Previous Article | Next Article 
Molecular and Cellular Biology, October 1998, p. 5942-5951, Vol. 18, No. 10
Department of Molecular Biology and
Microbiology1 and
Department of
Biochemistry,2 Tufts University School of
Medicine, Boston, Massachusetts 02111-1800
Received 9 June 1998/Accepted 10 July 1998
The interaction of the Fip1 subunit of polyadenylation factor I
with the Saccharomyces cerevisiae poly(A) polymerase (PAP) was assayed in vivo by two-hybrid analysis and was found to involve two
separate regions on PAP, located at opposite ends of the protein sequence. In vitro, Fip1 blocks access of the RNA primer to an RNA
binding site (RBS) that overlaps the Fip1 carboxy-terminal interaction
region and, in doing so, shifts PAP to a distributive mode of action.
Partial truncation of this RBS has the same effect, indicating that
this site is required for processivity. A comparison of the utilization
of ribo- and deoxyribonucleotides as substrates indicates the existence
on PAP of a second RBS which recognizes the last three nucleotides at
the 3' end of the primer. This site discriminates against
deoxyribonucleotides at the 3' end, and interactions at this site are
not affected by Fip1. Further analysis revealed that the specificity of
PAP for adenosine is not simply a function of the ATP binding site but
also reflects interactions with bases at the 3' end of the primer and
at another contact site 14 nucleotides upstream of the 3' end. These
results suggest that the unique specificity of PAP for ribose and base,
and thus the extent and type of activity with different substrates,
depends on interactions at multiple nucleotide binding sites.
Cleavage and polyadenylation of the
3' end of eukaryotic precursor mRNA is a modification essential for
proper mRNA utilization. The primary function of poly(A) polymerase
(PAP) in this processing reaction is to add poly(A) tails to the
cleaved precursor (for a review, see reference 34).
With the help of specificity factors, PAP is directed to the
appropriate substrate, exhibits increased processivity, and terminates
poly(A) synthesis at the correct tail length. The factors conferring
these activities to PAP are cleavage/polyadenylation specificity factor
(CPSF) and poly(A) binding protein II (PAB II) in mammalian cells
(34) and cleavage/polyadenylation factor I (CF I),
polyadenylation factor I (PF I), and Pab1 in the yeast
Saccharomyces cerevisiae (1, 4, 16, 23, 25). Direct contacts between the mammalian PAP and the p160 subunit of CPSF
(24) and between yeast PAP and the Fip1 subunit of PF I
(26) have been demonstrated. While specificity factors are the primary modulators of PAP activity, other regulatory mechanisms have also been documented. For example, the activity of mammalian PAP
is inhibited by direct interaction with the U1A protein, as a feedback
mechanism controlling the polyadenylation of mRNAs encoding U1A
(9) or with the U1 70K protein as part of the U1 snRNP
(8). Moreover, PAP can in turn modulate the activity of
cleavage factors. The mammalian enzyme stimulates the cleavage step of
the reaction (34), and a temperature-sensitive mutation in
the yeast PAP can affect the choice of cleavage site in vivo (20). The biochemical mechanisms underlying these regulatory events are not understood.
While PAP is most appropriately considered a catalytic subunit of the
cleavage-polyadenylation machinery, many of its enzymatic properties
can be studied independently of its association with these factors. PAP
does not require a nucleic acid template, a property shared with
terminal deoxynucleotidyltransferase and the CCA-adding tRNA
nucleotidyltransferases. Sequence comparisons (11, 21)
suggest that PAP has an organization of motifs similar to these and
other enzymes in the nucleotidyltransferase superfamily. Further
experimental work on bovine PAP showed that three conserved aspartates
within the proposed catalytic domain are necessary for catalysis
(21). By analogy with better-characterized members of the
nucleotidyltransferase family, the catalytic site in PAP is thought to
position and activate the 3' OH of the RNA primer to attack the The locations on PAP for binding of ATP and the 3'end of RNA are not
known. Essential carboxyl-terminal RNA binding sites (C-RBS) in yeast
and bovine PAPs have been identified (21, 36). The C-RBS of
the yeast PAP does not interact with the 3' end of the RNA
(36), and its role in enzyme function has not been defined. It is thought to interact in part with the phosphate backbone of
polynucleotides (36). The proposed interactions at the
catalytic site of PAP and the C-RBS do not account for the preference
of PAP for RNA as a primer and adenosine-containing ribonucleotides as
the nucleoside triphosphate (NTP) substrate, and it is clear that
our understanding of the mechanism of action of PAP, alone and when
complexed with specificity factors, is not complete.
Previous reports have made conclusions regarding the specificity of PAP
based on assays measuring the incorporation of radioactivity into
acid-precipitable products. By examining the products of such reactions
by gel electrophoresis, we have been able to more clearly dissect the
properties of PAP which contribute to its substrate specificity and to
determine the consequences of various protein-protein interactions on
PAP's activity. We have found that the overlap of the C-RBS with a
PAP-Fip1 interaction site allows the Fip1 subunit of PF I
(26) to regulate the processivity of PAP. A second site on
PAP, which is not affected by Fip1, recognizes the base and ribose
natures of the last three nucleotides of the primer, and a third site
contacts the RNA approximately 14 nucleotides upstream of the 3' end.
Based on these results, we discuss a model for the functional
organization of the S. cerevisiae poly(A) polymerase.
Nucleic acids.
Radioactive deoxynucleoside triphosphates
(dNTPs) and NTPs were from ICN and DuPont NEN. ATP, UTP, CTP, GTP, and
2'-dATP were from Promega, and 3'-dATP was obtained from Sigma.
Oligo(A)2, oligo(A)3, oligo(A)4,
oligo(A)12, and oligo(A)26 were from Oligos Etc. A 24-nucleotide single-stranded DNA
(ATGAGCTCAGCAGCAGAAAATAAA) was used as a DNA primer. For UV
cross-linking studies, randomly labeled GAL7-9 RNA was used as
described previously (36).
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Processivity of the Saccharomyces
cerevisiae Poly(A) Polymerase Requires Interactions at the
Carboxyl-Terminal RNA Binding Domain
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
,
phosphate bond of ATP. The observation that poly(A) synthesis proceeds
by a nucleophilic substitution (an SN2 in-line mechanism)
without a covalent intermediate (35) is consistent with such
a model.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
14PAP-GBD, the SacI-BsmI
fragment of wtPAP-GBD was replaced with the corresponding fragment from
plasmid pJ14PAP (36). For the second orientation, the GBD
was fused to the amino terminus of Pap1. In this case, the
SacI-XcmI fragment of pGAD-F327 (26)
was replaced with a SacI-AseI (blunted) fragment
of PAP1. GBD-6PAP, GBD-8PAP, GBD-9PAP, and
GBD-10PAP were constructed by truncation or replacement of the
wild-type PAP coding sequence with sequences as described for the
corresponding pJ6PAP, pJ8PAP, pJ9PAP, and pJ10PAP
expression plasmids (36). pGAD-FIP(20-327) was obtained by
two-hybrid screening (3) of the library prepared by James et
al. (12), using wtPAP-GBD as a bait and 14PAP-GBD as a
control. This fusion lacks the first 19 of the 327 amino acids of Fip1.
Two-hybrid assay.
S. cerevisiae EGY40 (ura3-1
his3-11 trp1-1 leu2-3,112), a gift from R. Brent, was used for
two-hybrid screening and analysis of PAP-Fip1 interactions in vivo. The
interactions of pGAD-FIP(20-327) with wtPAP-GBD, 14PAP-GBD,
GBD-wtPAP, and GBD-6PAP, -8PAP, -9PAP, and -10PAP were
tested by two-hybrid analysis (3), using the reporter
plasmid pBS-GAL (a gift from E. Androphy, Tufts University).
Interactions were quantitated by -galactosidase assays using
permeabilized cells (13).
Recombinant proteins.
Wild-type PAP, 14PAP, and 9PAP
were expressed and purified as described previously (36).
The Fip1-His6 fusion was expressed from the pFL11 plasmid,
a gift of W. Keller (26), using the expression conditions
and crude extract preparation described for PAP (36), except
that the composition of the lysis buffer was 10 mM Tris HCl (pH 8), 500 mM NaCl, 10% glycerol, 20 mM -mercaptoethanol, 1 mM
phenylmethylsulfonyl fluoride, 0.6 µM leupeptin, 2 µM pepstatin A,
and 0.5% Nonidet P-40. This His6-tagged Fip1 was then
purified by loading the supernatant onto a nickel-charged 2.5-ml
iminodiacetic acid column (Sigma) which had been equilibrated with
starting buffer (lysis buffer without Nonidet P-40). Bound protein was eluted by applying consecutive step elutions of five column volumes of
starting buffer containing 5, 20, 60, 125, 250, and 400 mM imidazole.
Fractions containing Fip1 (60 mM imidazole) were pooled, dialyzed
twice, for 3 h each, against 1 liter of 10 mM Tris-HCl (pH 8)-100
mM KCl-10% glycerol-1 mM phenylmethylsulfonyl fluoride-0.5 mM
dithiothreitol, and loaded onto an equilibrated 15-ml DEAE-Sephacel column (Pharmacia). The column was developed with a 100 to 500 mM KCl
gradient, and fractions containing Fip1 (150 mM KCl) were combined.
Attempts to purify Fip1 further by means of a 1-ml HiTrap heparin
column (Pharmacia) and a 1-ml Mono S column (Pharmacia) were
unsuccessful because Fip1 and contaminating proteins did not bind to
these matrices. The Fip1-containing flowthrough from the Mono S column
was applied to a 1-ml Mono Q column (Pharmacia) equilibrated with a
buffer containing 50 mM HEPES-KOH (pH 7.5), 100 mM KCl, 10% glycerol,
0.25 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 0.5 mM
dithiothreitol and eluted with a 100 to 500 mM KCl gradient. Fip1
eluted at a KCl concentration of approximately 200 mM. The S. cerevisiae poly(A) binding protein (Pab1) was a kind gift of Allan
Jacobson.
PAP assays. Polymerization reactions were carried out as described previously (36) in 10 µl of a solution containing 20 mM HEPES-KOH (pH 7.5), 10% glycerol, 1 mM MnCl2, 50 mM KCl, 0.25 mM EDTA, 0.5 mM dithiothreitol, 0.5 mg of bovine serum albumin per ml, 250 µM NTP, 1 µCi of [32P]NTP, 1 µM primer, and 20 to 250 ng of PAP (32 to 400 nM) at 30°C for the various periods of time. The various substrates, proteins, and PAP enzymes used in the different assays are indicated in the figure legends. Reaction products were analyzed either by Cherenkov counting of acid-precipitable counts as described previously (36) or by fractionation on 18% polyacrylamide-8.3 M urea gels and visualization by autoradiography, using a PhosphorImager (Molecular Dynamics). Cross-linking of PAP to RNA with UV light and analysis of products were performed as described previously (36), using 200 ng of PAP per 10-µl reaction volume.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Two PAP regions mediate interaction with Fip1. In eukaryotic cells, PAP functions as a complex with other proteins to specifically polyadenylate cleaved mRNA precursor. This type of reaction, when recreated in vitro with purified and/or partially purified factors, is referred to as the specific activity of PAP. The ability of PAP to extend any RNA primer in the absence of other proteins is known as its nonspecific activity. In our previous analysis of PAP truncations (36), we discovered that the N-terminal 18 amino acids of yeast PAP are essential for its specific activity in vitro and in vivo yet are entirely dispensable for nonspecific poly(A) addition. We have called this 18-amino-acid region specificity domain 1 (SpD1) (see Fig. 1A), reflecting its probable role in interactions with other components of the polyadenylation machinery. Preker et al. (26) have shown that Fip1, a component of PF I, interacts directly and specifically with yeast PAP. However, the Fip1 binding sites on PAP and the consequences of its interaction for PAP activity have not been studied.
To determine domains in PAP necessary for its interaction with Fip1, we employed yeast two-hybrid analysis (3). The GBD was fused in frame with the PAP coding sequence at a site 20 amino acids up from the carboxyl end of PAP. We had previously shown that the last 20 amino acids of PAP are not necessary for any of its activities (36). This construct (wtPAP-GBD) was tested for interaction with an amino-terminal fusion of the Gal4 activation domain (GAD) to Fip1 sequence GAD-FIP(20-327), using a Gal4-dependent-galactosidase reporter gene. The wtPAP-GBD fusion yielded a high
level of -galactosidase activity when paired with GAD-FIP(20-327) (Table 1). With a construct lacking the
amino-terminal specificity domain (14PAP-GBD) (Table 1),
-galactosidase activity was reduced over 50-fold, implicating this
region in Fip1 interaction.
|
-galactosidase reporter gene (Table 1). Interestingly, only the
wtPAP-GBD fusion, and not GBD-wtPAP, could rescue a lethal disruption
of the chromosomal PAP1 gene (data not shown). Since we have
previously shown that the SpD1 domain at the amino terminus of PAP is
essential for cell viability (36), the failure of GBD-wtPAP
to rescue a PAP1 knockout is likely to be the result of a
steric constraint imposed by the GBD, rendering SpD1 inaccessible to
interaction with specificity factors. Nevertheless, our two-hybrid results, as well as data from the original screen which identified Fip1
(26), showed that GBD-wtPAP is still capable of Fip1
interaction (Table 1) and indicated the presence of an interaction
domain separate from SpD1. To map this second domain, we performed
additional tests, using truncations of PAP from the C terminus of the
GBD-PAP fusion, and found that a deletion of 55 amino acids
(GBD-8PAP) led to a 50-fold drop in -galactosidase activity
(Table 1). Interestingly, truncations of 31 and 43 amino acids from the
carboxyl end of PAP (GBD-10PAP and GBD-9PAP, respectively) led to
an increase in -galactosidase activity in comparison to that of the
wild-type PAP construct (Table 1). This activation implies that the
carboxyl Fip1 interaction domain initially becomes more accessible in
these constructs before being affected by the truncation of amino acids
44 through 55. The presence of the GBD at the carboxyl terminus of PAP
in the wtPAP-GBD fusion may exert an even greater inhibitory effect,
explaining the negative result with 14PAP-GBD. We have designated
the interaction site defined by the 8 deletion as SpD2 (Fig.
1A). SpD2 has no homology to SpD1,
implying that the two PAP regions interact with Fip1 in different ways.
Because the two-hybrid analysis is conducted in vivo, either
interaction with Fip1 could be direct or mediated through other
cellular factors.
|
8 and
9 mutants is important for interaction with the RNA primer
(36). This study showed that the majority of PAP-RNA cross-links introduced by UV light occur at this C-RBS (Fig. 1A). Since
our two-hybrid results indicate that the second Fip1 interaction region
partly overlaps the C-RBS, we decided to test whether purified recombinant Fip1 could affect the ability of purified PAP to cross-link to RNA. PAP was incubated with uniformly labeled RNA in the presence or
absence of Fip1 and exposed to UV light. The samples were then treated
with RNase and resolved on an SDS-polyacrylamide gel, and PAP was
detected by silver staining and autoradiography, as described by
Zhelkovsky et al. (36). Cross-linking of RNA to PAP is
eliminated by the presence of a twofold molar excess of Fip1 (Fig. 1B;
compare lanes 1 and 2), suggesting that Fip1 is blocking the
interaction of C-RBS with RNA. A similar decrease in the amount of PAP
cross-linked to radioactive RNA is found when an excess of unlabeled
poly(A) is included in the reaction (Fig. 1B, lane 3).
The processivity of PAP depends on interactions at the C-RBS.
We also examined the effect of Fip1 on the nonspecific activity of PAP.
The addition of increasing amounts of recombinant Fip1 progressively
inhibited the activity of PAP, as determined by incorporation of
[-32P]AMP into oligo(A)12 primer (Fig.
1C). The inhibition was close to maximal at an Fip1/PAP molar ratio of
1:1, and further inhibition was not observed at ratios beyond 2.5:1.
Raising the concentration of RNA primer 10-fold partially rescued the
PAP activity, indicating that the mechanism of Fip1 inhibition is
competitive in nature. Further kinetic analysis indicated that at a
Fip1/PAP molar ratio of 2:1 the Km for RNA
increased to 10 µM, which is 20-fold higher than that for PAP alone.
These observations are consistent with the Fip1-mediated inhibition of
UV cross-linking but are surprising given the report of Preker et al.
(25) that nonspecific activity of PAP is stimulated by
association with the Fip1-containing PF I factor.
14PAP, which lacks SpD1,
displayed the same distribution of products as wild-type PAP, both in
the absence and presence of Fip1 (Fig. 2B). Examination of the reaction products generated by 9PAP, which lacks part of the C-RBS, revealed a product distribution similar to that of wild-type PAP in the presence
of Fip1 (Fig. 2C). Addition of Fip1 to reactions containing 9PAP
further slowed polymerization of the poly(A) tails, consistent with the
presence of SpD2 on this mutant enzyme.
|
9PAP deletion infringes on the C-RBS, resulting in a 50-fold higher
Km for RNA and a decreased ability to cross-link to the RNA substrate (36). Our results presented here
implicate the C-RBS in enzyme processivity and suggest that one
consequence of the interaction of Fip1 with SpD2 may be to limit the
interaction of Pap1 with the primer, resulting in a shift to a
distributive mode of action.
The S. cerevisiae poly(A) binding protein, Pab1
(29), is another protein known to affect the activity of
yeast PAP. It is responsible for limiting the length of the poly(A)
tails in the specific polyadenylation reaction (1, 16, 23),
and it inhibits nonspecific poly(A) addition (19), as
measured by incorporation of radioactivity into acid-precipitable
counts. When Pab1 was added to poly(A) addition reactions at a PAP/Pab1
ratio of 1:2, there was no effect on polymerization (Fig.
3A and B). In the absence of Pab1 or at a
low concentration of Pab1, very long poly(A) species rapidly appeared
as products of the reaction (Fig. 3A and B). In contrast, when the
amount of Pab1 was increased 20-fold to a molar concentration 1.5 times
that of the RNA primer, PAP acted in a distributive mode, elongating
the primer slowly and uniformly, without a jump from short to very long
products (Fig. 3C, as seen up to the 10-min time point). However,
processive poly(A) addition resumed as the amount of de
novo-synthesized poly(A) increased and Pab1 became limiting (Fig. 3C,
20-min time point). The inclusion of Fip1 as well as Pab1 in the
reaction further slowed the enzyme (Fig. 3D), as expected from the
analysis of Fip1-PAP interactions described above.
|
Fip1 does not inhibit the initial steps of poly(A) addition.
2'-dATP can be utilized by PAP and has been shown to be an effective
and economical means of 3'-end labeling RNA (15, 22). Because the primer is extended by only a few 2'-dAMPs, incorporation of
this nucleotide into the ends of the oligo(A)12 primer can also serve as an assay to examine factors affecting the initial steps
of the poly(A) addition reaction. We tested whether the addition of
Fip1 at a concentration that inhibits the processivity of PAP in
nonspecific poly(A) addition had any effect on this reaction. Figure
4A shows that the efficiency of 2'-dAMP
addition is the same regardless of the presence of Fip1. Furthermore,
9PAP, with a partial truncation of the C-RBS, also works well in the addition of 2'-dAMP (Fig. 4A). This result demonstrates that the catalytic function of PAP is not altered when it is complexed with Fip1
and suggests that the PAP-RNA interactions at the C-RBS are separate
from interactions involved in positioning the 3' end of the primer in
the active site.
|
A second RBS on PAP recognizes the last three nucleotides of the primer. To gain a better understanding of the mechanism of action of PAP, we further analyzed the kinetics of incorporation of dAMP into the RNA primer. 3'-dATP is a substrate for PAP but terminates polyadenylation because of the lack of an acceptor hydroxyl group (17). The chain-terminating ability of 3'-dATP is evident from the rapid appearance and accumulation of a single band, representing the incorporation of radioactive 3'-dAMP into the oligo(A)12 primer (Fig. 4B). From this time course, it is clear that 3'-dATP is an efficient substrate for PAP, and after 10 min of incubation, there was no further increase in incorporation of label into the end of the primer, indicating that all of the primer had been modified. When PAP is presented with radioactive 2'-dATP instead of 3'-dATP (Fig. 4B), the initial rate of incorporation of 2'-dAMP is similar to that of 3'-dATP. However, unlike 3'-dATP, incorporation of the first 2'-dAMP into the RNA primer does not block the reaction. The resulting hybrid primer can accept a second dAMP residue, but at a rate much lower than that for the incorporation of the initial 2'-dAMP. The accumulation of product with a third 2'-dAMP is even slower, and a very slow distributive elongation beyond this point is observed only with a 10-fold-higher concentration of PAP (see Fig. 7B). These results indicate that PAP uses 2'-dATP and 3'-dATP as its substrates equally well. However, PAP is highly sensitive to the lack of 2' OH groups at the end of the RNA primer, and even though such a primer is a catalytically competent substrate, PAP does not extend it very efficiently.
Since we had previously shown that single-stranded DNA could effectively compete for binding at the C-RBS of PAP (36), we decided to examine the kinetics of poly(A) addition with a 24-base DNA oligonucleotide as a primer. The last three bases of the DNA primer were deoxyadenylates (see Materials and Methods). With an oligo(A)12 riboprimer, incorporation of radioactivity into acid-precipitable material was evident at the earliest time point. In contrast, with DNA as the primer, a lag was observed in the initial phase of the reaction (Fig. 5A). Analysis of the reaction products by denaturing acrylamide gel electrophoresis provided an explanation for this lag. With an RNA primer, short heterogeneous poly(A) products are rapidly converted into very long poly(A) molecules (Fig. 5B). In contrast, with a DNA primer, the only detectable products are very long poly(A) species and a low level of primer which has been elongated by one or two AMPs. The accumulation of these short products (b and c in Fig. 5B) suggests that the addition of the first three AMP residues to the DNA primer is rate limiting. The marked increase in processivity following this short extension indicated that the ribonucleotide-extended DNA is highly preferred as a substrate, even with an excess of unextended DNA. These results, presented in Fig. 4 and 5, demonstrate that much of the specificity of PAP for ribose-containing substrates comes from interactions at the 3'-end RBS. Once a few dAMPs are added to an RNA primer, PAP treats the primer as DNA and does not extend it further. In contrast, once a few AMP residues are added to a DNA primer, it becomes as efficient a substrate as RNA.
|
|
Nonspecific nucleotidyl transfer reveals another level of substrate
specificity and points to the presence of an additional RBS.
It
has been reported that eukaryotic PAPs have a high specificity for ATP
as a substrate and little affinity for other NTPs (10, 32).
This conclusion, based on assays using incorporation of
acid-precipitable counts into primer, has led to the general assumption
that the preference for adenosine is a function of the ATP binding site
of the enzyme. However, analysis of the products derived from reactions
using other NTPs as substrates suggests that this interpretation may
not give a complete picture of how PAP selects its substrates. We
performed polyadenylation reactions using
[-32P]-labeled NTPs under our standard conditions of
30 nM PAP, 0.5 mM NTP, and 1 µM oligo(A)12 primer and
analyzed the products by gel electrophoresis (Fig.
7A). As expected, no phase of the
reaction is limited with ATP, and primer is rapidly polyadenylated. In agreement with previously reported decreases in incorporation of
radioactivity with other NTPs, the amounts of radioactive product in
reactions containing GTP, UTP, CTP, or 2'-dATP were much smaller than
that found for ATP. However, the distribution of products varied
depending on the NTP used.
|
9PAP mutant, suggesting that
this part of the C-RBS is not involved in the poly(G) interaction (data
not shown).
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Based on the data described in this report, we propose a model for the functional organization of S. cerevisiae PAP that is shown schematically in Fig. 8. We have found that PAP operates in different modes, depending on the length and composition of the primer and the presence of other proteins or mutations in PAP which limit the access of the enzyme to its RNA substrate. These modes, discussed below, suggest that PAP is roughly organized into two functionally distinct domains: a catalytic pocket consisting of the N-terminal part of the molecule and a primer grip region found in the carboxyl half. These domains represent at least two points of contact of PAP with the RNA substrate, one with the 3' end of the primer, at a site on PAP presumably near the nucleotidyltransferase catalytic triad, and the second with the body of the primer in the carboxyl part of PAP.
|
The catalytic domain of PAP is a region defined by the nucleotidyltransferase motif and sites which interact with the incoming NTP and the very-3' end of the nucleic acid primer. Structural analysis of enzymes in the nucleotidyltransferase family (30) predicts that the carboxylate triad in PAP participates in metal-coordinated binding of the phosphate groups of ATP, as well as in positioning the nucleophilic 3' OH of the primer terminus to facilitate the nucleotidyltransferase reaction. Regions in PAP which interact with the base and/or sugar group of ATP and with the nucleotides at the 3' end of the primer have not been identified. However, properties of these sites which contribute to the specificity of PAP can be deduced from the experimental data collected here and in other published studies.
We have previously shown that ATP analogs with a 2- or 8-azido group, commonly used to map ATP binding sites by cross-linking, did not work for this purpose with yeast PAP (reference 36 and unpublished data), suggesting that bulky substitutions on the base of the incoming NTP are not tolerated. The fact that all nonadenosine NTPs are transferred poorly to a primer (10, 32) suggests that the primary discrimination of NTP on the base level occurs at the ATP binding site. However, the fact that some incorporation of other nucleotides can be detected, especially at a high enzyme concentration (10, 22), suggests that PAP is not absolutely specific for adenosine as the base of the incoming NTP. In this regard, one of the original studies of the yeast PAP found cytidylate residues in the poly(A) tracts of RNA made in vivo (10). Furthermore, our comparison of CMP and dCMP incorporation indicates that the 2' hydroxyl group of ribose, while not essential, does stabilize the interaction at the ATP binding site.
Our results show that interactions at a 3'-end binding site (3'RBS, Fig. 8) also contribute to the ribose and base specificity of PAP. An oligo(A) trimer or a DNA primer that has been extended by three AMPs can efficiently prime poly(A) addition. These observations suggest that a minimum of three ribonucleotides at the 3' end are required to accurately position the 3' OH of the primer and form a productive complex in the active site of the enzyme (Fig. 8). Since DNA can serve as a primer, albeit a poor one, the 2' hydroxyl group of ribose must not be directly involved in catalysis and more likely stabilizes the primer binding. The fact that 2'-dAMP addition renders an RNA primer a poor substrate supports this model. Interestingly, terminal deoxynucleotidyltransferase, the closest analog of PAP in terms of biochemical activity, can incorporate ribonucleotides into an oligodeoxynucleotide primer, but incorporation also stalls after the addition of two nucleotides (28). This modified primer can then be used for deoxynucleotidyl elongation, in a reaction which also displays a lag ressembling that seen for PAP-catalyzed addition of AMP to DNA.
Based on our data, the 3' RBS of PAP recognizes the last three nucleotides of the primer and strongly discriminates against deoxyribonucleotidyl residues at this position. Our results also imply a role for the 3' RBS in base recognition. The incorporation of a single CMP onto a primer is quite rapid, but the resulting product is a poor substrate for further elongation. Similarly, a lag phase in the utilization of poly(U) primer by the bovine PAP (33) and of poly(C) primer by the yeast PAP (19) has been interpreted to mean that the addition of a few adenosines to the ends of these substrates converts them to more-efficient substrates. It is also interesting to note that the penultimate nucleotide in cleaved mRNA precursor is often cytidine, followed by adenosine (34). This configuration is probably unfavorable for PAP and may provide time for the processing machinery to reorganize from a cleavage to a polyadenylation complex.
An additional RBS on PAP may also contribute to the specificity of the
enzyme. The existence of this site is indicated by the surprising
observation that the polymerization of oligo(G) tracts into primer
abruptly stops after 14 nucleotides have been added (references
22 and 31 and results reported
herein). At this point, the PAP does not switch to a slow distributive elongation mode like that seen with 2'-dAMP or CMP incorporation. Instead, a Gaussian distribution of products occurs, with an average of
12 GMP residues accumulating. One possible explanation for this
phenomenon is the existence on PAP of an RBS which interacts with the
primer at a point approximately 14 nucleotides from the 3' end. This
site, which was termed guanylyl-RBS (G-RBS, Fig. 8) for the
discrimination against poly(G), is base specific, allowing PAP to
elongate a primer containing poly(A) and poly(U), but not poly(G),
beyond 14 nucleotides. The effect of poly(C) on this site has not been
tested. In support of this interpretation, unpublished work referenced
by Martin and Keller (22) suggests that the yeast PAP binds
very poorly to primer with a G14 tail in a mobility shift
experiment. The location of this site is not known, but our data
suggest that it is different from the 3' RBS and the portion of the
C-RBS defined by the 9 deletion of yeast PAP. A previous report
(10) has pointed out that GTP, unlike CTP and UTP, is a
noncompetitive inhibitor of yeast PAP. Based on this fact and the
unusual distribution of reaction products formed with GTP, we speculate
that the G-RBS may be involved in primer translocation, but additional
research will be necessary to define its function. It is interesting
that the vaccinia virus PAP, which exhibits very little sequence
homology to the eukaryotic PAPs, also stalls after addition of 14 guanidylate residues (31). This common property strengthens
the hypothesis that the eukaryotic and vaccinia virus PAPs share a
similar structure-function organization.
Even though PAP is dedicated to the synthesis of poly(A) on precursor mRNA, its ATP binding site is not absolutely specific. However, PAP clearly contains motifs which place it in the nucleotidyltransferase superfamily, a group which includes mostly DNA polymerases. If PAP shares with these enzymes a common ancestor which lacks NTP specificity, it has, perhaps through evolution, been adjusted at several levels to create its specificity for adenosine and ribose, in this case at the ATP binding site, the 3' RBS, and the G-RBS. The interactions at these sites, together with the higher concentration of ATP in the cell relative to the other NTPs, ensures that the tails added to mRNA are poly(A).
Another RBS (C-RBS, Fig. 8) is located at the carboxyl terminus of yeast PAP (36), and a similar site was found in bovine PAP (21). PAP can successfully elongate a single-stranded DNA primer after the rate-limiting addition of three AMP residues. Moreover, single-stranded DNA competes efficiently for binding at the C-RBS (36). Based on these findings, we conclude that the C-RBS does not discriminate the sugar nature of the primer. It is not involved in 3'-end recognition, since radioactivity cannot be transferred to this site during UV cross-linking experiments if the RNA is 3'-end labeled (36). It is not known whether this site exhibits any preference for the base composition of the RNA substrate. However, as discussed below, we have found that the C-RBS, by gripping the body of the primer, confers processivity to yeast PAP.
We have shown that poor interactions at the 3' RBS cause a very slow
elongation of unfavorable substrates such as oligo(A) dimer,
single-stranded DNA, or primer with cytidylates at the 3' end. Our
results indicate that during poly(A) addition without such limitations,
the processivity of yeast PAP depends on the ability of the RNA
molecule to interact simultaneously with the 3' RBS and the C-RBS (Fig.
8). Disruption of the C-RBS, as seen with 9PAP, keeps the enzyme in
a distributive mode. This C-RBS does not seem to participate in the
block to elongation caused by poly(G)14. Based on this fact
and the observation that oligo(A)26 is a better substrate
for PAP than is oligo(A)12, it is likely that the C-RBS
binds RNA most effectively at some point beyond 14 nucleotides from the
3' end (Fig. 8).
It is also intriguing that interactions of other proteins with PAP or
with the RNA substrate can shift PAP from a processive to a
distributive mode of action. Our data shown that Fip1 has this property
and probably acts through a direct interaction at SpD2 to limit access
of the RNA to the C-RBS (Fig. 8). Preker et al. (26) have
proposed that Fip1 recruits PAP to the rest of the polyadenylation
machinery, thereby directing its activity to the appropriate substrate,
i.e., the cleaved ends of the mRNA precursor. PF I-associated PAP shows
an increased processivity in the nonspecific poly(A) addition reaction
in comparison to PAP alone (25), suggesting that other
components of PF I must be able to restore the interaction with RNA
occluded by Fip1. Moreover, the 9PAP mutant, with a truncated C-RBS,
can rescue a yeast strain with a chromosomal disruption of the
PAP1 gene and is active in specific polyadenylation assays
in vitro, giving tails of the correct length (36). This
further supports the idea that other factors can overcome a block in
processivity. PF I subunits with such a property could include Yth1,
which interacts with Fip1 and nonspecifically with RNA (2),
or Pfs1, which has a zinc knuckle motif predicted to bind RNA
(25). The interaction of Fip1 with Rna14 (26)
provides additional bridges to the RNA substrate, via the Rna15 subunit
of CF IA as well as Hrp1 (CF IB), which directly contacts the UA-rich
efficiency element (15).
An unanswered question concerns the function of the SpD1 domain of yeast PAP. This region is clearly needed for PAP's participation in specific polyadenylation but is not necessary for Fip1's effect on PAP processivity. Further experiments will be needed to determine the consequences of the SpD1-mediated interaction of PAP with Fip1. Since it is possible that this interaction is mediated through other factors, it may also be involved in restoring PAP processivity. In summary, interaction of PAP with the Fip1 subunit of PF I may have several functions in controlling the activity of PAP. It could help prevent PAP from engaging inappropriate substrates. If the PAP-Fip1 interaction is maintained throughout the lengthening of the poly(A) tail to 50 to 90 nucleotides, disenabling the intrinsic processivity of PAP may make it easier to regulate PAP activity and facilitate the termination of poly(A) addition provoked by Pab1 (1, 16, 23).
Pab1 is required in the specific poly(A) addition reaction to limit the extension of the poly(A) tails to the normal length of 50 to 100 nucleotides (1, 16, 23). Pab1 also inhibits the nonspecific activity of yeast PAP (19). In this report, we have shown that the reason for this inhibition is a decrease in the processivity of PAP. The mechanism of Pab1 inhibition is most likely different from but related to that underlying the Fip1 inhibition. While Fip1 will block PAP from contacting the RNA through its C-RBS, the formation of Pab1-RNA complex leaves only the 3' end accessible, thereby preventing the RNA from interacting with the C-RBS. To have this effect, Pab1 would not need to interact directly with PAP. However, a combination of Fip1 and Pab1 was not sufficient to terminate the addition of poly(A) to oligo(A) primer; other components of the polyadenylation machinery must be needed for full termination.
Similar regulatory mechanisms may be operating with the mammalian PAP. The mammalian holoenzyme (PAP plus CPSF and PAB II) synthesizes the poly(A) tail in a bimodal fashion, first slowly extending the RNA by about 10 to 15 nucleotides to create a PAB II binding site and then rapidly and processively elongating it to 250 nucleotides (34). p160 of CPSF has been shown to inhibit specific and nonspecific polyadenylation (24). It will be interesting to see whether interactions with CPSF subunits or PAB II modulate the binding of RNA to the RBS found in the carboxyl half of mammalian PAP (21), in a manner analogous to what we have found for yeast PAP. The region of mammalian PAP containing this site becomes hyperphosphorylated during the M phase of the cell cycle, resulting in inactivation of the enzyme (5, 6). The increased negative charge may also prevent RNA interaction at this site on PAP. Further research should allow us to draw additional correlations between the structural organization of the PAP family and mechanisms which define and regulate its enzymatic properties.
| |
ACKNOWLEDGMENTS |
|---|
We thank Debu Raychaudhuri and David Lazinsky for helpful discussions and review of the manuscript.
This work was supported by grant RPG-95-048-03-NP from the American Cancer Society to C.M.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111-1800. Phone: (617) 636-6935. Fax: (617) 636-0337. E-mail: cmoore{at}opal.tufts.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Amrani, N., M. Minet, M. Le Gouar, F. Lacroute, and F. Wyers. 1997. Yeast Pab1 interacts with Rna15 and participates in the control of the poly(A) tail length in vitro. Mol. Cell. Biol. 17:3694-3701[Abstract]. |
| 2. |
Barabino, S.,
W. Hubner,
A. Jenny,
L. Minvielle-Sebastia, and W. Keller.
1997.
The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc finger proteins.
Genes Dev.
11:1703-1716 |
| 3. | Bartel, P., and S. Fields. 1995. Analyzing protein-protein interactions using two-hybrid system. Methods Enzymol. 254:241-263[Medline]. |
| 4. |
Chen, J., and C. Moore.
1992.
Separation of factors required for cleavage and polyadenylation of yeast pre-mRNA.
Mol. Cell. Biol.
12:3470-3481 |
| 5. | Colgan, D., K. Murthy, C. Prives, and J. Manley. 1996. Cell-cycle related regulation of poly(A) polymerase by phosphorylation. Nature 384:282-285[Medline]. |
| 6. | Colgan, D., K. Murthy, W. Zhao, C. Prives, and J. Manley. 1998. Inhibition of poly(A) polymerase requires p34cdc2/cyclin B phosphorylation of multiple consensus and non-consensus sites. EMBO J. 17:1053-1062[Medline]. |
| 7. | Gietz, R., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[Medline]. |
| 8. | Gunderson, S., M. Polycarpou-Schwarz, and I. Mattaj. 1998. U1 snRNP inhibits pre-mRNA polyadenylation through a direct interaction between U170K and poly(A) polymerase. Mol. Cell 1:255-264[Medline]. |
| 9. |
Gunderson, S.,
S. Vagner,
M. Polycarpou-Schwarz, and I. Mattaj.
1997.
Involvement of the carboxyl terminus of vertebrate poly(A) polymerase in U1A autoregulation and in the coupling of splicing and polyadenylation.
Genes Dev.
11:761-773 |
| 10. |
Haff, L., and E. Keller.
1975.
The polyadenylate polymerases from yeast.
J. Biol. Chem.
250:1838-1846 |
| 11. |
Holm, L., and C. Sander.
1995.
DNA polymerase belongs to an ancient nucleotidyltransferase superfamily.
Trends Biochem. Sci.
20:345-347[Medline].
|
| 12. | James, P., J. Halladay, and E. A. Craig. 1996. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425-1436[Abstract]. |
| 13. | Kaiser, C., S. Michaelis, and A. Mitchel. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 14. |
Keshgegian, A. A.,
S. M. Meltzer, and J. J. Furth.
1975.
Poly(A) polymerase of bovine lymphosarcoma.
Cancer Res.
35:1141-1146 |
| 15. |
Kessler, M.,
M. Henry,
S. Gross,
E. Shen,
J. Zhao,
P. Silver, and C. Moore.
1997.
Hrp1, a sequence-specific RNA-binding protein that shuttles between the nucleus and the cytoplasm, is required for mRNA 3'-end formation in yeast.
Genes Dev.
11:2545-2556 |
| 16. |
Kessler, M. M.,
J. Zhao, and C. L. Moore.
1996.
Purification of the Saccharomyces cerevisiae cleavage/polyadenylation factor I.
J. Biol. Chem.
271:27167-27175 |
| 17. |
Lingner, J., and W. Keller.
1993.
3'-end labeling of RNA with recombinant yeast poly(A) polymerase.
Nucleic Acids Res.
21:2917-2920 |
| 18. | Lingner, J., J. Kellermann, and W. Keller. 1991. Cloning and expression of the essential gene for poly(A) polymerase from S. cerevisiae. Nature 354:496-498[Medline]. |
| 19. |
Lingner, J.,
I. Radtke,
E. Wahle, and W. Keller.
1991.
Purification and characterization of poly(A) polymerase from Saccharomyces cerevisiae.
J. Biol. Chem.
266:8741-8746 |
| 20. | Mandart, E., and R. Parker. 1995. Effects of mutations in the Saccharomyces cerevisiae RNA14, RNA15, and PAP1 genes on polyadenylation in vivo. Mol. Cell. Biol. 15:6979-6986[Abstract]. |
| 21. |
Martin, G., and W. Keller.
1996.
Mutational analysis of mammalian poly(A) polymerase identifies a region for primer binding and a catalytic domain, homologous to the family  polymerases and to other nucleotidyltransferases.
EMBO J.
15:2593-2603[Medline].
|
| 22. | Martin, G., and W. Keller. 1998. Tailing and 3'-end labeling of RNA with yeast poly(A) polymerase and various nucleotides. RNA 4:226-230[Abstract]. |
| 23. |
Minvielle-Sebastia, L.,
P. Preker,
T. Wiederkehr,
Y. Strahm, and W. Keller.
1997.
The major yeast poly(A)-binding protein is associated with cleavage factor IA and functions in premessenger RNA 3'-end formation.
Proc. Natl. Acad. Sci. USA
94:7897-7902 |
| 24. |
Murthy, K. G. K., and J. L. Manley.
1995.
The 160 kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3' end formation.
Genes Dev.
9:2672-2683 |
| 25. | Preker, P., M. Ohnacker, L. Minvielle-Sebastia, and W. Keller. 1997. A multisubunit 3' end processing factor from yeast containing poly(A) polymerase and homologues of the subunits of mammalian cleavage and polyadenylation specificity factor. EMBO J. 16:4727-4737[Medline]. |
| 26. | Preker, P. J., J. Lingner, L. Minvielle-Sebastia, and W. Keller. 1995. The FIP1 gene encodes a component of a yeast pre-mRNA polyadenylation factor that directly interacts with poly(A) polymerase. Cell 81:379-389[Medline]. |
| 27. |
Raabe, T.,
K. G. K. Murthy, and J. L. Manley.
1994.
Poly(A) polymerase contains multiple functional domains.
Mol. Cell. Biol.
14:2946-2957 |
| 28. | Roychoudhury, R., and H. Kossel. 1971. Enzymic synthesis of ribonucleotide terminated oligodeoxynucleotides and their use as primers for the enzymic synthesis of polydeoxynucleotides. Eur. J. Biochem. 22:310-320[Medline]. |
| 29. | Sachs, A., M. Bond, and R. Kornberg. 1986. A single gene from yeast for both nuclear and cytoplasmic polyadenylate-binding proteins: domain structure and expression. Cell 45:827-835[Medline]. |
| 30. | Sousa, R. 1996. Structural and mechanistic relationships between nucleic acid polymerases. Trends Biochem. Sci. 21:186-191[Medline]. |
| 31. | Thomson, J., and P. Gershon. 1995. Use of vaccinia virus poly(A) polymerase for RNA 3'-end labeling with a chain-terminating nucleotide or a short 3' homopolymer tract. BioTechniques 19:416-425[Medline]. |
| 32. | Tsiapalis, C. M., J. W. Dorson, D. M. De Sante, and F. J. Bollum. 1973. Terminal riboadenylate transferase: a polyadenylate polymerase from calf thymus gland. Biochem. Biophys. Res. Commun. 50:737-743[Medline]. |
| 33. |
Wahle, E.
1991.
Purification and characterization of a mammalian polyadenylate polymerase involved in the 3' end processing of messenger RNA precursors.
J. Biol. Chem.
266:3131-3139 |
| 34. | Wahle, E., and U. Kuhn. 1997. The mechanism of 3' cleavage and polyadenylation of eukaryotic pre-mRNA. Prog. Nucleic Acid Res. Mol. Biol. 57:41-70[Medline]. |
| 35. | Wittmann, T., and E. Wahle. 1997. Purification and characterization of full-length mammalian poly(A) polymerase. Biochim. Biophys. Acta 1350:293-305[Medline]. |
| 36. |
Zhelkovsky, A. M.,
M. M. Kessler, and C. L. Moore.
1995.
Structure-function relationships in the Saccharomyces cerevisiae poly(A) polymerase.
J. Biol. Chem.
270:26715-26720 |
Molecular and Cellular Biology, October 1998, p. 5942-5951, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Perreault, A., Lemieux, C., Bachand, F.
(2007). Regulation of the Nuclear Poly(A)-binding Protein by Arginine Methylation in Fission Yeast. J. Biol. Chem.
282: 7552-7562
[Abstract] [Full Text] -
Forbes, K. P., Addepalli, B., Hunt, A. G.
(2006). An Arabidopsis Fip1 Homolog Interacts with RNA and Provides Conceptual Links with a Number of Other Polyadenylation Factor Subunits. J. Biol. Chem.
281: 176-186
[Abstract] [Full Text] -
Chen, L. S., Sheppard, T. L.
(2004). Chain Termination and Inhibition of Saccharomyces cerevisiae Poly(A) Polymerase by C-8-modified ATP Analogs. J. Biol. Chem.
279: 40405-40411
[Abstract] [Full Text] -
Mangus, D. A., Evans, M. C., Agrin, N. S., Smith, M., Gongidi, P., Jacobson, A.
(2004). Positive and Negative Regulation of Poly(A) Nuclease. Mol. Cell. Biol.
24: 5521-5533
[Abstract] [Full Text] -
MARTIN, G., KELLER, W.
(2004). Sequence motifs that distinguish ATP(CTP):tRNA nucleotidyl transferases from eubacterial poly(A) polymerases. RNA
10: 899-906
[Abstract] [Full Text] -
Mangus, D. A., Smith, M. M., McSweeney, J. M., Jacobson, A.
(2004). Identification of Factors Regulating Poly(A) Tail Synthesis and Maturation. Mol. Cell. Biol.
24: 4196-4206
[Abstract] [Full Text] -
ZHELKOVSKY, A., HELMLING, S., BOHM, A., MOORE, C.
(2004). Mutations in the middle domain of yeast poly(A) polymerase affect interactions with RNA but not ATP. RNA
10: 558-564
[Abstract] [Full Text] -
Kwak, J. E., Wang, L., Ballantyne, S., Kimble, J., Wickens, M.
(2004). Mammalian GLD-2 homologs are poly(A) polymerases. Proc. Natl. Acad. Sci. USA
101: 4407-4412
[Abstract] [Full Text] -
Gross, S., Moore, C. L.
(2001). Rna15 Interaction with the A-Rich Yeast Polyadenylation Signal Is an Essential Step in mRNA 3'-End Formation. Mol. Cell. Biol.
21: 8045-8055
[Abstract] [Full Text] -
Gross, S., Moore, C.
(2001). Five subunits are required for reconstitution of the cleavage and polyadenylation activities of Saccharomyces cerevisiae cleavage factor I. Proc. Natl. Acad. Sci. USA
10.1073/pnas.101046598v1
[Abstract] [Full Text] -
Helmling, S., Zhelkovsky, A., Moore, C. L.
(2001). Fip1 Regulates the Activity of Poly(A) Polymerase through Multiple Interactions. Mol. Cell. Biol.
21: 2026-2037
[Abstract] [Full Text] -
Bard, J., Zhelkovsky, A. M., Helmling, S., Earnest, T. N., Moore, C. L., Bohm, A.
(2000). Structure of Yeast Poly(A) Polymerase Alone and in Complex with 3'-dATP. Science
289: 1346-1349
[Abstract] [Full Text] -
Mizrahi, N., Moore, C.
(2000). Posttranslational Phosphorylation and Ubiquitination of the Saccharomyces cerevisiae Poly(A) Polymerase at the S/G2 Stage of the Cell Cycle. Mol. Cell. Biol.
20: 2794-2802
[Abstract] [Full Text] -
Zhao, J., Kessler, M., Helmling, S., O'Connor, J. P., Moore, C.
(1999). Pta1, a Component of Yeast CF II, Is Required for Both Cleavage and Poly(A) Addition of mRNA Precursor. Mol. Cell. Biol.
19: 7733-7740
[Abstract] [Full Text] -
Zhao, J., Hyman, L., Moore, C.
(1999). Formation of mRNA 3' Ends in Eukaryotes: Mechanism, Regulation, and Interrelationships with Other Steps in mRNA Synthesis. Microbiol. Mol. Biol. Rev.
63: 405-445
[Abstract] [Full Text] -
Gross, S., Moore, C.
(2001). Five subunits are required for reconstitution of the cleavage and polyadenylation activities of Saccharomyces cerevisiae cleavage factor I. Proc. Natl. Acad. Sci. USA
98: 6080-6085
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»