williams,
A. G. Hovanessian, and G. N. Barber.
1991.
Functional expression and RNA binding analysis of the interferon-induced, double-stranded RNA-activated, 68,000-Mr protein kinase in a cell-free system.
Mol. Cell. Biol.
11:5497-5505[Abstract/Free Full Text].
|
| 24.
|
Koski, R. A., and S. G. Clarkson.
1982.
Synthesis and mutation of Xenopus laevis methionine tRNA gene transcription homologous cell-free extracts.
J. Biol. Chem.
257:4514[Abstract/Free Full Text].
|
| 25.
|
Kumar, A.,
J. Hague,
J. Lacaste,
J. Hiscott, and B. R. G. Williams.
1994.
The dsRNA-dependent protein kinase, PKR, activates transcription factor NF- B by binding IkB.
Proc. Natl. Acad. Sci. USA
9:6288-6292.
|
| 26.
|
Kumar, A.,
Y.-L. Yang,
V. Flati,
S. Der,
S. Kadereit,
J. Hague,
A. Deb,
L. Reis,
C. Weismann, and B. R. G. Williams.
1997.
Deficient cytokine signaling in mouse embryo fibroblasts with a targeted deletion in the PKR gene: role of IRF-1 and NF B.
EMBO J.
16:406-416[Medline].
|
| 27.
|
Little, R., and M. Bratten.
1989.
Genomic organization of human 5S rDNA and sequence of one tandem repeat.
Genomics
4:376-383[Medline].
|
| 28.
|
Liu, W.-M.,
W.-M. Chu,
P. V. Choudary, and C. W. Schmid.
1995.
Cell stress and translational inhibitors transiently increase the abundance of mammalian SINE transcripts.
Nucleic Acids Res.
23:1758-1765[Abstract/Free Full Text].
|
| 29.
|
Liu, W.-M.,
R. J. Maraia,
C. M. Rubin, and C. W. Schmid.
1994.
Alu transcripts: cytoplasmic localization and regulation of DNA methylation.
Nucleic Acids Res.
22:1087-1095[Abstract/Free Full Text].
|
| 29a.
| Liu, W.-M., and C. W. Schmid.
Unpublished data.
|
| 30.
|
Maitra, R. K.,
N. A. J. McMillan,
S. Desai,
J. McSwiggen,
A. G. Hovanessian,
G. Sen,
B. R. G. Williams, and R. H. Silverman.
1994.
HIV-1 TAR RNA has an intrinsic ability to activate interferon-inducible enzymes.
Virology
204:823-827[Medline].
|
| 31.
|
Manche, L.,
S. R. Green,
C. Schmedt, and M. B. Mathews.
1992.
Interactions between double-stranded RNA regulators and the protein kinase DAI.
Mol. Cell. Biol.
12:5238-5248[Abstract/Free Full Text].
|
| 32.
|
Maraia, R. J.,
C. T. Driscoll,
T. Bilyeu,
K. Hsu, and G. J. Darlington.
1993.
Multiple dispersed loci produce small cytoplasmic Alu RNA.
Mol. Cell. Biol.
13:4233-4241[Abstract/Free Full Text].
|
| 33.
|
McMillan, N. A. J., and B. R. G. Williams.
1996.
Structure and function of the interferon-induced protein kinase PKR and related enzymes, p. 225-253. In
M. J. Clemens (ed.), Structure and function of the interferon-induced protein kinase, PKR, and related enzymes in protein phosphorylation in cell growth regulation.
Harwood Academic Publishers, Amsterdam, The Netherlands.
|
| 34.
|
Murtha-Riel, P.,
M. V. Davies,
B. J. Scherer,
S. Y. Choi,
J. W. Hershey, and R. J. Kaufman.
1993.
Expression of a phosphorylation-resistant eukaryotic initiation factor 2 alpha-subunit mitigates heat shock inhibition of protein synthesis.
J. Biol. Chem.
268:12946-12951[Abstract/Free Full Text].
|
| 35.
|
O'Malley, R. P.,
T. M. Mariano,
J. Siekierka, and M. M. Mathews.
1986.
A mechanism for the control of protein synthesis by adenovirus VA RNAI.
Cell
44:391-400[Medline].
|
| 36.
|
Panning, B., and J. R. Smiley.
1993.
Activation of RNA polymerase III transcription of human Alu repetitive elements by adenovirus type 5: requirement for the E1b 58-kilodaton protein and the products of E4 open reading frames 3 and 6.
Mol. Cell. Biol.
13:3231-3244[Abstract/Free Full Text].
|
| 37.
|
Reichman, M., and S. Penman.
1973.
Stimulation of polypeptide initiation in vitro after protein synthesis inhibition in vivo in HeLa cells.
Proc. Natl. Acad. Sci. USA
70:2678-2682[Abstract/Free Full Text].
|
| 38.
|
Schmedt, C.,
S. R. Gree,
L. Manche,
D. R. Taylor,
Y. Ma, and M. B. Mathews.
1995.
Functional characterization of the RNA-binding domain and motif of the double stranded RNA-dependent protein kinase DAI (PKR).
J. Mol. Biol.
249:29-44[Medline].
|
| 39.
|
Schmid, C. W., and R. Maraia.
1992.
Transcriptional regulation and transpositional selection of active SINE sequences.
Curr. Opin. Genet. Dev.
2:874-882[Medline].
|
| 40.
|
Schmid, C. W.
1996.
Alu: structure, origin, evolution, significance and function of one-tenth of human DNA.
Prog. Nucleic Acid Res. Mol. Biol.
53:283-319[Medline].
|
| 41.
|
Schneider, R. J.
1996.
Adenovirus and vaccinia virus translational control, p. 575-606. In
J. W. B. Hershey, M. B. Mathews, and N. Sonenburg (ed.), Translational control.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 42.
|
Scorsone, K. A.,
R. Panniers,
A. G. Rowlands, and E. C. Henshaw.
1987.
Phosphorylation of eukaryotic initiation factor 2 during physiological stresses which affect protein synthesis.
J. Biol. Chem.
262:14538-14541[Abstract/Free Full Text].
|
| 43.
|
Sinnett, D.,
C. Richer,
J. M. Deragon, and D. Labuda.
1992.
Alu RNA transcripts in human embryonal carcinoma cells. Model of post-transcriptional selection of master sequences.
J. Mol. Biol.
226:689-706[Medline].
|
| 44.
|
Weiner, A. M.,
P. L. Deininger, and A. Efstratiadis.
1986.
Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information.
Annu. Rev. Biochem.
55:631-661[Medline].
|
Mol Cell Biol, January 1998, p. 58-68, Vol. 18, No. 1
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Herceg, Z.
(2007). Epigenetics and cancer: towards an evaluation of the impact of environmental and dietary factors. Mutagenesis
22: 91-103
[Abstract]
[Full Text]
-
Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M.
(2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev.
70: 1032-1060
[Abstract]
[Full Text]
-
Hasler, J., Strub, K.
(2006). Alu elements as regulators of gene expression. Nucleic Acids Res
34: 5491-5497
[Abstract]
[Full Text]
-
Hasler, J., Strub, K.
(2006). Alu RNP and Alu RNA regulate translation initiation in vitro.. Nucleic Acids Res
34: 2374-2385
[Abstract]
[Full Text]
-
Kim, D. D.Y., Kim, T. T.Y., Walsh, T., Kobayashi, Y., Matise, T. C., Buyske, S., Gabriel, A.
(2004). Widespread RNA Editing of Embedded Alu Elements in the Human Transcriptome. Genome Res
14: 1719-1725
[Abstract]
[Full Text]
-
Yang, S., Smit, A. F., Schwartz, S., Chiaromonte, F., Roskin, K. M., Haussler, D., Miller, W., Hardison, R. C.
(2004). Patterns of Insertions and Their Covariation With Substitutions in the Rat, Mouse, and Human Genomes. Genome Res
14: 517-527
[Abstract]
[Full Text]
-
Jolly, C., Metz, A., Govin, J., Vigneron, M., Turner, B. M., Khochbin, S., Vourc'h, C.
(2004). Stress-induced transcription of satellite III repeats. JCB
164: 25-33
[Abstract]
[Full Text]
-
Doerwald, L., Onnekink, C., van Genesen, S. T., de Jong, W. W., Lubsen, N. H.
(2003). Translational Thermotolerance Provided by Small Heat Shock Proteins Is Limited to Cap-dependent Initiation and Inhibited by 2-Aminopurine. J. Biol. Chem.
278: 49743-49750
[Abstract]
[Full Text]
-
Wickstead, B., Ersfeld, K., Gull, K.
(2003). Repetitive Elements in Genomes of Parasitic Protozoa. Microbiol. Mol. Biol. Rev.
67: 360-375
[Abstract]
[Full Text]
-
Zhou, H.-R., Lau, A. S., Pestka, J. J.
(2003). Role of Double-Stranded RNA-Activated Protein Kinase R (PKR) in Deoxynivalenol-Induced Ribotoxic Stress Response. Toxicol Sci
74: 335-344
[Abstract]
[Full Text]
-
Deininger, P. L., Batzer, M. A.
(2002). Mammalian Retroelements. Genome Res
12: 1455-1465
[Abstract]
[Full Text]
-
Rubin, C. M., Kimura, R. H., Schmid, C. W.
(2002). Selective stimulation of translational expression by Alu RNA. Nucleic Acids Res
30: 3253-3261
[Abstract]
[Full Text]
-
Nussbaum, J. M., Gunnery, S., Mathews, M. B.
(2002). The 3'-untranslated regions of cytoskeletal muscle mRNAs inhibit translation by activating the double-stranded RNA-dependent protein kinase PKR. Nucleic Acids Res
30: 1205-1212
[Abstract]
[Full Text]
-
Ogiwara, I., Miya, M., Ohshima, K., Okada, N.
(2002). V-SINEs: A New Superfamily of Vertebrate SINEs That Are Widespread in Vertebrate Genomes and Retain a Strongly Conserved Segment within Each Repetitive Unit. Genome Res
12: 316-324
[Abstract]
[Full Text]
-
Bird, A.
(2002). DNA methylation patterns and epigenetic memory. Genes Dev.
16: 6-21
[Full Text]
-
Liang, R., Igarashi, H., Tsuzuki, T., Nakabeppu, Y., Sekiguchi, M., Kasprzak, K. S., Shiao, Y.-H.
(2001). Presence of Potential Nickel-Responsive Element(s) in the Mouse MTH1 Promoter. Annals of Clinical & Laboratory Science
31: 91-98
[Abstract]
[Full Text]
-
PARKER, L.M., FIERRO-MONTI, I., REICHMAN, T.W., GUNNERY, S., MATHEWS, M.B.
(2001). Double-stranded RNA-binding Proteins and the Control of Protein Synthesis and Cell Growth. Cold Spring Harb Symp Quant Biol
66: 485-498
[Abstract]
-
Stenger, J. E., Lobachev, K. S., Gordenin, D., Darden, T. A., Jurka, J., Resnick, M. A.
(2001). Biased Distribution of Inverted and Direct Alus in the Human Genome: Implications for Insertion, Exclusion, and Genome Stability. Genome Res
11: 12-27
[Abstract]
[Full Text]
-
Li, T.-H., Kim, C., Rubin, C. M., Schmid, C. W.
(2000). K562 cells implicate increased chromatin accessibility in Alu transcriptional activation. Nucleic Acids Res
28: 3031-3039
[Abstract]
[Full Text]
-
Osman, F., Jarrous, N., Ben-Asouli, Y., Kaempfer, R.
(1999). A cis-acting element in the 3'-untranslated region of human TNF-alpha mRNA renders splicing dependent on the activation of protein kinase PKR. Genes Dev.
13: 3280-3293
[Abstract]
[Full Text]
-
Stevens, R. W., Baltch, A. L., Smith, R. P., McCreedy, B. J., Michelsen, P. B., Bopp, L. H., Urnovitz, H. B.
(1999). Antibody to Human Endogenous Retrovirus Peptide in Urine of Human Immunodeficiency Virus Type 1-Positive Patients. CVI
6: 783-786
[Abstract]
[Full Text]
-
Gao, Y., Xue, S.-a., Griffin, B. E.
(1999). Sensitivity of an Epstein-Barr Virus-Positive Tumor Line, Daudi, to Alpha Interferon Correlates with Expression of a GC-Rich Viral Transcript. Mol. Cell. Biol.
19: 7305-7313
[Abstract]
[Full Text]
-
Krichevsky, A. M., Metzer, E., Rosen, H.
(1999). Translational Control of Specific Genes during Differentiation of HL-60 Cells. J. Biol. Chem.
274: 14295-14305
[Abstract]
[Full Text]
-
Urnovitz, H. B., Tuite, J. J., Higashida, J. M., Murphy, W. H.
(1999). RNAs in the Sera of Persian Gulf War Veterans Have Segments Homologous to Chromosome 22q11.2. CVI
6: 330-335
[Abstract]
[Full Text]
-
Kumar, K. U., Srivastava, S. P., Kaufman, R. J.
(1999). Double-Stranded RNA-Activated Protein Kinase (PKR) Is Negatively Regulated by 60S Ribosomal Subunit Protein L18. Mol. Cell. Biol.
19: 1116-1125
[Abstract]
[Full Text]
-
Goodier, J. L., Maraia, R. J.
(1998). Terminator-specific Recycling of a B1-Alu Transcription Complex by RNA Polymerase III Is Mediated by the RNA Terminus-binding Protein La. J. Biol. Chem.
273: 26110-26116
[Abstract]
[Full Text]
-
Ueda, Y., Chaudhuri, G.
(2000). Differential Expression of B1-containing Transcripts in Leishmania-exposed Macrophages. J. Biol. Chem.
275: 19428-19432
[Abstract]
[Full Text]
-
Tian, B., Mathews, M. B.
(2001). Functional Characterization of and Cooperation between the Double-stranded RNA-binding Motifs of the Protein Kinase PKR. J. Biol. Chem.
276: 9936-9944
[Abstract]
[Full Text]