This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Honkakoski, P.
Right arrow Articles by Negishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Honkakoski, P.
Right arrow Articles by Negishi, M.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, October 1998, p. 5652-5658, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

The Nuclear Orphan Receptor CAR-Retinoid X Receptor Heterodimer Activates the Phenobarbital-Responsive Enhancer Module of the CYP2B Gene

Paavo Honkakoski,dagger Igor Zelko, Tatsuya Sueyoshi, and Masahiko Negishi*

Pharmacogenetics Section, Laboratory of Reproductive and Developmental Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina 27709

Received 17 March 1998/Returned for modification 21 April 1998/Accepted 7 July 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

PBREM, the phenobarbital-responsive enhancer module of the cytochrome P-450 Cyp2b10 gene, contains two potential nuclear receptor binding sites, NR1 and NR2. Consistent with the finding that anti-retinoid X receptor (RXR) could supershift the NR1-nuclear protein complex, DNA affinity chromatography with NR1 oligonucleotides enriched the nuclear orphan receptor RXR from the hepatic nuclear extracts of phenobarbital-treated mice. In addition to RXR, the nuclear orphan receptor CAR was present in the same enriched fraction. In the phenobarbital-treated mice, the binding of both CAR and RXR was rapidly increased before the induction of CYP2B10 mRNA. In vitro-translated CAR bound to NR1, but only in the presence of similarly prepared RXR. PBREM was synergistically activated by transfection of CAR and RXR in HepG2 and HEK293 cells when the NR1 site was functional. A CAR-RXR heterodimer has thus been characterized as a trans-acting factor for the phenobarbital-inducible Cyp2b10 gene.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cytochromes P-450 (CYPs) comprise a superfamily of heme-thiolate proteins. They function as monooxygenases that are activated by accepting electrons from NADPH-CYP reductase (19). The CYP enzymes display diverse functions, from the synthesis and degradation of biological signaling molecules such as steroid hormones and fatty acid derivatives to the metabolism of xenobiotic chemicals including pharmaceutical drugs and environmental contaminants and carcinogens. Phenobarbital (PB) is the prototype of a large group of structurally diverse xenobiotic chemicals that induce the subset of the CYP genes within the CYP2A, CYP2B, CYP2C, and CYP3A subfamilies, with the CYP2B genes being the most effectively induced (3, 4, 8, 14, 24). PB-type inducers regulate mainly at the transcription level. Compared with the well-known Ah receptor-mediated regulation of the CYP1A1 gene (4, 6), the mechanism by which PB induces transcription of the CYP2B genes has been elusive.

Recently, PB-responsive enhancer activity has been associated with DNA sequences found approximately -2.3 kbp upstream of the initiation site of the rat CYP2B2 and mouse Cyp2b10 genes (8, 9, 18, 23). The core enhancer sequence is the 51-bp DNA sequence located at bp -2339 to -2289 of the Cyp2b10 gene and was designated phenobarbital-responsive enhancer module (PBREM) (8-10). PBREM seems to be a general PB-responsive enhancer since it responds to numerous PB-type inducers including 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP), polychlorinated biphenyls, chlorinated pesticides, organic solvents, and some plant products such as camphor (10). The PBREM sequences are conserved and functional in the PB-inducible rat CYP2B genes but are mutated and nonfunctional in the noninducible mouse Cyp2b9 gene (8). The nuclear factors that regulate the PBREM activity have not been identified.

PBREM contains putative nuclear receptor binding sites, NR1 and NR2, that flank a nuclear factor 1 (NF1) binding site. Specific mutations of these NR sites resulted in a complete loss of the responsiveness of PBREM to PB-type inducers (8, 10). In this study, we have identified the nuclear orphan receptors CAR and retinoid X receptor (RXR), which bind to the NR1 site of PBREM in response to PB induction. Additionally, we have demonstrated an activation of PBREM by these orphan receptors in transformed cell lines. CAR is known to activate a subset of retinoic acid-responsive elements (1), and the Cyp2b10 gene appears to be the first identified target gene for this orphan receptor.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Reagents. Antibodies against mouse isoforms of TRalpha 1 (sc-772X), RARalpha /beta /gamma (sc-773X), RXRalpha (sc-553X), RXRbeta (sc-831X), RXRgamma (sc-555X), and c-jun (sc-044X) were purchased from Santa Cruz Biotechnology. Anti-COUP-TFII and anti-HNF4 were kind gifts from Ming-Jer Tsai and James Darnell, Jr., respectively. Anit-hCAR was raised in rabbits against the bacterial recombinant protein. Another antibody to mCAR was also raised by immunizing rabbits by the peptide (CALFSPDRPGVTQREEIDQLQE) containing 21 residues from 276 to 296 of murine CAR (mCAR). The following expression plasmids were kindly provided: RXR by Ronald Evans, TRalpha 1 by Leslie DeGroot, COUP-TFI by Ming-Jer Tsai, FXR by Cary Weinberger, pCMV-LXR by David Mangelsdorf, pCMV-HNF4 by James Darnell, Jr., and pCMV-MB67 by David Moore. [alpha -32P]dATP (>6,000 Ci/mmol), [14C]dichloroacetylchloramphenicol (56 mCi/mmol), and L-[14C]leucine (>300 mCi/mmol) were purchased from Amersham.

Transient transfection. The primary hepatocytes were prepared from 2-month-old C57BL/KS/J male mice (Jackson Laboratory) by two-step collagenase perfusion (7). These hepatocytes were electroporated with 30 µg each of individual enhancer-pBLCAT2 reporter plasmids (15) and 10 µg of pSVbeta gal control plasmid (Promega). Transfected cells on dishes (2 × 106 to 3 × 106 cells) were cultured for 24 h in the absence or presence of inducers under the previous conditions. HepG2 and HEK293 cells were cultured in minimal essential medium supplemented with 10% fetal bovine serum, 100 U of penicillin per ml, and 100 µg of streptomycin per ml and transfected by the calcium phosphate method (CellPhect kit; Pharmacia). As described in our previous papers (7, 8), the cell extracts from either transfected hepatocytes or the transformed cell lines were assayed for protein or beta -galactosidase, heat treated for 20 min, and assayed for chloramphenicol acetyltransferase (CAT) activity. All the experiments were done in triplicate, and the data were normalized for beta -galactosidase activity.

DNA affinity chromatography. Adult Crl:CDS-1(ICR)BR mice (Charles River Breeding Co.) were treated with PB (100 mg/kg of body weight, injected intraperitoneally). Between 3 and 5 h after PB treatment, the mouse liver nuclear extracts were prepared and were applied to a heparin-agarose column (22, 25). The fractions which exhibited NR1 binding activity were subsequently incubated with NR1-conjugated Dynabeads under the conditions previously described (22, 25). Pooled fractions from the agarose column were dialyzed against buffer A (25 mM Tris-HCl [pH 7.5] buffer containing 0.5 mM EDTA, 0.5 mM dithiothreitol, 10% glycerol, and 0.05% Nonidet P-40 [NP-40]) and incubated for 30 min at 4°C with 20 µg of herring sperm DNA per ml, 10 µg of poly(dI · dC) per ml, and 25 µg of NR1* oligonucleotides per ml. Following incubation for 30 min at 4°C, the beads were washed three times with buffer A that contained increasing concentrations of NaCl (0.1, 0.2, 0.3, and 0.5 M).

Recombinant proteins. The CARs were bacterially expressed. For mCAR, the coding sequence was amplified from mouse liver cDNAs with 5'AGTCTCGGATCCATGACAGCTATGCTAACACT3' and 5'AGAGTCCTCGAGTCAACTGCAAATCTCCCCGA3' as primers (GenBank no. AF009327) and the amplified mCAR DNA fragment was cloned into pGEX-4T.3 (Pharmacia) at the BamHI and XhoI sites. By using the MB67 (human CAR [hCAR])-bearing pT7HisMyc plasmid (1), the recombinant hCAR was expressed in inclusion bodies and purified by metal affinity chromatography on His-Bind Resin (Novagen Inc.) in the presence of 6 M guanidine. The radiolabeled RXRalpha , hCAR, and mCAR were synthesized by using one-step in vitro transcription and translation (TNT coupled reticulocyte lysate system; Promega).

Gel shift assays and Western blot analysis. Gel shift assays were done in 10 µl of 10 mM HEPES (pH 7.6)-0.5 mM dithiothreitol-15% glycerol-2 µg of poly(dl · dC)-0.05% NP-40-50 mM NaCl with approximately 30,000 cpm of 32P-end-labeled oligonucleotide probe. In competition experiments, mixtures of unlabeled oligonucleotides in 20- or 50-fold excess were added before the start of the binding reaction initiated by nuclear extract. In antibody supershift experiments nuclear extracts were preincubated at 25°C with 1 µg of preimmune immunoglobulin G (IgG) or specific IgG for 15 min before being subjected to electrophoresis on a 5% acrylamide gel. For Western blot analysis, the proteins resolved on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel (10% polyacrylamide) were transferred to a polyvinylidene difluoride membrane that was incubated with anti-RXR or anti-hCAR (anti-recombinant hCAR and anti-hCAR peptide). After the secondary anti-rabbit IgG-horseradish peroxidase (1:5,000 dilution), the immunoreactive bands were visualized with enhanced chemiluminescence reagents (Amersham Life Science Inc.).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Functional analysis of the NR sites of PBREM. Spacing and mutation variants of the NR1 site were introduced into the context of the wild-type 51-bp PBREM sequence. The mutated elements were ligated to thymidine kinase (tk)-CAT reporter plasmids and transfected into mouse primary hepatocytes to test their responsiveness (Fig. 1). As expected, the wild-type PBREM displayed the highest enhancer activity, showing 7- to 10-fold induction of CAT expression. We altered the number of nucleotides in the spacer of the wild-type NR1 site of PBREM from 4 to 2, 5, or 7 (SP2-CAT, SP5-CAT, or SP7-CAT). The responsiveness of the altered PBREMs was decreased dramatically to only threefold induction by the 2- or 7-bp spacer. Alteration of the NR1 sequence to the perfect AGGTCA repeats (PDR4-CAT) also resulted in a significant loss of PBREM activity. Additionally, the responsiveness of the SP5-CAT plasmid was relatively high, about 75% of the wild-type value. Thus, NR1 responded most efficiently when it retained the wild-type characteristics of DR4, although it responded well as a DR5 motif.


View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1.   Functional assays to define the NR1 site as a DR4 motif. (A) The 51-bp enhancer-tk-CAT plasmids of the spacing and mutation variations of the 51-bp enhancer element were placed in front of the tk-CAT plasmids and were transfected into mouse primary hepatocytes. The CAT activity of the transfected cell extracts in the absence or the presence of 50 nM TCPOBOP is shown by open and solid bars, respectively. The data shown are means and standard deviations from three or four independent transfections, relative to the activity of the wild-type 51-bp enhancer element (wt = 100). (B) The PBREM sequence and motifs are depicted. The half-sites (a and b) of the putative NR binding sites are shown in boldface type. The bipartite NF1 binding motif is boxed.

The roles of each half-site in responsiveness were also examined (Fig. 1). For this purpose, the individual half-sites were mutated by a 4-bp central CTGG substitution within the context of the PBREM-TK-CAT plasmids. Each of these half-site mutations decreased the responsiveness of the PBREM to less than threefold induction, whereas double mutations of both NR1 and NR2 half-sites (NR1a2a dm and NR1b2b dm) completely abolished activity. Mutation of the NF1 site decreased the basal activity by 20% and reduced the responsiveness to 4.6-fold induction. While the NF1 mutation was as effective as a single half-site mutation in decreasing the PBREM activity, it did not abolish the activity. These results showed that both NR sites play major roles in the activation of PBREM and that the individual NR half-sites are essential for full responsiveness.

Binding analysis of the NR1 site. The functional analysis was followed by a search for nuclear proteins that could bind to the NR1 site. Since the binding of a nuclear orphan receptor is dictated by the sequence, orientation, and spacing of the half-sites (16, 17), several oligonucleotides containing altered spacing and substitution were designed as NR1 binding competitors (Fig. 2A). The binding of NR1 probe to the PB-treated liver nuclear extracts was completely abolished by oligonucleotide SP4 and effectively abolished by SP5 but was decreased only slightly by SP3 (Fig. 2B). Neither PDR4 nor MUT-SP competed with NR1 for binding to nuclear proteins: the 4-bp TTCC spacer was changed to GGAA in MUT-SP. The competition was decreased when the four central nucleotides of either NR1a or NR1b was mutated to CTGG (NR1a mut and NR1b mut) or when the direct repeat was changed to an inverted or everted repeat (IR4 and ER4). Thus, the characteristics of binding of NR1 to the nuclear protein were consistent with the transcription activity studies, indicating that NR1 is most active in the original imperfect DR4 motif.


View larger version (59K):
[in this window]
[in a new window]
  		FIG. 2.   Gel shift assay to define the NR1 site as a DR4 motif and RXR binding. (A) Sequences of indicated NR1 mutants used as competitors for NR1 binding are compared to the wild-type NR1 (SP4 = wt). Spacer mutations are denoted by SP with numbers of bases. In MUT-SP, four bases of spacer are mutated. In addition to a random mutation in either the NR1a or NR1b site (NR1a mut and NR1b mut), these sites are mutated to create a perfect direct repeat with different orientations (PDR4, IR4, and ER4). The dots and hyphens indicate no change and deletions, respectively. The different nucleotides are shown in lowercase type. (B) Competition for NR1 binding was done with a 20-fold excess of indicated oligonucleotides. (C) Supershift assays were done by incubating preimmune IgG (1 µg) or indicated antibodies (1.5 µg) with liver nuclear extract from PB-treated mice. The results are representative of three independent experiments.

Supershift assays performed with antibodies of various DR4 motif binding receptors such as COUP-TF, thyroid hormone receptor (TR), retinoic acid receptor (RAR) and RXR indicated that only anti-RXRalpha created a new, slower-migrating complex (Fig. 2C). Under the gel shift conditions, the major NR1 binding complex of the PB-treated liver nuclear extracts appeared to contain RXR. Anti-HNF4 and anti-AP-1 were used as controls, since HNF4 and AP-1 are not DR4 binding proteins. As expected, these antibodies did not supershift the NR1 complex. The results strongly suggested that the NR1-nuclear protein complex contains RXR.

RXRalpha , RXRbeta , and mCAR as NR1 binding proteins. A related CYP2B gene, the mouse Cyp2b9 gene, is not PB inducible. The sequence of this gene corresponding to PBREM had diverged, resulting in a nonfunctional PBREM element (8, 9). Moreover, the mutated NR1 sequence (NR1*) of the Cyp2b9 gene did not compete with the functional NR1 for binding to nuclear proteins. Using DNA-affinity beads of the NR1 or NR1* oligonucleotides, we performed chromatography on the hepatic nuclear extracts from the PB-treated (for 3 to 5 h) and untreated mice. Gel shift assays showed that the NR1 binding proteins were recovered only from the NR1 affinity beads and were enriched mainly in the 0.5 M NaCl eluates from the samples from the PB-treated mice (Fig. 3A, right-hand lane). As shown in Fig. 3B, the subsequent Western blot analysis with anti-RXRalpha and anti-RXRbeta detected a single band that was similar in its apparent molecular mass to RXR (60 kDa). Since anti-RXRgamma did not react with the band (data not shown), the NR1 binding proteins with molecular masses near 60 kDa were RXRalpha and RXRbeta . Consistent with the results of the gel shift assays, RXRs were purified only from the samples from the PB-treated mice. Since the RXRs in the various fractions applied to the column exhibited the same levels, PB appeared to induce an RXR complex that could bind to NR1 probe. The RXR binding thus seems to be specific to the NR1 site and to PB induction.


View larger version (76K):
[in this window]
[in a new window]
 

View larger version (36K):
[in this window]
[in a new window]
  		FIG. 3.   DNA affinity chromatography of RXRs and CAR. Pooled fractions of the liver nuclear extracts from a heparin-agarose column were incubated with either NR1 oligonucleotide-conjugated or NR1* oligonucleotide-conjugated magnetic beads. C and PB denote the extracts isolated from the untreated and the PB-treated (for 3 to 5 h) mice. The proteins were eluted from the beads with 0.3 and then 0.5 M NaCl. (A) The eluted proteins were subjected to a gel shift assay with NR1 as the probe. Nuclear extracts (1 µg of protein) and approximately 0.1 to 0.05 µg of the eluted proteins were used for gel shift assay. (B) For Western blots, 10 µg of nuclear extracts and 0.05 µg of the eluted proteins were resolved on an SDS-10% polyacrylamide gel and immunoblotted with anti-RXRalpha or anti-RXRbeta IgG (1:3,000 dilution) or anti-hCAR serum (1:250 dilution). The arrows pointing to and from the bars indicate the applied and path-through fractions, respectively. Prestained Protein Marker Broad Range (New England Biolabs) was used as the molecular mass maker (shown in thousands). The results are representative of at least two independent purifications.

Given the facts that induction by PB of the Cyp2b10 gene was liver specific (7), that NR1 binding protein preferred the DR4 and DR5 motif, and that RXR was present in the NR1 binding complex, we assumed that the NR1 binding protein was a RXR heterodimer with a liver-enriched orphan receptor. Since the orphan nuclear receptor CAR met these criteria, its association with NR1 was examined. Antibodies (anti-hCAR) were raised against the bacterially expressed hCAR and the 21-residue peptide of mCAR in rabbits. Both antibodies cross-reacted with the bacterially expressed mCAR (data not shown). These anti-CAR antibodies could not shift the NR1-nuclear protein complex in the gel shift assay, because their antigenic sites may be masked by protein-protein and/or protein-DNA interactions of the complex. We therefore used these antibodies in a Western blot analysis to detect mCAR. Anti-hCAR visualized a specific band on a Western blot of the 0.5 M NaCl eluate of the PB-treated extracts from the NR1-affinity beads (Fig. 3B right-hand lane). The apparent molecular mass of this immunoreactive band was 40 kDa, which agreed with the molecular mass (40,893 Da) calculated from the deduced amino acid sequence of mCAR1 (2). This indicated that the NR1 binding complex contains both mCAR and RXR, presumably as a heterodimer.

Time-dependent binding of mCAR1 and RXR after PB treatment. Supershift assays with anti-RXRalpha and the hepatic nuclear extracts prepared at various times after PB treatment showed that the level of the NR1-RXR complex had an initial sharp increase that peaked at 3 h and then began to decrease at 24 h (Fig. 4). Importantly, this increase in the level of the complex preceded the rise in the CYP2B10 mRNA level. To obtain direct evidence of increasing binding of the nuclear orphan receptors CAR and RXR to NR1, we precipitated the NR1-nuclear protein complex by using NR1 affinity beads and analyzed it by Western blotting (Fig. 5). Anti-hCAR detected a single band at the molecular mass corresponding to mCAR, and this band was not recovered in the presence of the competitive NR1 oligonucleotide. In accordance with the increase in the level of the supershift band and preceding the mRNA induction, mCAR dramatically increased its binding to NR1, with the level of the complex peaking at 3 h after PB treatment. RXRalpha (or RXRbeta [data not shown]) also displayed a rapid increase in its binding to NR1 after PB treatment (Fig. 5). The high binding level of RXR, however, remained at 24 h, at which time the level of mCAR was significantly decreased, suggesting that mCAR was not the only orphan receptor that bound to NR1 as an RXR heterodimer in response to PB induction. Since the time course of the mCAR binding was more consistent with those of the anti-RXR supershifts and of the CYP2B10 mRNA level, the CAR-RXR heterodimer was implicated as the regulatory factor for the PB-inducible transcription. Because of their later appearance after PB treatment, other possible RXR heterodimers may display low-affinity binding to NR1 and may not regulate the activation of PBREM.


View larger version (74K):
[in this window]
[in a new window]
  		FIG. 4.   Supershift displaying the PB-dependent increase in RXR binding to NR1. (A) Liver nuclear extracts were prepared from 20 PB-treated mice injected at each time point. Three independent nuclear extracts were prepared from each time point, and 1 µg of the nuclear proteins per line was incubated with NR1 oligoprobe as described in Materials and Methods and resolved on a 5% polyacrylamide gel. The arrow indicates a band shifted by anti-RXRalpha . (B) Total RNA (6 µg per lane) prepared from the same liver pool at each time point was subjected to Northern hybridization with the CYP2B10 and albumin cDNA probes. The number above each lane indicates the time (in hours) after PB treatment. These results are representative of two or more independent experiments.


View larger version (30K):
[in this window]
[in a new window]
  		FIG. 5.   Western blot displaying the PB-dependent binding of mCAR1 and RXR to NR1. Liver nuclear extracts (1 mg of proteins in 1 ml of the incubation mixture) from the PB-treated mice at each time point (1 to 24 h) were incubated with NR1 affinity beads. In the right-hand lane (6 hr. + NR1), an excess amount of NR1 oligonucleotide (10 µg) was included as a competitor during the incubation. A 30-µl volume of the 100-µl eluates with 0.5 M NaCl was subjected to Western blot analysis with anti-RXRalpha IgG (1:3,000 dilution) and anti-CAR (peptide) serum (1:250 dilution). The results are representative of five or more independent experiments.

In vitro binding to NR1 and synergistic activation of PBREM. Since the key NR1-nuclear protein complex appeared to be the mCAR-RXR heterodimer, in vitro-translated RXR and CAR (either mCAR or hCAR) were used for the gel shift assay to verify their binding to NR1 (Fig. 6). Neither CAR nor RXRalpha alone was able to bind to NR1, but their mixture displayed specific binding to NR1. The binding was effectively competed with NR1 oligonucleotide but not with NR1* oligonucleotide. With respect to the specificity of spacing variations (Fig. 2B), the binding of the in vitro-translated mCAR-RXR heterodimer to NR1 was competed most effectively by SP4, followed by SP5 and then by SP3. The SP0, SP1, SP2, and SP7 oligonucleotides did not affect the NR1 binding to the in vitro-translated mCAR-RXR heterodimer.


View larger version (80K):
[in this window]
[in a new window]
  		FIG. 6.   Binding of in vitro-translated CAR and RXR to NR1 probe. Gel shifts were performed using in vitro-translated CARs (1.25 µl each) and RXR (1.25 µl) and 32P-labeled NR1 probe. For competitions, a 50-fold molar excess of each cold oligonucleotide was added to the reaction mixtures. The figure was generated from an experiment with mCAR since hCAR bound to the NR1 probe with the same specificity as did mCAR. The solid arrowhead indicates a gel shift band formed with RXR, mCAR, and NR1, while the open arrowheads point to supershift bands by anti-RXR. The results are representative of two or more independent experiments.

Transfection of RXR alone did not activate PBREM in HepG2 or HEK293 cells (Fig. 7). Transfection of hCAR, on the other hand, resulted in an approximately 10-fold increase of the PBREM activity without the presence of a PB-type inducer. Moreover, a synergistic increase was observed when RXR was transfected in addition to hCAR. Endogenously expressed RXR in the transfected cells might have contributed the 10-fold increase by hCAR and the relatively small increase by further transfection of RXR. Other nuclear orphan receptors including LXRalpha , TRalpha 1, and HNF4 failed to induce transcription from the PBREM-linked reporter gene (Fig. 7). The activation was also specific to the NR1 sequence, since space alterations (SP2 and SP7) and half-site mutations (NR1a mut and NR1b mut) decreased the activation to approximately 2-fold from the original 10-fold.


View larger version (18K):
[in this window]
[in a new window]
  		FIG. 7.   Activation of PBREM by CAR and RXR in the transformed cell lines. The HepG2 (or HEK293) cells were transfected at 30 to 40% confluence with 0.5 µg (or 0.4 µg) of the appropriate CAT reporter plasmid, 0.5 µg (or 0.125 µg) of beta -galactosidase plasmid, and 0.15 µg (or 0.075 µg) of expression vector for individual nuclear receptors. At 48 h after transfection, cell extracts were assayed for beta -galactosidase and CAT activities. The fold inductions of the normalized CAT activities are compared with the activity from the PBREM-tk-CAT alone (set to 100). Standard deviations were calculated from at least three independent experiments.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Inducible gene transcription as a result of exposure to xenobiotic chemicals is characteristic of the xenobiotic-metabolizing enzymes. PB alone can induce the genes encoding CYP, NADPH-CYP reductase, and different transferases involved in conjugation reactions, in addition to many other genes (9, 24). We have now identified the nuclear orphan receptors CAR and RXR as factors regulating the transcription of the PB-inducible Cyp2b10 genes. Presumably as the RXR heterodimer, CAR regulates the enhancer activity of the 51-bp PBREM through its binding to the NR1 site. The Cyp2b10 gene is the first target gene identified for the orphan receptor CAR.

hCAR (originally called MB67) was initially cloned by screening a human liver cDNA library with degenerate oligonucleotides corresponding to the DNA binding domain (P box) of the RAR/TR orphan receptor subfamily (1). CAR is a liver-enriched nuclear receptor and, as a heterodimer with RXR, can activate a subset of retinoic acid response elements (RAREs) consisting of direct repeats related to the hexamer AGGTCA (1, 2). In the light of the fact that the CAR-RXR heterodimer can regulate the PBREM activity in the transformed cell lines, does CAR bind to NR1 in vivo in response to PB induction so as to regulate the PB-inducible transcription of the Cyp2b10 gene? Indeed, CAR binding to NR1, presumably as a heterodimer with RXR, increased sharply after PB treatment. The PB-induced increase in CAR binding occurred in accordance with that of the supershift band by anti-RXR and preceded the accumulation of CYP2B10 mRNA. Moreover, the mRNA level decreased as the level of CAR decreased at 24 h after PB induction. These results therefore provide compelling evidence that the CAR-RXR heterodimer is a trans-acting factor responsible for NR1-mediated transcription activity from PBREM in the liver. PBREM is a composite regulatory element consisting of two NR sites with different sequences and NF1 site. It responds to the numerous structurally unrelated PB-type inducers (10). Our present studies therefore do not limit orphan receptors involved in the induction of the CYP2B gene by PB only to CAR.

Since none of the transformed cell lines, including HepG2 cells, responds to PB by inducing the CYP2B genes, it is not possible at present to investigate directly whether and how PB can activate the binding of mCAR to PBREM. The constitutive (or intrinsic) activation by mCAR in cell lines in the absence of PB may have several explanations. mCAR may be activated by a potential ligand present in the cell culture medium. Alternatively, an unknown repressor of mCAR in the liver may not have been present in the cell lines. The repressors can be proteins, such as SHP, which represses the activation of RAREs by various orphan receptors including mCAR (20), or they can be metabolites, such as geranylgeraniol, that repress the nuclear orphan receptor LXRalpha (5). In addition, a role for protein phosphorylation and dephosphorylation in the PB induction of CYP2B genes is evident (11, 21). CAR may be constitutively activated by the lack of proper signaling pathways in the transformed cell lines. However, each of these possible explanations may be a clue to uncovering the induction mechanism in the liver.

With respect to the scores of the PB-type inducers, many of the members of this immense group of structurally unrelated chemicals can activate transcription from the PBREM-CAT reporter gene in the mouse primary hepatocytes (10). It would be interesting to see whether the CAR-RXR heterodimer can mediate most of these activations. Expression of the PB-inducible P-450 genes can also be affected by endocrine factors, such as glucocorticoid, sex, and thyroid hormones (reference 9 and references therein). Since these endocrine factors often control their target genes through nuclear steroid hormone receptors, these factors may interfere with PB induction signals by inducing cross talk between nuclear receptors. The CYP-dependent metabolism can, on the other hand, produce a practically unlimited number of potential ligands (both endogenous hormones and exogenous chemicals) for the nuclear receptors. It appears that the induction of the CYP genes may depend on a tight interaction between members of the two superfamilies, those of the nuclear receptor and the CYP genes themselves. Our present finding that the CAR-RXR heterodimer is a PB-responsive trans-acting factor strengthens this view, and as an additional example, the CYP4A gene is activated by exposure to peroxisome proliferators through binding of the PPAR-RXR heterodimer (12, 13). The PXR-RXR heterodimer may activate transcription of CYP3A gene by synthetic glucocorticoids such as pregnenolone 16alpha -carbonitrile and dexamethasone t-butylacetate (13a). Finally, a large group of the nuclear orphan receptors may provide cells with the capability to induce the various CYP genes and other genes responsive to unlimited numbers of xenobiotic chemicals.

    ACKNOWLEDGMENTS

We thank Cary Weinberger and Anton Jetten (both at National Institute of Environmental Health Sciences) for helpful discussion and comments on the manuscript.

P.H. and I.Z. contributed equally to this work.

    FOOTNOTES

* Corresponding author. Mailing address: Pharmacogenetics Section, Laboratory of Reproductive and Developmental Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709. Phone: (919) 541-2404. Fax: (919) 541-0696. E-mail: negishi{at}niehs.nih.gov.

dagger Present address: Department of Pharmaceutics, University of Kuopio, FIN-70211 Kuopio, Finland.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Baes, M., T. Gulick, H. Choi, M. Martinoli, D. Simha, and D. D. Moore. 1994. A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements. Mol. Cell. Biol. 14:1544-1552[Abstract/Free Full Text].
2. Choi, H.-S., M. Chung, I. Tzameli, D. Simha, Y.-K. Lee, W. Seol, and D. D. Moore. 1997. Differential transactivation by two isoforms of the orphan nuclear hormone receptor CAR. J. Biol. Chem. 272:23565-23571[Abstract/Free Full Text].
3. Conney, A. H. 1967. Pharmacological implications of microsomal enzyme induction. Pharmacol. Rev. 19:317-366[Abstract/Free Full Text].
4. Denison, M. S., and J. P. Whitlock, Jr. 1995. Xenobiotic-inducible transcription of cytochrome P450 genes. J. Biol. Chem. 270:18175-18178[Free Full Text].
5. Forman, B. M., B. Ruan, J. Chen, G. J. Scroepfer, Jr., and R. M. Evans. 1997. The orphan nuclear receptor LXRalpha is positively and negatively regulated by distinct products of mevalonate metabolism. Proc. Natl. Acad. Sci. 94:10588-10593[Abstract/Free Full Text].
6. Hankinson, O. 1995. The aryl hydrocarbon receptor complex. Annu. Rev. Pharmacol. Toxicol. 35:307-340[Medline].
7. Honkakoski, P., R. Moore, J. Gynther, and M. Negishi. 1996. Characterization of phenobarbital-inducible mouse Cyp2b10 gene transcription in primary hepatocytes. J. Biol. Chem. 271:9746-9753[Abstract/Free Full Text].
8. Honkakoski, P., and M. Negishi. 1997. Characterization of a phenobarbital-responsive enhancer module in mouse P450 Cyp2b10 gene. J. Biol. Chem. 272:14943-14949[Abstract/Free Full Text].
9. Honkakoski, P., and M. Negishi. 1998. Regulatory DNA elements of phenobarbital-responsive cytochrome P450 CYP2B genes. J. Biochem. Mol. Toxicol. 12:3-9[Medline].
10. Honkakoski, P., R. Moore, K. Washburn, and M. Negishi. 1998. Activation by diverse xenochemicals of the 51-bp phenobarbital-responsive enhancer module of the Cyp2b10 gene. Mol. Pharmacol. 53:597-601[Abstract/Free Full Text].
11. Honkakoski, P., and M. Negishi. 1998. Protein serine/threonine phosphatase inhibitors suppress phenobarbital-induced Cyp2b10 gene transcription in mouse primary hepatocytes. Biochem. J. 330:889-895.
12. Issemann, I., and S. Green. 1990. Activation of a member of the steroid hormone receptor by peroxisome proliferators. Nature 347:645-650[Medline].
13. Johnson, E. J., C. A. Palmer, K. J. Griffin, and M.-H. Hsu. 1996. Role of the peroxisome proliferator-activating receptor in cytochrome P450 4A gene regulation. FASEB J. 10:1241-1248[Abstract].
13a. Kliwere, S. A., J. T. Moore, L. Wada, J. L. Staudinger, M. A. Watson, S. A. Jones, D. D. McKee, B. B. Oliver, T. M. Wilson, R. H. Zetterstrom, T. Permann, and J. M. Lehmann. 1998. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 92:73-82[Medline].
14. Lubet, R. A., K. H. Dragnev, D. P. Chauhan, R. W. Nims, B. A. Diwan, J. M. Ward, C. R. Jones, J. M. Rice, and M. S. Miller. 1992. A pleiotropic response to phenobarbital-type enzyme inducers in the F344/NCr rat: effects of chemicals of varied structure. Biochem. Pharmacol. 43:1067-1078[Medline].
15. Luckow, B., and G. Schütz. 1987. CAT construction with multiple unique restriction sites for the functional analysis of eucaryotic promoters and regulatory elements. Nucleic Acids Res. 15:5490[Free Full Text].
16. Mangelsdorf, D. J., C. Thummel, M. Beato, P. Herrlich, G. Schütz, K. Umesono, B. Blumberg, P. Kastner, M. Mark, P. Chambon, and R. M. Evans. 1995. The nuclear receptor superfamily: the second decade. Cell 83:835-839[Medline].
17. Mangelsdorf, D. J., and R. M. Evans. 1995. The RXR heterodimers and orphan receptors. Cell 83:841-850[Medline].
18. Park, Y., H. Li, and B. Kemper. 1996. Phenobarbital induction mediated by a distal CYP2B2 sequence in rat liver transiently transfected in situ. J. Biol. Chem. 271:23725-23728[Abstract/Free Full Text].
19. Porter, T. D., and M. J. Coon. 1991. Cytochrome P-450: multiplicity of isoforms, substrates, and catalytic and regulatory mechanism. J. Biol. Chem. 266:13469-13472[Free Full Text].
20. Seol, W., H.-S. Choi, and D. D. Moore. 1996. An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 272:1336-1339[Abstract].
21. Sidhu, J. S., and C. J. Omiecinski. 1995. cAMP-associated inhibition of phenobarbital-inducible cytochrome P450 gene expression in primary hepatocyte cultures. J. Biol. Chem. 270:12762-12773[Abstract/Free Full Text].
22. Sueyoshi, T., R. Kobayashi, K. Nishio, K. Aida, R. Moore, T. Wada, H. Handa, and M. Negishi. 1995. A nuclear factor (NF2d9) that binds to the male-specific P-450 (Cyp2d-9) in mouse liver. Mol. Cell. Biol. 15:4158-4166[Abstract].
23. Trottier, E., A. Belzil, C. Stoltz, and A. Anderson. 1995. Localization of a phenobarbital-responsive element (PBRE) in the 5'-flanking region of the rat CYP2B2 gene. Gene 158:263-268[Medline].
24. Waxman, D. J., and L. Azaroff. 1992. Phenobarbital induction of cytochrome P-450 gene expression. Biochem. J. 281:577-592.
25. Yokomori, N., R. Kobayashi, R. Moore, T. Sueyoshi, and M. Negishi. 1995. DNA methylation site in the male-specific P-450 (Cyp2d-9) promoter and the heteromeric transcription factor GABP. Mol. Cell. Biol. 15:5355-5362[Abstract].

Molecular and Cellular Biology, October 1998, p. 5652-5658, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Gao, J., He, J., Zhai, Y., Wada, T., Xie, W. (2009). The Constitutive Androstane Receptor Is an Anti-obesity Nuclear Receptor That Improves Insulin Sensitivity. J. Biol. Chem. 284: 25984-25992 [Abstract] [Full Text]  
  • Ooe, H., Kon, J., Oshima, H., Mitaka, T. (2009). Thyroid Hormone Is Necessary for Expression of Constitutive Androstane Receptor in Rat Hepatocytes. Drug Metab. Dispos. 37: 1963-1969 [Abstract] [Full Text]  
  • Liu, M.-J., Takahashi, Y., Wada, T., He, J., Gao, J., Tian, Y., Li, S., Xie, W. (2009). The Aldo-Keto Reductase Akr1b7 Gene Is a Common Transcriptional Target of Xenobiotic Receptors Pregnane X Receptor and Constitutive Androstane Receptor. Mol. Pharmacol. 76: 604-611 [Abstract] [Full Text]  
  • Phillips, J. M., Burgoon, L. D., Goodman, J. I. (2009). The Constitutive Active/Androstane Receptor Facilitates Unique Phenobarbital-Induced Expression Changes of Genes Involved in Key Pathways in Precancerous Liver and Liver Tumors. Toxicol Sci 110: 319-333 [Abstract] [Full Text]  
  • Xu, C., Wang, X., Staudinger, J. L. (2009). Regulation of Tissue-Specific Carboxylesterase Expression by Pregnane X Receptor and Constitutive Androstane Receptor. Drug Metab. Dispos. 37: 1539-1547 [Abstract] [Full Text]  
  • Phillips, J. M., Burgoon, L. D., Goodman, J. I. (2009). Phenobarbital Elicits Unique, Early Changes in the Expression of Hepatic Genes that Affect Critical Pathways in Tumor-Prone B6C3F1 Mice. Toxicol Sci 109: 193-205 [Abstract] [Full Text]  
  • Phillips, J. M., Goodman, J. I. (2009). Multiple Genes Exhibit Phenobarbital-Induced Constitutive Active/Androstane Receptor-Mediated DNA Methylation Changes during Liver Tumorigenesis and in Liver Tumors. Toxicol Sci 108: 273-289 [Abstract] [Full Text]  
  • Audet-Walsh, E., Anderson, A. (2009). Dexamethasone Induction of Murine CYP2B Genes Requires the Glucocorticoid Receptor. Drug Metab. Dispos. 37: 580-588 [Abstract] [Full Text]  
  • Cheng, X., Klaassen, C. D. (2008). Perfluorocarboxylic Acids Induce Cytochrome P450 Enzymes in Mouse Liver through Activation of PPAR-{alpha} and CAR Transcription Factors. Toxicol Sci 106: 29-36 [Abstract] [Full Text]  
  • Wada, T., Kang, H. S., Jetten, A. M., Xie, W. (2008). The Emerging Role of Nuclear Receptor ROR{alpha} and Its Crosstalk with LXR in Xeno- and Endobiotic Gene Regulation. Exp. Biol. Med. 233: 1191-1201 [Abstract] [Full Text]  
  • Merrell, M. D., Jackson, J. P., Augustine, L. M., Fisher, C. D., Slitt, A. L., Maher, J. M., Huang, W., Moore, D. D., Zhang, Y., Klaassen, C. D., Cherrington, N. J. (2008). The Nrf2 Activator Oltipraz Also Activates the Constitutive Androstane Receptor. Drug Metab. Dispos. 36: 1716-1721 [Abstract] [Full Text]  
  • Yamamoto, Y., Negishi, M. (2008). The Antiapoptotic Factor Growth Arrest and DNA-Damage-Inducible 45 {beta} Regulates the Nuclear Receptor Constitutive Active/Androstane Receptor-Mediated Transcription. Drug Metab. Dispos. 36: 1189-1193 [Abstract] [Full Text]  
  • Gupta, A., Mugundu, G. M., Desai, P. B., Thummel, K. E., Unadkat, J. D. (2008). Intestinal Human Colon Adenocarcinoma Cell Line LS180 Is an Excellent Model to Study Pregnane X Receptor, but Not Constitutive Androstane Receptor, Mediated CYP3A4 and Multidrug Resistance Transporter 1 Induction: Studies with Anti-Human Immunodeficiency Virus Protease Inhibitors. Drug Metab. Dispos. 36: 1172-1180 [Abstract] [Full Text]  
  • Pascual, M., Gomez-Lechon, M. J., Castell, J. V., Jover, R. (2008). ATF5 Is a Highly Abundant Liver-Enriched Transcription Factor that Cooperates with Constitutive Androstane Receptor in the Transactivation of CYP2B6: Implications in Hepatic Stress Responses. Drug Metab. Dispos. 36: 1063-1072 [Abstract] [Full Text]  
  • Rosen, M. B., Abbott, B. D., Wolf, D. C., Corton, J. C., Wood, C. R., Schmid, J. E., Das, K. P., Zehr, R. D., Blair, E. T., Lau, C. (2008). Gene Profiling in the Livers of Wild-type and PPAR{alpha}-Null Mice Exposed to Perfluorooctanoic Acid. Toxicol Pathol 36: 592-607 [Abstract] [Full Text]  
  • Inoue, K., Negishi, M. (2008). Nuclear Receptor CAR Requires Early Growth Response 1 to Activate the Human Cytochrome P450 2B6 Gene. J. Biol. Chem. 283: 10425-10432 [Abstract] [Full Text]  
  • Johnson, D. J., Owen, A., Plant, N., Bray, P. G., Ward, S. A. (2008). Drug-Regulated Expression of Plasmodium falciparum P-Glycoprotein Homologue 1: a Putative Role for Nuclear Receptors. Antimicrob. Agents Chemother. 52: 1438-1445 [Abstract] [Full Text]  
  • Sueyoshi, T., Moore, R., Sugatani, J., Matsumura, Y., Negishi, M. (2008). PPP1R16A, The Membrane Subunit of Protein Phosphatase 1{beta}, Signals Nuclear Translocation of the Nuclear Receptor Constitutive Active/Androstane Receptor. Mol. Pharmacol. 73: 1113-1121 [Abstract] [Full Text]  
  • Wortham, M., Czerwinski, M., He, L., Parkinson, A., Wan, Y.-J. Y. (2007). Expression of Constitutive Androstane Receptor, Hepatic Nuclear Factor 4{alpha}, and P450 Oxidoreductase Genes Determines Interindividual Variability in Basal Expression and Activity of a Broad Scope of Xenobiotic Metabolism Genes in the Human Liver. Drug Metab. Dispos. 35: 1700-1710 [Abstract] [Full Text]  
  • Peffer, R. C., Moggs, J. G., Pastoor, T., Currie, R. A., Wright, J., Milburn, G., Waechter, F., Rusyn, I. (2007). Mouse Liver Effects of Cyproconazole, a Triazole Fungicide: Role of the Constitutive Androstane Receptor. Toxicol Sci 99: 315-325 [Abstract] [Full Text]  
  • Chow, E. K.-H., Razani, B., Cheng, G. (2007). Innate immune system regulation of nuclear hormone receptors in metabolic diseases. J. Leukoc. Biol. 82: 187-195 [Abstract] [Full Text]  
  • Cerveny, L., Svecova, L., Anzenbacherova, E., Vrzal, R., Staud, F., Dvorak, Z., Ulrichova, J., Anzenbacher, P., Pavek, P. (2007). Valproic Acid Induces CYP3A4 and MDR1 Gene Expression by Activation of Constitutive Androstane Receptor and Pregnane X Receptor Pathways. Drug Metab. Dispos. 35: 1032-1041 [Abstract] [Full Text]  
  • Matsumoto, K., Yu, S., Jia, Y., Ahmed, M. R., Viswakarma, N., Sarkar, J., Kashireddy, P. V., Sambasiva Rao, M., Karpus, W., Gonzalez, F. J., Reddy, J. K. (2007). Critical Role for Transcription Coactivator Peroxisome Proliferator-activated Receptor (PPAR)-binding Protein/TRAP220 in Liver Regeneration and PPAR{alpha} Ligand-induced Liver Tumor Development. J. Biol. Chem. 282: 17053-17060 [Abstract] [Full Text]  
  • Urquhart, B. L., Tirona, R. G., Kim, R. B. (2007). Nuclear Receptors and the Regulation of Drug-Metabolizing Enzymes and Drug Transporters: Implications for Interindividual Variability in Response to Drugs. J Clin Pharmacol 47: 566-578 [Abstract] [Full Text]  
  • Koike, C., Moore, R., Negishi, M. (2007). Extracellular Signal-Regulated Kinase Is an Endogenous Signal Retaining the Nuclear Constitutive Active/Androstane Receptor (CAR) in the Cytoplasm of Mouse Primary Hepatocytes. Mol. Pharmacol. 71: 1217-1221 [Abstract] [Full Text]  
  • Yamazaki, Y., Kakizaki, S., Horiguchi, N., Sohara, N., Sato, K., Takagi, H., Mori, M., Negishi, M. (2007). The role of the nuclear receptor constitutive androstane receptor in the pathogenesis of non-alcoholic steatohepatitis. Gut 56: 565-574 [Abstract] [Full Text]  
  • Nakamura, K., Moore, R., Negishi, M., Sueyoshi, T. (2007). Nuclear Pregnane X Receptor Cross-talk with FoxA2 to Mediate Drug-induced Regulation of Lipid Metabolism in Fasting Mouse Liver. J. Biol. Chem. 282: 9768-9776 [Abstract] [Full Text]  
  • Phillips, J. M., Yamamoto, Y., Negishi, M., Maronpot, R. R., Goodman, J. I. (2007). Orphan Nuclear Receptor Constitutive Active/Androstane Receptor-Mediated Alterations in DNA Methylation during Phenobarbital Promotion of Liver Tumorigenesis. Toxicol Sci 96: 72-82 [Abstract] [Full Text]  
  • Kawase, A., Tsunokuni, Y., Iwaki, M. (2007). Effects of Alterations in CAR on Bilirubin Detoxification in Mouse Collagen-Induced Arthritis. Drug Metab. Dispos. 35: 256-261 [Abstract] [Full Text]  
  • Tien, E. S., Matsui, K., Moore, R., Negishi, M. (2007). The Nuclear Receptor Constitutively Active/Androstane Receptor Regulates Type 1 Deiodinase and Thyroid Hormone Activity in the Regenerating Mouse Liver. J. Pharmacol. Exp. Ther. 320: 307-313 [Abstract] [Full Text]  
  • Jackson, J. P., Ferguson, S. S., Negishi, M., Goldstein, J. A. (2006). Phenytoin Induction of the Cyp2c37 Gene Is Mediated by the Constitutive Androstane Receptor. Drug Metab. Dispos. 34: 2003-2010 [Abstract] [Full Text]  
  • Rencurel, F., Foretz, M., Kaufmann, M. R., Stroka, D., Looser, R., Leclerc, I., da Silva Xavier, G., Rutter, G. A., Viollet, B., Meyer, U. A. (2006). Stimulation of AMP-Activated Protein Kinase Is Essential for the Induction of Drug Metabolizing Enzymes by Phenobarbital in Human and Mouse Liver. Mol. Pharmacol. 70: 1925-1934 [Abstract] [Full Text]  
  • Chow, E. K., Castrillo, A., Shahangian, A., Pei, L., O'Connell, R. M., Modlin, R. L., Tontonoz, P., Cheng, G. (2006). A role for IRF3-dependent RXR{alpha} repression in hepatotoxicity associated with viral infections. JEM 203: 2589-2602 [Abstract] [Full Text]  
  • Sugatani, J., Wada, T., Osabe, M., Yamakawa, K., Yoshinari, K., Miwa, M. (2006). Dietary Inulin Alleviates Hepatic Steatosis and Xenobiotics-Induced Liver Injury in Rats Fed a High-Fat and High-Sucrose Diet: Association with the Suppression of Hepatic Cytochrome P450 and Hepatocyte Nuclear Factor 4{alpha} Expression. Drug Metab. Dispos. 34: 1677-1687 [Abstract] [Full Text]  
  • Shelby, M. K., Klaassen, C. D. (2006). Induction of Rat UDP-Glucuronosyltransferases in Liver and Duodenum by Microsomal Enzyme Inducers That Activate Various Transcriptional Pathways. Drug Metab. Dispos. 34: 1772-1778 [Abstract] [Full Text]  
  • Zhang, P., Noordine, M.-L., Cherbuy, C., Vaugelade, P., Pascussi, J. M., Duee, P.-H., Thomas, M. (2006). Different activation patterns of rat xenobiotic metabolism genes by two constituents of garlic. Carcinogenesis 27: 2090-2095 [Abstract] [Full Text]  
  • Slitt, A. L., Cherrington, N. J., Fisher, C. D., Negishi, M., Klaassen, C. D. (2006). INDUCTION OF GENES FOR METABOLISM AND TRANSPORT BY TRANS-STILBENE OXIDE IN LIVERS OF SPRAGUE-DAWLEY AND WISTAR-KYOTO RATS. Drug Metab. Dispos. 34: 1190-1197 [Abstract] [Full Text]  
  • Faucette, S. R., Sueyoshi, T., Smith, C. M., Negishi, M., LeCluyse, E. L., Wang, H. (2006). Differential Regulation of Hepatic CYP2B6 and CYP3A4 Genes by Constitutive Androstane Receptor but Not Pregnane X Receptor. J. Pharmacol. Exp. Ther. 317: 1200-1209 [Abstract] [Full Text]  
  • Miao, J., Fang, S., Bae, Y., Kemper, J. K. (2006). Functional Inhibitory Cross-talk between Constitutive Androstane Receptor and Hepatic Nuclear Factor-4 in Hepatic Lipid/Glucose Metabolism Is Mediated by Competition for Binding to the DR1 Motif and to the Common Coactivators, GRIP-1 and PGC-1{alpha}. J. Biol. Chem. 281: 14537-14546 [Abstract] [Full Text]  
  • Seidel, S. D., Stott, W. T., Kan, H. L., Sparrow, B. R., Gollapudi, B. B. (2006). Gene Expression Dose-Response of Liver with a Genotoxic and Nongenotoxic Carcinogen. International Journal of Toxicology 25: 57-64 [Abstract] [Full Text]  
  • Fukushima, S., Kinoshita, A., Puatanachokchai, R., Kushida, M., Wanibuchi, H., Morimura, K. (2005). Hormesis and dose-response-mediated mechanisms in carcinogenesis: evidence for a threshold in carcinogenicity of non-genotoxic carcinogens. Carcinogenesis 26: 1835-1845 [Abstract] [Full Text]  
  • Auerbach, S. S., Stoner, M. A., Su, S., Omiecinski, C. J. (2005). Retinoid X Receptor-{alpha}-Dependent Transactivation by a Naturally Occurring Structural Variant of Human Constitutive Androstane Receptor (NR1I3). Mol. Pharmacol. 68: 1239-1253 [Abstract] [Full Text]  
  • Lempiainen, H., Molnar, F., Macias Gonzalez, M., Perakyla, M., Carlberg, C. (2005). Antagonist- and Inverse Agonist-Driven Interactions of the Vitamin D Receptor and the Constitutive Androstane Receptor with Corepressor Protein. Mol. Endocrinol. 19: 2258-2272 [Abstract] [Full Text]  
  • Emi, Y., Ueda, K., Ohnishi, A., Ikushiro, S.-i., Iyanagi, T. (2005). Transcriptional Enhancement of UDP-Glucuronosyltransferase Form 1A2 (UGT1A2) by Nuclear Factor I-A (NFI-A) in Rat Hepatocytes. J Biochem 138: 313-325 [Abstract] [Full Text]  
  • Wyde, M. E., Kirwan, S. E., Zhang, F., Laughter, A., Hoffman, H. B., Bartolucci-Page, E., Gaido, K. W., Yan, B., You, L. (2005). Di-n-Butyl Phthalate Activates Constitutive Androstane Receptor and Pregnane X Receptor and Enhances the Expression of Steroid-Metabolizing Enzymes in the Liver of Rat Fetuses. Toxicol Sci 86: 281-290 [Abstract] [Full Text]  
  • Maher, J. M., Cheng, X., Slitt, A. L., Dieter, M. Z., Klaassen, C. D. (2005). INDUCTION OF THE MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN FAMILY OF TRANSPORTERS BY CHEMICAL ACTIVATORS OF RECEPTOR-MEDIATED PATHWAYS IN MOUSE LIVER. Drug Metab. Dispos. 33: 956-962 [Abstract] [Full Text]  
  • Ding, X., Staudinger, J. L. (2005). The Ratio of Constitutive Androstane Receptor to Pregnane X Receptor Determines the Activity of Guggulsterone against the Cyp2b10 Promoter. J. Pharmacol. Exp. Ther. 314: 120-127 [Abstract] [Full Text]  
  • Xia, J., Kemper, B. (2005). Structural Determinants of Constitutive Androstane Receptor Required for Its Glucocorticoid Receptor Interacting Protein-1-mediated Nuclear Accumulation. J. Biol. Chem. 280: 7285-7293 [Abstract] [Full Text]  
  • Jyrkkarinne, J., Windshugel, B., Makinen, J., Ylisirnio, M., Perakyla, M., Poso, A., Sippl, W., Honkakoski, P. (2005). Amino Acids Important for Ligand Specificity of the Human Constitutive Androstane Receptor. J. Biol. Chem. 280: 5960-5971 [Abstract] [Full Text]  
  • Rencurel, F., Stenhouse, A., Hawley, S. A., Friedberg, T., Hardie, D. G., Sutherland, C., Wolf, C. R. (2005). AMP-activated Protein Kinase Mediates Phenobarbital Induction of CYP2B Gene Expression in Hepatocytes and a Newly Derived Human Hepatoma Cell Line. J. Biol. Chem. 280: 4367-4373 [Abstract] [Full Text]  
  • Swales, K., Kakizaki, S., Yamamoto, Y., Inoue, K., Kobayashi, K., Negishi, M. (2005). Novel CAR-mediated Mechanism for Synergistic Activation of Two Distinct Elements within the Human Cytochrome P450 2B6 Gene in HepG2 Cells. J. Biol. Chem. 280: 3458-3466 [Abstract] [Full Text]  
  • Squires, E. J., Sueyoshi, T., Negishi, M. (2004). Cytoplasmic Localization of Pregnane X Receptor and Ligand-dependent Nuclear Translocation in Mouse Liver. J. Biol. Chem. 279: 49307-49314 [Abstract] [Full Text]  
  • Lamba, J. K., Lamba, V., Yasuda, K., Lin, Y. S., Assem, M., Thompson, E., Strom, S., Schuetz, E. (2004). Expression of Constitutive Androstane Receptor Splice Variants in Human Tissues and Their Functional Consequences. J. Pharmacol. Exp. Ther. 311: 811-821 [Abstract] [Full Text]  
  • Yamamoto, Y., Moore, R., Goldsworthy, T. L., Negishi, M., Maronpot, R. R. (2004). The Orphan Nuclear Receptor Constitutive Active/Androstane Receptor Is Essential for Liver Tumor Promotion by Phenobarbital in Mice. Cancer Res. 64: 7197-7200 [Abstract] [Full Text]  
  • Kodama, S., Koike, C., Negishi, M., Yamamoto, Y. (2004). Nuclear Receptors CAR and PXR Cross Talk with FOXO1 To Regulate Genes That Encode Drug-Metabolizing and Gluconeogenic Enzymes. Mol. Cell. Biol. 24: 7931-7940 [Abstract] [Full Text]  
  • Frank, C., Molnar, F., Matilainen, M., Lempiainen, H., Carlberg, C. (2004). Agonist-dependent and Agonist-independent Transactivations of the Human Constitutive Androstane Receptor Are Modulated by Specific Amino Acid Pairs. J. Biol. Chem. 279: 33558-33566 [Abstract] [Full Text]  
  • Wang, H., Faucette, S., Moore, R., Sueyoshi, T., Negishi, M., LeCluyse, E. (2004). Human Constitutive Androstane Receptor Mediates Induction of CYP2B6 Gene Expression by Phenytoin. J. Biol. Chem. 279: 29295-29301 [Abstract] [Full Text]  
  • Swales, K., Negishi, M. (2004). CAR, Driving into the Future. Mol. Endocrinol. 18: 1589-1598 [Abstract] [Full Text]  
  • Jackson, J. P., Ferguson, S. S., Moore, R., Negishi, M., Goldstein, J. A. (2004). The Constitutive Active/Androstane Receptor Regulates Phenytoin Induction of Cyp2c29. Mol. Pharmacol. 65: 1397-1404 [Abstract] [Full Text]  
  • Maglich, J. M., Watson, J., McMillen, P. J., Goodwin, B., Willson, T. M., Moore, J. T. (2004). The Nuclear Receptor CAR Is a Regulator of Thyroid Hormone Metabolism during Caloric Restriction. J. Biol. Chem. 279: 19832-19838 [Abstract] [Full Text]  
  • Faucette, S. R., Wang, H., Hamilton, G. A., Jolley, S. L., Gilbert, D., Lindley, C., Yan, B., Negishi, M., LeCluyse, E. L. (2004). REGULATION OF CYP2B6 IN PRIMARY HUMAN HEPATOCYTES BY PROTOTYPICAL INDUCERS. Drug Metab. Dispos. 32: 348-358 [Abstract] [Full Text]  
  • Saini, S. P. S., Sonoda, J., Xu, L., Toma, D., Uppal, H., Mu, Y., Ren, S., Moore, D. D., Evans, R. M., Xie, W. (2004). A Novel Constitutive Androstane Receptor-Mediated and CYP3A-Independent Pathway of Bile Acid Detoxification. Mol. Pharmacol. 65: 292-300 [Abstract] [Full Text]  
  • Bauer, D., Wolfram, N., Kahl, G. F., Hirsch-Ernst, K. I. (2004). Transcriptional Regulation of CYP2B1 Induction in Primary Rat Hepatocyte Cultures: Repression by Epidermal Growth Factor Is Mediated via a Distal Enhancer Region. Mol. Pharmacol. 65: 172-180 [Abstract] [Full Text]  
  • Handschin, C., Meyer, U. A. (2003). Induction of Drug Metabolism: The Role of Nuclear Receptors. Pharmacol. Rev. 55: 649-673 [Abstract] [Full Text]  
  • Cherrington, N. J., Slitt, A. L., Maher, J. M., Zhang, X.-X., Zhang, J., Huang, W., Wan, Y.-J. Y., Moore, D. D., Klaassen, C. D. (2003). INDUCTION OF MULTIDRUG RESISTANCE PROTEIN 3 (MRP3) IN VIVO IS INDEPENDENT OF CONSTITUTIVE ANDROSTANE RECEPTOR. Drug Metab. Dispos. 31: 1315-1319 [Abstract] [Full Text]  
  • Kobayashi, K., Sueyoshi, T., Inoue, K., Moore, R., Negishi, M. (2003). Cytoplasmic Accumulation of the Nuclear Receptor CAR by a Tetratricopeptide Repeat Protein in HepG2 Cells. Mol. Pharmacol. 64: 1069-1075 [Abstract] [Full Text]  
  • Frank, C., Gonzalez, M. M., Oinonen, C., Dunlop, T. W., Carlberg, C. (2003). Characterization of DNA Complexes Formed by the Nuclear Receptor Constitutive Androstane Receptor. J. Biol. Chem. 278: 43299-43310 [Abstract] [Full Text]  
  • Fraser, D. J., Zumsteg, A., Meyer, U. A. (2003). Nuclear Receptors Constitutive Androstane Receptor and Pregnane X Receptor Activate a Drug-responsive Enhancer of the Murine 5-Aminolevulinic Acid Synthase Gene. J. Biol. Chem. 278: 39392-39401 [Abstract] [Full Text]  
  • de Longueville, F., Atienzar, F. A., Marcq, L., Dufrane, S., Evrard, S., Wouters, L., Leroux, F., Bertholet, V., Gerin, B., Whomsley, R., Arnould, T., Remacle, J., Canning, M. (2003). Use of a Low-Density Microarray for Studying Gene Expression Patterns Induced by Hepatotoxicants on Primary Cultures of Rat Hepatocytes. Toxicol Sci 75: 378-392 [Abstract] [Full Text]  
  • Ourlin, J. C., Lasserre, F., Pineau, T., Fabre, J. M., Sa-Cunha, A., Maurel, P., Vilarem, M.-J., Pascussi, J. M. (2003). The Small Heterodimer Partner Interacts with the Pregnane X Receptor and Represses Its Transcriptional Activity. Mol. Endocrinol. 17: 1693-1703 [Abstract] [Full Text]  
  • Wyde, M. E., Bartolucci, E., Ueda, A., Zhang, H., Yan, B., Negishi, M., You, L. (2003). The Environmental Pollutant 1,1-Dichloro-2,2-bis (p-chlorophenyl)ethylene Induces Rat Hepatic Cytochrome P450 2B and 3A Expression through the Constitutive Androstane Receptor and Pregnane X Receptor. Mol. Pharmacol. 64: 474-481 [Abstract] [Full Text]  
  • Chen, C., Staudinger, J. L., Klaassen, C. D. (2003). NUCLEAR RECEPTOR, PREGNANE X RECEPTOR, IS REQUIRED FOR INDUCTION OF UDP-GLUCURONOSYLTRANSFERASES IN MOUSE LIVER BY PREGNENOLONE-16{alpha}-CARBONITRILE. Drug Metab. Dispos. 31: 908-915 [Abstract] [Full Text]  
  • Dvorak, Z., Modriansky, M., Pichard-Garcia, L., Balaguer, P., Vilarem, M.-J., Ulrichova, J., Maurel, P., Pascussi, J.-M. (2003). Colchicine Down-Regulates Cytochrome P450 2B6, 2C8, 2C9, and 3A4 in Human Hepatocytes by Affecting Their Glucocorticoid Receptor-Mediated Regulation. Mol. Pharmacol. 64: 160-169 [Abstract] [Full Text]  
  • Rosenfeld, J. M., Vargas, R. Jr., Xie, W., Evans, R. M. (2003). Genetic Profiling Defines the Xenobiotic Gene Network Controlled by the Nuclear Receptor Pregnane X Receptor. Mol. Endocrinol. 17: 1268-1282 [Abstract] [Full Text]  
  • Degawa, M., Namiki, M., Yoshimoto, N., Makino, M., Iwamoto, M., Nemoto, K., Hashimoto, Y. (2003). Constitutive Expression of Cytochrome P450 Genes in Newly Established Rat Hepatic Cell Lines. J Biochem 133: 825-831 [Abstract] [Full Text]  
  • Ledda-Columbano, G. M., Pibiri, M., Concas, D., Molotzu, F., Simbula, G., Cossu, C., Columbano, A. (2003). Sex difference in the proliferative response of mouse hepatocytes to treatment with the CAR ligand, TCPOBOP. Carcinogenesis 24: 1059-1065 [Abstract] [Full Text]  
  • Maglich, J. M., Parks, D. J., Moore, L. B., Collins, J. L., Goodwin, B., Billin, A. N., Stoltz, C. A., Kliewer, S. A., Lambert, M. H., Willson, T. M., Moore, J. T. (2003). Identification of a Novel Human Constitutive Androstane Receptor (CAR) Agonist and Its Use in the Identification of CAR Target Genes. J. Biol. Chem. 278: 17277-17283 [Abstract] [Full Text]  
  • Wang, H., Faucette, S. R., Gilbert, D., Jolley, S. L., Sueyoshi, T., Negishi, M., LeCluyse, E. L. (2003). Glucocorticoid Receptor Enhancement of Pregnane X Receptor-Mediated CYP2B6 Regulation in Primary Human Hepatocytes. Drug Metab. Dispos. 31: 620-630 [Abstract] [Full Text]  
  • Wang, H., Faucette, S., Sueyoshi, T., Moore, R., Ferguson, S., Negishi, M., LeCluyse, E. L. (2003). A Novel Distal Enhancer Module Regulated by Pregnane X Receptor/Constitutive Androstane Receptor Is Essential for the Maximal Induction of CYP2B6 Gene Expression. J. Biol. Chem. 278: 14146-14152 [Abstract] [Full Text]  
  • Xie, W., Yeuh, M.-F., Radominska-Pandya, A., Saini, S. P. S., Negishi, Y., Bottroff, B. S., Cabrera, G. Y., Tukey, R. H., Evans, R. M. (2003). Control of steroid, heme, and carcinogen metabolism by nuclear pregnane X receptor and constitutive androstane receptor. Proc. Natl. Acad. Sci. USA 100: 4150-4155 [Abstract] [Full Text]  
  • Shiraki, T., Sakai, N., Kanaya, E., Jingami, H. (2003). Activation of Orphan Nuclear Constitutive Androstane Receptor Requires Subnuclear Targeting by Peroxisome Proliferator-activated Receptor gamma Coactivator-1alpha . A POSSIBLE LINK BETWEEN XENOBIOTIC RESPONSE AND NUTRITIONAL STATE. J. Biol. Chem. 278: 11344-11350 [Abstract] [Full Text]  
  • Kawana, K., Ikuta, T., Kobayashi, Y., Gotoh, O., Takeda, K., Kawajiri, K. (2003). Molecular Mechanism of Nuclear Translocation of an Orphan Nuclear Receptor, SXR. Mol. Pharmacol. 63: 524-531 [Abstract] [Full Text]  
  • Andersin, T., Vaisanen, S., Carlberg, C. (2003). The Critical Role of Carboxy-Terminal Amino Acids in Ligand-Dependent and -Independent Transactivation of the Constitutive Androstane Receptor. Mol. Endocrinol. 17: 234-246 [Abstract] [Full Text]  
  • Ittrich, C., Deml, E., Oesterle, D., Kuttler, K., Mellert, W., Brendler-Schwaab, S., Enzmann, H., Schladt, L., Bannasch, P., Haertel, T., Monnikes, O., Schwarz, M., Kopp-Schneider, A. (2003). Prevalidation of a Rat Liver Foci Bioassay (RLFB) Based on Results from 1600 Rats: A Study Report. Toxicol Pathol 31: 60-79 [Abstract]  
  • Pascussi, J. M., Busson-Le Coniat, M., Maurel, P., Vilarem, M.-J. (2003). Transcriptional Analysis of the Orphan Nuclear Receptor Constitutive Androstane Receptor (NR1I3) Gene Promoter: Identification of a Distal Glucocorticoid Response Element. Mol. Endocrinol. 17: 42-55 [Abstract] [Full Text]  
  • Dogra, S. C., Tremethick, D., May, B. K. (2003). Evidence That the Coactivator CBP/p300 Is Important for Phenobarbital-Induced but Not Basal Expression of the CYP2H1 Gene. Mol. Pharmacol. 63: 73-80 [Abstract] [Full Text]  
  • Zhang, J., Huang, W., Chua, S. S., Wei, P., Moore, D. D. (2002). Modulation of Acetaminophen-Induced Hepatotoxicity by the Xenobiotic Receptor CAR. Science 298: 422-424 [Abstract] [Full Text]  
  • Kliewer, S. A., Goodwin, B., Willson, T. M. (2002). The Nuclear Pregnane X Receptor: A Key Regulator of Xenobiotic Metabolism. Endocr. Rev. 23: 687-702 [Abstract] [Full Text]  
  • Fraser, D. J., Podvinec, M., Kaufmann, M. R., Meyer, U. A. (2002). Drugs Mediate the Transcriptional Activation of the 5-Aminolevulinic Acid Synthase (ALAS1) Gene via the Chicken Xenobiotic-sensing Nuclear Receptor (CXR). J. Biol. Chem. 277: 34717-34726 [Abstract] [Full Text]  
  • Xiao, L., Cui, X., Madison, V., White, R. E., Cheng, K.-C. (2002). Insights from a Three-Dimensional Model into Ligand Binding to Constitutive Active Receptor. Drug Metab. Dispos. 30: 951-956 [Abstract] [Full Text]  
  • Maglich, J. M., Stoltz, C. M., Goodwin, B., Hawkins-Brown, D., Moore, J. T., Kliewer, S. A. (2002). Nuclear Pregnane X Receptor and Constitutive Androstane Receptor Regulate Overlapping but Distinct Sets of Genes Involved in Xenobiotic Detoxification. Mol. Pharmacol. 62: 638-646 [Abstract] [Full Text]  
  • Xiong, H., Yoshinari, K., Brouwer, K. L. R., Negishi, M. (2002). Role of Constitutive Androstane Receptor in the In Vivo Induction of Mrp3 and CYP2B1/2 by Phenobarbital. Drug Metab. Dispos. 30: 918-923 [Abstract] [Full Text]  
  • Dussault, I., Lin, M., Hollister, K., Fan, M., Termini, J., Sherman, M. A., Forman, B. M. (2002). A Structural Model of the Constitutive Androstane Receptor Defines Novel Interactions That Mediate Ligand-Independent Activity. Mol. Cell. Biol. 22: 5270-5280 [Abstract] [Full Text]  
  • Goodwin, B., Hodgson, E., D'Costa, D. J., Robertson, G. R., Liddle, C. (2002). Transcriptional Regulation of the Human CYP3A4 Gene by the Constitutive Androstane Receptor. Mol. Pharmacol. 62: 359-365 [Abstract] [Full Text]  
  • Makinen, J., Frank, C., Jyrkkarinne, J., Gynther, J., Carlberg, C., Honkakoski, P. (2002). Modulation of Mouse and Human Phenobarbital-Responsive Enhancer Module by Nuclear Receptors. Mol. Pharmacol. 62: 366-378 [Abstract] [Full Text]  
  • Min, G., Kemper, J. K., Kemper, B. (2002). Glucocorticoid Receptor-interacting Protein 1 Mediates Ligand-independent Nuclear Translocation and Activation of Constitutive Androstane Receptor in Vivo. J. Biol. Chem. 277: 26356-26363 [Abstract] [Full Text]  
  • Drocourt, L., Ourlin, J.-C., Pascussi, J.-M., Maurel, P., Vilarem, M.-J. (2002). Expression of CYP3A4, CYP2B6, and CYP2C9 Is Regulated by the Vitamin D Receptor Pathway in Primary Human Hepatocytes. J. Biol. Chem. 277: 25125-25132 [Abstract] [Full Text]  
  • Ueda, A., Kakizaki, S., Negishi, M., Sueyoshi, T. (2002). Residue Threonine 350 Confers Steroid Hormone Responsiveness to the Mouse Nuclear Orphan Receptor CAR. Mol. Pharmacol. 61: 1284-1288 [Abstract] [Full Text]  
  • Baader, M., Gnerre, C., Stegeman, J. J., Meyer, U. A. (2002). Transcriptional Activation of Cytochrome P450 CYP2C45 by Drugs Is Mediated by the Chicken Xenobiotic Receptor (CXR) Interacting with a Phenobarbital Response Enhancer Unit. J. Biol. Chem. 277: 15647-15653 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Honkakoski, P.
Right arrow Articles by Negishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Honkakoski, P.
Right arrow Articles by Negishi, M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»