INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Transcription is a complex process requiring the coordinate action of multiple basal and transactivating proteins. In eukaryotic cells, this process is complicated further by the packaging of DNA into chromatin. Nucleosomes provide the fundamental repeat unit of chromatin, consisting of two molecules of each of the four core histones (H2A, H2B, H3, and H4) and ~146 bp of DNA wound in almost two turns around the exterior of the histone octamer (37). Individual nucleosomes as well as more highly folded structures are generally inhibitory to the initiation of transcription. Alterations in nucleosomal structure and in chromatin packing often accompany transcriptional activation (12).

Posttranslational acetylation of the histones has long been correlated with transcriptional activation (36, 39, 40). Acetylation neutralizes the charge associated with epsilon amino groups of lysine residues, thereby loosening contacts between the histones and the negatively charged DNA. Histone acetylation also influences compaction of nucleosomal arrays, yielding less condensed chromatin structures (16). Both of these effects can increase transactivator binding to nucleosomal DNA, facilitating transcriptional activation.

A molecular basis for the linkage between histone acetylation and gene activation was provided by the discovery that the yeast transcriptional adapter Gcn5p serves as the catalytic subunit of a histone acetyltransferase type A activity (5). Gcn5p is associated with two multisubunit complexes in yeast, which include Ada proteins (Ada2p, Ada3p, and Ada5p) and/or certain Spt proteins (6, 14, 18, 24, 25, 31). These complexes are required for transcriptional activation by particular transactivators, including heterologous VP16 derivatives and endogenous Gcn4p (3, 13, 24, 34). Components of the Gcn5p-Adap complex contact both transactivator proteins and basal transcription proteins, thus providing an adapter or coactivator function, in addition to histone acetyltransferase activity (2, 34). Association with both Ada2p and acetyltransferase activity is required for Gcn5p function in vivo (8, 38).

Human homologs of GCN5 have been cloned based on sequence and functional similarities of their predicted products to the yeast protein. A cDNA predicted to encode a protein of similar size and with overall homology to yeast Gcn5p has been described (7, 41). A human ADA2 gene has also been cloned, indicating a conservation of adapter and histone acetyltransferase functions across species (7). In addition, a cDNA encoding a second, larger Gcn5-related protein that possesses unique sequences in its amino-terminal half has been identified. This protein, P/CAF (p300/CREB binding protein [CBP]-associated factor), associates with two highly related proteins, p300 and CBP, that have a region of homology with ADA2 (41). Interestingly, p300 and CBP are also histone acetyltransferases (1, 29). Interactions between P/CAF and p300 or CBP are disrupted by the viral E1A oncogene product, and this disruption is required for cellular transformation by E1A (41). Proper association of these histone acetyltransferase activities, then, is extremely important for normal cell growth (32).

In order to further study the functions of histone acetyltransferases in the growth and development of mammalian cells, we endeavored to isolate sequences encoding mouse GCN5 (mmGCN5) and mmP/CAF. To our surprise, although our mmGCN5 exhibited 98% identity with the reported human GCN5 (hsGCN5) sequence, the mouse cDNA encoded an extended amino-terminal domain with high similarity to a corresponding domain in P/CAF. Upon further examination, we found that the reported hsGCN5 cDNA (41) may result from an incompletely spliced transcript, and that a more prevalent transcript exists that potentially encodes a longer hsGCN5 protein similar to that encoded by the mouse cDNA that we isolated. Moreover, in contrast to previous reports that yeast and human GCN5 proteins acetylate only free core histones, the full-length recombinant mmGCN5 protein containing this extended amino-terminal region acetylates both free and nucleosomal histones H3 and H4. These results suggest that this additional domain in the mammalian GCN5 acetyltransferase facilitates chromatin recognition. Interestingly, P/CAF and GCN5 are expressed in inverse ratios in many mouse tissues, indicating that these proteins may serve tissue-specific functions.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

cDNA library screening. Nested PCR with degenerate oligomers and a mouse embryonic cDNA library (13.5 days postcoitum [dpc]) as the template was performed to generate a fragment of the mmGCN5 cDNA. Oligomers were chosen from regions of sequence conserved between yeast and Tetrahymena, which correspond to amino acids 131 to 244 of the yeast protein sequence. A single band of 123 bp was generated and cloned into pBluescript (Stratagene). Sequencing revealed 80% nucleotide identity and 94% identity at the amino acid level to the reported hsGCN5. This PCR product and human EST clones (IMAGE clone no. 243927) with similarity to GCN5 were used together to screen a cDNA library under conditions of low stringency as previously described (11). Clones were plaque purified and rescued as per the manufacturer's protocol. Sequencing revealed two types of clones, some with similarity to hsGCN5 and some with similarity to hsP/CAF. All of the P/CAF clones contained only a short piece of P/CAF, and rescreening of the library failed to isolate any longer clones. Therefore, an oligomer corresponding to the 5'-most sequence of mmP/CAF was used to screen a 10.5-dpc embryonic mouse plasmid library with GeneTrapper technology (Gibco BRL). Additional clones, corresponding to full-length P/CAF sequences, were isolated according to the manufacturer's protocol.

Genomic library screening. A mouse genomic library, Lambda FIXII (Stratagene), was screened by using a mixture of a 5' fragment of the mmGCN5 cDNA and a 5' fragment of the mmP/CAF cDNA. Positive plaques were picked and subjected to secondary screening. Phage DNA was prepared from positive plaques by standard procedures. Genomic inserts were released from phage DNA by NotI digestion and subsequently subcloned into Bluescript KS(+) (Stratagene).

Sequencing analysis. DNA sequencing was performed by using the Thermo-Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science). Sequencing amplification conditions were 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min for 40 cycles. Alternatively, automated sequencing was carried out by the Sequencing Core Facility at the M. D. Anderson Cancer Center.

Sequence alignment. Published sequences were obtained by searching the GenBank, PIR-Protein, and SWISS-PROT databases. Sequence alignment was carried out with the Genetics Computer Group (GCG) (Wisconsin Package version 9.1; GCG, Madison, Wis.) Pileup program. Percent identity between two proteins was calculated by using the GCG Bestfit program.

Linkage analysis mapping. Restriction fragment length polymorphisms for mmGCN5 or mmP/CAF in C57BL/6J and SPRET/Ei subspecies were determined by using genomic DNA purchased from the Jackson Laboratory. The Jackson Laboratory interspecific backcross panel (C57BL/6JEi × SPRET/Ei)F₁ × SPRET/Ei, known as Jackson BSS (33), was then used to map the chromosomal locations of the mmGCN5 and mmP/CAF genes. Predigested panels (BglII digestion for P/CAF or XbaI digestion for GCN5) were analyzed by Southern blotting with a GCN5 or P/CAF intronic probe. Typing results were processed via the Jackson Laboratory database analysis (see http://www.jax.org/resources/documents/cmdata for raw data).

RT-PCR. Isolation of total RNA from various mouse tissues was performed as described previously (10). RNA was digested with RNase A-free DNase I (Ambion) for 30 min at 37°C. Reverse transcriptase PCR (RT-PCR) was performed with an RT-PCR kit (Perkin-Elmer) according to manufacturer's protocols. Reverse transcription was carried out at 42°C for 15 min, followed by heating at 95°C for 5 min. PCRs were carried out at 95°C for 60 s and 60°C for 60 s for 35 cycles as suggested by the manufacturer. Primer A (see Fig. 3B for sequence location) for RT-PCR is CTGGTGCCTGAGAAGAGGAC; primer B (see Fig. 3B) is CTCCGAAGGTGGCATGGTGAAG.

RNA analysis. Total RNA from adult mouse tissues or whole embryos (13.5 dpc) was extracted as described previously (10). RNAs were electrophoresed on a 1.1% agarose gel containing formaldehyde, along with RNA molecular size markers (Gibco BRL). RNA was transferred to a GeneScreen Plus membrane (NEN Life Science) in 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Hybridization was carried out with mmGCN5- and mmP/CAF-specific probes.

GCN5 protein analysis. Mouse embryos (12.5 dpc) were homogenized in radioimmunoprecipitation assay buffer (1× phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 100 µg of phenylmethylsulfonyl fluoride per ml, 1 µg of aprotinin per ml) and then centrifuged at 15,000 × g for 20 min at 4°C. Supernatant was collected for Western blotting, and GCN5 was immunoprecipitated with the polyclonal hsGCN5 antibody (generously provided by Shelley Berger, Wistar Institute) by the protocol of Santa Cruz Biotech, Inc. HeLa cell nuclear extract was kindly provided by Warren Liao and Yongsheng Ren (M.D. Anderson Cancer Center).

Cloning and expression of full-length mmGCN5 and mmP/CAF. Comparison of the mmGCN5 genomic and cDNA clones revealed that the isolated cDNA lacks the sequences encoding the first 74 amino acids. These sequences (which lack introns) were excised from the GCN5 genomic clone by NcoI and BssHII digestion and inserted into the appropriate position of the cDNA clone to generate a full-length mmGCN5 cDNA, as verified by DNA sequencing. Full-length mmGCN5 was subcloned into the NcoI and HindIII sites of the pRSETB vectors (Invitrogen), such that an N-terminal His₆ tag was fused in frame with the coding region. Similarly, full-length mmP/CAF was subcloned into the BamHI and KpnI sites of the pRSETB vector. His₆-tagged proteins were induced in BL21-DE3 bacterial cells by addition of 1 mM IPTG (isopropyl--D-thiogalactopyranoside). Recombinant protein was purified by using nickel-nitrilotriacetic acid resin (Qiagen) according to the manufacturer's protocol. Purified recombinant proteins were verified by Western blot analysis with an antibody specific to the His₆ tag (Clontech).

Acetyltransferase assays. Acetyltransferase assays were performed as previously described (4, 5). HeLa cell mononucleosomes or core histones were the kind gift of Jerry Workman, and the cysteine-linked peptides (corresponding to amino acids 1 to 20 of H3 or to this same region with substitution of acetyl-lysine at positions 9 and 14) were the gift of C. David Allis. Calf thymus histones were purchased from Worthington Biochemical Corporation (Freehold, N.J.). Acetylation assays were performed in 10- to 30-µl volumes with either 10 µg of histones or the indicated amount of synthetic peptide. Following incubation at 30°C for 30 min, an aliquot of each reaction mixture was processed for liquid scintillation counting (P81 filter assay) as described by Brownell et al. (5), and when appropriate, another aliquot was electrophoresed on an SDS-22% polyacrylamide gel and histones were visualized by Coomassie blue staining and autoradiography.

GST fusion protein interaction assays. Glutathione S-transferase (GST)-CBP/p300 interaction assays were performed as described by Yang et al. (41) except that crude bacterial lysates containing His-tagged recombinant P/CAF, GCN5, or HIRA were used and the interactions were detected by Western blotting with the His tag antibody.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Cloning of mmGCN5. In order to study the function of acetyltransferases in a mammalian system, we endeavored to clone mouse GCN5 homologs. First we generated a fragment of the mmGCN5 cDNA using a nested PCR strategy employing degenerate primers homologous to conserved regions of the yeast GCN5 and the Tetrahymena p55 genes. To further enhance the probability of identifying GCN5-related sequences, this fragment was used together with a human GCN5 EST to screen a 13.5-dpc mouse embryonic cDNA library under conditions of low stringency (11). Multiple positive clones were identified, and upon sequencing, these were found to contain open reading frames predicted to encode proteins with significant homology to either hsGCN5 or hsP/CAF (Fig. 1).

View larger version (78K): [in this window] [in a new window]   FIG. 1.   Alignment of the mmGCN5, mmP/CAF, and reported hsGCN5 amino acid sequences. Identical amino acids are shaded. Amino acid deletions are indicated with a dotted line. The locations of the histone acetyltransferase (HAT)/acetyl coenzyme A binding regions (20, 38) and the bromodomain motif (17) are indicated. The full bromodomain likely encompasses amino acids 363 to 472 of hsGCN5 (19).

View larger version (20K): [in this window] [in a new window]   FIG. 2.   Comparison of GCN5 and P/CAF sequences across species. (A) Schematic comparisons of mmGCN5 and mmP/CAF sequences with GCN5 and P/CAF proteins from other species. Published sequences were obtained by searching the PIR-Protein and SWISS-PROT databases. Positions of the putative catalytic domains and the bromodomains are indicated above the diagram. Percent identities between proteins are indicated on the right. yGcn5p, yeast Gcn5p; HAT, histone acetyltransferase; aa, amino acids. The dotted box indicates the existence of a predicted extended amino-terminal region in the hsGCN5 protein. (B) Comparison of the Kozak consensus sequence for translation start sites, the predicted mmGCN5 translation start sites, and the previously reported hsGCN5 translation start site (41). The underlined AUG is the codon for the initiator methionine. The A of the AUG is designated +1. In the consensus sequence, the nucleotides at positions 3 and +4 have the greatest impact on translation efficiency; 97% of vertebrate mRNAs have a purine (A or G, preferably A) in position 3, and 46% have a G in position +4 (21, 22).

View larger version (47K): [in this window] [in a new window]   FIG. 3.   (A) Genomic structure of mmGCN5. Exons in the mmGCN5 gene are shown in boxes, while introns are represented by the intervening lines. The thick line indicates the intron that is retained in some alternatively spliced variants and which is homologous with sequences found in the previously reported 5' untranslated region of the hsGCN5 cDNA. The asterisks indicate in-frame stop codons that would prevent translation of the full-length protein. Exon 7 is the exon that is skipped in the mouse cDNA. Exon 8 is the first coding exon in the reported hsGCN5 cDNA. The positions of the translation start codon (ATG) and the termination codon (TAG) are indicated. (B) Coexistence of multiple forms of mammalian GCN5 transcripts. Left panel, DNase I-treated RNAs from mouse kidney, ovary, and embryo and human HeLa and hepatoma cell lines were RT-PCR amplified by using primers A and B shown in the diagram on the right. RT-PCR products were resolved on an ethidium bromide (Et-Br)-stained agarose gel. Mouse genomic DNA was also amplified under the same conditions. A prevalent product corresponding to the size of the mouse cDNA (without introns 6 and 7) was amplified from all of the RNA samples, while other, larger products corresponding to the size of the reported human cDNA (containing intron 6 but not intron 7) were barely detected. Middle panel, the RT-PCR products were transferred to nylon membrane and hybridized with mmGCN5 cDNA sequences. Right panel, the same blot from the middle panel was stripped and rehybridized with a probe (probe A) specific to the conserved intron 6. (C) The RT-PCR products described above were gel purified and then amplified by PCR with a nested pair of primers. The PCR products were then subjected to DNA sequencing. The nucleotide sequence of the 317-bp fragment is shown. The smaller (292-bp) fragment has the same sequence as the larger fragment except that it lacks exon 7 sequences. Exons are boxed, and introns are numbered underneath. In-frame stop codons are in boldface and marked by asterisks. The mmGCN5 reading frame separated by intron 6 and exon 7 is shown. The initiator methionine codon for the reported hsGCN5 (41) protein is in boldface and underlined.

Incomplete splicing might yield a shorter GCN5 protein in mouse and human cells. We were interested in determining the basis of the incongruity in size between mmGCN5 and the reported human cDNA. Inspection of the mmGCN5 genomic sequence revealed the presence of an intron (intron 6 in Fig. 3A) 10 bp upstream of the previously reported upstream-most hsGCN5 translation initiation site (41). Sequences highly similar (91% identical) to these intronic sequences are also present in the predicted 5' untranslated region of the reported hsGCN5 cDNA but are absent in the mouse cDNA we isolated as described above. These comparisons suggest either that the mouse and human GCN5 genes are subject to differential splicing events, in which this intron is either removed (mouse) or retained (human), or that the previously identified human cDNA sequence is incomplete. Interestingly, a conserved, in-frame stop codon is found near the beginning of intron 6, and retention of this intron would prevent translation of the larger protein in both mouse and human cells, perhaps yielding a smaller protein with a size corresponding to that previously predicted for hsGCN5.

Long GCN5 proteins are present in both human and mouse cells. To identify the size of the native mammalian GCN5 protein(s), total cell extracts prepared from a 12.5-dpc mouse embryo or human HeLa cells were probed with a polyclonal serum raised against the previously described hsGCN5 (generously provided by Shelley Berger, Wistar Institute). The hsGCN5-specific antiserum detected a 98-kDa protein in the HeLa cell nuclear extracts, consistent with the predicted size of the full-length GCN5 protein containing the extended amino-terminal region (Fig. 4A, left panel). To ensure that this band corresponded to mmGCN5 and that the hsGCN5 antibody did not cross-react with P/CAF, we compared the relative signals obtained with the hsGCN5 antibody and a P/CAF antibody (generously provided by Yoshihiro Nakatani, National Institutes of Health) with extracts from U2OS cells or HeLa cells. The P/CAF antibody recognized a single band in the U20S extract, consistent with previous reports that P/CAF is well expressed in these cells (41), and in the HeLa cell nuclear extract. The hsGCN5 antibody, however, did not recognize any proteins of a similar size in either extract but did recognize a prominent band of ~98 kDa in the HeLa cell nuclear extract. Therefore, the hsGCN5 antibody does not appear to cross-react significantly with PCAF, and we conclude that the 98-kDa protein recognized by this antibody in HeLa cell extracts is GCN5.

View larger version (19K): [in this window] [in a new window]   FIG. 4.   Detection of both long and short GCN5 proteins. (A) Left panel, protein extracts were prepared from U2OS cells or HeLa cell nuclei and probed with polyclonal antibodies to hsP/CAF or hsGCN5, as indicated. Right panel, protein extracts were prepared from 12.5-dpc mouse embryos or HeLa cells and probed with the hsGCN5 antibody. (B) GCN5 proteins were immunoprecipitated (IP) from 12.5-dpc mouse embryos and then probed with hsGCN5 antibody. An unrelated HIRA polyclonal antibody was used as a negative control.

Cloning of mmP/CAF. A second GCN5-related cDNA clone that contained a high degree of similarity to hsP/CAF was isolated in our screen of the mouse cDNA library. Since all initial clones appeared to be incomplete, containing an 867-bp fragment of the cDNA (relative to the human sequence), a second library was screened by using GeneTrapper technology. Multiple full-length cDNAs containing an open reading frame predicted to encode 813 amino acids were obtained. This open reading frame exhibited 93% identity to the hsP/CAF cDNA sequence but only 75% identity to the reported hsGCN5 cDNA sequence (41). We therefore designated this clone mmP/CAF. Both the mmGCN5 and the mmP/CAF sequences possess predicted catalytic domains and bromodomains identified in a number of recently identified histone acetyltransferases, including several highly conserved amino acids near the putative catalytic center (Fig. 1).

Ubiquitous but complementary expression of mmGCN5 and mmP/CAF. To examine and compare the expression of mmGCN5 and mmP/CAF, total RNA was extracted from various mouse tissues, subjected to denaturing electrophoresis, transferred to a membrane, and then probed with mmGCN5- or mmP/CAF-specific sequences.

View larger version (46K): [in this window] [in a new window]   FIG. 5.   Ubiquitous and complementary expression of mmGCN5 and mmP/CAF. (Top panel) Total RNA was isolated from various mouse tissues and embryos as indicated. Northern blot hybridization was performed with a mixture of mmGCN5 and mmP/CAF cDNA probes. Two transcripts were detected and are indicated by arrows on the right. The identities of the transcripts were confirmed by Northern blot hybridization with single GCN5 or P/CAF probes (data not shown). Positions of RNA molecular size standards (in kilobases) are shown on the left. (Bottom panel) Ethidium bromide-stained gel showing 18S rRNAs.

Chromosomal locations of the mmGCN5 and mmP/CAF genes. The chromosomal location of the mmGCN5 gene was mapped by standard linkage analysis with the Jackson Laboratory interspecific backcross panel (C57BL/6Jei × SPRET/Ei)F₁ × SPRET/Ei, also known as Jackson BSS (33). mmGCN5 mapped cleanly to a distal region on chromosome 11 and cosegregated tightly with BRCA1, as well as with a number of other genes previously mapped to that locus (data not shown, but raw data from the Jackson Laboratory are available at http://www.jax.org/resources/documents/cmdata). Interestingly, the hsGCN5 gene was recently mapped by fluorescent in situ hybridization analysis to a syntenic region of human chromosome 17 (9) and was also found to cosegregate with human BRCA1.

mmGCN5 encodes a histone acetyltransferase with substrate specificity similar to that of P/CAF. The high degree of homology between the mouse, human, and yeast GCN5 proteins strongly predicts that mmGCN5 and mmP/CAF will exhibit histone acetyltransferase activity. We confirmed this initially by examining the activities of the isolated, conserved acetylase domains of mmGCN5 and mmP/CAF, expressed as recombinant proteins in Escherichia coli. As expected, this domain of mmGCN5 was quite active as a histone acetylase, and it preferentially acetylated free (nonnucleosomal) histone H3, and to a lesser degree H4, as does yeast Gcn5p (23) and the previously reported form of the hsGCN5 protein (41). Full-length mmGCN5 and mmP/CAF recombinant proteins (also expressed in bacteria) exhibited this same substrate specificity towards free histones (Fig. 6 and data not shown).

View larger version (25K): [in this window] [in a new window]   FIG. 6.   Acetylation of histone H3 synthetic peptides by mmGCN5 and mmP/CAF. (A and B) Results of acetyltransferase assays with recombinant full-length mmGCN5 and synthetic peptides corresponding to the amino-terminal tail of histone H3. (C and D) Results of peptide assays with recombinant mmP/CAF. Peptides were either unacetylated (un) or synthesized with acetyl-lysine residues at either K9 and K18 (di9,18) or K9 and K14 (di9,14) in H3. Vector indicates assay of a control extract, made from bacteria transformed by the recombinant vector without an acetyltransferase insert, subjected to the His tag purification procedure.

View larger version (74K): [in this window] [in a new window]   FIG. 7.   Acetylation of nucleosomal histones by mmGCN5 and mmP/CAF. Acetyltransferase assays were performed with HeLa cell mononucleosomes or free histones as indicated, and an aliquot of each assay mixture was resolved on an SDS-22% polyacrylamide gel. Coomassie blue-stained gels and corresponding autoradiographs are shown. In both assays, histones H3 and H4 were acetylated by the recombinant full-length mmGCN5.

mmGCN5 and mmP/CAF both interact with CBP and p300. hsP/CAF interacts with CBP and p300 (41). Given the similarity between mmGCN5 and mmP/CAF, we examined the abilities of both of these proteins to bind to CBP or p300 in vitro (Fig. 8).

View larger version (31K): [in this window] [in a new window]   FIG. 8.   mmGCN5 and mmP/CAF both interact with CBP and p300 in vitro. (A) Fragments of CBP fused to GST that were used for the interaction assays in panel C. These fragments span the region of homology to ADA2 and extend into the transactivation domain of CBP (41). (B) Recombinant, His-tagged proteins used in the interaction assays of panel C were resolved by SDS-polyacrylamide gel electrophoresis and probed with an antibody specific for the His tag. The amounts shown represent 0.25 or 1% of the protein used in the assay, as indicated. (C) GST-CBP or -p300 fusion proteins were mixed with crude bacterial lysates containing P/CAF, GCN5, or HIRA protein. Interacting proteins were recovered by using glutathione-Sepharose and detected on Western blots with the anti-His tag antibody. The p300 B' fragment is homologous to the CBP B fragment, and the CBP B fragment is missing residues 1801 to 1851 (41).

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The recent identification of nuclear histone acetyltransferases has directly linked chromatin modification with transcriptional regulation (1, 5, 26, 29). We report here the cloning of mmGCN5 and mmP/CAF sequences. We find that mmGCN5 differs from yeast GCN5 and the previously reported hsGCN5 sequences in that it encodes a large N-terminal domain similar to that found in P/CAF. Our data indicate that hsGCN5 contains this extra domain as well. While this domain does not appear to affect the histone specificity of the acetyltransferase, it does afford the enzyme the ability to modify nucleosomal substrates in vitro.

In vivo, both the yeast and mammalian enzymes must interact with and modify nucleosomal histones. In yeast, this is accomplished by association of Gcn5p into high-molecular-weight protein complexes that can modify nucleosomes and that recognize additional histones (14). At least some of the Gcn5p-associated proteins are conserved in higher eukaryotes, and Gcn5-Ada complexes have been identified in human cells (7), further indicating that these enzymes serve similar functions across species. We scanned the yeast genome database to determine whether a protein homologous to the amino-terminal domains of mmGCN5 or mmP/CAF might exist that could be a component of the Gcn5p-containing complexes. However, we found no such homologs.

Interestingly, a single GCN5-related gene has been identified in Drosophila. This gene exhibits high similarity to mammalian P/CAF (34a) and encodes the extended N-terminal domain. Although this domain is apparently not needed in yeast, its functions are not restricted to mammals.

Our work indicates that multiple differentially spliced forms of GCN5 transcripts coexist in both mouse and human cells, which may generate different isoforms of GCN5 proteins. Of course, we cannot rule out the possibility that the less abundant products represent incompletely spliced RNAs, but it is interesting that intron 6 and the stop codons therein are conserved between human and mouse. Since we detected transcripts containing intron 6 in both mouse and human tissues, we are intrigued by the possibility that shortened GCN5 proteins, containing either the N-terminal domain alone or the C-terminal domain alone, may provide an additional level of regulation of GCN5 functions. For example, we detected the full-length GCN5 protein in mouse embryo extracts and some human cells, but we detected a shorter, less abundant protein in HeLa cells in addition to the full-length protein. It will be especially interesting to determine whether various forms of GCN5 proteins are differentially regulated in different cell types or at different developmental stages.

The long form of mmGCN5 is very similar to mmP/CAF in structure, in acetyltransferase activity and substrate specificity, and in interactions with CBP/p300. Additional experiments are needed to determine whether these two proteins are functionally redundant in vivo. Even if GCN5 and P/CAF perform the same functions, they might be utilized at different developmental stages or in different cell types or tissues. The similarity between these proteins is somewhat reminiscent of that between CBP and p300. These two proteins also appear to be functionally equivalent in vitro, but mutations in p300 and CBP cause different phenotypes (27, 30), indicating that the proteins are not functionally redundant in vivo. It will be interesting to determine whether the same is true for mmGCN5 and mmP/CAF.

Several histone acetyltransferases, including p300/CBP and P/CAF, have been implicated in growth control and tumorigenesis (30, 32, 41). p300/CBP physically interacts with the tumor suppressor p53 and potentiates sequence-specific DNA binding and transactivation by p53 through acetylation of its C-terminal domain (15). Moreover, mutations in p300 have been found in certain colorectal and gastric cancers (27). CBP mutations are also involved in the etiology of certain acute myeloid leukemias and Rubinstein-Taybi syndrome (30), a developmental disorder with a high incidence of neoplasms. In addition, P/CAF counteracts the transforming activity elicited by oncoprotein E1A, and overexpression of P/CAF has been shown to inhibit cell cycle progression (41). Therefore, histone acetyltransferases have been postulated to be negative regulators of cell growth and, possibly, tumor suppressors. We (this study) and others (9) have found that GCN5 cosegregates with the tumor suppressor BRCA1 gene (1-centimorgan interval) in a highly syntenic region in mouse (chromosome 11) and human (chromosome 17). Interestingly, loss of heterozygosity on human chromosome 17 is a frequent genetic alteration in sporadic breast and ovarian cancers, where mutations in BRCA1 and BRCA2 are rarely found (28, 35). Indeed, a novel tumor suppressor gene involved in these cancers has been postulated to be located adjacent to the BRCA1 locus (28, 35). GCN5 may provide an attractive candidate for this novel tumor suppressor. The isolation and characterization of mmGCN5 and mmP/CAF reported here should facilitate further study of the roles of these genes and of histone acetylation in normal mammalian development, as well as in abnormal events leading to tumorigenesis.