Previous Article | Next Article 
Molecular and Cellular Biology, October 1998, p. 6014-6022, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Association of Guide RNA Binding Protein gBP21 with
Active RNA Editing Complexes in Trypanosoma brucei
Thomas E.
Allen,1,2
Stefan
Heidmann,3
RoseMary
Reed,1,2
Peter J.
Myler,1,2
H. Ulrich
Göringer,4 and
Kenneth D.
Stuart1,2,*
Seattle Biomedical Research Institute,
Seattle, Washington, 98109-1651,1 and
Department
of Pathobiology, University of Washington Seattle, Washington
98195,2 and
Department of Genetics,
University of Bayreuth, 95440 Bayreuth,3 and
Laboratorium für Molekulare Biologie, Genzentrum der
LMU München am MPI für Biochemie, 82152 Martinsried,4 Germany
Received 6 April 1998/Returned for modification 3 June
1998/Accepted 19 June 1998
 |
ABSTRACT |
RNA editing in Trypanosoma brucei mitochondria produces
mature mRNAs by a series of enzyme-catalyzed reactions that
specifically insert or delete uridylates in association with a
macromolecular complex. Using a mitochondrial fraction enriched for in
vitro RNA editing activity, we produced several monoclonal antibodies that are specific for a 21-kDa guide RNA (gRNA) binding protein initially identified by UV cross-linking. Immunofluorescence studies localize the protein to the mitochondrion, with a preference for the
kinetoplast. The antibodies cause a supershift of previously identified
gRNA-specific ribonucleoprotein complexes and immunoprecipitate in
vitro RNA editing activities that insert and delete uridylates. The
immunoprecipitated material also contains gRNA-specific
endoribonuclease, terminal uridylyltransferase, and RNA ligase
activities as well as gRNA and both edited and unedited mRNA. The
immunoprecipitate contains numerous proteins, of which the 21-kDa
protein, a 90-kDa protein, and novel 55- and 16-kDa proteins can be UV
cross-linked to gRNA. These studies indicate that the 21-kDa protein
associates with the ribonucleoprotein complex (or complexes)
that catalyze RNA editing.
 |
INTRODUCTION |
RNA editing produces mature mRNAs in
the mitochondria of trypanosomatids by guide RNA (gRNA)-directed
posttranscriptional insertion and deletion of uridylates (U's)
(2). This process can be so extensive that most of the
coding sequence, as well as the initiation and termination codons,
results from RNA editing (1, 11, 27, 28, 30). Stage-specific
RNA editing appears to regulate mitochondrial respiration in the
different life stages of African trypanosomes (9, 29). The
mRNAs for components of respiratory complex I are preferentially edited
in the mammalian stage of the life cycle, where the trypanosomes lack
cytochromes, rely on glycolysis for energy production, and utilize
complex I and alternate oxidase for terminal respiration. In contrast, the invertebrate stage predominantly utilizes cytochrome-mediated oxidative phosphorylation for energy generation while editing cytochrome mRNAs only in this stage.
The edited mRNA sequence is specified by trans-acting small
RNA molecules called gRNAs, which are complementary to their
edited cognate mRNAs (4). The gRNAs have three distinct
regions. A 5- to 15-nucleotide (nt) region at the 5' end of gRNAs
is complementary to the sequence of its cognate preedited mRNA that is
immediately 3' to the region that will be edited. Formation of a duplex
between these regions, called the anchor duplex, is an essential
prelude to editing. A 55- to 70-nt guiding region, immediately
3' to the anchor region, contains the sequence information that can
specify the insertion or deletion of U's at 1 to 20 internucleotide
sites in the pre-mRNA. The third region contains the 3' end of the
gRNA, which has a 5- to 24-nt oligo(U) tail that is added
posttranscriptionally, presumably by a terminal uridylyltransferase
(TUTase) activity. The function of the oligo(U) tail is unknown, but it
may enhance the interaction between the gRNA and the region of the RNA
that is 5' of the editing site, which tends to be purine rich (5, 25). While gRNAs have distinct sequences, they appear to
form similar structures in vitro with 5' and 3' stem-loops (12,
24).
In vitro studies indicate that RNA editing occurs by a series of
enzymatically catalyzed steps (13, 25, 26). These
studies suggest that editing is initiated by endoribonucleolytic
cleavage of the pre-mRNA at a site that is 5' to the anchor duplex.
Following cleavage, U's are added or removed at the 3' end of the 5'
cleavage product by one or more enzymes that are yet to be fully
characterized. The 5' cleavage product with the added or removed U's
is ligated with the 3' cleavage product by an RNA ligase to produce the
edited product. The mechanism by which the number of U's is specified by the gRNA is not yet determined. Chimeric RNA molecules in which gRNAs are covalently linked at their 3' end to the 3' portion of a
pre-RNA are also detected both in vivo and in vitro (6, 13,
20). These molecules do not appear to be editing intermediates as
previously proposed but rather seem to be aberrant by-products of the
editing reaction (13, 25).
In vitro editing activity requires Trypanosoma brucei
mitochondrial extract in addition to pre-mRNA, gRNA, divalent cations, ATP, and UTP (for insertion) (13, 26). The in vitro RNA
editing activities that insert or delete U's sediment at ~20S in
isokinetic glycerol gradients, indicating that editing occurs in
association with a multicomponent macromolecular complex
(8). The 20S fraction also contains the gRNA-specific
endoribonuclease activity as well as TUTase and RNA ligase. However,
substantial TUTase and RNA ligase activities also sediment at ~40S,
suggesting that multiple forms of the editing complex may exist
(8, 18). Such a complex (or complexes) would be predicted to
contain multiple molecules to account for the several catalytic
activities and other functions such as RNA binding, positioning,
translocation, and unwinding. Four RNP complexes (G1 to G4) that form
with mitochondrial extract and gRNA have also been visualized on native
polyacrylamide gels (10, 19). These complexes were
found to be gRNA specific, since homologous and heterologous gRNA
prevent their formation whereas non-gRNA transcripts do not. The
complexes contain protein since both sodium dodecyl sulfate (SDS) and
proteinase K prevent their formation.
While editing occurs in association with an RNP complex, the components
of that complex remain largely unknown and hence uncharacterized. Several candidate protein components have been identified by their ability to UV cross-link specifically with gRNA (15, 16,
19). In T. brucei, these include 21- and 90-kDa
proteins that are highly specific for gRNA, based on RNA competition
experiments (19). The 21-kDa protein (gBP21) has been
recently purified, and its gene has been cloned and sequenced
(14). The sequence predicts an arginine-rich protein, and
the recombinant protein binds gRNA with high affinity. UV cross-linking
of the 90-kDa protein requires that the gRNAs have an oligo(U) tail,
while the 21-kDa protein binds to the 3' stem-loop of gRNA (12,
19).
The development of an in vitro assay for RNA editing (26)
permitted the enrichment of editing activity by biochemical techniques. Material enriched for RNA editing activity was used to produce a panel
of 81 independent monoclonal antibodies (MAbs), of which six are
specific for a 21-kDa protein that binds gRNA. The MAbs alter the
mobility on native polyacrylamide gels of gRNA-specific RNP complexes
G1 and G2, and they immunoprecipitate the in vitro RNA editing activity
as well as all catalytic activities and RNAs associated with editing.
The immunoprecipitate contains multiple proteins, including some with
mobilities similar to those of the eight major proteins reported to
have been found in a fraction enriched for editing activity by
biochemical techniques (21) as well as proteins that
specifically cross-link with gRNA (19). The data presented
here indicate that gBP21 can associate with RNP complexes that are
capable of RNA editing in vitro. The possible significance of this
association is discussed.
 |
MATERIALS AND METHODS |
Antigen preparation and MAb production.
T. brucei
procyclic and bloodstream forms (EATRO 164) were grown in vitro as
previously described (31). Subcellular fractionation, storage of mitochondrial vesicles, and preparation of mitochondrial lysate that is active for in vitro RNA editing were performed as
described by Corell et al. (8). The lysate was fractionated by slowly adding solid (NH4)2SO4 at
4°C to a concentration of 30% with stirring for 1 h. The
supernatant from centrifugation at 15,000 rpm for 30 min at 4°C in a
Beckman JA-20 rotor contained the in vitro RNA editing activity (assay
described below). The supernatant was raised to 45%
(NH4)2SO4 at 4°C with stirring
for 1 h and recentrifuged. The pellet, which contained the in
vitro RNA editing activity, was resuspended in 500 µl of HHE (20 mM HEPES [pH 7.9], 50 mM KCl, 10 mM magnesium acetate, 0.5 mM
dithiothreitol) with 1 mM ATP and layered on a 11.5-ml 10 to 40%
glycerol gradient. Gradients were centrifuged at 38,000 rpm in a
Beckman SW40 rotor for 5 h at 4°C and fractions of 500 µl were
collected. Fractions containing RNA editing activity were concentrated
by adding (NH4)2SO4 to 70% as
described above to produce the antigen for MAb production, which was
performed by standard protocols (7). Five female BALB/c mice
were injected subcutaneously with ~15 µg of antigen in Freund's
complete adjuvant and again 14 days later with antigen in Freund's
incomplete adjuvant. The mice were injected intraperitoneally with
antigen in incomplete Freund's adjuvant on day 35 and then both
intraperitoneally and intravenously with antigen in incomplete Freund's adjuvant on day 56. Three days later, splenocytes from the
best responder were fused with the SP2/O myeloma cell line and grown in
96-well plates. Supernatants were screened by enzyme-linked immunosorbent assay (ELISA) for antibody against the immunogen, using
plates coated with immunogen (10 µg/ml) and using goat anti-mouse immunoglobulin G (IgG) conjugated with alkaline phosphatase (Bio-Rad) as the secondary antibody. Clones from positive wells were made by
limiting dilution and rescreened by ELISA to yield a total of 81 clones.
Plasmids and RNA.
gRNA expression plasmids for gA6[14]wt
and gA6[14]
16G, as well as mRNA substrates A6short/Tag.1
and A6-eEs1, were constructed as previously described (13,
26). gRNAs and mRNA substrates were transcribed by using T7 RNA
polymerase and purified on a 9% (wt/vol) denaturing polyacrylamide
gel, followed by visualization by UV shadowing. Uniformly labeled
transcripts were transcribed in the presence of
[
-32P]UTP (800 Ci/mmol) and purified as described
above except that the transcripts were visualized by autoradiography.
mRNA substrates were labeled by ligation of [32P]pCp to
the 3' end of the transcript as previously described (25),
purified on a 9% (wt/vol) denaturing polyacrylamide gel, and
visualized by autoradiography.
Western blot analysis.
A 600-ng aliquot of total
mitochondrial lysate was separated by polyacrylamide gel
electrophoresis on an SDS-12% (wt/vol) polyacrylamide gel, followed
by transfer to nitrocellulose by using standard protocols
(7). The filters were blocked for 1 h in
phosphate-buffered saline (PBS; 4.3 mM Na2HPO4,
1.4 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl [pH
7.3]) containing 10% (wt/vol) nonfat milk and 0.2% (vol/vol) Tween
20. Tissue culture supernatants diluted 1:100 were incubated with the
filter overnight at 4°C with gentle agitation. After several washes
in PBS, goat anti-mouse antibody conjugated to horseradish peroxidase
(Bio-Rad) diluted 1:5,000 was added, and the mixture was incubated at
room temperature for 2 h. The Amersham ECL kit was used to
visualize the MAb protein target, following the manufacturer's
protocol.
Indirect immunofluorescence.
Procyclic trypanosomes grown to
mid-logarithmic phase were washed in TDB (20 mM
Na2HPO4, 2 mM NaH2PO4,
5 mM KCl, 80 mM NaCl, 1 mM MgSO4, 10 mM glucose [pH
7.4]), resuspended to 5 × 106 cells/ml in TDB, and
spotted onto printed microscope slides. The parasites were allowed to
adhere to the slide for 15 min in a moist chamber and were then fixed
for 10 min at room temperature with 1.5% (vol/vol) formaldehyde in
PBS. Bloodstream-form parasites harvested at the peak of parasitemia
were washed with TDB, fixed in suspension with 1.5% (vol/vol)
formaldehyde in PBS at 2 × 107 cells/ml, and then
spotted onto slides pretreated with 3% bovine serum albumin in
PBS supplemented with 0.02% (wt/vol) NaN3. Cells were
permeabilized by treatment for 10 min with 0.1% (vol/vol) Triton
X-100 in PBS, washed with PBS, and then blocked for 1 h with 3%
(wt/vol) bovine serum albumin in PBS supplemented with 0.02%
(wt/vol) NaN3. The cells were incubated with the undiluted hybridoma supernatants for 1 h in a moist chamber, washed
extensively with PBS, and incubated for 1 h with fluorescein
isothiocyanate-conjugated goat anti-mouse antibody (Dianova)
diluted 1:200 in PBS. The fixed cells were treated for 5 min with
4',6-diamidino-2-phenylindole (DAPI; 0.8 µg/µl in PBS) to stain
DNA. The cells were washed with PBS and mounted with ProLong antifade
medium (Molecular Probes) according to the manufacturer's
specifications. Fluorescence was observed with a Nikon fluorescence
microscope equipped with the appropriate filters.
Gel retardation assay.
Ten femtomoles of radiolabeled gRNA
was incubated with mitochondrial lysate (5 µg) in 15 µl of
binding buffer (20 mM HEPES [pH 7.9], 50 mM KCl, 10 mM magnesium
acetate, 1 mM EDTA, 0.5 mM dithiothreitol, 750 ng of yeast RNA
per µl) for 30 min at 27°C. Immediately after incubation,
complexes were separated on a 4% (wt/vol) nondenaturing polyacrylamide
gel (acrylamide/methylene bisacrylamide ratio of 80:1) in 50 mM
Tris-glycine (pH 8.8) at 5 to 10 V/cm. After electrophoresis, gels were
fixed in 10% (vol/vol) methanol-10% (vol/vol) acetic acid for 30 min, dried, and subjected to autoradiography. Supershift experiments
included ~500 ng of MAb in the reaction mixture.
Immunoprecipitation.
Immunomagnetic beads (Dynabeads M-450;
Dynal) coated with goat anti-mouse IgG were coupled with purified MAbs
at a concentration of 1.5 µg of MAb/mg of immunomagnetic beads.
Coupling was performed in PBS for 30 min at 4°C with bidirectional
mixing. After incubation, a magnet was applied for 2 min, followed by
three to four 1-min washes with PBS. In experiments where MAbs were
cross-linked to the immunomagnetic beads, 1.2 × 106
MAb-specific beads were incubated in 10 ml of 0.2 M triethanolamine (pH
9.0) at 23°C with 52 mg of dimethyl pimelimidate dihydrochloride (Sigma) for 45 min with mixing. After incubation, the beads were incubated in an additional 10 ml of 0.2 M triethanolamine (pH 9.0) at
23°C for 2 h and then washed with either PBS or HHE.
Immunoprecipitation of mitochondrial proteins was performed by
incubating crude mitochondrial lysate with MAb-specific immunomagnetic
beads at a mitochondrial protein/MAb ratio of 10:1 (vol/vol). The
mixture was allowed to incubate at 4°C with bidirectional mixing for
2 h. After incubation, the beads were washed five times (1 min
each) with cold HHE. The final washed beads were resuspended in the
amount of HHE appropriate for the experimental design being used. For
SDS-PAGE analysis of proteins, MAb-specific immunomagnetic beads
prepared as described above were incubated after the final wash with
elution buffer (25 mM glycine [pH 2.5], 150 mM KCl, 1% [wt/vol]
SDS) for 10 min at 4°C with bidirectional mixing. The eluted proteins
were then dialyzed against HHE, separated by SDS-PAGE on a 10%
(wt/vol) gel, and detected by silver staining.
In vitro RNA editing, TUTase, and RNA ligase assays.
The in
vitro deletion assay was modified from previously published protocols
(13, 25). Three milligrams of MAb-specific immunomagnetic
beads used in immunoprecipitation reactions as described above was
resuspended in 60 µl of assay buffer (HHE with 5 mM
CaCl2, 1 U of RNasin, 1 mM ATP, 750 ng of Torula
yeast RNA per µl, 0.25 pmol of gA6[14]
16G, and 2.5 pmol of
[32P]pCp-labeled A6short/Tag.1) and incubated at 27°C
for 1 h with mixing. The in vitro insertion assay was essentially
the same as the deletion assay except that (i)
[32P]pCp-labeled A6-eES1 in combination with gA6[14]wt
was used instead of A6short/Tag.1 with gA6[14]
16G and (ii)
1 mM UTP was included in the reaction mixture. After incubation, 40 µl of Tris-EDTA was added, followed by phenol-chloroform extraction.
The RNA was then precipitated by adding 5 µg of glycogen, 12 µl of
3 M sodium acetate, and 300 µl of cold ethanol. The pellet was then
washed with 70% (vol/vol) ethanol and resuspended in 5 µl of
diethylpyrocarbonate-treated H2O and 5 µl of formamide
dye (95% [vol/vol] formamide, 0.09% [wt/vol] bromophenol blue,
0.09% [wt/vol] xylene cyanol FF). The samples were then loaded onto
a 9% (wt/vol) denaturing polyacrylamide gel. After electrophoresis,
the gels were dried and the RNA was visualized by autoradiography.
TUTase assays were modified from previously reported protocols
(8). MAb-specific immunomagnetic beads (1.5 mg) from
immunoprecipitation reactions described above were resuspended in 20 µl of HHE with 1 mM ATP, 1 µg of yeast tRNA, and 5 µCi of
[
-32P]UTP (800 Ci/mmol). After incubation for 30 min
at 27°C, a 5-µl aliquot of the reaction mixture was spotted onto
duplicate fiberglass disks, followed by four 15-min washes in cold 10%
(wt/vol) trichloroacetic acid with 50 mM sodium pyrophosphate on ice.
Incorporated radioactivity was quantified by liquid scintillation
counting.
RNA ligase activity was assessed by self-adenylylation of the enzyme
(22). MAb-specific immunomagnetic beads (1.5 mg) from immunoprecipitation reactions described above were resuspended in 20 µl of HHE with 10% (vol/vol) dimethyl sulfoxide, 1 µg of yeast
tRNA, and 5 µCi of [
-32P]ATP (3,000 Ci/mmol). The
reaction mixture was incubated at 27°C for 30 min, and then 6.6 µl
of 3× SDS-PAGE loading dye (150 mM Tris-HCl [pH 6.8], 300 mM
dithiothreitol, 6% [wt/vol] SDS, 0.3% [wt/vol] bromophenol blue,
30% [vol/vol] glycerol) was added. Proteins were separated by
SDS-PAGE on a 10% gel. The gel was dried, and proteins were visualized
by autoradiography.
RNA isolation and analysis.
Immunoprecipitation of
associated RNA was performed with MAb-specific magnetic beads prepared
as described above. Mitochondrial extract was mixed with the
MAb-specific beads at a ratio of 4:1 (vol/vol) for 4 h at 4°C.
The RNA was extracted from the immunoprecipitated material with an
equal volume of phenol-chloroform and then precipitated with ethanol.
The RNA was then separated on either a 2% (vol/vol) formaldehyde-containing agarose gel or a 6% (wt/vol) polyacrylamide-7 M urea gel and then transferred to nitrocellulose as previously described (23). The membranes were prehybridized in 5× SSPE (50 mM NaH2PO4 [pH 7.0], 40 mM NaOH, 900 mM
NaCl, 5 mM EDTA)-1% (wt/vol) SDS-10× Denhardt's solution-50 µg
of denatured sheared salmon sperm DNA per ml for 5 h at the
hybridization temperatures listed below. The membranes were hybridized
overnight in 5× SSPE with 32P 5' end-labeled
oligonucleotide probes MURF4.1
(CCTTTCTCCTTCATTTCCTCTCCTGTCTCCTTCTCTTCCGCCC) at 50°C,
MURF4.14 (CACAATAATACATACATAATAACAAACGCAACC) at 50°C, and
gA6-1 (CACTGTCAAAATCTGATTCGTTATCGGAG) at 55°C. The
membranes were washed sequentially for 1, 2, and 3 min in 5× SSPE-1%
(wt/vol) SDS at room temperature and for 6 min in 1× SSPE-1%
(wt/vol) SDS at the hybridization temperature. The RNA was visualized
by autoradiography.
UV cross-linking.
The gRNA-specific cross-linking to
proteins in crude mitochondrial extract was performed as previously
described (19) except that the buffer used was HHE. In
experiments where UV cross-linking was performed after
immunoprecipitation (see Fig. 9), MAb-specific immunomagnetic beads
(1.5 mg) from immunoprecipitation reactions described above were
resuspended in 15 µl of HHE containing 10 fmol of radiolabeled gRNA
(see above) and 250 ng of yeast RNA per µl as a competitor. The
reaction mixture was incubated for 20 min at rom temperature and
then subjected to UV cross-linking as previously described
(19). Following UV cross-linking, 1.5 µl of RNase A
(10-mg/ml stock) was added, and the reaction mixture was incubated for
15 min at 37°C. After incubation, 3.5 µl of 3× SDS-PAGE loading
dye was added. Proteins were then separated on an SDS-12%
polyacrylamide gel; the gel was dried and subjected to autoradiography.
 |
RESULTS |
Production and identification of anti-gBP21 MAbs.
Precipitation with (NH4)2SO4 and
glycerol gradient sedimentation allowed substantial enrichment of the
in vitro RNA editing activity (Fig. 1).
All detectable in vitro RNA editing activity precipitates at between 30 and 45% (NH4)2SO4 (Fig. 1A), which represents ~10% of the protein in total mitochondrial extract. The
bulk of the precipitated activity sediments at ~20S (fractions 16 to
18) in 10 to 40% (vol/vol) glycerol gradients (Fig. 1B), indicating
that the activity is associated with complexes.
(NH4)2SO4 precipitation did not
affect the sedimentation of editing complexes compared to gradients for
which (NH4)2SO4 precipitation was
not performed (data not shown) (8). This ~20S fraction
from the 30 to 45% (NH4)2SO4
fraction was used to raise a panel of MAbs as described in Materials
and Methods. Eighty-one independent MAbs that showed a variety of
protein targets based on Western blot analysis were obtained (data not
shown). Of these, six were found to be specific for a ~21-kDa protein
by Western blot analysis, as illustrated by assays using MAb 56, the
antibody used most extensively in this study (Fig.
2A). We examined the possibility that
this was the ~21-kDa protein previously identified as a gRNA-specific UV-cross-linking protein that is present in mitochondrial extracts (19). To do this, we incubated uniformly labeled gRNA with
mitochondrial extract, UV cross-linked the RNA to the protein, and
treated the preparation with RNase A to remove the non-cross-linked
portion of the RNA as described in Materials and Methods. This
treatment labeled several proteins, as we previously had found (Fig.
2B, crude extract) (19). However, all six MAbs
immunoprecipitated the labeled ~21-kDa protein when coupled with
magnetic beads (Fig. 2B [data not shown for two of the MAbs]).
Magnetic beads alone or coupled with a control MAb (anti-T.
brucei dihydrolipoyl transacylase MAb ODB2) did not
immunoprecipitate labeled proteins. Similarly, experiments using an RNA
transcript of equal size derived from pBluescript (Stratagene) did not
immunoprecipitate any UV-cross-linked proteins (data not shown). In
addition, the MAbs reacted with recombinant gBP21 protein in Western
blot analysis (Fig. 2C; data for MAb 56 shown). Thus, these six MAbs
are specific for gBP21, and this protein is present in fractions
enriched for in vitro RNA editing activity. Further Western blot
analysis determined that only four of the six MAb cell lines (MAb lines
46, 56, 61, and 67) produced antibodies in high quantities.
Consequently, these four MAbs were used in subsequent experiments.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Antigen for MAb production. The in vitro RNA editing
activity was enriched by subcellular fractionation of mitochondria
followed by (NH4)2SO4 precipitation
and glycerol gradient fractionation to prepare immunogen used for the
production of MAbs (see Materials and Methods). (A) In vitro editing
assay (U deletion) of fractions from sequential steps of
(NH4)2SO4 precipitation of crude
mitochondrial lysate, showing editing activity in the 45% pellet. The
product formed by the deletion of three U's from editing site 1 of the
input RNA (A6short/Tag.1) is indicated. (B) In vitro RNA editing assay
(U deletion) of the 20S fraction from glycerol gradient sedimentation
of the 45% (NH4)2SO4 precipitate
showing the editing activity.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of target protein. (A) Western blot
analysis of crude mitochondrial lysate separated by SDS-PAGE on a 12%
(wt/vol) gel. MAb 56 (and five other MAbs not shown) recognized an
~21-kDa protein. (B) Immunoprecipitation of gRNA UV-cross-linked
proteins. Proteins that cross-link with uniformly labeled gRNA in crude
mitochondrial lysate and immunoprecipitate with the MAbs specific to
gBP21 after treatment with RNase A were separated by SDS-PAGE on a 12%
(wt/vol) gel and visualized by autoradiography as described in
Materials and Methods. The four MAbs shown (and two others not shown)
recognize an ~21-kDa UV-cross-linking protein. (C) Western blot
analysis showing that the MAbs (MAb 56 shown) recognize recombinant
gBP21. Time points refer to sampling intervals after induction of
culture (see Materials and Methods). Sizes are indicated in kilodaltons
at the left.
|
|
Immunofluorescence analysis with MAb 56 shows distinct staining of the
mitochondrion, most intensely in the kinetoplast (Fig.
3A [DAPI] and
3B [MAb 56]). The bloodstream forms show the typical
single tubular
mitochondrion (Fig.
3C), while the
procyclic forms
have a network of interconnected tubules (Fig.
3B).
Thus, gBP21
appears to be exclusively localized in the mitochondrion
and preferentially
located in the kinetoplast region.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 3.
Immunofluorescence with MAbs specific to gBP21.
Procyclic and bloodstream forms of T. brucei were fixed and
stained with MAbs against gBP21 and with DAPI (see Materials and
Methods). (A) DAPI staining showing the nucleus and smaller kinetoplast
of procyclic T. brucei. (B) Procyclic T. brucei
after incubation with MAb 56 and development with a goat anti-mouse
antibody conjugated with fluorescein isothiocyanate. The kinetoplast is
evident as an intensely staining spot in the network of mitochondrial
tubules. (C) Bloodstream T. brucei examined as in panel B,
showing the single tubular mitochondrion.
|
|
Anti-gBP21 MAbs recognize complexes that are associated with
editing.
The anti-gBP21 MAbs supershift gRNA-specific complexes
that are visualized in 4% (wt/vol) nondenaturing polyacrylamide gels (Fig. 4). The G1, G2, and G3 complexes
that were previously shown to be specific for gRNA (10, 19)
are shown in Fig. 4 (No MAb). The G4 complex is not resolved in these
gels. The G1 and G2 complexes, which were shown to contain a ~21-kDa
protein that UV cross-links to gRNA (19), supershift upon
the inclusion of anti-gBP21 MAbs (Fig. 4). Supershifting of the G3
complex was not detected. As with the formation of the RNP complexes,
the supershift is not affected by the addition of heterologous RNA
transcripts (pBluescript) as a competitor of both the formation of the
RNP complexes and the subsequent supershift (data not shown). In
addition, SDS and proteinase K digestion ablates both the formation of
the RNP complex and the subsequent supershift (data not shown). The
amount of G1 and G2 that is supershifted is dependent on the amount of
MAb added to the reaction and thus is probably not due to differences between the MAbs (data not shown). As seen in Fig. 4 (MAb 61), all of
G1 and G2 can be supershifted by the MAbs. These studies indicate that
the G1 and G2 RNP complexes contain gBP21 and that all of the labeled
gRNA is associated with the gBP21 protein. They also imply that while
G3 contains gRNA, the specificity for gRNA does not appear to entail
gBP21 or its state is such that anti-gBP21 MAb cannot produce a
detectable mobility shift.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 4.
Supershift of gRNA-specific RNP complexes G1 and G2.
Specific complexes that form with uniformly labeled gRNA were separated
on a 4% (wt/vol) nondenaturing polyacrylamide gel and then
autoradiographed. The lane marked as containing no MAb shows
gRNA-specific RNP complexes that form in the absence of the MAbs. Lanes
in which MAbs specific for gBP21 were added to the reaction mixture
(see Materials and Methods) show a supershift of RNP complexes G1 and
G2.
|
|
The anti-gBP21 MAbs can immunoprecipitate in vitro RNA editing
activity.
Immunomagnetic beads coupled with either of four
anti-gBP21 MAbs immunoprecipitated both deletion and insertion editing
activities (Fig. 5). As shown in Fig. 5A,
the four MAbs (MAbs 46, 56, 61, and 67) precipitate the activity that
specifically deletes four U's from the synthetic mRNA substrate. The
gRNA/pre-mRNA chimeras that form in vitro (as well as in vivo) and
which are thought to be nonproductive by-products of editing are also
observed (13, 25). In addition, the specific 3' cleavage
product of the pre-mRNA is produced. This finding demonstrates that the
gRNA-specific endoribonuclease is also present in the
immunoprecipitated material. By inference, the material contains a 3'
exoribonuclease activity that removes the U's from the 3' end of the
5' cleavage product of the pre-mRNA, although the reverse activity of
the enzyme that adds U's could also be responsible. A control MAb
(ODB2) attached to immunomagnetic beads and immunomagnetic beads alone
do not immunoprecipitate activities responsible for production of
edited RNA, chimeras, or the endoribonuclease activity. Similarly, the anti-gBP21 MAbs immunoprecipitate the activity that specifically inserts two U's into pre-mRNA (Fig. 5B [results for MAb 61 not shown]). The immunoprecipitate produces edited RNA, gRNA/pre-mRNA chimeras, and the 3' cleavage product of the pre-mRNA that is the
result of gRNA-specific endoribonucleolytic cleavage. Micrococcal nuclease treatment of mitochondrial extracts before immunoprecipitation abolished the ability of the MAbs to immunoprecipitate both deletion and insertion type editing, suggesting a requirement for an RNA component (data not shown). The editing activity is in excess relative to the MAb in these experiments since the extract incubated with the immunomagnetic beads is sufficient for hundreds of in vitro
editing assays. Attempts to deplete the extract of editing activity
were inconclusive since while repeated immunoprecipitations resulted in
abolishment of activity in the supernatant, the need to use less
supernatant and to handle the material more may alone have resulted in
the abolishment of activity in the supernatant. Thus, it is unclear if
gBP21 is associated with all complexes that are capable of editing.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoprecipitation of in vitro editing activity.
Material that immunoprecipitates with MAbs against gBP21 was tested for
its ability to support in vitro RNA editing that deletes (A) or inserts
(B) U's. The right gel in panel B shows a longer separation of the RNA
molecules that increases the resolution of the edited product from the
input RNA. Input RNA, 3' cleavage product, chimeras, and edited product
are diagramed to the right of the corresponding RNA molecule. Editing
products were identified by their comigration with known editing
products. Editing activity is immunoprecipitated with magnetic beads
coupled with MAbs specific for gBP21 but not with immunomagnetic beads
alone (No MAb) or with immunomagnetic beads coupled to a control
antibody (ODB2).
|
|
In addition to the endo- and exoribonuclease activities, the anti-gBP21
MAbs immunoprecipitate the 3'-terminal TUTase and
RNA ligase activities
(Fig.
6) that are implied by the
cleavage/ligation
model for RNA editing (
30). The TUTase
activity, which may add
U's to the 3' end of gRNA, is present in
abundance in the material
immunoprecipitated with each of the
anti-gBP21 MAbs but absent
from immunoprecipitates resulting from the
use of uncoated beads
or beads coated with control antibody ODB2 (Fig.
6A). Similarly,
RNA ligase, as measured by self-adenylylation, is also
immunoprecipitated
by the four anti-gBP21 MAbs but not in the control
immunoprecipitations
(Fig.
6B). Thus, the anti-gBP21 MAbs
immunoprecipitate all of
the individual activities that are expected to
be associated with
RNA editing as well as the overall in vitro RNA
editing activity
itself. As found with in vitro RNA editing activity,
micrococcal
nuclease treatment of extracts before immunoprecipitation
abolishes
the ability of the MAbs to immunoprecipitate TUTase or the
self-adenylylatable
proteins (data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Immunoprecipitation of TUTase and
[ -32P]ATP self-adenylylatable proteins (RNA ligase).
(A) TUTase activity, as monitored by the addition of
[ -32P]UTP to yeast tRNA (counts per minute are
shown), immunoprecipitates with the anti-gBP21 MAbs but not with
immunomagnetic beads alone (No MAb) or immunomagnetic beads coupled
with control MAb ODB2. (B) Anti-gBP21 MAbs immunoprecipitate the
[ -32P]ATP self-adenylylatable proteins (RNA ligase)
while immunomagnetic beads and the control antibody (ODB2) do not.
|
|
Northern blot analyses of the material that is immunoprecipitated by
the anti-gBP21 MAbs reveal the presence of gRNA (as expected
since the
MAbs are against a gRNA binding protein) as well as
preedited,
partially edited, and edited mRNAs (Fig.
7). A probe
that is specific for
gA6[14] gRNA reveals the presence of endogenous
gRNA (Fig.
7A)
(
3). Hybridization with the MURF4.1 oligonucleotide
probe,
which is complementary to 3' A6 mRNA sequence that is not
edited,
reveals preedited A6 mRNA as well as partially edited
A6 mRNA in the
immunoprecipitated material (Fig.
7B) (
3). The
MURF4.14
oligonucleotide probe, which is complementary to 5' edited
A6 sequence,
reveals fully and partially edited A6 mRNA (Fig.
7C) (
3).
Control MAb ODB2 as well as immunomagnetic beads alone
do not
immunoprecipitate either gRNA or mRNA (data not shown).
Thus, the
material that is immunoprecipitated by antibodies specific
for gBP21
contains all activities and RNAs that are expected to
be part of the
complex that catalyzes RNA editing.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
Immunoprecipitation of gRNA and mRNA. Northern blots of
immunoprecipitated RNA were probed with oligonucleotide probes for
gA6[14]gRNA (A), MURF4.1 (which is complementary to 3' A6 mRNA
sequence which does not get edited; this probe reveals preedited as
well as partially edited A6 mRNA) (B), and MURF4.14 (which is
complementary to 5' edited A6 sequence; this probe reveals fully and
partially edited A6 mRNA) (C).
|
|
Protein profile of immunoprecipitated proteins.
SDS-PAGE
analysis of the material immunoprecipitated by the anti-gBP21 antibody
shows a complex pattern of proteins upon silver staining. However,
multiple experiments reveal a consistent pattern of 13 major proteins
with apparent molecular masses of 18, 24, 25, 28, 30, 32, 45, 47, 50, 52, 64, 65, and 69 kDa (Fig. 8). This pattern, which has remained consistent throughout multiple experiments, is not seen when immunoprecipitation experiments are performed with
immunomagnetic beads alone or when MAb ODB2 is used.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
SDS-PAGE analysis of immunoprecipitated proteins.
Proteins present in the material immunoprecipitated from crude
mitochondrial extract with gBP21-specific MAb 56 were separated by
SDS-PAGE on a 10% (wt/vol) gel and silver stained. Thirteen prominent
bands are seen; sizes of standards are indicated in kilodaltons at the
left.
|
|
Immunoprecipitation of gRNA binding proteins.
We examined
proteins in the immunoprecipitated material that UV cross-link to gRNA
since several proteins have been implicated in RNA editing by their
ability to UV cross-link to gRNA. In these experiments,
immunoprecipitation with anti-gBP21 MAb 46 was followed by UV
cross-linking to added uniformly labeled gRNA and RNase A treatment
(see Materials and Methods). As expected, the 21-kDa gBP21 protein is
prominently seen in addition to a 90-kDa protein, which may be the same
protein that we previously observed to require the gRNA U tail for UV
cross-linking (19). Furthermore, a ~55-kDa and a ~16-kDa
protein, neither of which has previously been described, were
also observed (Fig. 9). This finding
suggests that these proteins are closely associated with gRNA in RNA
editing complexes.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 9.
Proteins in the immunoprecipitate that UV cross-link
with gRNA. Uniformly labeled gRNA was added to crude mitochondrial
extract and to material immunoprecipitated with MAb 46, UV
cross-linked, treated with RNase A, and separated on an SDS-12%
polyacrylamide gel, followed by visualization of the proteins by
autoradiography as described in Materials and Methods. The cross-linked
21-kDa protein as well as proteins of ~55, ~16, and ~90 kDa are
evident. Sizes are indicated in kilodaltons at the left.
|
|
 |
DISCUSSION |
This study reports that MAbs specific for the gRNA binding protein
gBP21 can immunoprecipitate in vitro RNA editing activity and its
component activities of gRNA-specific endoribonuclease, TUTase, and RNA
ligase (protein self-adenylylation). In addition, gRNA and preedited,
partially edited, and fully edited mRNAs are also immunoprecipitated.
This finding suggests that the antibodies immunoprecipitate functional
editing complexes by virtue of their association with the gBP21
protein. The MAbs are specific for gBP21 since they reveal a single
~21-kDa protein in Western blot analyses of samples from isolated
T. brucei mitochondria (Fig. 2A) and from Escherichia
coli expressing recombinant gBP21 (Fig. 2C) and since they
immunoprecipitate a ~21-kDa protein that specifically cross-links
with gRNA (Fig. 2B). The recovery of six of 81 MAbs specific for gBP21
shows that this protein is present in the 20S fraction from the 30 to
45% (NH4)2SO4 precipitate and
suggests that it may be abundant in this fraction and/or highly
immunogenic.
The immunoprecipitation of editing activity and its associated
activities appears to be specific but does not definitively demonstrate
a functional association of gBP21 with the editing complex. The
specificity is evident from the results that MAbs specific for other
mitochondrial components or non-T. brucei antigens as well
as immunomagnetic beads to which additional antibodies are not coupled
do not precipitate the activities. The inability to immunoprecipitate
the activities after treatment of mitochondrial extract with (and
subsequent to inactivation of) micrococcal nuclease suggests a
functional association between gBP21 and the editing complex which
involves RNA. However, although the addition of EGTA does not inhibit
the editing activity (and other activities), the editing activity is
not detectable in either the immunoprecipitate or supernatant after
micrococcal nuclease treatment and inactivation. In contrast, TUTase
and the self-adenylylatable proteins are seen in the supernatant after
treatment. The loss of in vitro RNA editing activity may have been the
consequence of the manipulations, dilution, or dissociation. Thus, a
more direct assessment is needed to ascertain the functional
association of gBP21 with the complex. Nevertheless, the
immunoprecipitation of RNA editing activities that insert and delete
U's by the anti-gBP21 MAbs indicates that gBP21 is associated with
complexes that perform both types of RNA editing, which implies that
they may be similar.
The coprecipitation of in vitro RNA editing activities that insert and
delete U's, the component activities of endoribonuclease, TUTase, and RNA ligase, as well as gRNA and mRNA, suggests that all of
these activities and molecules might be assembled within a
multicomponent macromolecular complex. This is consistent with the
current view that editing occurs by a series of enzyme catalyzed steps
(4, 13, 25). According to this model, editing is initiated
by an endoribonucleolytic cleavage at a site that is directed by the
gRNA (25). This gRNA-dependent endoribonuclease sediments at
~20S, as do RNA editing complexes (8), while
gRNA-independent endoribonuclease activity remains at the top of
glycerol gradients. The relationship between the two endoribonuclease
activities is unclear; they may be distinct enzymes or simply differ
in their association with the complex (17).
Nevertheless, gRNA-dependent endoribonuclease is
immunoprecipitated by anti-gBP21 MAbs (Fig. 5). The MAbs also
immunoprecipitate activities that add or remove U's at the 3' end of
the 5' cleavage product of pre-mRNA, since RNA edited by U insertion or
deletion is produced by the immunoprecipitate. TUTase activity,
detected as the addition of U's to yeast tRNA, is also
immunoprecipitated by the anti-gBP21 MAbs (Fig. 6A) and may be
responsible for the U insertion. It is unclear if this enzyme is also
responsible for the posttranscriptional addition of U's to the 3' end
of gRNA or if there are multiple U-addition enzymes. Removal of U's
during RNA editing may conceivably occur by the reverse activity of the
same enzyme that adds U's. However, one study (21) suggests
that, at least for TUTase, this may not be the case since UMP and not
UTP is released upon U removal, although these studies did not examine
authentic sites that are edited. The anti-gBP21 MAbs also
immunoprecipitate the 57- and (to a lesser extent) 50-kDa
self-adenylylatable proteins (Fig. 6B). These proteins are probably RNA
ligases since they accumulate when incubated with nonligatable
substrates but deadenylylate and release AMP upon incubation with
ligatable substrates (22). Thus, they may be responsible for
the RNA ligase activity that catalyzes the final step in a single round
of RNA editing. The requirement for ATP
-
bond hydrolysis for in
vitro RNA editing may reflect the ATP requirement of RNA ligase,
although other steps in editing may also require ATP hydrolysis
(22, 26).
The in vitro RNA editing activity as well as the associated
gRNA-dependent endoribonuclease and RNA editing-associated U addition and deletion activities sediment with a broad profile centered at
~20S in glycerol gradients (8). While TUTase and the 50- and 57-kDa self-adenylylatable proteins also sediment with a peak in
this region of the gradient, a second peak of TUTase and the self-adenylylatable proteins, which is more prominent in some strains
and studies, is centered at ~40S (8, 18). In addition, gRNA and preedited mRNA sediment near 30S, while partially and fully
edited mRNAs sediment with a broad profile nearer 40S (8, 18). Perhaps the greater apparent sedimentation
coefficient reflects the increased mRNA size due to RNA editing
and/or gRNA or protein accumulation during editing. One possibility,
which we favor, is that complexes sedimenting at ~20S can edit
exogenously added RNAs whereas those sedimenting down to ~40S are
associated with endogenous RNA and thus do not edit exogenous RNA
(30). An alternative suggestion is that the ~20S and
~40S peaks represent different complexes (18). Western
blot analysis shows that most gBP21 protein is well above the 20S
fraction in glycerol gradients, indicating that the majority of it is
not (or not stably) associated with the editing complexes (data not
shown). However, G1 and G2 gRNA-specific complexes that contain gBP21
which form in vitro (19) can be quantitatively supershifted
by the anti-gBP21 MAbs, while the G3 complexes that contain a 90-kDa
protein but not gBP21 are not (Fig. 4). Thus, gBP21 may be in
substantial excess relative to editing complexes and/or it does not
remain associated with the editing complex during the entire editing
process. One possibility is that gBP21 plays a role in the association
of the gRNA with the editing complex. Perhaps G1 and G2 represent early
steps in the association of gRNA with a complex that associates the
gRNA with the editing complex, and the G3 (and perhaps G4) complex represents a later step in the assembly of the complex. The
localization of gBP21 throughout the mitochondrion with a greater
concentration in the kinetoplast might imply a functional partitioning
(Fig. 3). Perhaps the kinetoplast, which is the site of preedited RNA and gRNA transcription, is also a site of assembly of the editing complexes.
Studies of gRNA structure (12, 24) indicate that gRNAs
assume a double stem-loop structure with the anchor sequence contained within the 5' stem and the 3' U tail extending from and not included within the 3' stem. In vitro footprint analysis shows that gBP21 protects a substantial part of the 3' stem-loop structure
(12). This might leave the 5' region free to form a duplex
with the pre-mRNA. UV cross-linking to gRNA with the 90-kDa protein,
which is U tail dependent (19), sediments at 10S to 20S on
glycerol gradients after incubation with mitochondrial extract, as does UV-cross-linked gBP21 (8). However, the UV-cross-linked
90-kDa protein is primarily seen in the ~40S fraction, while most
UV-cross-linked 21-kDa protein is in a 10S fraction if the extract is
fractionated before UV cross-linking. Perhaps there is a greater
affinity or stability of the association of the gRNA with the editing
complex than for gBP21, and most 90-kDa protein remains associated with a complex whereas most 21-kDa protein is free in solution. Elucidation of the roles of these proteins and the other proteins associated with
the editing complex will await other studies, including gene knockout
experiments.
The composition of the editing complex(es) is uncertain. In addition to
gRNA and pre-mRNA, the complex(es) likely contains multiple proteins,
and the possibility that other RNAs are present has not yet been
excluded. UV cross-linking has identified numerous potential protein
constituents of the editing complex, including gBP21 and the 90-kDa
U-tail binding protein which become conspicuous in competition
experiments (19) and 55- and 16-kDa proteins revealed upon
anti-gBP21 MAb enrichment (Fig. 9). Complexes enriched by
immunoaffinity purification consistently contain proteins with approximate apparent molecular masses of 18, 24, 25, 28, 30, 32, 45, 47, 50, 52, 64, 65, and 69 kDa (Fig. 8). These may include the proteins
of 16, 21, 55, and 90 kDa, given the inaccuracy of measurements,
especially in comparisons of silver-stained proteins with those
radiolabeled by RNA cross-linking and with the variation in silver
staining intensities seen between proteins. Complexes with RNA editing
and associated activities prepared by biochemical techniques have fewer
prominent proteins. Those prepared by the Sollner-Webb group
(21) have major proteins with apparent molecular masses of
21, 45, 50, 55, 58, 66, 90, and 95 kDa. These protein profiles are
quite similar although not identical. In any event, a demonstration of
a specific association between one or more of the proteins is needed
before it can be concluded that these proteins are components of the
editing complex.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant GM42188 to K.D.S., who is
also a Burroughs Wellcome Scholar of Molecular Parasitology. T.E.A. was
supported by NIH postdoctoral fellowship 1F32AI09206-01; S.H. and
H.U.G. were supported by funding from the Deutsche
Forschungsgemeinschaft.
We thank Reza Salavati and Rob Igo for critical reading of the
manuscript and members of the Stuart laboratory for many helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Seattle
Biomedical Research Institute, 4 Nickerson St., Seattle, WA
98109-1651. Phone: (206) 284-8846, ext. 316. Fax: (206) 284-0313. E-mail: kstuart{at}u.washington.edu.
 |
REFERENCES |
| 1.
|
Benne, R.
1994.
RNA editing in trypanosomes.
Eur. J. Biochem.
221:9-23[Medline].
|
| 2.
|
Benne, R.,
J. van den Burg,
J. P. J. Brakenhoff,
P. Sloof,
J. H. Van Boom, and M. C. Tromp.
1986.
Major transcripts of the frameshifted coxII gene from trypanosome mitochondria contain four nucleotides that are not encoded in the DNA.
Cell
46:819-826[Medline].
|
| 3.
|
Bhat, G. J.,
D. J. Koslowsky,
J. E. Feagin,
B. L. Smiley, and K. Stuart.
1990.
An extensively edited mitochondrial transcript in kinetoplastids encodes a protein homologous to ATPase subunit 6.
Cell
61:885-894[Medline].
|
| 4.
|
Blum, B.,
N. Bakalara, and L. Simpson.
1990.
A model for RNA editing in kinetoplastid mitochondria: "guide" RNA molecules transcribed from maxicircle DNA provide the edited information.
Cell
60:189-198[Medline].
|
| 5.
|
Blum, B., and L. Simpson.
1990.
Guide RNAs in kinetoplastid mitochondria have a nonencoded 3' oligo(U) tail involved in recognition of the preedited region.
Cell
62:391-397[Medline].
|
| 6.
|
Blum, B., and L. Simpson.
1992.
Formation of guide RNA/messenger RNA chimeric molecules in vitro, the initial step of RNA editing, is dependent on an anchor sequence.
Proc. Natl. Acad. Sci. USA
89:11944-11948[Abstract/Free Full Text].
|
| 7.
|
Coligan, E.,
A. M. Kruibsbeek,
D. H. Margulies,
E. M. Shevach, and W. Strober.
1991.
Current protocols in immunology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 8.
|
Corell, R. A.,
L. K. Read,
G. R. Riley,
J. K. Nellissery,
T. Allen,
M. L. Kable,
M. D. Wachal,
S. Seiwert,
P. J. Myler, and K. D. Stuart.
1996.
Complexes from Trypanosoma brucei that exhibit deletion editing and other editing-associated properties.
Mol. Cell. Biol.
16:1410-1418[Abstract].
|
| 9.
|
Feagin, J. E., and K. Stuart.
1988.
Development aspects of uridine addition within mitochondrial transcripts of Trypanosoma brucei.
Mol. Cell. Biol.
8:1259-1265[Abstract/Free Full Text].
|
| 10.
|
Göringer, H. U.,
D. J. Koslowsky,
T. H. Morales, and K. D. Stuart.
1994.
The formation of mitochondrial ribonucleoprotein complexes involving guide RNA molecules in Trypanosoma brucei.
Proc. Natl. Acad. Sci. USA
91:1776-1780[Abstract/Free Full Text].
|
| 11.
|
Hajduk, S. L.,
M. E. Harris, and V. W. Pollard.
1993.
RNA editing in kinetoplastid mitochondria.
FASEB J.
7:54-63[Abstract].
|
| 12.
|
Hermann, T.,
B. Schmid,
H. Heumann, and H. U. Göringer.
1997.
A three-dimensional working model for a guide RNA from Trypanosoma brucei.
Nucleic Acids Res.
25:2311-2318[Abstract/Free Full Text].
|
| 13.
|
Kable, M. L.,
S. D. Seiwert,
S. Heidmann, and K. Stuart.
1996.
RNA editing: a mechanism for gRNA-specified uridylate insertion into precursor mRNA.
Science
273:1189-1195[Abstract].
|
| 14.
|
Köller, J.,
U. Müller,
B. Schmid,
A. Missel,
V. Kruft,
K. Stuart, and H. U. Göringer.
1997.
Trypanosoma brucei gBP21: an arginine rich mitochondrial protein that binds to guide RNA with high affinity.
J. Biol. Chem.
272:3749-3757[Abstract/Free Full Text].
|
| 15.
|
Köller, J.,
G. Nörskau,
A. S. Paul,
K. Stuart, and H. U. Göringer.
1994.
Different Trypanosoma brucei guide RNA molecules associate with an identical complement of mitochondrial proteins in vitro.
Nucleic Acids Res.
22:1988-1995[Abstract/Free Full Text].
|
| 16.
|
Leegwater, P.,
D. Speijer, and R. Benne.
1995.
Identification by UV cross-linking of oligo(U)-binding proteins in mitochondria of the insect trypanosomatid Crithidia fasciculata.
Eur. J. Biochem.
227:780-786[Medline].
|
| 17.
|
Piller, K. J.,
L. N. Rusché,
J. Cruz-Reyes, and B. Sollner-Webb.
1997.
Resolution of the RNA editing gRNA-directed endonuclease from two other endonucleases of Trypanosoma brucei mitochondria.
RNA
3:279-290[Abstract].
|
| 18.
|
Pollard, V. W.,
M. E. Harris, and S. L. Hajduk.
1992.
Native mRNA editing complexes from Trypanosoma brucei mitochondria.
EMBO J.
11:4429-4438[Medline].
|
| 19.
|
Read, L. K.,
H. U. Göringer, and K. Stuart.
1994.
Assembly of mitochondrial ribonucleoprotein complexes involves specific guide RNA (gRNA)-binding proteins and gRNA domains but does not require preedited mRNA.
Mol. Cell. Biol.
14:2629-2639[Abstract/Free Full Text].
|
| 20.
|
Riley, G. R.,
P. J. Myler, and K. Stuart.
1995.
Quantification of RNA editing substrates, products and potential intermediates: implication for development regulation.
Nucleic Acids Res.
23:708-712[Abstract/Free Full Text].
|
| 21.
|
Rusché, L. N.,
J. Cruz-Reyes,
K. J. Piller, and B. Sollner-Webb.
1997.
Purification of a functional enzymatic editing complex from Trypanosoma brucei mitochondria.
EMBO J.
16:4069-4081[Medline].
|
| 22.
|
Sabatini, R., and S. L. Hajduk.
1995.
RNA ligase and its involvement in guide RNA/mRNA chimera formation. Evidence for a cleavage-ligation mechanism of Trypanosoma brucei mRNA editing.
J. Biol. Chem.
270:7233-7240[Abstract/Free Full Text].
|
| 23.
|
Sambrook, J.,
T. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Schmid, B.,
G. R. Riley,
K. Stuart, and H. U. Göringer.
1995.
The secondary structure of guide RNA molecules from Trypanosoma brucei.
Nucleic Acids Res.
23:3093-3102[Abstract/Free Full Text].
|
| 25.
|
Seiwert, S. D.,
S. Heidmann, and K. Stuart.
1996.
Direct visualization of uridylate deletion in vitro suggests a mechanism for kinestoplastid RNA editing.
Cell
84:1-20[Medline].
|
| 26.
|
Seiwert, S. D., and K. Stuart.
1994.
RNA editing: transfer of genetic information from gRNA to precursor mRNA in vitro.
Science
266:114-117[Abstract/Free Full Text].
|
| 27.
|
Simpson, L.,
D. A. Maslov, and B. Blum.
1993.
RNA editing in Leishmania mitochondria, p. 53-86.
In
R. Benne (ed.), RNA editing: the alteration of protein coding sequences of RNA. Ellis Horwood Ltd., Chichester, England.
|
| 28.
|
Sollner-Webb, B.
1991.
RNA editing.
Curr. Opin. Cell Biol.
3:1056-1061[Medline].
|
| 29.
|
Stuart, K.
1993.
RNA editing in mitochondria of African trypanosomes, p. 26-52.
In
R. Benne (ed.), RNA editing: the alteration of protein coding sequences of RNA. Ellis Harwood Ltd., Chichester, England.
|
| 30.
|
Stuart, K.,
T. E. Allen,
S. Heidmann, and S. D. Seiwert.
1997.
RNA editing in kinetoplastid protozoa.
Microbiol. Mol. Biol. Rev.
61:105-120[Abstract].
|
| 31.
|
Stuart, K.,
E. Gobright,
L. Jenni,
M. Milhausen,
L. Thomashow, and N. Agabian.
1984.
The IsTaR 1 serodeme of Trypanosoma brucei: development of a new serodeme.
J. Parasitol.
70:747-754[Medline].
|
Molecular and Cellular Biology, October 1998, p. 6014-6022, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Osato, D., Rogers, K., Guo, Q., Li, F., Richmond, G., Klug, F., Simpson, L.
(2009). Uridine insertion/deletion RNA editing in trypanosomatid mitochondria: In search of the editosome. RNA
15: 1338-1344
[Abstract]
[Full Text]
-
Panigrahi, A. K., Zikova, A., Dalley, R. A., Acestor, N., Ogata, Y., Anupama, A., Myler, P. J., Stuart, K. D.
(2008). Mitochondrial Complexes in Trypanosoma brucei: A Novel Complex and a Unique Oxidoreductase Complex. Mol. Cell. Proteomics
7: 534-545
[Abstract]
[Full Text]
-
Cifuentes-Rojas, C., Pavia, P., Hernandez, A., Osterwisch, D., Puerta, C., Cruz-Reyes, J.
(2007). Substrate Determinants for RNA Editing and Editing Complex Interactions at a Site for Full-round U Insertion. J. Biol. Chem.
282: 4265-4276
[Abstract]
[Full Text]
-
Sacharidou, A., Cifuentes-Rojas, C., Halbig, K., Hernandez, A., Dangott, L. J., De Nova-Ocampo, M., Cruz-Reyes, J.
(2006). RNA editing complex interactions with a site for full-round U deletion in Trypanosoma brucei. RNA
12: 1219-1228
[Abstract]
[Full Text]
-
Panigrahi, A. K., Ernst, N. L., Domingo, G. J., Fleck, M., Salavati, R., Stuart, K. D.
(2006). Compositionally and functionally distinct editosomes in Trypanosoma brucei. RNA
12: 1038-1049
[Abstract]
[Full Text]
-
Salavati, R., Ernst, N. L., O'Rear, J., Gilliam, T., Tarun, S. Jr., Stuart, K.
(2006). KREPA4, an RNA binding protein essential for editosome integrity and survival of Trypanosoma brucei. RNA
12: 819-831
[Abstract]
[Full Text]
-
Vondruskova, E., van den Burg, J., Zikova, A., Ernst, N. L., Stuart, K., Benne, R., Lukes, J.
(2005). RNA Interference Analyses Suggest a Transcript-specific Regulatory Role for Mitochondrial RNA-binding Proteins MRP1 and MRP2 in RNA Editing and Other RNA Processing in Trypanosoma brucei. J. Biol. Chem.
280: 2429-2438
[Abstract]
[Full Text]
-
Penschow, J. L., Sleve, D. A., Ryan, C. M., Read, L. K.
(2004). TbDSS-1, an Essential Trypanosoma brucei Exoribonuclease Homolog That Has Pleiotropic Effects on Mitochondrial RNA Metabolism. Eukaryot Cell
3: 1206-1216
[Abstract]
[Full Text]
-
Kang, X., Falick, A. M., Nelson, R. E., Gao, G., Rogers, K., Aphasizhev, R., Simpson, L.
(2004). Disruption of the Zinc Finger Motifs in the Leishmania tarentolae LC-4 (=TbMP63) L-complex Editing Protein Affects the Stability of the L-complex. J. Biol. Chem.
279: 3893-3899
[Abstract]
[Full Text]
-
SIMPSON, L., APHASIZHEV, R., GAO, G., KANG, X.
(2004). Mitochondrial proteins and complexes in Leishmania and Trypanosoma involved in U-insertion/deletion RNA editing. RNA
10: 159-170
[Abstract]
[Full Text]
-
Wang, B., Ernst, N. L., Palazzo, S. S., Panigrahi, A. K., Salavati, R., Stuart, K.
(2003). TbMP44 Is Essential for RNA Editing and Structural Integrity of the Editosome in Trypanosoma brucei. Eukaryot Cell
2: 578-587
[Abstract]
[Full Text]
-
PANIGRAHI, A. K., SCHNAUFER, A., ERNST, N. L., WANG, B., CARMEAN, N., SALAVATI, R., STUART, K.
(2003). Identification of novel components of Trypanosoma brucei editosomes. RNA
9: 484-492
[Abstract]
[Full Text]
-
SIMPSON, L., SBICEGO, S., APHASIZHEV, R.
(2003). Uridine insertion/deletion RNA editing in trypanosome mitochondria: A complex business. RNA
9: 265-276
[Abstract]
[Full Text]
-
APHASIZHEV, R., APHASIZHEVA, I., NELSON, R. E., SIMPSON, L.
(2003). A 100-kD complex of two RNA-binding proteins from mitochondria of Leishmania tarentolae catalyzes RNA annealing and interacts with several RNA editing components. RNA
9: 62-76
[Abstract]
[Full Text]
-
Cruz-Reyes, J., Zhelonkina, A. G., Huang, C. E., Sollner-Webb, B.
(2002). Distinct Functions of Two RNA Ligases in Active Trypanosoma brucei RNA Editing Complexes. Mol. Cell. Biol.
22: 4652-4660
[Abstract]
[Full Text]
-
Igo, R. P. Jr., Lawson, S. D., Stuart, K.
(2002). RNA Sequence and Base Pairing Effects on Insertion Editing in Trypanosoma brucei. Mol. Cell. Biol.
22: 1567-1576
[Abstract]
[Full Text]
-
Muller, U. F., Goringer, H. U.
(2002). Mechanism of the gBP21-mediated RNA/RNA annealing reaction: matchmaking and charge reduction. Nucleic Acids Res
30: 447-455
[Abstract]
[Full Text]
-
Blom, D., Burg, J. v. d., Breek, C. K. D., Speijer, D., Muijsers, A. O., Benne, R.
(2001). Cloning and characterization of two guide RNA-binding proteins from mitochondria of Crithidia fasciculata: gBP27, a novel protein, and gBP29, the orthologue of Trypanosoma brucei gBP21. Nucleic Acids Res
29: 2950-2962
[Abstract]
[Full Text]
-
Cruz-Reyes, J., Zhelonkina, A., Rusche, L., Sollner-Webb, B.
(2001). Trypanosome RNA Editing: Simple Guide RNA Features Enhance U Deletion 100-Fold. Mol. Cell. Biol.
21: 884-892
[Abstract]
[Full Text]
-
Panigrahi, A. K., Gygi, S. P., Ernst, N. L., Igo, R. P. Jr., Palazzo, S. S., Schnaufer, A., Weston, D. S., Carmean, N., Salavati, R., Aebersold, R., Stuart, K. D.
(2001). Association of Two Novel Proteins, TbMP52 and TbMP48, with the Trypanosoma brucei RNA Editing Complex. Mol. Cell. Biol.
21: 380-389
[Abstract]
[Full Text]
-
Igo, R. P. Jr., Palazzo, S. S., Burgess, M. L. K., Panigrahi, A. K., Stuart, K.
(2000). Uridylate Addition and RNA Ligation Contribute to the Specificity of Kinetoplastid Insertion RNA Editing. Mol. Cell. Biol.
20: 8447-8457
[Abstract]
[Full Text]
-
Hayman, M. L., Read, L. K.
(1999). Trypanosoma brucei RBP16 Is a Mitochondrial Y-box Family Protein with Guide RNA Binding Activity. J. Biol. Chem.
274: 12067-12074
[Abstract]
[Full Text]