Previous Article | Next Article 
Molecular and Cellular Biology, October 1998, p. 6142-6151, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Circadian Regulation of a Drosophila Homolog of the
Mammalian Clock Gene: PER and TIM Function as Positive
Regulators
Kiho
Bae,1
Choogon
Lee,1
David
Sidote,2
Keng-yu
Chuang,2 and
Isaac
Edery2,*
Graduate Program in Microbiology and
Molecular Genetics,1 and
Department of
Molecular Biology and Biochemistry,2 Center for
Advanced Biotechnology and Medicine, Rutgers University, Piscataway,
New Jersey 08854
Received 4 June 1998/Returned for modification 30 June
1998/Accepted 8 July 1998
 |
ABSTRACT |
The Clock gene plays an essential role in the
manifestation of circadian rhythms (
24 h) in mice and is a member of
the basic helix-loop-helix (bHLH) PER-ARNT-SIM (PAS) superfamily of
transcription factors. Here we report the characterization of a novel
Drosophila bHLH-PAS protein that is highly homologous to
mammalian CLOCK. (Similar findings were recently described by Allada et
al. Cell 93:791-804, 1998, and Darlington et al., Science
280:1599-1603, 1998.) Transcripts from this putative Clock
ortholog (designated dClock) undergo daily rhythms in
abundance that are antiphase to the cycling observed for the RNA
products from the Drosophila melanogaster circadian clock
genes period (per) and timeless
(tim). Furthermore, dClock RNA cycling is
abolished and the levels are at trough values in the absence of either
PER or TIM, suggesting that these two proteins can function as
transcriptional activators, a possibility which is in stark contrast to
their previously characterized role in transcriptional autoinhibition.
Finally, the temporal regulation of dClock expression is
quickly perturbed by shifts in light-dark cycles, indicating that this
molecular rhythm is closely connected to the photic entrainment
pathway. The isolation of a Drosophila homolog of
Clock together with the recent discovery of mammalian
homologs of per indicate that there is high structural conservation in the integral components underlying circadian
oscillators in Drosophila and mammals. Nevertheless,
because mammalian Clock mRNA is constitutively expressed,
our findings are a further example of striking differences in the
regulation of putative circadian clock orthologs in different species.
 |
INTRODUCTION |
Many organisms ranging from bacteria
to humans display circadian (
24 h) rhythms in a wide variety of
biochemical, physiological, and behavioral phenomena (for a review, see
reference 19). These rhythms are regulated by
endogenous biochemical oscillators or clocks that can be entrained
(synchronized) by environmental stimuli, most notably the daily changes
in light intensity and temperature. It is likely that the most
significant evolutionarily conserved role of circadian clocks is to
enable organisms to organize their physiology and behavior to occur at
biologically advantageous times in a day.
A major goal in the study of circadian rhythms is to understand the
molecular underpinnings of the pacemakers that govern these rhythms.
Genetic approaches using model organisms have played a pivotal role in
identifying genes that are critical for the manifestation of a variety
of behavioral rhythms. The best characterized examples of such genes
are period (per) (24) and
timeless (tim) (42) in
Drosophila melanogaster, frequency
(frq) (31) in Neurospora crassa, and
Clock (51) in mice. Although the in vivo
biochemical roles of the protein products encoded by these genes are
not clear, they all appear to have a primary function in the regulation
of transcription (for a recent review, see reference
38).
For example, in D. melanogaster, daily cycles in
per and tim mRNAs are largely governed by a
transcriptional feedback loop, likely negative, that depends on the
presence of both PER and TIM, suggesting that a shared mechanism
participates in the autoregulation of per and tim
transcription (17, 18, 43, 47, 53). The observation that PER
and TIM physically interact to form a functional complex that enters
the nucleus in a temporally gated manner, an event that is accompanied
by decreases in the levels of per and tim
transcripts, likely explains this reciprocal autoregulation (8,
13, 25, 37, 54). Likewise, the Neurospora FRQ protein also participates in a negative transcriptional feedback loop that is
dependent on the nuclear localization of FRQ and leads to daily
oscillations in the abundance of frq transcripts (3, 28). In addition, PER, TIM, and FRQ undergo temporally regulated changes in abundance as well as phosphorylation (10, 12, 22, 30,
32, 53, 54). Current understanding posits that the protein and
RNA products of per, tim, and frq
comprise transcription-translation-based autoinhibitory loops that are
central to the oscillatory mechanisms in these species (reviewed in
reference 38). Although PER, TIM, and FRQ behave as
negative elements in circadian transcriptional loops, they do not share
significant sequence similarities (4, 31, 33). Furthermore,
it does not appear that these proteins bind DNA, suggesting indirect
modes of action for their roles in transcriptional autoinhibition.
Specifically, it has been proposed that PER might inhibit gene
expression by forming nonfunctional heterodimers with transcription
factors (reviewed in reference 38).
The predicted involvement of CLOCK in transcriptional regulation is
based on the demonstration that it is a member of the basic
helix-loop-helix (bHLH) PER-ARNT-SIM (PAS) superfamily of transcription
factors (23). The structure of bHLH-PAS proteins is highly
conserved (for a recent review, see reference 5); the bHLH domain which mediates protein dimerization and DNA-binding is
near the amino terminus and is closely followed by another protein
dimerization motif called the PAS domain (named for the first three
proteins identified with this motif: D. melanogaster PER, mammalian aryl hydrocarbon receptor nuclear translocator [ARNT],
and D. melanogaster SIM). In bHLH-PAS-containing
proteins, the PAS domain is ~250 to 300 amino acids long and contains
two well-conserved repeats of approximately 50 amino acids, designated PAS-A and PAS-B. Finally, in many cases, the carboxyl termini of these
proteins have glutamine-rich regions associated with transcriptional activation. In this context, it is noteworthy that a mutation that causes a deletion within the glutamine-rich region
of the carboxy terminus of mCLOCK results in mice with altered activity
rhythms (23). Thus, in contrast to PER, TIM, and FRQ, which
function as negative regulators, CLOCK is predicted to have a
role in the stimulation of transcription. It is anticipated that a
significant role for transcriptional activators in circadian feedback
loops is to stimulate the rhythmic production of elements associated
with negative regulation, such as PER, TIM, and FRQ. Indeed, a recent
study has shown that a transcription factor termed WC-2 is necessary
for expression of frq and the manifestation of overt
circadian rhythms in Neurospora (6). Presumably,
after an appropriately timed delay following the production of the
negative regulators, these factors complete the transcriptional
feedback loop by somehow inhibiting the activities of the
transcriptional activators. The emerging picture is that
transcriptional feedback loops composed of positive and negative
regulatory elements that alternate in their functioning are core
features of circadian oscillatory mechanisms.
In addition to the inferred functional conservation of transcriptional
feedback loops in circadian oscillatory mechanisms, the recent
discovery of per homologs in mice (mper-1 and
mper-2) (1, 44, 45, 48, 49) indicates that the
Drosophila and mammalian clocks also share components that
are structurally conserved, raising the possibility of a
Drosophila Clock homolog. Moreover, in D. melanogaster, a circadian transcriptional enhancer that drives
high-amplitude per mRNA cycling contains an E-box element that is necessary for high-level expression, suggesting the involvement of a bHLH-containing transcription factor in the regulation of per expression (16). In this report, we
characterize a putative D. melanogaster ortholog of
mammalian Clock (dClock). Similar findings were
recently reported by two independent groups (2, 9). We show
that dClock transcript levels are regulated in a circadian
fashion in sharp contrast to the constitutive expression of mammalian
Clock (48, 49). Taken together with recent
findings, our data indicate that putative circadian clock orthologs in
different species can be subject to very different regulatory schemes.
Surprisingly, our data also indicate that PER and TIM can function as
positive elements in the regulation of gene expression.
 |
MATERIALS AND METHODS |
Fly strains and collections.
The wild-type Canton-S (CS)
flies and the mutant per01 flies used in this
study were descendants of stocks originally maintained in the
laboratory of M. Rosbash (Brandeis University, Waltham, Mass.) and were
previously described (see, e.g., reference 10). The
tim0 flies were descendants of stocks originally
maintained in the laboratory of A. Sehgal (University of Pennsylvania
Medical School, Philadelphia) and were previously described
(42). All flies were grown and maintained in vials
containing standard agar-cornmeal-sugar-yeast-tegosept medium. Vials
containing ~100 young (2-to-6-day-old) adult flies were placed in
incubators (Precision Scientific) at 25°C, exposed to at least 2 cycles of 12 h of light and 12 h of darkness (12-h LD) (where
zeitgeber time 0 [ZT0] is lights on and ZT12 is lights off) and were
subsequently maintained in the dark (DD). At selected times during the
12-h LD and the DD periods, flies were collected by freezing. In the
12-h LD shift experiment (see Fig. 4), four groups of flies were
exposed to 3 days of 12-h LD. On the third day of 12-h LD, two
groups of flies were subjected to a shift in the relative timing of the
12-h LD cycle. One group was removed at ZT11.9 and placed in another
incubator where the lights-on period was continued from ZT12 to ZT16.
At ZT16, the lights were turned off and the flies were maintained in
the dark for the standard 12-h period followed by the next lights-on
period at ZT4 (ZTs are given relative to the original 12-h LD
entraining condition). Thus, on the third day of 12-h LD, the light
period was extended by 4 h, followed by a standard 12-h LD cycle.
The other experimental group was removed at ZT20 and placed in another
incubator where it was exposed to light for the standard 12-h period
followed by a lights-off period beginning at ZT8 (relative to the
original 12-h LD entraining condition). Thus, on the third day of 12-h LD, the light period was initiated 4 h earlier, followed by a standard 12-h LD cycle. The two other groups of flies were maintained in the original 12-h LD condition used during entrainment and served as
controls for each of the two groups of flies that were subjected to
12-h LD shifts.
5' RACE.
To obtain DNA sequences upstream of an
uncharacterized Drosophila melanogaster expressed sequence
tag (EST) (GenBank accession no. AA698290) whose deduced translation
product shows very high homology to the PAS-B motif of mCLOCK (data not
shown and see Fig. 1) we used the 5' rapid amplification of cDNA ends
(5' RACE) system from Gibco/BRL (version 2.0). 5' RACE was performed according to manufacturer's recommended procedure on total head RNA
isolated from wild-type CS flies collected between ZT15 and 16. Total
RNA was extracted from ~30 µl of fly heads by using TriReagent
(Sigma) as previously described (29). 5' RACE-PCR products
were directly subcloned into the pGEM-T Easy vector (Promega), and the
inserts were sequenced (described below). The initial round of 5' RACE
experiments was done with three nested primers based on the EST
sequence available in the database (GenBank accession no. AA698290).
The primers used in the initial 5' RACE-PCR experiment were 5'
CATTCCAGTATCGGAGGT 3', 5' CGTTGTCGTAGTGGTTGTTACCCTC 3', and
5' CGATACGGCTCCAAGACTTCCTAT 3'. This yielded several
prominent PCR products ranging in size, and the largest (~0.6 kb) was
selected for sequencing. As expected from the size of the 0.6-kb PCR
fragment, the predicted size of a CLOCK homolog, and a putative PAS-B
starting point in the 5' RACE experiment, DNA sequence analysis
(described below) indicated that this 5' RACE-PCR product did not
contain the translation start site (data not shown and see Fig. 1). In a second round of 5' RACE experiments, a new set of two nested primers
based on the EST sequence were used: 5' CGTTCAGAACGATGATGGCTAAG 3'
and 5' GTACTTCTCGATTCCGTTTGCCCA 3'. Two prominent PCR
products of approximately 1.0 and 1.3 kb were selected for sequencing. Sequence analysis indicated that the 5' terminus of the ~1.0-kb PCR
product was slightly upstream of a region encoding the PAS-A domain,
whereas the ~1.3-kb fragment terminated upstream of the predicted
translation start site (see below and data not shown).
DNA sequencing and analysis.
Five independent inserts
derived from 5' RACE-PCR experiments (i.e., one isolate of the 0.6-kb
fragment and two independent isolates of both the 1.0- and 1.3-kb
fragments; see above) and a cDNA clone containing an EST that showed
high homology to mCLOCK (GenBank accession no. AA698290; obtained from
Genome Systems Inc., St. Louis, Mo.) were sequenced in both directions.
DNA sequences were determined by the DNA synthesis and sequencing
laboratory at the University of Medicine and Dentistry of New Jersey
with an ABI 377 Sequencer with the enzyme Amplitaq polymerase FS. The predicted open reading frame (ORF) for dCLOCK (see Fig. 1) was constructed by combining sequences derived from the five independent 5'
RACE-PCR products in addition to that derived from sequencing the cDNA
clone obtained from Genome Systems Inc. Protein searches of
nonredundant databases were done with ADVANCED BLAST. The GAP program
(Genetics Computer Group) was used for sequence alignments.
RNase protection assay.
For each time point, total RNA was
extracted from ~10 µl of fly heads by using TriReagent (Sigma) as
previously described (29). The abundance of
dClock, tim, and per transcripts was determined by RNase protection assays (18) performed with
the modifications described by Zeng et al. (53). The
radiolabeled antisense probes used to determine the levels of
per and tim RNA were as previously described
(46). To measure dClock RNA levels, we used PCR
to generate a DNA fragment that contained nucleotides 3 to 293 of the
Drosophila EST clone showing high homology to mCLOCK
(numbering according to GenBank accession no. AA698290). The
oligonucleotides used in the PCR were (nucleotides corresponding to the
EST are underlined) 5'
AATTGGATCCGAAGTTTTTGTTTCTGGATCACCGTG 3' and 5'
AATTCTCGAGCAGAACCTCGGCATAGCTGACAAC 3'. The PCR
product was subcloned into the pGEM-T Easy vector (Promega) and
linearized with BamHI, and antisense radiolabeled probe was
produced in vitro by using SP6 RNA polymerase as previously described
(18). As a control for RNA loading in each lane, a ribosomal
protein probe (RP49) was included in each protection assay
(18). Protected bands were quantified with a PhosphorImager
from Molecular Dynamics, and values were normalized relative to those
of RP49 (18).
Nucleotide sequence accession number.
The cDNA sequence for
dClock has been submitted to GenBank under the accession no.
AF06997.
 |
RESULTS |
Identification of a novel Drosophila bHLH-PAS protein
with high homology to mammalian CLOCK.
In a search for
D. melanogaster cDNAs with homology to mammalian
Clock, we noticed an uncharacterized EST in the database that encodes a conceptual translation product with very high sequence identity to the PAS-B domain of mouse and mammalian CLOCK (GenBank accession no. AA698290). A cDNA clone containing this EST was obtained
(Genome Systems Inc.) and as expected because the synthesis of this
cDNA was primed with oligo(dT), sequencing verified that a poly(A) tail
is present at the 3' terminus of the insert. The remaining portion of
the ORF encoded by this gene was cloned by using 5' RACE PCR (see
Materials and Methods). In total, we sequenced 3,727 bp of cDNA.
Analysis of the cDNA sequence indicated a single large ORF of 3,081 bp.
The presumptive 5' untranslated region has at least two ATG codons that
are quickly followed by in-frame stop codons (data not shown). The
predicted initiating AUG codon for the large ORF lies within a
favorable Kozak consensus sequence for translation start sites (
3
AAAATGG +4). A sequence of 264 bp follows the stop codon at
the end of the large ORF and as expected it contains a consensus
sequence for poly(A) addition (ATAAA) that is closely followed by a
stretch of 18 adenosine residues at its 3' terminus.
The single large ORF encodes a protein product of 1,027 amino acid
residues with a predicted molecular mass of 116.1 kDa. A BLAST
analysis (ADVANCED BLAST) against a nonredundant amino acid database
(National Center for Biotechnology Information) performed with the
entire 1,027 amino acid sequence identified mammalian CLOCK
(23) and MOP4 (20) (also referred to as NPAS2 [55]) as the proteins most highly homologous to the
predicted Drosophila protein (designated dCLOCK) (data not
shown). Although the function of MOP4 is not known, it is a
bHLH-PAS protein that shows very high homology to CLOCK
(23). Alignment of dCLOCK, mouse CLOCK (mCLOCK), and human
MOP4 (hMOP4) showed that extensive homology is largely limited to
four regions (Fig. 1 and data not shown): (i) an amino terminal region
that includes a bHLH domain; (ii) PAS-A repeats; (iii) PAS-B repeats;
and (iv) a region immediately carboxy terminal to the PAS-B repeat
which was shown to function as a cytoplasmic localization
determinant in D. melanogaster PER (37). All
three proteins share the same putative basic region of EKKRR
(Fig. 1) (20), which is found
in only a few of the characterized bHLH-PAS proteins, suggesting that
the E-box DNA elements with which these proteins presumably interact
contain similar half-sites. The most significant homology was found in the PAS-B repeat; over a stretch of 46 amino acids this region in
dCLOCK (amino acids 264 to 309) shows a remarkable 86 to 90% identity
and 94 to 96% similarity with mammalian CLOCK and MOP4 (Fig. 1A and
data not shown). However, it is noteworthy that dCLOCK and mCLOCK but
not MOP4 have very prominent polyglutamine stretches in their carboxy
terminal regions (Fig. 1) (20, 23, 55). Polyglutamine
stretches in the carboxy terminal regions of many proteins function to
activate transcription.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of the predicted protein sequences of dCLOCK
and mCLOCK. (A) A schematic representation of dCLOCK and mCLOCK with
homologous regions highlighted by different colors is shown. Yellow,
amino-terminal region containing bHLH; blue, A and B repeats of PAS;
green, region in PAS domain that is immediately carboxy terminal to
PAS-B; orange, polyglutamine stretch; red, glutamine-rich region. The
boundaries of the bHLH-PAS repeats, glutamine-rich region, and
polyglutamine stretch were according to King et al. (23).
The boundary of the region immediately carboxy terminal to the PAS-B
repeat is based on Saez and Young (37). (B) Pairwise
alignment of dCLOCK and mCLOCK amino acids was done with the Genetics
Computer Group program GAP. Amino acid identity is indicated by a
vertical line and similarity is indicated by dots. Overall, the amino
acid sequences of dCLOCK and mCLOCK are 50% identical and 67% similar
(data not shown). The mCLOCK sequence is from King et al.
(23). A line above the four amino acids that differ between
our sequence and that recently published by Darlington et al.
(9) is shown.
|
|
The sequence analysis clearly indicates that the Drosophila
cDNA we characterized encodes a novel bHLH-PAS protein that is very
homologous to mammalian CLOCK (overall homology is 50% identity and
67% similarity). Around the time that we submitted our manuscript, two
independent groups reported the molecular isolation of
dClock (2, 9). Conceptual translation of our
large ORF (in the original version of our manuscript we designated it
dPAS1 [GenBank accession no. AF06997]) yields a protein sequence that
is identical to that reported by Darlington et al. (9)
except that our sequence contains four extra amino acids (Fig. 1).
Because we detected cDNA sequences encoding these four amino acids in
only one of two independent isolates derived from reverse transcriptase
PCR (see Materials and Methods), it is possible that they are a cloning artifact. Furthermore, the dCLOCK sequence shown in Allada et al.
(2) is also missing these four amino acids and otherwise differs from our sequence and that of Darlington et al. (9) only in that the longest polyglutamine repeat in Allada et al. (2) is 25 rather than 33 residues in length. The discrepancy in the length of the longest polyglutamine stretch is presumably due to
the polymorphic nature of this region (2).
dClock transcripts undergo daily cycles in abundance
that are antiphase to per and tim mRNAs.
If dClock is an integral component of the
Drosophila circadian timekeeping mechanism, then it might be
expected to show rhythmic expression. To determine whether the
abundance of dClock RNA changes during the course of a day,
we exposed wild-type CS flies to three 12-h LD cycles (where zeitgeber
time 0 [ZT0] is when lights were turned on and ZT12 is when lights
were turned off). At different times during the 12-h LD cycles, flies
were collected, total RNA was isolated from heads, and the levels of
dClock transcripts were determined by RNase protection (see
Materials and Methods). Heads were used because it is the anatomical
location of the best characterized circadian clock in D. melanogaster (11, 15). Furthermore, the
dClock cDNA we characterized was derived from D. melanogaster head and sensory organs (see Materials and Methods and data not shown). The results indicate that in light-dark
conditions, dClock RNA displays robust cycling with an
approximately fivefold peak-trough amplitude (n = 5),
reaching peak abundance within several hours of the dark-light
transition at ZT0 and trough values around the light-dark transition at
ZT12 (Fig. 2).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Daily cycling of dClock mRNA in heads from
wild-type D. melanogaster. (A) Autoradiogram of
dClock, per, tim, and RP49 transcripts
in wild-type flies during a 12-h LD cycle. Levels of dClock,
per, tim, and RP49 transcripts were determined by
RNase protection assays (see Materials and Methods). (B) Quantitation
of results shown in panel A. Time course of dClock,
per, and tim transcript levels in wild-type flies
during 12-h LD conditions. Peak levels for each mRNA were set to 100. Relative RNA level refers to ratio of dClock,
per, or tim transcripts to RP49 RNA. Closed bar,
darkness; open bar, light. Similar results were obtained in five
independent experiments, and a representative example is shown.
|
|
Intriguingly, the time course of dClock transcript cycling
in adult heads is strikingly antiphase to that observed for
per and tim RNAs (Fig. 2). The circadian cycling
of four D. melanogaster transcripts has been well
characterized (i.e., per [18],
tim [43], Crg-1
[35], and Dreg-5 [50]),
and they all have similar phases reaching peak values in the early
night. To the best of our knowledge, dClock is the first
documented case of a D. melanogaster clock-regulated
RNA that peaks in the early day, similar in phase to transcripts from
the Neurospora circadian clock gene frequency (frq) (3). Our data indicate that circadian
oscillators in the Drosophila head can drive phase-specific
cycling of different transcripts. Recently, Darlington et al.
(9) also reported that the levels of dClock
transcripts oscillate in a 12-h LD cycle. However, they describe the
oscillation as bimodal with a major peak at ZT23 and a minor peak at
ZT5. In five independent experiments, we never observed a bimodal
distribution (Fig. 2 through 4 and data not shown). Furthermore, they
detected at least two variants of dClock transcripts
(9): (i) a major form that encodes full-length dCLOCK
(variant A) and (ii) a minor form that is produced by the use of an
alternative splice acceptor site (variant B), generating a coding
region that goes out of frame after the bHLH domain. The possibility
that the differences in the RNA curve observed in our study and that
reported by Darlington et al. (9) are due to the detection
of different dClock mRNA variants is unlikely because the
riboprobe we used in our RNase protection assays is directed to a
region that is present in both variants (i.e., to a region that encodes
the PAS-B domain; see Materials and Methods). Moreover,
Darlington et al. (9) showed that both splice variants cycled in phase with a bimodal distribution, and therefore detecting either variant should have yielded qualitatively similar results. At
present it is not clear why the curves describing the dClock mRNA cycles in the two studies differ.
PER and TIM are necessary for high-level expression of
dClock.
The cycling of dClock mRNA in 12-h LD
(Fig. 2) might be an exogenous response to the daily changes in light
and dark or reflect bona fide circadian regulation. To test whether the
daily cycling of dClock mRNA is driven by an endogenous
circadian clock, we measured its time course in 12-h LD-entrained flies
that were maintained in constant DD. The level of
dClock RNA continued to undergo daily oscillations for at
least 2 days in constant DD (Fig. 3A),
strongly suggesting that this molecular cycle is clock regulated.
Furthermore, a phase relationship is maintained in DD similar to that
observed during 12-h LD with no indication of bimodal behavior. To
confirm that dClock RNA is regulated in a circadian manner,
we used two arrhythmic D. melanogaster mutants that do
not produce functional PER (per01)
(24) or TIM (tim0) (42).
As expected, the levels of dClock RNA were constant throughout a daily cycle in both mutants (Fig. 3B). Surprisingly, however, the abundance of dClock transcripts was similar to
or lower than that observed for trough values in wild-type flies. Although the biochemical roles of PER and TIM are not clear, numerous lines of evidence indicate that these two proteins interact in the cytoplasm to form a PER-TIM complex that enters the nucleus, where
it functions to inhibit per and tim
transcription (see Discussion). Moreover, a role for the PER-TIM
complex in the negative regulation of other genes is indicated by the
observation that in the per01 (and where
analyzed in the tim0) mutant the levels of the
circadianly regulated Crg-1 (35) and
Dreg-5 (50) transcripts are close to their
respective peak levels in wild-type flies. In stark contrast, the
ability to accumulate high levels of dClock transcripts
requires PER and TIM, indicating a novel role for these two proteins in
the stimulation of gene expression.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Circadian regulation of dClock mRNA cycling.
(A) Levels of dClock mRNA in wild-type flies during the last
12-h LD cycle and the first 2 days in constant dark conditions. Peak
levels of dClock mRNA at ZT3 were set to 100. Time refers to
hours since last dark-to-light transition at ZT0. (B) PER and TIM are
required for high-level expression of dClock. Levels of
dClock mRNA in wild-type CS, per01,
and tim0 flies during 12-h LD. Peak levels
of dClock mRNA in wild-type flies was set to 100. Relative
RNA levels refers to ratios of dClock to RP49 RNA. Closed
bar, darkness; open bar, light; striped bar, subjective day. Each
experiment was done at least three times with similar results, and
representative examples are shown.
|
|
Shifts in the timing of light-dark cycles elicit rapid changes in
the temporal regulation of dClock RNA levels.
A
hallmark feature of circadian rhythms is that they are reset by changes
in the timing of light-dark cycles (reviewed in reference
19). This adaptive property enables circadian
rhythms to maintain phase synchrony with the entraining agent. To
determine how quickly the dClock RNA rhythm responds to
shifts in 12-h LD cycles, four groups of flies were exposed for several
days to a standard 12-h LD cycle (dark period began at ZT12 and light period began at ZT0 [abbreviated hereafter in the form 12D:0L]). Subsequently, two groups of flies were transferred from the original 12-h LD condition to a 12-h LD cycle that was either delayed (16D:4L) or advanced (8D:20L) by 4 h (Fig. 4)
(see Materials and Methods). Exposure of flies to photic stimuli in the
early (e.g., 16D:4L) and late (e.g., 8D:20L) night results in output
behavioral rhythms that are phase delayed or phase advanced,
respectively (references 26, 30, 32, 34, and 41 and
data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
dClock RNA levels in flies exposed to shifts
in the timing of a 12-h LD cycle. Four groups of wild-type
D. melanogaster were entrained by a standard 12-h LD
cycle for 3 days. Subsequently, two groups of flies were transferred
from the original 12-h LD condition and treated with either a backward
(A) or forward (B) shift of 4 h in the timing of the 12-h LD
cycle; a group of flies maintained in standard 12-h LD conditions
served as the control for each group of flies that was exposed to a
12-h LD shift (see Materials and Methods). (A) The 4-h backward shift
was initiated by extending the light period for four extra hours
(between ZT12 and ZT16) and beginning the dark period at ZT16 (16D:4L)
relative to the original 12-h LD cycle (12D:0L). (B) The 4-h forward
shift was initiated by beginning the light period 4 h earlier at
ZT20 (8D:20L) relative to the original 12-h LD cycle (12D:0L). Peak
levels of dClock mRNA under standard 12-h LD conditions were
set to 100. Levels of dClock transcripts were determined by
RNase protection assays. Relative RNA levels refers to ratios of
dClock to RP49 RNA. Closed bar, darkness; open bar, light.
The experiment was done twice with similar results, and one example is
shown.
|
|
Both a backward (Fig. 4A) and a forward (Fig. 4B) shift in the timing
of the 12-h LD cycle evoked rapid effects on the temporal regulation of
dClock RNA abundance, indicating that this molecular rhythm
is quickly entrained by photic stimuli. Extending the light period from
ZT12 to ZT16 (16D:4L) was accompanied by a delay of several hours in
the accumulation profile of dClock RNA (Fig. 4A).
Conversely, beginning the light period prematurely (at ZT20 [8D:20L])
led to a more rapid decline in the levels of dClock RNA
(Fig. 4B). The effects of the 12-h LD shifts on the temporal regulation
of dClock transcript levels are consistent with the direction of the phase shifts in the clock-controlled locomotor activity rhythm in D. melanogaster exposed to similar
photic treatments. Likewise, the per-tim
transcriptional-translational feedback loop is also perturbed by light
pulses in a manner that is consistent with the direction of the phase
shifts in behavioral rhythms (25, 30, 54). However, in stark
contrast to dClock expression, photic stimuli in the early
night delay the declining phase in per and tim
mRNA levels, whereas similar light treatments in the late night result
in an earlier rise in the levels of these mRNAs (references
25 and 30 and data not shown).
The results clearly indicate that photic signals elicit opposite
effects on the expression of dClock compared to
per and tim.
Recent studies have shown that the primary clock-specific response to
light in D. melanogaster is the photic-induced
degradation of TIM (22, 32, 54). A model that can account
for the time-of-day-specific response of the clock to light (i.e.,
phase delays in the early night and phase advances in the late night)
has been proposed (22, 25, 32, 54). Essentially, photic
stimuli in the early night are accompanied by delays in the nuclear
entry time of the PER-TIM complex. Conversely, exposure of flies to
light in the late night elicits the rapid degradation of nuclear TIM
and PER leading to the premature release of the autoinhibitory
mechanism and consequently an earlier accumulation of per
and tim transcripts. In the 16D:4L shift (Fig. 4A), the
accumulation and nuclear entry of PER and TIM is retarded whereas in
the 8D:20L shift, the levels of nuclear PER and TIM undergo more rapid
decreases (references 22, 25, 30, 32 and data not
shown). Thus, results from the 12-h LD shift experiments suggest that
PER, TIM, or the PER-TIM complex must be present in the nucleus to
stimulate expression of dClock. This contention is in
agreement with the observation that high levels of dClock
transcripts occur at times in a daily cycle when PER and TIM are
present in the nucleus. Nevertheless, we cannot exclude the formal
possibility that cytoplasmic PER and/or TIM decreases the stability of
dClock mRNA and that once they localize to the nucleus they
no longer modulate dClock expression. Finally, because the
response of dClock expression to changes in 12-h LD cycles
is rapid, it argues against the possibility that there is a very
extended delay between the activity of PER and TIM and the regulation
of dClock mRNA levels.
 |
DISCUSSION |
In this study, we characterized a novel D. melanogaster bHLH-PAS protein that shows very high homology to
mammalian CLOCK. Similar findings were recently reported by Allada et
al. (2) and Darlington et al. (9). Together,
these results provide further evidence that the components of
mammalian and Drosophila circadian clocks are highly
conserved. Nevertheless, our data highlight some dramatic differences
in the regulation and possible biochemical activities of putative clock
orthologs.
What might be the role of dCLOCK in pacemaker function? Because
it is a member of the bHLH-PAS superfamily and contains a polyglutamine repeat, it is almost certain that dCLOCK functions as a transcriptional activator. Indeed, a recent study showed that in
Drosophila tissue culture cells, expression of
dClock can drive the expression of a reporter gene flanked
on the 5' end with E-box elements present in either per or
tim (9). Moreover, a mutation in
dClock (Jrk) that eliminates much of the putative activation domain of this transcription factor results in flies with
low per and tim transcription, likely explaining
the arrhythmic phenotype of the homozygous mutant (2). The
putative in vivo partner of dCLOCK is likely the Drosophila
homolog of the bHLH-PAS protein BMAL1, termed CYC
(cycle) (2, 9). Importantly, a mutation
in cyc also leads to low transcription of per and
tim and to an arrhythmic mutant phenotype (36). A
similar situation has been shown in the mammalian system where mCLOCK
interacts with BMAL1 or its close relative MOP3 to activate
transcription through E-box elements such as those found in
per from either Drosophila or mammals (14,
21). Based on these recent findings, it is postulated that in
Drosophila, dCLOCK interacts with CYC to function as a
positive element in a circadian transcriptional loop by stimulating the
expression of per and tim (2, 9) (Fig.
5A). To generate the negative element in
the transcriptional feedback loop, PER, TIM, and/or the PER-TIM complex
(the latter possibility is shown in Fig. 5A) inhibits the activity of
the dCLOCK-CYC complex (9). Daily fluctuations in the
subcellular distribution and levels of PER and TIM are thought to
contribute to a properly timed delay in the ability of these two
proteins to inhibit dCLOCK-CYC activity resulting in a transcriptional feedback loop that is regulated in a circadian manner.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Model of how PER and TIM might regulate
dClock expression and function in the transcriptional
feedback loop. (A) dCLOCK (dCLK) and CYC interact to form a heterodimer
that binds E-box elements on per and tim 5'
regulatory sequences leading to transcriptional activation (2,
9). Increases in the levels of per and tim
transcripts are subsequently followed by a rise in the amounts of PER
and TIM proteins (not shown). After attaining a critical intracellular
concentration, PER and TIM interact to form a complex that enters the
nucleus (8, 13, 25, 37, 54), where PER, TIM, and/or the
PER-TIM complex (the latter case is shown) inhibit the transcriptional
activity of dCLOCK-CYC (9). In addition, nucleus-localized
PER, TIM and/or the PER-TIM complex stimulate the rhythmic expression
of dClock. Unlike per, tim, and
dClock, cyc is expressed constitutively
(36). (B) Three examples of how PER and TIM might lead to
the stimulation of dClock transcription. See Discussion for
more details. Gray oval, hypothetical transcription complex that
stimulates dClock expression; black oval, hypothetical
transcription complex that inhibits dClock expression.
|
|
Although the biochemical modes of action for PER and TIM in clock
function are not established, evidence accumulated over many years has
generated very strong evidence for the participation of these two
proteins in the inhibition of transcription. These include the
observations that (i) high-level expression of per from a
transgene containing a constitutive promoter is accompanied by the low
abundance of noncycling per RNA from the wild-type chromosomal copy (53); (ii) in the
per01 mutant, the levels of the circadianly
regulated Crg-1 and Dreg-5 transcripts are close
to their respective peak levels in wild-type flies (35, 50);
(iii) light pulses in the early and late night delay the declining
phase and advance the accumulating phase of per mRNA
(25), respectively (in sharp contrast to dClock
expression [Fig. 4]); (iv) failure to turn off the lights in a
standard 12-h LD cycle results in a delay of the PER-TIM dependent
autoinhibition (30); (v) in mammalian tissue culture cells,
forced expression of Drosophila PER inhibits the
transcriptional stimulatory activity of ARNT and AHR, two mammalian
bHLH-PAS proteins that form a functional heterodimer
(27); and most recently (vi) the demonstration that coexpression of PER and TIM can inhibit dCLOCK-dependent gene expression in tissue culture cells (9). Presumably, PER
and/or TIM inhibits its own transcription by interacting with one or more components of a dCLOCK-CYC-containing complex blocking its function (9). Because PER has a PAS domain but no bHLH
region, it is reasonable to expect that PER is the direct factor that interacts with either dCLOCK or CYC yielding nonfunctional
heterodimers. However, although TIM does not have a PAS domain, it can
nevertheless interact with the PAS domain of PER (13),
suggesting that TIM can also bind bHLH-PAS containing transcription
factors.
Yet our data indicate that PER and TIM are required for the high-level
expression of dClock (Fig. 3B). This finding is consistent with the observation that dClock RNA levels begin to
increase around the time when the PER-TIM complex begins to accumulate in the nucleus (ZT18-19) (8, 25) and decrease during the declining phase in the accumulation of nuclear PER and TIM (ZT2-8) (10, 22, 32, 53, 54). Although mutations that eliminate functional PER and TIM both lead to low levels of dClock RNA
(Fig. 3B), it is not clear that both clock proteins are actively
required in the nucleus to effect a transcriptional response. For
example, the nuclear localization of PER and TIM are dependent on each other (37, 52). A role for PER and/or TIM in the stimulation of gene expression is further supported by the effects of changing the
timing of light-dark cycles on the time course of dClock RNA (Fig. 4). Shifting the timing of a light-dark cycle such that the
nuclear entry time of the PER-TIM complex is delayed (25) resulted in a
concomitant delay in the accumulation of dClock mRNA
abundance (Fig. 4A). Consistently, exposure of flies to light in the
late night elicits the rapid degradation of TIM and premature disappearance of PER from the nucleus (22, 25, 32, 54), events that are
accompanied by an earlier decline in the levels of dCLOCK transcripts
(Fig. 4B). These results suggest that the presence of PER and/or TIM in
the nucleus is necessary for the high-level expression of
dClock. Taken together, our findings indicate that PER, TIM,
or the PER-TIM complex also functions as a positive element in a
circadian feedback loop. They also suggest an explanation for the
finding that in the per01 mutant, the levels of
per mRNA are approximately 50% of the peak value observed
in wild-type flies (18). If PER was functioning solely as a
negative regulator of its own transcription, a prediction is that in
the absence of PER, its mRNA levels should be similar to the wild-type
peak values. Notwithstanding this prediction, our findings suggest that
the levels of dCLOCK are much lower in the mutant background (Fig. 3B).
Thus, PER and TIM are acting as both negative regulators of dCLOCK
protein activity (9) (Fig. 5A) and as positive regulators of
dClock expression (Figs. 3B, 4, and 5A). We postulate that
the combination of no PER-TIM-mediated inhibition but lower dCLOCK
levels in per01 flies results in a dCLOCK-CYC
complex with an effective activity that is ca. 50% lower than that
present during the transcription of peak amounts of per and
tim in wild-type flies.
How might the apparently contradictory findings showing that PER and
TIM can act as both positive and negative elements in the regulation of
gene expression be reconciled? A speculative proposal is that PER or
TIM do not function to directly activate transcription but that during
their daily subcellular movement they shuttle a transcription factor(s)
from the cytoplasm to the nucleus where it can interact with specific
DNA elements on dClock to elicit an appropriate
transcriptional response (Fig. 5B). A second possibility is that PER
and/or TIM can act as both a dominant negative inhibitor (Fig. 5A) and
a coactivator (Fig. 5B) depending on the transcriptional complex it
interacts with. Finally, in keeping with its previously suggested
biochemical function, PER and/or TIM might abrogate the activity of a
transcriptional complex that inhibits dClock expression
(Fig. 5B), a mechanism that could phenocopy a stimulatory response.
This postulated mechanism is likely more difficult to resolve when
considering feedback loops. Our findings are also consistent with
posttranscriptional effects of PER and TIM, e.g., increasing the
stability of dClock transcripts. Future studies to
understand better the biochemical functions of PER and TIM in the
control of transcription in vivo will be required. For example, because
PER interacts with TIM via its PAS domain (13), it is not
clear if PER must first disengage from TIM prior to interacting with
other PAS-containing proteins. In any event, our results demonstrate
for the first time that PER and TIM are required for high-level gene
expression. It will be of interest to determine how widespread a role
PER and TIM play in the stimulation of gene expression.
The observation that dClock mRNA levels undergo daily cycles
(9) (Figs. 2 through 4) suggests that it might be a state variable in a circadian timekeeping mechanism (a state variable is a
clock component whose rhythmic changes in abundance or activity, rather than mere presence in the cell, is a necessary element of the
timekeeping mechanism [3]). Although it is not clear whether the cycling of dClock mRNA is reflected at the
protein level, the rhythmic expression of dClock
suggests that regulation of dCLOCK abundance is important for clock
function. Indeed, that the Drosophila timekeeping mechanism
is very sensitive to the levels of dCLOCK is strongly suggested by the
recent finding showing that reductions in the gene dosage of
dClock from two to one copy resulted in flies
manifesting activity rhythms that are approximately 1.5 to 2 h
longer than those observed in wild-type controls (2). At
this level of analysis, the Drosophila circadian pacemaker is more sensitive to the dosage of dClock than to that of
the two previously characterized state variables in this species, per and tim (2). Based on the
constitutive expression of cyc RNA (reference
36 and data not shown), fluctuations in the
abundance of dCLOCK could contribute to the production of a
transcriptional complex that regulates gene expression in a circadian
manner (Fig. 5A). However, fluctuations in the levels of one or both
components of the dCLOCK-CYC complex are not necessary to generate
cyclical transcriptional activity because temporal changes in the
activity of this complex could be regulated by oscillations in the
abundance of PER and/or TIM. A more complicated scenario in which other bHLH-PAS proteins that can compete for binding with either dCLOCK or
CYC are expressed in a temporally regulated manner can also be
envisaged.
Despite the high structural conservation of circadian clock components
in different species, there is remarkable diversity in the regulation
and possible biochemical function of putative clock orthologs. For
example, although a circadian pacemaker in the brains of silkmoths is
dependent on PER (40), the PER and TIM proteins in this
organism are apparently exclusively cytoplasmic (39), in
stark contrast to the situation in D. melanogaster, in
which the temporal regulation of PER and TIM nuclear entry is necessary
for clock functioning (8, 37, 52). In addition, light
elicits rapid increases in the levels of mouse per1
transcripts (1, 44, 45), whereas early changes in the levels
of per (or tim) RNA are not observed in
D. melanogaster (22, 25, 30). The
photosensitivity of mper-1 is very reminiscent of the rapid
increases in frq RNA levels by light pulses (7).
Although a TIM homolog in mammals has not been described and the
functional relationship of mper-1 and mper-2 (and
possibly other mper homologs) to Drosophila per
is not clear, these results suggest that putative circadian clock
orthologs in different species might be regulated in very different
manners. Here we show a striking example whereby dClock
transcripts show daily rhythms in contrast to the constitutive expression of mammalian Clock (48, 49). Thus, the
emerging picture seems to encompass the combination of the following
two extreme possibilities: (i) clock components that do not share structural similarity, such as the PER and FRQ proteins, can
nevertheless be similarly regulated and appear to have very similar
roles in clock function; and (ii) putative clock orthologs, such as
D. melanogaster and silkmoth PER, share extensive
structural features yet apparently have different biochemical modes of
action. Differences in how clock orthologs function within molecular
loops and how they are regulated by input pathways are likely to
reflect species-specific adaptations that confer biological advantages.
 |
ACKNOWLEDGMENTS |
This work was partially supported by an NIH grant to I.E.
K.B. and C.L. contributed equally to this study.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Biochemistry, CABM, 679 Hoes Ln., Piscataway, NJ 08854. Phone: (732) 235-5550. Fax: (732) 235-5318. E-mail:
edery{at}mbcl.rutgers.edu.
 |
REFERENCES |
| 1.
|
Albrecht, U.,
Z. S. Sun,
G. Eichele, and C. C. Lee.
1997.
A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light.
Cell
91:1055-1064[Medline].
|
| 2.
|
Allada, R.,
N. E. White,
W. V. So,
J. C. Hall, and M. Rosbash.
1998.
A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless.
Cell
93:791-804[Medline].
|
| 3.
|
Aronson, B. D.,
K. A. Johnson,
J. J. Loros, and J. C. Dunlap.
1994.
Negative feedback defining a circadian clock: autoregulation of the clock gene frequency.
Science
263:1578-1584[Abstract/Free Full Text].
|
| 4.
|
Citri, Y.,
H. V. Colot,
A. C. Jacquier,
Q. Yu,
J. C. Hall,
D. Baltimore, and M. Rosbash.
1987.
A family of unusually spliced biologically active transcripts encoded by a Drosophila clock gene.
Nature
326:42-47[Medline].
|
| 5.
|
Crews, S. T.
1998.
Control of cell lineage-specific development and transcription by bHLH-PAS proteins.
Genes Dev.
12:607-620[Free Full Text].
|
| 6.
|
Crosthwaite, S. K.,
J. C. Dunlap, and J. J. Loros.
1997.
Neurospora wc-1 and wc-2: transcription, photoresponses, and the origins of circadian rhythmicity.
Science
276:763-769[Abstract/Free Full Text].
|
| 7.
|
Crosthwaite, S. K.,
J. J. Loros, and J. C. Dunlap.
1995.
Light-induced resetting of a circadian clock is mediated by a rapid increase in frequency transcript.
Cell
81:1003-1012[Medline].
|
| 8.
|
Curtin, K. D.,
Z. J. Huang, and M. Rosbash.
1995.
Temporally regulated nuclear entry of the Drosophila period protein contributes to the circadian clock.
Neuron
14:365-372[Medline].
|
| 9.
|
Darlington, T. K.,
K. Wager-Smith,
M. F. Ceriani,
D. Staknis,
N. Gekakis,
T. D. L. Steeves,
C. J. Weitz,
J. S. Takahashi, and S. A. Kay.
1998.
Closing the circadian loop: CLOCK-induced transcription of its own inhibitors per and tim.
Science
280:1599-1603[Abstract/Free Full Text].
|
| 10.
|
Edery, I.,
L. J. Zwiebel,
M. E. Dembinska, and M. Rosbash.
1994.
Temporal phosphorylation of the Drosophila period protein.
Proc. Natl. Acad. Sci. USA
91:2260-2264[Abstract/Free Full Text].
|
| 11.
|
Ewer, J.,
B. Frisch,
M. J. Hamblen-Coyle,
M. Rosbash, and J. C. Hall.
1992.
Expression of the period clock gene within different cell types in the brain of Drosophila adults and mosaic analysis of these cells' influence on circadian behavioral rhythms.
J. Neurosci.
12:3321-3349[Abstract].
|
| 12.
|
Garceau, N. Y.,
Y. Liu,
J. J. Loros, and J. C. Dunlap.
1997.
Alternative initiation of translation and time-specific phosphorylation yield multiple forms of the essential clock protein FREQUENCY.
Cell
89:469-476[Medline].
|
| 13.
|
Gekakis, N.,
L. Saez,
A. M. Delahaye-Brown,
M. P. Myers,
A. Sehgal,
M. W. Young, and C. J. Weitz.
1995.
Isolation of timeless by PER protein interaction: defective interaction between timeless protein and long-period mutant PERL.
Science
270:811-815[Abstract/Free Full Text].
|
| 14.
|
Gekakis, N.,
D. Staknis,
H. B. Nguyen,
F. C. Davis,
L. D. Wilsbacher,
D. P. King,
J. S. Takahashi, and C. J. Weitz.
1998.
Role of the CLOCK protein in the mammalian circadian mechanism.
Science
280:1564-1569[Abstract/Free Full Text].
|
| 15.
|
Handler, A. M., and R. J. Konopka.
1979.
Transplantation of a circadian pacemaker in Drosophila.
Nature
279:236-238[Medline].
|
| 16.
|
Hao, H.,
D. L. Allen, and P. E. Hardin.
1997.
A circadian enhancer mediates PER-dependent mRNA cycling in Drosophila melanogaster.
Mol. Cell. Biol.
17:3687-3693[Abstract].
|
| 17.
|
Hardin, P. E.,
J. C. Hall, and M. Rosbash.
1992.
Circadian oscillations in period gene mRNA levels are transcriptionally regulated.
Proc. Natl. Acad. Sci. USA
89:11711-11715[Abstract/Free Full Text].
|
| 18.
|
Hardin, P. E.,
J. C. Hall, and M. Rosbash.
1990.
Feedback of the Drosophila period gene product on circadian cycling of its messenger RNA levels.
Nature
343:536-540[Medline].
|
| 19.
|
Hastings, J. W.,
B. Rusak, and Z. Boulos.
1991.
Circadian rhythms: the physiology of biological timing, p. 435-546.
In
C. L. Prosser (ed.), Neural and integrative animal physiology. Wiley-Liss, Inc., New York, N.Y.
|
| 20.
|
Hogenesch, J. B.,
W. K. Chan,
V. H. Jackiw,
R. C. Brown,
Y. Z. Gu,
M. Pray-Grant,
G. H. Perdew, and C. A. Bradfield.
1997.
Characterization of a subset of the basic-helix-loop-helix-PAS superfamily that interacts with components of the dioxin signaling pathway.
J. Biol. Chem.
272:8581-8593[Abstract/Free Full Text].
|
| 21.
|
Hogenesch, J. B.,
Y. Z. Gu,
S. Jain, and C. A. Bradfield.
1998.
The basic-helix-loop-helix-PAS orphan MOP3 forms transcriptionally active complexes with circadian and hypoxia factors.
Proc. Natl. Acad. Sci. USA
95:5474-5479[Abstract/Free Full Text].
|
| 22.
|
Hunter-Ensor, M.,
A. Ousley, and A. Sehgal.
1996.
Regulation of the Drosophila protein timeless suggests a mechanism for resetting the circadian clock by light.
Cell
84:677-685[Medline].
|
| 23.
|
King, D. P.,
Y. Zhao,
A. M. Sangoram,
L. D. Wilsbacher,
M. Tamaka,
M. P. Antoch,
T. D. L. Steeves,
M. H. Vitaterna,
J. M. Kornhauser,
P. L. Lowry,
F. W. Turek, and J. S. Takahashi.
1997.
Positional cloning of the mouse circadian Clock gene.
Cell
89:641-653[Medline].
|
| 24.
|
Konopka, R. J., and S. Benzer.
1971.
Clock mutants of Drosophila melanogaster.
Proc. Natl. Acad. Sci. USA
68:2112-2116[Abstract/Free Full Text].
|
| 25.
|
Lee, C.,
V. Parikh,
T. Itsukaichi,
K. Bae, and I. Edery.
1996.
Resetting the Drosophila clock by photic regulation of PER and a PER-TIM complex.
Science
271:1740-1744[Abstract].
|
| 26.
|
Levine, J. D.,
C. I. Casey,
D. D. Kalderon, and F. R. Jackson.
1994.
Altered circadian pacemaker functions and cyclic AMP rhythms in the Drosophila learning mutant dunce.
Neuron
13:967-974[Medline].
|
| 27.
|
Lindebro, M. C.,
L. Poellinger, and M. L. Whitelaw.
1995.
Protein-protein interaction via PAS domains: role of the PAS domain in positive and negative regulation of the bHLH/PAS dioxin receptor-Arnt transcription factor complex.
EMBO J.
14:3528-3539[Medline].
|
| 28.
|
Luo, C.,
J. J. Loros, and J. C. Dunlap.
1998.
Nuclear localization is required for function of the essential clock protein FRQ.
EMBO J.
17:1228-1235[Medline].
|
| 29.
|
Majercak, J.,
D. Kalderon, and I. Edery.
1997.
Drosophila melanogaster deficient in protein kinase A manifest behavior-specific arrhythmia but normal clock function.
Mol. Cell. Biol.
17:5915-5922[Abstract].
|
| 30.
|
Marrus, S. B.,
Z. Hongkui, and M. Rosbash.
1996.
Effect of constant light and circadian entrainment of perS flies: evidence for light-mediated delay of the negative feedback loop in Drosophila.
EMBO J.
15:6877-6886[Medline].
|
| 31.
|
McClung, C. R.,
B. A. Fox, and J. C. Dunlap.
1989.
The Neurospora clock gene frequency shares a sequence element with the Drosophila clock gene period.
Nature
339:558-562[Medline].
|
| 32.
|
Myers, M. P.,
K. Wager-Smith,
A. Rothenfluh-Hilfiker, and M. W. Young.
1996.
Light-induced degradation of TIMELESS and entrainment of the Drosophila circadian clock.
Science
271:1736-1740[Abstract].
|
| 33.
|
Myers, M. P.,
K. Wager-Smith,
C. S. Wesley,
M. W. Young, and A. Sehgal.
1995.
Positional cloning and sequence analysis of the Drosophila clock gene, timeless.
Science
270:805-808[Abstract/Free Full Text].
|
| 34.
|
Qiu, J., and P. E. Hardin.
1996.
per mRNA cycling is locked to lights-off under photoperiodic conditions that support circadian feedback loop function.
Mol. Cell. Biol.
16:4182-4188[Abstract].
|
| 35.
|
Rouyer, F.,
M. Rachidi,
C. Pikielny, and M. Rosbash.
1997.
A new gene encoding a putative transcription factor regulated by the Drosophila circadian clock.
EMBO J.
16:3944-3954[Medline].
|
| 36.
|
Rutila, J. E.,
V. Suri,
M. Le,
W. V. So,
M. Rosbash, and J. C. Hall.
1998.
CYCLE is a second bHLH-PAS clock protein essential for circadian rhythmicity and transcription of Drosophila period and timeless.
Cell
93:805-814[Medline].
|
| 37.
|
Saez, L., and M. W. Young.
1996.
Regulation of nuclear entry of the Drosophila clock proteins period and timeless.
Neuron
17:911-920[Medline].
|
| 38.
|
Sassone-Corsi, P.
1998.
Molecular clocks: mastering time by gene regulation.
Nature
392:871-874[Medline].
|
| 39.
|
Sauman, I., and S. M. Reppert.
1996.
Circadian clock neurons in the silkmoth Antheraea pernyi: novel mechanisms of Period protein regulation.
Neuron
17:889-900[Medline].
|
| 40.
|
Sauman, I.,
T. Tsai,
A. L. Roca, and S. M. Reppert.
1996.
Period protein is necessary for circadian control of egg hatching behavior in the silkmoth Antheraea pernyi.
Neuron
17:901-909[Medline].
|
| 41.
|
Saunders, D. S.,
S. W. Gillanders, and R. D. Lewis.
1994.
Light pulse phase response curves for the locomoter activity rhythm in period mutants.
J. Insect Physiol.
40:957-968.
|
| 42.
|
Sehgal, A.,
J. L. Price,
B. Man, and M. W. Young.
1994.
Loss of circadian behavioral rhythms and per RNA oscillations in the Drosophila mutant timeless.
Science
263:1603-1606[Abstract/Free Full Text].
|
| 43.
|
Sehgal, A.,
A. Rothenfluh-Hilfiker,
M. Hunter-Ensor,
Y. Chen,
M. P. Myers, and M. W. Young.
1995.
Rhythmic expression of timeless: a basis for promoting circadian cycles in period gene autoregulation.
Science
270:808-810[Abstract/Free Full Text].
|
| 44.
|
Shearman, L. P.,
M. J. Zylka,
D. R. Weaver,
L. F. Kolakowski, Jr., and S. M. Reppert.
1997.
Two period homologs: circadian expression and photic regulation in the suprachiasmatic nuclei.
Neuron
19:1261-1269[Medline].
|
| 45.
|
Shigeyoshi, Y.,
K. Taguchi,
S. Yamamoto,
S. Takekida,
L. Yan,
H. Tei,
T. Moriya,
S. Shibata,
J. J. Loros,
J. C. Dunlap, and H. Okamura.
1997.
Light-induced resetting of a mammalian circadian clock is associated with rapid induction of the mPer1 transcript.
Cell
91:1043-1053[Medline].
|
| 46.
|
Sidote, D.,
J. Majercak,
V. Parikh, and I. Edery.
1998.
Differential effects of light and heat on the Drosophila circadian clock proteins PER and TIM.
Mol. Cell. Biol.
18:2004-2013[Abstract/Free Full Text].
|
| 47.
|
So, W. V., and M. Rosbash.
1997.
Post-transcriptional regulation contributes to Drosophila clock gene mRNA cycling.
EMBO J.
16:7146-7155[Medline].
|
| 48.
|
Sun, Z. S.,
U. Albrecht,
O. Zhuchenko,
J. Bailey,
G. Eichele, and C. C. Lee.
1997.
RIGUI, a putative mammalian ortholog of the Drosophila period gene.
Cell
90:1003-1011[Medline].
|
| 49.
|
Tei, H.,
H. Okamura,
Y. Shigeyoshi,
C. Fukuhara,
R. Ozawa,
M. Hirose, and Y. Sakaki.
1997.
Circadian oscillation of a mammalian homologue of the Drosophila period gene.
Nature
389:512-516[Medline].
|
| 50.
|
Van Gelder, R. N., and M. A. Krasnow.
1996.
A novel circadianly expressed Drosophila melanogaster gene dependent on the period gene for its rhythmic expression.
EMBO J.
15:1625-1631[Medline].
|
| 51.
|
Vitaterna, M. H.,
D. P. King,
A. M. Chang,
J. M. Kornhauser,
P. L. Lowrey,
J. D. McDonald,
W. F. Dove,
L. H. Pinto,
F. W. Turek, and J. S. Takahashi.
1994.
Mutagenesis and mapping of a mouse gene, Clock, essential for circadian behavior.
Science
264:719-725[Abstract/Free Full Text].
|
| 52.
|
Vosshall, L. B.,
J. L. Price,
A. Sehgal,
L. Saez, and M. W. Young.
1994.
Block in nuclear localization of period protein by a second clock mutation, timeless.
Science
263:1606-1609[Abstract/Free Full Text].
|
| 53.
|
Zeng, H.,
P. E. Hardin, and M. Rosbash.
1994.
Constitutive overexpression of the Drosophila period protein inhibits period mRNA cycling.
EMBO J.
13:3590-3598[Medline].
|
| 54.
|
Zeng, H.,
Z. Qian,
M. P. Myers, and M. Rosbash.
1996.
A light-entrainment mechanism for the Drosophila circadian clock.
Nature
380:129-135[Medline].
|
| 55.
|
Zhou, Y. D.,
M. Barnard,
H. Tian,
X. Li,
H. Z. Ring,
U. Francke,
J. Shelton,
J. Richardson,
D. W. Russell, and S. L. McKnight.
1997.
Molecular characterization of two mammalian bHLH-PAS domain proteins selectively expressed in the central nervous system.
Proc. Natl. Acad. Sci. USA
94:713-718[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 1998, p. 6142-6151, Vol. 18, No. 10
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Li, Q., Lang, X.
(2008). Internal Noise-Sustained Circadian Rhythms in a Drosophila Model. Biophys. J
94: 1983-1994
[Abstract]
[Full Text]
-
Zheng, X., Sehgal, A.
(2008). Probing the Relative Importance of Molecular Oscillations in the Circadian Clock. Genetics
178: 1147-1155
[Abstract]
[Full Text]
-
Dunlap, J. C.
(2008). Salad Days in the Rhythms Trade. Genetics
178: 1-13
[Full Text]
-
Kim, E. Y., Ko, H. W., Yu, W., Hardin, P. E., Edery, I.
(2007). A DOUBLETIME Kinase Binding Domain on the Drosophila PERIOD Protein Is Essential for Its Hyperphosphorylation, Transcriptional Repression, and Circadian Clock Function. Mol. Cell. Biol.
27: 5014-5028
[Abstract]
[Full Text]
-
Yoshii, T., Fujii, K., Tomioka, K.
(2007). Induction of Drosophila Behavioral and Molecular Circadian Rhythms by Temperature Steps in Constant Light. J Biol Rhythms
22: 103-114
[Abstract]
-
Benito, J., Zheng, H., Hardin, P. E.
(2007). PDP1{varepsilon} Functions Downstream of the Circadian Oscillator to Mediate Behavioral Rhythms. J. Neurosci.
27: 2539-2547
[Abstract]
[Full Text]
-
Bae, K., Edery, I.
(2006). Regulating a Circadian Clock's Period, Phase and Amplitude by Phosphorylation: Insights from Drosophila. J Biochem
140: 609-617
[Abstract]
[Full Text]
-
Brunner, M., Schafmeier, T.
(2006). Transcriptional and post-transcriptional regulation of the circadian clock of cyanobacteria and Neurospora.. Genes Dev.
20: 1061-1074
[Abstract]
[Full Text]
-
Kim, E. Y., Edery, I.
(2006). Balance between DBT/CKI{varepsilon} kinase and protein phosphatase activities regulate phosphorylation and stability of Drosophila CLOCK protein. Proc. Natl. Acad. Sci. USA
103: 6178-6183
[Abstract]
[Full Text]
-
Yu, W., Zheng, H., Houl, J. H., Dauwalder, B., Hardin, P. E.
(2006). PER-dependent rhythms in CLK phosphorylation and E-box binding regulate circadian transcription.. Genes Dev.
20: 723-733
[Abstract]
[Full Text]
-
Wagner, A.
(2005). Circuit topology and the evolution of robustness in two-gene circadian oscillators. Proc. Natl. Acad. Sci. USA
102: 11775-11780
[Abstract]
[Full Text]
-
Hardin, P. E.
(2004). Transcription Regulation within the Circadian Clock: The E-box and Beyond. J Biol Rhythms
19: 348-360
[Abstract]
-
Smolen, P., Hardin, P. E., Lo, B. S., Baxter, D. A., Byrne, J. H.
(2004). Simulation of Drosophila Circadian Oscillations, Mutations, and Light Responses by a Model with VRI, PDP-1, and CLK. Biophys. J
86: 2786-2802
[Abstract]
[Full Text]
-
Preuss, F., Fan, J.-Y., Kalive, M., Bao, S., Schuenemann, E., Bjes, E. S., Price, J. L.
(2004). Drosophila doubletime Mutations Which either Shorten or Lengthen the Period of Circadian Rhythms Decrease the Protein Kinase Activity of Casein Kinase I. Mol. Cell. Biol.
24: 886-898
[Abstract]
[Full Text]
-
Ashmore, L. J., Sathyanarayanan, S., Silvestre, D. W., Emerson, M. M., Schotland, P., Sehgal, A.
(2003). Novel Insights into the Regulation of the Timeless Protein. J. Neurosci.
23: 7810-7819
[Abstract]
[Full Text]
-
Leloup, J.-C., Goldbeter, A.
(2003). Toward a detailed computational model for the mammalian circadian clock. Proc. Natl. Acad. Sci. USA
100: 7051-7056
[Abstract]
[Full Text]
-
Smolen, P., Baxter, D. A., Byrne, J. H.
(2002). A Reduced Model Clarifies the Role of Feedback Loops and Time Delays in the Drosophila Circadian Oscillator. Biophys. J
83: 2349-2359
[Abstract]
[Full Text]
-
Hayasaka, N., LaRue, S. I., Green, C. B.
(2002). In Vivo Disruption of Xenopus CLOCK in the Retinal Photoreceptor Cells Abolishes Circadian Melatonin Rhythmicity without Affecting Its Production Levels. J. Neurosci.
22: 1600-1607
[Abstract]
[Full Text]
-
Stempfl, T., Vogel, M., Szabo, G., Wulbeck, C., Liu, J., Hall, J. C., Stanewsky, R.
(2002). Identification of Circadian-Clock-Regulated Enhancers and Genes of Drosophila melanogaster by Transposon Mobilization and Luciferase Reporting of Cyclical Gene Expression. Genetics
160: 571-593
[Abstract]
[Full Text]
-
Glossop, N. R. J., Hardin, P. E.
(2002). Central and peripheral circadian oscillator mechanisms in flies and mammals. J. Cell Sci.
115: 3369-3377
[Abstract]
[Full Text]
-
Smolen, P., Baxter, D. A., Byrne, J. H.
(2001). Modeling Circadian Oscillations with Interlocking Positive and Negative Feedback Loops. J. Neurosci.
21: 6644-6656
[Abstract]
[Full Text]
-
Pando, M. P., Pinchak, A. B., Cermakian, N., Sassone-Corsi, P.
(2001). A cell-based system that recapitulates the dynamic light-dependent regulation of the vertebrate clock. Proc. Natl. Acad. Sci. USA
10.1073/pnas.181228598v1
[Abstract]
[Full Text]
-
Collett, M. A., Dunlap, J. C., Loros, J. J.
(2001). Circadian Clock-Specific Roles for the Light Response Protein WHITE COLLAR-2. Mol. Cell. Biol.
21: 2619-2628
[Abstract]
[Full Text]
-
McDonald, M. J., Rosbash, M., Emery, P.
(2001). Wild-Type Circadian Rhythmicity Is Dependent on Closely Spaced E Boxes in the Drosophila timeless Promoter. Mol. Cell. Biol.
21: 1207-1217
[Abstract]
[Full Text]
-
Martinek, S., Young, M. W.
(2000). Specific Genetic Interference With Behavioral Rhythms in Drosophila by Expression of Inverted Repeats. Genetics
156: 1717-1725
[Abstract]
[Full Text]
-
So, W. V., Sarov-Blat, L., Kotarski, C. K., McDonald, M. J., Allada, R., Rosbash, M.
(2000). takeout, a Novel Drosophila Gene under Circadian Clock Transcriptional Regulation. Mol. Cell. Biol.
20: 6935-6944
[Abstract]
[Full Text]
-
EDERY, I.
(2000). Circadian rhythms in a nutshell. Physiol. Genomics
3: 59-74