Previous Article | Next Article 
Molecular and Cellular Biology, November 1998, p. 6178-6190, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Two Independent Internal Ribosome Entry Sites Are Involved in
Translation Initiation of Vascular Endothelial Growth Factor
mRNA
Isabelle
Huez,
Laurent
Créancier,
Sylvie
Audigier,
Marie-Claire
Gensac,
Anne-Catherine
Prats, and
Hervé
Prats*
INSERM U397, Endocrinologie et Communication
Cellulaire, Institut Fédératif de Recherche Louis
Bugnard, CHU Rangueil, 31403 Toulouse cedex 04, France
Received 3 April 1998/Returned for modification 2 June
1998/Accepted 4 August 1998
 |
ABSTRACT |
The mRNA of vascular endothelial growth factor (VEGF), the major
angiogenic growth factor, contains an unusually long (1,038 nucleotides) and structured 5' untranslated region (UTR). According to
the classical translation initiation model of ribosome scanning, such a
5' UTR is expected to be a strong translation inhibitor. In
vitro and bicistronic strategies were used to show that the VEGF mRNA
translation was cap independent and occurred by an internal ribosome
entry process. For the first time, we demonstrate that two
independent internal ribosome entry sites (IRESs) are present in this
5' UTR. IRES A is located within the 300 nucleotides upstream from the
AUG start codon. RNA secondary structure prediction and site-directed mutagenesis allowed the identification of a
49-nucleotide structural domain (D4) essential to IRES A activity. UV
cross-linking experiments revealed that IRES A activity was correlated
with binding of a 100-kDa protein to the D4 domain. IRES B is located in the first half of the 5' UTR. An element between nucleotides 379 and
483 is required for its activity. Immunoprecipitation experiments
demonstrated that a main IRES B-bound protein was the polypyrimidine
tract binding protein (PTB), a well-known regulator of picornavirus
IRESs. However, we showed that binding of the PTB on IRES B does not
seem to be correlated with its activity. Evidence is provided of an
original cumulative effect of two IRESs, probably controlled by
different factors, to promote an efficient initiation of translation at
the same AUG codon.
 |
INTRODUCTION |
The vascular endothelial growth
factor (VEGF) is a potent endothelial cell mitogen that plays a crucial
role in the regulation of both physiologic and pathologic angiogenesis
(10, 44). VEGF is involved not only in embryogenic
development and differentiation of the vascular system, in wound
healing, and in reproductive function but also in pathologic angiogenic
processes such as proliferative retinopathies, tumor growth, arthritis,
and psoriasis (10).
Numerous studies have been devoted to understanding the expression
regulation of this factor, especially at the transcriptional level. A
wide range of cytokines or oncogenic proteins, including interleukins
1
(31) and 6 (8), insulin-like growth factor 1 (IGF-1) (14), tumor growth factor
(TGF-
)
(5), c-Src (36), v-Raf (15), and Ras
(46), and oxygen tension have been shown to regulate VEGF
gene transcription (48). VEGF may also be
posttranscriptionally regulated. The VEGF pre-mRNA undergoes alternative splicing which generates four polypeptide isoforms of 121, 165, 189, and 206 amino acids (11), the functions of which
have not yet been fully defined. VEGF mRNA stability is also
influenced by hypoxic conditions or by IGF-1 expression (49, 57). Finally, posttranslational modifications of VEGF isoforms, including plasmin and urokinase proteolysis or glycosylation, have been
described (11, 43).
Surprisingly, very little is known about the possible translational
control of VEGF messenger except for a stimulatory effect on VEGF
translation in CHO cells overexpressing the cap binding protein
eukaryotic initiation factor 4E (eIF4E) (25). However, the
VEGF mRNA presents unusual features also found in other RNAs of
viral origin or transcribed from cellular proliferation regulator genes, such as the fibroblast growth factor 2 (FGF-2) gene, the platelet-derived growth factor (PDGF) gene, or the c-myc
proto-oncogene. The 5' untranslated region (UTR) of the mRNA
is unusually long, as the transcription starting point is located 1,038 nucleotides (nt) upstream from the AUG initiation codon and heavily
structured due to a high percentage of G and C residues. The 5' UTR
region also contains three noncanonical upstream CUG codons in frame with the initiator AUG codon. All of these elements make the use of a
conventional ribosome scanning model for translation initiation very
difficult (26).
A cap-independent mechanism involving an internal ribosome entry site
(IRES) has been identified in picornavirus messengers, which are
uncapped and present a long 5' UTR (20, 41). The presence of
an IRES has also been reported for many viral (cardiovirus, rhinovirus, and aphthovirus) (21) and some cellular
human (Bip, FGF-2, IGF-II, eIF4G, PDGF, and c-Myc) (2, 13, 33, 37, 50, 51, 53) messengers and in Drosophila antennapedia
and ultrabithorax mRNAs (39, 59). The IRESs discovered
so far differ in their primary sequences but show similarities in their secondary structures which appear to be crucial to IRES function (21, 28). In several picornaviruses, the internal entry
process has been shown to require cellular factors including the
polypyrimidine tract binding protein (PTB) (1), which is
also involved in the nuclear splicing regulatory pathway (40,
56).
We show here that the mRNA of the major angiogenic factor is
translated by an internal ribosome entry process. Furthermore, we
demonstrate that the VEGF 5' mRNA leader contains two independent IRESs which are able to promote efficient translation at the AUG start
codon. The patterns of cellular proteins binding to the two IRESs are
clearly different. These data suggest that different factors could
control the activities of these IRESs.
 |
MATERIALS AND METHODS |
Plasmid constructions.
The VEGF cDNAs and the DNA fragment
corresponding to 5' UTR of the messenger were kindly provided by J. Abraham (52) and cloned into a pKS-derived plasmid. PCR was
performed with sense oligonucleotide
5'AAATCTAGAATTCGCGGAGGCTTGGGGCA3' and antisense oligonucleotide 5'GGTATCGATTGGATGGCAGTAG3' to construct a
translational fusion between VEGF and chloramphenicol acetyltransferase
(CAT). The amplified fragment extending from positions 1 to 1205 (corresponding to the 5' UTR and the 167 nt downstream from the AUG
codon) was cloned in a previously described pSCT-derived vector
(45) upstream from the CAT coding sequence, under the
control of cytomegalovirus (CMV) and T7 promoters. This chimeric
construct, called pVC, was expected to encode one VEGF-CAT protein of
32 kDa.
A hairpin (
G =
40 kcal/mol) (described in
reference 53) was introduced into the pVC construct
between the promoters and the 5' end of VEGF cDNA, leading to the pHVC
construct. Bicistronic vectors were constructed from the previously
described pSCTCAT plasmid, which contains the CAT gene downstream from
the CMV promoter (45). The IVS2
intron was removed from
this plasmid, and a synthetic intron, obtained from plasmid pRLCMV
(Promega), was added just downstream from the CMV promoter. A second
CAT gene was then introduced downstream from the intron. This
intermediate vector was called pCC. All or part of the 5' UTR leader of
VEGF plus 167 nt of the coding sequence was then cloned in the
intercistronic region between the two CAT genes. The bicistronic vector
containing the entire 5' UTR (nt 1 to 1205), designated pCVC, was
expected to encode two CAT proteins of 24 and 32 kDa. The
above-described hairpin (
G =
40 kcal/mol) was
introduced into pCVC between the CMV promoter and the first cistron.
This construct was designated pHCVC. Different deletions of the VEGF 5'
UTR were performed. Removal of the first 475 nt in the 5' UTR (up to
the BamHI site) resulted in plasmid pCVC1, removal of the
first 654 nt (up to the XmnI site) resulted in pCVC2,
removal of the first 745 nt (to Nhe site) yielded pCVC3,
removal of the first 846 nt (to the BanII site) resulted in
pCVC4, and removal of the first 917 nt (up to the Sma site)
gave pCVC5. We then constructed another bicistronic plasmid to
determine the 3' border of the IRES. This plasmid contained the entire
VEGF 5' UTR, in which the AUG codon of VEGF was directly fused to a
chimeric CAT gene (fCAT) resulting from translational fusion of part of
the nucleolin gene with the CAT gene (pSVNC82) (9). This
chimeric fCAT gene was used to discriminate between the products of the
two CAT cistrons encoded by this bicistronic vector during Western
immunoblotting. This 5' UTR-fCAT fusion was obtained by PCR
amplification using oligonucleotides T7 (matching sequence upstream
from the 5' UTR), and 5'
AAACCTAGGGCCCAAGTTCATGGTTTCGGAG 3' (matching nt 1029 to 1046) on plasmid pVC. This PCR fragment was digested at the
ApaI site (underlined sequence) and fused to fCAT in the pCC
vector deleted from the second CAT cistron. This CAT-VEGF 5' UTR (nt 1 to 1046)-fCAT-containing plasmid was called pCVC0. Several deletions
were then made from this plasmid in the VEGF 5' UTR. The plasmid was
called pCVC30 when the first 745 nt were deleted, pCVC60 when nt 654 (XmnI site) to 917 (Sma site) were removed,
pCVC70 when nt 554 (NaeI site) to 1013 (NaeI site) were deleted, pCVC90 when nt 1 to 91 (AgeI site) as
well as nt 554 to 1013 were removed, and pCVC80 when nt 332 (SacI site) to 1013 (NaeI site) were deleted.
We also constructed a set of bicistronic vectors containing two
different reporter cistrons, i.e., the renilla and firefly
genes coding
for luciferase enzyme, designated LUCr and LUCf,
respectively.
LUCr was cloned from plasmid pRLCMV (Promega), whereas
the
LUCf gene was obtained from plasmid pGL3LUCf (Promega). For
technical
convenience, the
XbaI and
NarI sites present in
the
5' end of the LUCf cDNA were mutated by a single base pair change
using complementary oligonucleotides (5'
CTAGTGGATAGAATGGTGCCGGGCCTTTCTTTATGTTTTTGGCGTCTTCCATACCA
3' and
5' AGCTTGGTATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCACCATTCTATCCA
3').
The backbone of this new bicistronic vector was the same
as that
of pCVC. The full 5' UTR (nt 1 to 1046) was cloned between
the two LUC
genes; this construct was called pRVL1. We also cloned
nt 745 to 1046 in the intercistronic region and called the construct
pRVL2.
A deletion was performed in pRVL2 in which nt 848 (
BanII
site) to 918 (
Sma site) were replaced with complementary
oligonucleotides
5' CATGGACAGGCCCTGGC 3' and 5'
CCGGGCCAGGGCCTGTCCATGAGCC 3'. This
construct was called
pRVL2

D4. Another deletion plasmid (pRVL3)
constructed from pRVL2
consisted of a deletion of nt 917 (
Sma site) to 1013 (
NaeI site). pRVL4 contained a 5' UTR fragment limited
by nt
801 to 1046 in the intercistronic space. This fragment was
obtained by
PCR from plasmid pCVCO, using oligonucleotide 5'
TTT
GGATCCGAAGGAAGAGGAGAGGGGGC
3' (matching residues
798 to 817) and a reverse one located in
the CAT gene (5'
GCAACTGACTGAAATGCC 3'). This amplified fragment
was then
restricted at the
ApaI (see description of pCVCO above)
and
BamHI (underlined) sites to obtain only the corresponding
VEGF sequence. pRVL6 was obtained after cloning of the 5' UTR
fragment
(nt 91 to 554 and 1013 to 1039) contained in plasmid
pCVC90 between the
two LUC genes. pRVL7, pRVL8, pRVL9, and pRVL10
were constructed from
pRVL6 after deletion of nucleotides 483
(
PvuI site) to 1013 (
NaeI site), 379 (
BssHII site) to 1013, 332
(
SacI site) to 1013, and 189 (
DraI site) to 1013, respectively.
pRVL11 contained nt 134 to 483 and 1013 to 1039. This
fragment
was obtained from plasmid pRVL6 by PCR using
oligonucleotide 5'
AAA
GAATTCAGATCTTTGATATTCATTGATCCGGG 3'
(matching residues 134
to 155) and a reverse one located in the
LUCf gene. This amplified
fragment was then restricted by the
EcoRI (underlined) and the
PvuI sites and
recloned in the intercistronic space. pRVL12 was
constructed in the
same way, using oligonucleotide 5'
AAA
GAATTCAGATCTTGAATCGGGCCGACGGCT
3' (matching
residues 241 to 260), and thus contained nt 241 to
483 and 1013 to 1039 between the two LUC genes. pRVL13 consisted
of a deletion of
nucleotides 379 (
BssHII site) to 1013 (
NaeI site)
from pRVL12.
Monocistronic vectors derived from plasmid pSCTCAT in which VEGF 5' UTR
fragments had been introduced upstream from the CAT
gene were
constructed for cross-linking experiments. pVC30 contained
nt 745 to
1046 upstream from the CAT gene. We also cloned the
mutated 5' UTR
fragment contained in pRVL2

D4 (nt 745 to 858 and
907 to 1046)
upstream from the CAT gene. This plasmid was called
pVC30

D4. pVC1
was a pVC-derived plasmid in which nt 1 to 475
were deleted. Probes C
and D (see Fig.
8A) are derived from plasmids
pSKV3 and pKSV4,
pKS-derived vectors in which were inserted the
VEGF 5' UTR regions
contained in plasmids pRVL11 (nt 134 to 483
and 1013 to 1046) and
pRVL12 (nt 241 to 483 to 1013 to 1046),
respectively.
Two new plasmids, pVC80 and pVC90, were constructed for in vitro
translation by inserting the fragments of the VEGF 5' UTR
contained in
plasmids pCVC80 and pCVC90 (nt 1 to 332 and 1013
to 1046 and nt 91 to
554 and 1013 to 1046) into the pSCTCAT vector
upstream from the CAT
gene. We also constructed vector pVC5, a
derivative from pVC in which
nt 1 to 917 were deleted.
Probes transcribed from two pKS-derived vectors, called pKSV1 and
pKSV2, were used for the RNase protection assays. We inserted
nt 1 to
745 (bordered by
EcoRI and
NheI sites) into
plasmid pKS
digested at the
XbaI and
EcoRI sites
in pKSV1. In pKSV2, we inserted
nt 1 to 1046 (bordered by the
XbaI and
ApaI sites) into plasmid
pKS digested by
XbaI and
ApaI.
In vitro translation.
Plasmids pVC, pVC90, pVC80, pVC30, and
pVC30
D4 were linearized downstream from the 3' end of the CAT coding
sequence at the BglII site. pSCT11A (53) was
linearized downstream from the 3' end of the FGF-2 coding sequence at
the HindIII site. Capped or uncapped RNAs were generated
in vitro, using the T7 mMessage mMachine kit (Ambion) according to the
manufacturer's instructions, with or without adding
m7GpppG (0.5 mM) to the transcription reaction. RNA
transcripts were quantified by absorbance at 260 nm and ethidium
bromide staining on an agarose gel, which also allowed verification of
their integrity. In vitro translation in rabbit reticulocyte lysate
(RRL; Promega) was performed as previously described (45),
in the presence of [35S]methionine (Amersham).
Translation products were analyzed by polyacrylamide gel
electrophoresis (PAGE) in a sodium dodecyl sulfate (SDS)-12.5%
polyacrylamide gel (45); the dried gels were scanned with a
PhosphorImager apparatus (Molecular Dynamics), and quantification of
the bands was performed with Imagequant software.
DNA transfection and Western immunoblotting.
COS-7 monkey
cells were transfected with Fugene-6 transfection reagent (Boehringer)
according to manufacturer's instructions or by the DEAE-dextran method
as described previously (45). Forty-eight hours after
transfection, either (i) the cells were scraped in phosphate-buffered
saline (PBS) and the pellets were resuspended in 1% SDS solution and
sonicated or (ii) the cells were lysed in 1 ml of Tri-Reagent
(Euromedex). Following the latter method and after total RNA extraction
(see below), the proteins were precipitated with 1 volume of
isopropanol. The protein pellet was then washed five times in 2 ml of a
0.3 M guanidine hydrochloride-95% ethanol buffer and once in 2 ml of
ethanol. The protein pellet was then heated to 65°C for 20 min and
resuspended in 1% SDS solution. Total proteins were quantified by the
bicinchoninic acid assay (Pierce) (absorbance at 562 nm), and 10 µg
of proteins from each cell lysate was used for Western immunoblotting.
In summary, lysates were heated for 2 min at 95°C in SDS- and
dithiothreitol (DTT)-containing sample buffer, separated in a 12.5%
polyacrylamide gel, and transferred onto a nitrocellulose membrane. CAT
proteins were immunodetected with rabbit polyclonal anti-CAT antibodies
prepared in the laboratory (1/10,000 dilution). Antibodies were
detected with an enhanced chemiluminescence kit (Amersham).
Cellular RNA purification.
Total cellular RNAs were prepared
by the Tri-Reagent method (Euromedex), derived from the guanidinium
thiocyanate procedure (7). A total of 5 × 106 transfected cells were scraped, centrifuged, and lysed
in 1 ml of Tri-Reagent. RNA was extracted after addition of 0.2 ml of chloroform and precipitated with isopropanol. After an ethanol wash and
precipitation, the RNA was quantified by measuring the absorbance at
260 nm and checked for integrity by electrophoresis on an agarose gel
and ethidium bromide staining.
RNase mapping.
A complementary-strand RNA probe was
generated in vitro by T7 or T3 RNA polymerase (Promega) according to
manufacturer's instructions, using a linearized DNA template and in
the presence of 50 µCi of [
-32P]UTP. Probe A was
transcribed by using T3 polymerase from plasmid pKSV2 linearized at the
XbaI site. Probe C was transcribed by using T3 polymerase
from plasmid pKSV2 linearized at the BamHI site. Probe B was
transcribed by using T7 polymerase from plasmid pKSV1 linearized at the
EcoRI site. 32P-labeled RNA was purified by
using the RNaid kit (Bio 101). The RNase protection experiments were
performed with an RPAII kit (Ambion) according to the manufacturer's
instructions. A 10-µg aliquot of total cellular RNA and a large
excess (2 × 106 cpm) of probe were precipitated with
ethanol; 10 µg of yeast RNA can be added to the total RNA before
precipitation to increase the size of the RNA pellet. All experiments
described were tested with and without addition of RNA. As a control
experiment, total RNA samples were incubated 15 min at 37°C in the
presence of 10 U of RNase-free DNase 1 prior to the precipitation in
order to avoid DNA contamination. The pellet was resuspended in 20 µl
of hybridization buffer, heated at 90°C for 4 min, and incubated at
42°C for 14 h. Then 200 µl of RNase digestion buffer
containing 20 U of RNase T1 and 1 µg of RNase A were
added, and the reaction mixture was incubated for 30 min at 37°C; 300 µl of inhibitor RNase buffer and 10 µg of carrier yeast RNA were
then added, and the reaction mixture was precipitated at
20°C for
20 min. The pellet was resuspended in 8 µl of gel loading buffer,
denatured, and fractionated on a 5% acrylamide-8 M urea gel at 200 V
for 1.5 h. The gel was then fixed, dried, and autoradiographed.
Control experiments showed that all probes described, used alone or
only with yeast RNA, were totally digested after RNase mix treatment.
UV cross-linking assay and immunoprecipitation.
Cytoplasmic
extracts from COS-7 cells were prepared as previously described
(53). Confluent cells were scraped in PBS and centrifuged.
The cell pellet was resuspended in lysis buffer (10 mM NaCl, 10 mM
Tris-HCl [pH 7.4], 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM DTT),
and frozen-thawed three times. The extract was centrifuged at
12,000 × g for 10 min, and the supernatant (S10) was
brought to 5% (vol/vol) glycerol and frozen in aliquots at
80°C.
Probes A (nt 1 to 1121) and B (nt 1 to 475) (see Fig.
6A) were
transcribed by using T7 polymerase from plasmid pVC linearized
at the
NcoI site and
BamHI sites, respectively. Probe C
(nt 475
to 1121; Fig.
6A) was transcribed by using T7 polymerase from
plasmid pVC1 linearized with
NcoI. Probes D (nt 745 to 1046)
and
E (nt 745 to 858 and 907 to 1046) (Fig.
6A) were transcribed by
using T7 polymerase from plasmids pVC30 and pVC30

D4 linearized
with
Bsp120.1. Probes A (nt 91 to 554 and 1013 to 1046) and B
(nt
91 to 189) (Fig.
8A) were transcribed from plasmid pVC90 linearized
with
Bsp120.1 and
DraI, respectively. Probes C
(nt 134 to 483)
and D (nt 241 to 483) (Fig.
8A) were transcribed from
plasmids
pKSV3 and pKSV4 linearized with
NaeI.
32P-labeled RNA probes (1 × 10
6 to
1.5 × 10
6 cpm) were incubated with 6 µg of S10
extract, preincubated or not with 2.5 µg of
calf liver tRNA
(Boehringer Mannheim) for 15 min at 30°C, in buffer
containing 5 mM
HEPES (pH 7.5), 25 mM KCl, 2 mM MgCl
2, 3.8% glycerol,
0.2 mM DTT, and 1.5 mM ATP in a final volume of 10 µl at 30°C
for 15 min (
34). Samples were transferred to ice and irradiated
with a UV Stratalinker (Stratagene) by being fixed 10 cm from
the bulbs
and routinely irradiated with 400,000 µJ/cm
2 at 254 nm;
2.5 µg of calf liver tRNA was then added to calibrate
the RNase
digestion when no prior incubation of the S10 extract
with tRNA had
been performed. The samples were then treated with
a mix of RNase ONE
(5 U; Promega) and 2.5 µg of RNase A at 37°C
for 30 min and, when
indicated, with proteinase K (Sigma) at 37°C
for 20 min at a final
concentration of 1 mg/ml. PAGE sample buffer
was added, and the samples
were heated for 2 min at 95°C and loaded
on an SDS-10 or 12.5%
polyacrylamide gel. The gel was fixed in
30% methanol-10% acetic
acid for 30 min, dried, and autoradiographed.
The cross-linked proteins were immunoprecipitated with Pansorbin as
follows. Ten microliters of the cross-linked
32P-labeled
sample (see below) was diluted to 150 µl in PBS-Nonidet
P-40 (NP-40)
buffer (1× PBS, 50 mM NaF, 2 mM EDTA, 2 mM EGTA,
0.05% NP-40) and
precleared by incubation with 50 µl of Pansorbin
for 10 min at room
temperature (RT). The supernatant was incubated
for 30 min at RT with 5 µl of anti-PTB antibody (kindly provided
by J. G. Patton)
(
40) and then for 30 min at RT with 50 µl of
Pansorbin.
After five washes in HEPES-NP-40 buffer (150 mM NaCl,
15 mM HEPES [pH
7.4], 1 mM EDTA [pH 7.4], 0.5% NP-40), the samples
were analyzed by
PAGE (10 or 12.5% gel) as described above.
Dual luciferase assay.
LUCf and LUCr activities were
measured by using the Dual-Luciferase reporter assay system (Promega).
Transfected COS-7 cell plates (60 by 15 mm) or 24-well dishes were
rinsed twice with PBS, scraped, and homogenized in 400 µl of lysis
reagent provided with the kit 24 to 48 h after transfection. The
lysate was cleared by a 2-min centrifugation at 4°C. Chemiluminescent
signals were measured in a luminometer (Berthold) equipped with
automatic injectors. A 20-µl volume of extract was incubated with 100 µl of Luciferase Assay Reagent II (Promega) for 2 s, and LUCf
activity was measured for a period of 15 s; 100 µl of Stop and
Glo buffer (Promega), stopping the firefly enzymatic reaction and
containing the substrate for LUCr enzyme, was then injected.
Luminescence corresponding to LUCr activity was measured for 15 s
starting 3 s after injection.
 |
RESULTS |
Identification of an IRES in the 5' UTR of the VEGF mRNA.
Two alternative strategies involving hairpin-containing
monocistronic vectors or bicistronic vectors were used to study
whether VEGF expression was translationally regulated by
an internal ribosome entry process. The first approach had been
successful for identification of Moloney murine leukemia virus IRES
(55), and the second had been used to identify IRESs in
several viral and cellular mRNAs (22, 33, 41).
DNA plasmids were designed to contain the 1,038 nt of the VEGF 5' UTR
and the first 167 nt of its coding sequence fused in
frame with the CAT
coding sequence (Fig.
1A). The predicted
size
of the chimeric VEGF-CAT protein encoded by this vector was 32
kDa. In the monocistronic plasmid (Fig.
1A, construct A [pVC]),
this
5' UTR-VEGF-CAT sequence was controlled by the CMV and T7
promoters. In
a second construct, a stable (
G =

40 kcal/mol)
hairpin was added downstream from the promoters to impair the
cap-dependent ribosome scanning (construct B [pHVC]). This latter
construct was expected to encode a 32-kDa VEGF-CAT protein only
if
there was an IRES in the VEGF mRNA leader.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of an IRES in the VEGF mRNA 5' UTR.
(A) Schematic representation of the chimeric constructs used for
transfection experiments. pVC (construct A) corresponds to the VEGF-CAT
fusion in which nt 1 to 1205 of the VEGF cDNA were fused to the CAT
coding sequence (see Materials and Methods). This fusion gives rise to
a chimeric VEGF-CAT protein of 32 kDa. pHVC (construct B) is derived
from pVC and carries an additional 5' hairpin ( G = 40 kcal/mol) downstream from the CMV promoter. pCVC (construct C) is
a bicistronic vector containing the CAT gene as a first cistron
upstream from the VEGF-CAT fusion in the pVC construct. pHCVC
(construct D), derived from pCVC, contains a 5' hairpin
( G = 40 kcal/mol) upstream from the first CAT
cistron. (B) The constructs depicted in panel A were transiently
transfected in COS-7 cells, and their expression was analyzed by
Western immunoblotting using an anti-CAT antibody. The amount of
transfected cell protein extract loaded on each lane was adjusted to
the quantity of the mono- and bicistronic mRNAs present in each
extract. The control (Ct) lane corresponds to untransfected COS-7
cells. The positions of CAT and VEGF-CAT proteins are indicated by
arrows.
|
|
Two bicistronic constructs were also derived from the pVC construct by
subcloning the CAT coding sequence upstream from the
5' UTR-VEGF-CAT
sequence (Fig.
1A, construct C [pCVC]) and adding
a 5' hairpin
structure upstream from the CAT first cistron (construct
D [pHCVC]).
A 24-kDa CAT protein and a 32-kDa VEGF-CAT protein
were expected to be
translated from the first and second cistrons,
respectively, if the
VEGF mRNA 5' UTR contained an IRES.
The four constructs were separately transfected into COS-7 cells, and
the translation products were analyzed by Western immunoblotting
using
an anti-CAT antibody (Fig.
1B). The amount of mRNA encoded
by the
transfected constructs was analyzed in each extract by
RNase protection
assay, and the signals were quantified with a
PhosphorImager
(data not shown). The amounts of transfected COS-7
cell protein
extracts involved in the Western blotting experiment
were adjusted to
the quantity of mono- and bicistronic mRNAs present
in each
extract. A 32-kDa VEGF-CAT protein was detected as a major
band with
all four constructs, while a minor band band, probably
corresponding to
a proteolysis product of the 32-kDa protein,
was observed at 28 kDa
(Fig.
1B, lanes A to D). The protein was
expressed from the
hairpin-containing monocistronic vector pHVC
(lane B) as well as from
the bicistronic vector (lanes C and D),
even though the level of
expression was lower than that obtained
from the monocistronic vector
pVC. This phenomenon had been observed
previously with FGF-2 and
Moloney murine leukemia virus mRNAs
(
53,
55) and can be
explained by a contribution of cap-dependent
initiation in addition to
the internal ribosome entry process
in these vectors. Interestingly,
the second cistron (VEGF-CAT)
was more efficiently expressed than the
first cistron (CAT) from
the bicistronic pCVC vector (lane C).
Furthermore the presence
of a 5' hairpin in the bicistronic construct
strongly decreased
CAT translation without affecting that of the
chimeric VEGF-CAT
protein, thereby confirming that expression of the
second cistron
was not due to a reinitiation event (lane D). These
results revealed
the presence of a very efficient IRES in the VEGF
mRNA leader
sequence.
Localization of IRES A in the VEGF mRNA 5' UTR.
A number of additional bicistronic constructs containing
shortened intercistronic UTRs, with or without a 5' hairpin (Fig. 2A), were designed to more precisely
localize the IRES structure in the VEGF mRNA 5' UTR. Identical
amounts of each DNA construct were used to transfect COS-7 cells, and
the level of protein synthesis was determined as described above. The
same quantity of COS-7 cell protein extracts was loaded in all lanes.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Mapping of the IRES by progressive deletions in the VEGF
mRNA 5' UTR. (A) Schematic representation of the different
deletions of the 5' leader performed in the bicistronic vectors pCVC
and pHCVC. Only the pHCVC series is represented here. (B) Western
immunoblotting was performed as described for Fig. 1B after
transfection of COS-7 cells with the constructs detailed in panel A. The presence or absence of a hairpin in the vector, as well as the name
of the vector, is indicated above each lane. The same quantity of COS-7
cell protein extract was loaded in all lanes. Positions of the CAT and
VEGF-CAT proteins are indicated with arrows. (C) Representation of two
bicistronic vectors containing another VEGF-CAT fusion in which nt 1 to
1046 (including the AUG codon) of the VEGF 5' leader are fused to the
chimeric fCAT gene resulting from the translational fusion of part of
the nucleolin gene with the CAT gene (9). These two plasmids
were transfected in COS-7 cells, and the extracts were analyzed as
described for Fig. 1B. The positions of the CAT and fCAT proteins are
indicated with arrows.
|
|
As expected, the first cistron CAT was expressed in cells transfected
with the different constructs lacking the 5' hairpin
(Fig.
2B, lanes A,
C, E, G, I, and K), whereas its expression
was strongly diminished in
cells transfected with plasmids containing
the 5' hairpin (lanes B, D,
F, H, J, and L). Expression of the
VEGF-CAT second cistron was detected
for deletions of the first
475, 654, and 745 nt of the VEGF 5' UTR
(lanes C to H, respectively)
and was not affected by the presence of a
5' hairpin. In contrast,
no expression of VEGF-CAT was observed with a
shorter intercistronic
sequence starting at position 846 or 917 of the
leader 5' end.
These results indicate that the 101-nt-long fragment delimited by
positions 745 and 846 (between positions

293 and

192 upstream
from
the AUG codon) is required for the formation of a functional
IRES.
Hereafter this fragment will be referred to as the IRES
A 5'
region. Although the 293 nt upstream from the AUG codon seem
sufficient
for IRES function, Fig.
2B shows that the translation
efficiency of the
VEGF-CAT mRNA decreased with shortening of the
5' UTR
(compare lanes A to H). This finding suggests that sequences
located at
different positions in the 5' UTR are required for
optimal IRES
efficiency.
Two additional constructs were made to determine the involvement of the
VEGF coding sequence located downstream from the AUG
codon in the
internal entry process. They consisted of fusion
of the full VEGF 5'
UTR or its 3' 293 bp up to and including the
AUG codon with the
chimeric fCAT gene and composed of 560 neutral
nucleotides of the
nucleolin coding sequence in frame with the
CAT gene. This chimeric
fCAT reporter gene was used to discriminate
the products of the two CAT
cistrons in Western immunoblotting.
The results showed an efficient
expression of the fCAT protein
from both constructs (Fig.
2C),
revealing that the first 167 coding
nucleotides of the VEGF coding
region, present in the plasmids
used previously (Fig.
2A), were not
required for efficient internal
entry of the ribosomes on the
messenger.
Altogether, these data clearly localize an IRES within the 293 nt
upstream from the AUG start codon of VEGF mRNA. This IRES
will
hereafter be called IRES A.
Verification of the bicistronic mRNA integrity in transfected
COS-7 cells.
Bicistronic RNA integrity was assessed by RNase
protection assays (see Materials and Methods) to rule out the
possibility that the observed VEGF-CAT protein could be expressed
from unexpected monocistronic mRNA generated by a cleavage or a
cryptic promoter located in the VEGF 5' UTR. The protection experiments
were performed with total RNA from COS-7 cells transfected with
bicistronic or monocistronic constructs containing either the complete
leader sequence, a deletion of the first 475 nt, or a deletion of the last 293 nt (Fig. 3A). Three probes, A,
B, and C, with expected sizes of 1054, 748, and 572 nt were used for
hybridization with transfected COS-7 total RNA before RNase digestion;
they were expected to produce protected fragments of 1,017, 696, and
535 nt, respectively, after RNase digestion. The data presented in Fig.
3B show that the protected fragments are unique and of the expected
sizes, thus demonstrating that the intercistronic region is full size
in the bicistronic mRNA.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Verification of the integrity of the bicistronic
mRNA by RNase protection assay. (A) Schematic representation of
monocistronic vector pVC (construct 1) and bicistronic vectors pCVC and
pCVC1 (constructs 2 and 3) used to generate RNA templates. The regions
A', B', and C', protected by the three antisense RNA probes A, B, and
C, are indicated. The RNA probes A, B, and C are slightly longer than
the protected fragments because of the presence of additional
nucleotides in the polylinker regions of the plasmids used as templates
for the probes (see Materials and Methods). (B) Vectors shown in panel
A were transfected in COS-7 cells. Total mRNAs were purified and
analyzed by RNase A and T1 protection (see Materials and
Methods), using the RNA probes A (1054 nt), B (748 nt), and C (572 nt),
complementary to nt 1 to 1046, 1 to 745, and 475 to 1046, respectively.
The first lane corresponds to a mix of the three probes alone, without
RNase treatment. The RNA templates and probes used are indicated at the
bottom. The fragments protected by the probes A, B, and C are notated
as A' (1,017 nt), B' (690 nt), and C' (535 nt), respectively.
|
|
Characterization of the structural features of IRES A.
Figure
4 shows the secondary structures,
predicted by the Zuker procedure (6), of the entire or
293-bp fragment of the 5' UTR (nt 745 to 1038) demonstrated to be
sufficient for IRES function (Fig. 2B). Extended base pairing is
apparent all along this UTR fragment, bringing the AUG codon in the
vicinity of the IRES A 5' region (nt 745 to 846). A stem-loop
structure, called D5, bearing an unpaired GNRA (where N is C, G, A, or
U and R is G or A; in this case GUGA) sequence is located in the first
half of the leader between nt 416 and 434. This motif was shown to be
common to picornavirus IRES and implicated in aphthovirus IRES function
(32). Involvement of this predicted structure in the VEGF
IRES activity is discussed later.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
IRES A secondary predicted structures and sequence
conservation in mammals. (A) Secondary structure of the complete VEGF
mRNA 5' UTR predicted by the ESSA folding program (6).
The 5' and 3' ends of the sequence corresponding to nt 1 and 1047, respectively, are indicated. Nucleotide positions and the IRES A
predicted domains D1 to D4 are also indicated. D5 corresponds to a
stem-loop structure bearing an unpaired loop-located GNRA sequence. (B)
Secondary predicted structure of the IRES A. Nucleotide positions and
the four domains D1 to D4 are indicated. The 5' and 3' ends of the
region analyzed correspond to nt 745 to 1052, respectively. (C)
Alignment of the cDNA sequence of the region corresponding to human
IRES A with bovine, rat, and mouse VEGF cDNA sequences. The conserved
regions are boxed. The D4 domain is indicated. Relative positions of
the nucleotides aligned from the transcription start point of rat,
human, and mouse cDNAs are indicated. The complete 5' UTR of bovine
VEGF mRNA is not known.
|
|
Interestingly, two predicted structured domains (D3 and D4, from nt 917 to 1013 and 858 to 907, respectively) are present
downstream from the
IRES A 5' region (Fig.
4B). Furthermore, a
DNA sequence comparison of
the human (
29), bovine (
52), rat
(
30),
and mouse (
47) 3' ends of the VEGF mRNA 5' UTR revealed
several regions highly conserved in these species, particularly
the
region corresponding to the D4 domain (Fig.
4C). This led
us to study
the potential role of these evolutionary conserved
domains in IRES
function.
cis elements involved in IRES A activity.
The predicted structural data shown in Fig. 4 were used to design
new deletions for further characterization of the VEGF IRES A. A new
bicistronic vector was produced in which the LUCr gene was subcloned as
the first cistron and the (LUCf) gene was subcloned as the second
cistron (Fig. 5) to improve sensitivity
and quantification of the assay. The VEGF complete or deleted 5' UTR
(constructs pRVL1, pRVL2, and pRVL5), as well as new deleted fragments
corresponding to removal of predicted domains D4 and D3 and the first
56 nt of IRES A (constructs pRVL2
D4, pRVL3, and pRVL4,
respectively), were introduced into the intercistronic region. Either a
hairpin (
G =
40 kcal/mol) or the
encephalomyocarditis virus (EMCV) IRES (35) was introduced
between the LUCr and LUCf genes as controls (construct pRHL or pREL,
respectively). These plasmids were transfected in COS-7 cells as
described above. The ratio between the activities of the two luciferase
enzymes observed in the cell extracts was calculated and compared with
the data obtained with the negative control construct pRHL (Fig. 5).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Characterization of IRES A cis-acting
elements. Schematic drawing of the bicistronic vectors containing the
LUCr gene as the first cistron, all or part of the VEGF mRNA leader
sequence in the intercistronic region, and the LUCf gene as the second
cistron. Construct pREL contains the EMCV IRES in the intercistronic
region (positive control); construct pRHL contains a hairpin
( G = 40 kcal/mol) in the intercistronic region
(negative control). These plasmids were transfected in COS-7 cells, and
luciferase activities were measured as described in Materials and
Methods. On the right, the histogram and corresponding values represent
the ratio between the LUCf/LUCr activities obtained with each construct
and that obtained with pRHL. Each value represents the average of at
least four independent transfection experiments.
|
|
Clearly the full-size VEGF 5' UTR induced LUCf expression comparable to
that induced by the EMCV IRES (pRVL1 and pREL), whereas
the
745-nt-deleted 5' UTR containing the IRES A 5' region (pRVL2)
resulted in a reduced relative activity. These results were in
agreement with those obtained in assays using the bicistronic
CAT/VEGF-CAT mRNA (Fig.
2B), thereby ruling out any interference
of
the reporter system with the IRES activity.
Interestingly, removal of the D4 domain strongly affected translation
of the LUCf gene (pRVL2

D4), while deletion of the D3
domain (pRVL3)
resulted in only a 50% decrease in IRES activity
compared to that
obtained with the pRVL2 construct. In comparison
to pRVL2 construct
efficiency, deletion of the 5' 56 nt of IRES
A resulted in a 60%
decrease of LUCf expression (pRVL4), indicating
a very low IRES
activity, albeit higher than that obtained with
the D4 deletion. This
result confirmed the observation made in
Fig.
2. These results
indicated that the IRES A 5' end (nt 745
to 801) and the D4 domain (nt
858 to 907) are necessary for the
IRES function. Both elements probably
form the core of the VEGF
IRES, whereas the D3 domain (nt 917 to 1013)
seems also to play
a role in IRES activity.
Identification of cellular factors bound to VEGF 5' UTR and to IRES
A.
UV cross-linking experiments were performed with COS-7 cell
extracts and different 32P-labeled RNA probes corresponding
to either the complete 5' UTR or deleted fragments of the 5' UTR (Fig.
6A) to identify cellular factors
interacting with the VEGF 5' UTR and particularly with IRES A. As shown
in Fig. 6B, the protein pattern differed according to the RNA probe
used. The complete leader was able to bind at least nine proteins (Fig.
6B, lane A). Most of these proteins were able to bind to probe B,
corresponding to the upstream part of the leader (lane B). In contrast,
probes C, D, and E bound only a small number of proteins. Three major
proteins migrating at 120, 100, and 85 kDa were detected with probes C
and D, corresponding to the downstream part of the leader and both
containing the IRES (lanes C and D, bands a, b, and c). Finally probe
E, in which the D4 domain was deleted, was able to bind the p85 and the
p120 proteins but not p100 (lane E). These results showed a correlation between the cross-linking of p100 to RNA and IRES activity and suggested a potential role of the 100-kDa protein in IRES function.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
UV cross-linking of COS-7 cell proteins on the VEGF
mRNA 5' UTR. (A) Drawing of the different 32P-labeled
RNA probes, obtained from T7 in vitro transcription and corresponding
to the complete or parts of the VEGF 5' UTR mRNA. Relative
positions of the 5' and 3' ends of each probe are indicated.
(B) UV cross-linking experiments performed with probes A to E. S10
COS-7 cell extracts were incubated with 106 cpm of the
different probes followed by UV irradiation and treatment with RNases A
and ONE (see Materials and Methods). The control (Ct) lane corresponds
to proteinase K treatment of sample loaded in the first lane.
Size markers are indicated. (C) 32P-labeled probes
corresponding to VEGF probe A (complete 5' UTR) and to EMCV IRES
were cross-linked with proteins extracted from S10 COS-7 cells, and the
complex was immunoprecipitated with an anti-PTB antibody. The samples
were analyzed before (CL) and after (I) immunoprecipitation. The use of
a VEGF or EMCV probe is indicated above the lanes. PTB migration is
indicated with an arrow.
|
|
With regard to the proteins cross-linked to the upstream part of the
VEGF 5' UTR, one of the major bound proteins had an apparent
molecular
mass of 60 kDa (Fig.
6B, lanes A and B, band P), close
to that of PTB,
a well-known protein involved in the activities
of several picornavirus
IRESs. This prompted us to immunoprecipitate
the proteins cross-linked
to the first half of the leader (probe
B) with an anti-PTB antibody
(Fig.
6C). An EMCV IRES probe was
used as a positive control. As
shown in Fig.
6C, PTB could be
clearly detected following
immunoprecipitation of both VEGF and
the EMCV RNA cross-linked proteins
with the anti-PTB antibody.
The VEGF mRNA 5' UTR contains two distinct IRESs.
It is
clear from data presented in Fig. 2B and 5 that the complete 5' UTR
behaved as a more efficient IRES than the IRES A fragment containing nt
745 to 1046. Furthermore, deletion of the D4 domain in the full-length
5' UTR led to a 30% reduced internal entry activity compared to that
observed with the corresponding complete leader (data not shown),
whereas the same deletion in the IRES A context almost abolished IRES
activity. We also showed above that the binding of PTB occurred in the
5' part of the VEGF mRNA 5' UTR. These data led us to investigate
the presence of a second IRES in the 5' part of the UTR.
To test this hypothesis, four new bicistronic plasmids containing
different portions of the upstream half of the VEGF 5' UTR
were
designed (Fig.
7A, left) and used to
transfect COS-7 cells,
and the cell extracts were analyzed by Western
immunoblotting
with an anti-CAT antibody. It was apparent from these
experiments
that three VEGF mRNA leader fragments corresponding to
nt 1 to
654, 1 to 554, and 91 to 554, respectively, were able to
promote
translation of the second cistron fCAT (Fig.
7A, right, lanes
B, C, and E). fCAT expression was, however, less
efficient with
these three constructs (lacking the IRES A) than
with the complete
leader (lane A). In contrast, the fragment extending
from positions
1 to 332 exhibited very low IRES activity (Fig.
7A, lane
D).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
Mapping of IRES B. (A) Schematic drawing of the
bicistronic constructs containing the complete or truncated VEGF 5' UTR
between the first CAT cistron and the second chimeric fCAT cistron
(depicted in Fig. 2C). The 5' and 3' boundaries of the deletions are
indicated. Western immunoblotting was performed (right) as described
for Fig. 1B after transfection of COS-7 cells with plasmids A to E. The
CAT and fCAT proteins are shown by arrows. The control (Ct) lane
corresponds to untransfected cells. (B) Representation of bicistronic
vectors containing a stable hairpin structure upstream from the LUCr
gene (first cistron), fragments of the VEGF mRNA leader sequence in
the intercistronic region, and the LUCf gene as the second cistron. The
5' and 3' boundaries of the deletions are indicated. These plasmids
were transfected into COS-7 cells, and luciferase activities measured
as described in Materials and Methods. On the right, the histogram and
corresponding values represent the LUCf/LUCr activity ratio obtained
with each construct and that obtained with pRHL. Each value represents
the average of at least four independent transfection experiments.
|
|
Taken together, these results suggest that a second IRES is present
between positions 91 and 554 of the VEGF 5' UTR. To obtain
a more
precise and more quantitative characterization of this
IRES, we
subcloned a series of segments of the 5' half of the
VEGF UTR into the
LUCr-LUCf vector depicted in Fig.
5. COS-7 cell
transfection and
luciferase activity measurements were performed
as described above.
With regard to the IRES 3' border deletions,
it was clearly apparent
that nt 91 to 483 (pRVL7) retained most
of the activity of the
reference fragment characterized by the
results in Fig.
7A (Fig.
7B, pRVL6, nt 91 to 554) and can be defined
as IRES B. In
contrast, the fragments containing nt 91 to 379,
91 to 332, and 91 to
189 (pRVL8, -9 and -10) had no significant
IRES activity. These results
suggest that a 104-bp fragment located
between nt 379 and 483 is
strictly necessary for IRES B activity
since its deletion abolished the
internal entry process. Deletions
performed in the 5' border (pRVL11,
-12, and -13) showed that
the two fragments containing nt 134 to 483 or
241 to 483 retained
about 50% of IRES B activity (Fig.
7B, pRVL11 and
-12). It was
thus apparent that the sequence limited by nt 91 and 134 played
a role in IRES B function. These data enabled us to conclude
that
IRES B was located in a 392-nt-long fragment between nt 91 and
483 and that a 104-nt segment at the 3' end of this fragment was
strictly
necessary for IRES activity. It should be noted that
this 104-nt
segment contains the D5 predicted stem-loop structure
bearing a GNRA
sequence in the loop (Fig.
4A). We can thus hypothesize
a possible role
of the GNRA motif in a cellular IRES function.
PTB binding to IRES B is independent of IRES efficiency.
As we
had shown that PTB was the main protein bound to the upstream half of
the VEGF RNA leader sequence (Fig. 6), we were prompted to see whether
PTB interacted with IRES B. As for Fig. 6, this was investigated by UV
cross-linking and immunoprecipitation experiments using several
fragments of the 5' part of the leader with or without IRES activity as
probes; the EMCV IRES was used as a control (Fig.
8). It was clearly apparent from these
experiments that the RNA segments containing nt 91 to 189 and nt 134 to
483 were able to bind PTB with the same efficiency as the segment extending from nt 91 to 554 (Fig. 8, probes and lanes A, B, and C). In
contrast, the fragment extending from nt 241 to nt 483 was no longer
able to bind this protein (Fig. 8, probe and lane D). PTB binding to
probe C was confirmed by immunoprecipitation with anti-PTB antibody
(Fig. 8B, lane C).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 8.
UV cross-linking of COS-7 cell proteins on IRES B. (A)
Top, drawing of the different 32P-labeled RNA probes,
obtained from T7 in vitro transcription and corresponding to the
complete or parts of the IRES B sequence. Relative positions of the 5'
and 3' ends of each probe are indicated. Bottom, UV cross-linking
experiments performed with probes A to D and a probe corresponding to
the EMCV IRES (first lane). S10 COS-7 cell extracts were incubated with
1.5 × 106 cpm of the different probes followed by UV
irradiation and treatment with RNases A and ONE (see Materials and
Methods). Size markers are indicated. (B) Immunoprecipitation with an
anti-PTB antibody of COS-7 cell protein extract cross-linked to EMCV
and VEGF probes C and D (lane 1, 2, and 4). Lane 3 corresponds to
a control immunoprecipitation of cell extract and probe C without
previous cross-linking. UV cross-linking or absence of
cross-linking before immunoprecipitation is indicated by a plus or
a minus sign, respectively, below each lane.
|
|
These results permitted the localization of a PTB binding site between
nt 134 and 189, a region which had no influence on
IRES activity (Fig.
7B, pRVL11 and -12). Furthermore, PTB bound
to fragments B and C but
not to fragment D (Fig.
8), while internal
entry activity was
maintained in fragments C and D but was not
detected in fragment B
(Fig.
7B). This evidenced an absence of
correlation between PTB binding
and IRES B activity in our experimental
conditions.
Activities of the two IRESs in RRL.
The ability of both IRESs
to promote cap-independent translation in vitro was analyzed by using
monocistronic RNA containing different fragments of the VEGF 5' UTR
fused to the CAT gene. A cap-dependent control which corresponded
to the leader deleted FGF-2 mRNA (53) was included.
Equal amounts of uncapped and capped monocistronic mRNAs were
transcribed in vitro for each construct and assayed for translation in
RRL (Fig. 9B). Cap independence was
evaluated by calculating the ratio of CAT expression obtained from
uncapped versus capped mRNA (NC/C ratio) (Fig. 9B and C).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 9.
Activities of IRES A and IRES B in vitro. (A) Schematic
drawing of the monocistronic vectors used as T7 polymerase templates.
The in vitro transcriptions were performed in the presence or absence
of a cap structure. In constructs A and F, the translation product is
the chimeric VEGF-CAT protein depicted in Fig. 1A. In constructs B to
E, the translation product is the CAT protein. In construct G, the
translation product is the FGF-2 protein. (B) Identical quantities of
the different capped or noncapped mRNAs were translated in RRL. The
presence or absence of a cap structure in the mRNA is indicated by
a plus or minus sign, respectively, below each lane, together with the
construct used. (C) The lanes in panel B were quantified with
PhosphorImager. The histogram indicates the ratio of the translation
efficiency observed in uncapped RNA versus capped mRNA. The line
corresponds to cap-independent translation initiation (ratio of 1). The
experiment reported here is representative of five independent
experiments.
|
|
Interestingly, the 1,038-nt-long leader showed an NC/C ratio of 1.25, indicating mostly cap independence compared to the cap-dependent
control (Fig.
9B and C; compare constructs A and G). Cap independence
in the various deleted constructs was conferred by the fragment
from nt
91 to 554, with an NC/C ratio of 0.9 (Fig.
8, construct
B), whereas
translation became cap dependent when the leader contained
nt 1 to 332 (Fig.
8, construct C). Furthermore, the segment containing
nt 745 to
1038 was also able to confer cap independence to translation,
with an
NC/C ratio of 1, whereas deletion of the D4 domain led
to cap-dependent
translation of the CAT gene (Fig.
8, constructs
D and E). As expected,
translation was cap dependent when the
leader was restricted to nt 917 to 1038 (construct F).
These results show that two distinct mRNA segments are able to
promote cap-independent translation in vitro. These segments
correspond
to IRESs A and B characterized in transfected COS-7
cells.
These different approaches enabled us to conclude that the VEGF
mRNA leader contains two distinct IRESs which can promote
cap-independent translation from AUG 1039 in both RRL and COS-7
transfected cells.
 |
DISCUSSION |
In this study, we demonstrate that the synthesis of VEGF, the
major angiogenic factor, occurs through an internal ribosome entry site
process. This observation, together with the previous discovery of an
IRES in the mRNA of another important angiogenic factor, FGF-2
(53), suggests an involvement of IRES-dependent translation
in the control of angiogenesis. It is also clearly apparent from our
results that two IRESs are present in the 5' UTR of the VEGF mRNA
and that they bind some different factors. This novel and interesting
feature of VEGF mRNA suggests that VEGF expression is controlled at
the translational level, probably in a specific way, by each of the two
IRESs.
IRES A is located in a 293-nt-long fragment just upstream from the AUG
codon (nt 745 to 1038 from the mRNA 5' end [Fig. 2]). Analysis of
the cis elements involved in the activity of this IRES
revealed a need for at least two elements: the 5' part of the
IRES-containing fragment (IRES A 5' region, between nt 745 and
846) and the D4 domain (nt 858 to 907 [Fig. 5]). The D4 loop, containing nucleotides AGACA, differs from the sequences of the loop
consensus motifs ACCC (21) and GNRA or CAAA (18,
32) conserved in picornavirus IRESs. The data from Fig. 5 also
show a detectable but more marginal influence of the D3 domain (nt 917 to 1013) in IRES function. According to its AUG proximal location, this
IRES seems to allow ribosome binding and translation initiation without scanning. This is reminiscent of the so-called type II IRESs
described in the literature and including the cardiovirus IRESs
(21).
IRES B is located in a 392-nt segment between nt 91 and 483 from the
mRNA 5' end and exhibits optimal activity in the presence of nt 91 to 134 (Fig. 7). A 104-bp sequence limited by nt 379 and 483 is
strictly necessary for IRES B activity. This sequence contains a
predicted stem-loop structure bearing a GNRA motif, defined as an
element shared by all picornavirus IRES (21, 32). The
observation of such a predicted structure also suggests the presence of
an IRES in this region. Although involvement of the motif would need to
be confirmed, it seems that VEGF mRNA could be an example of
cellular IRES the activity of which would require this unpaired GNRA
sequence. Strikingly the 3' border of this IRES was located more than
500 nt from the AUG codon (position 1039). This is reminiscent of the
picornavirus type I IRESs, in which the 3' border is located quite far
upstream from the start codon (1). However, in IRES B, the
spacer region, which does contain a second IRES, is longer than that of
the picornavirus type I IRES, which is usually about 150 nt in length.
Insertion of AUG codons in the poliovirus type I IRES, upstream from
the authentic start codon, has demonstrated that ribosome scanning occurs from the IRES 3' border to reach the AUG codon (17). It cannot be excluded that this could be the case for VEGF IRES B,
although the length of the spacer region and its predicted stable
structure (Fig. 4) would argue against such a hypothesis. Alternatively, two other hypotheses can be proposed. One possibility is
that the spacer region allows a jump between the IRES B and the AUG.
Such a mechanism has been described for adenovirus (60) and
cauliflower mosaic virus (12). In the case of adenovirus, the 5' part of the mRNA leader allows cap-independent translation to occur, while the 3' part is required for the jump. This hypothesis cannot be ruled out here. Another possibility is that the 5' part of
the leader, although it contains an independent IRES, can also behave as an enhancer of IRES A. In this case, the two IRESs would together form a single super-IRES structure. Further investigations are
necessary before we can choose between these hypotheses.
However, the existence of two independent IRESs is supported by their
very different UV cross-linked protein patterns (Fig. 6).
Interestingly, very few proteins are UV cross-linked to IRES A (Fig.
6). One, p100, seems to bind to the D4 domain, suggesting a potential
role of this protein in IRES function.
Among the proteins which are bound to the 5' half of the VEGF mRNA
leader (Fig. 6), most, including the PTB, are bound on the 5' part of
IRES B (Fig. 8A). These experiments did not permit detection of protein
whose binding was correlated to IRES B activity. This one-dimensional
analysis was not, however, sufficient for conclusions to be drawn in an
absence of IRES-specific protein, as different proteins may have the
same electrophoretic mobility. Several proteins were bound to a
polypyrimidine-rich sequence located between nt 189 and 241 (Fig. 8A;
compare lanes B, C, and D). PTB is the major protein bound to the 5'
part of the RNA leader, and its binding site was mapped to between nt
134 and 189, which suggests that it recognizes the short UUUC sequence
present around position 172 of the leader, which corresponds to the PTB
consensus binding site described for viral IRESs (19, 42).
According to the predicted structural data, this consensus site is
located in a paired sequence. However, whereas PTB plays a crucial role in the function of EMCV and foot-and-mouth disease IRESs (4, 23,
38), its binding to IRES B does not seem to be correlated to IRES
activity. These data are consistent with several reports showing that
PTB is not the universal internal entry factor and that its binding to
RNA does not necessarily imply its requirement for IRES function
(3, 24).
The occurrence of two IRESs in the VEGF mRNA, probably controlled
by different factors, provides interesting possibilities for the
regulation of VEGF expression at the translational level. As VEGF plays
a central role in angiogenesis, its expression has to be finely
regulated. Two independent IRES domains, sensitive to different
environmental conditions or cellular contexts, could permit an
additional degree of flexibility in the expression of this growth
factor. It should also be mentioned that the VEGF 5' leader presents
potential initiation codons located between the two IRESs, in the same
open reading frame as the AUG 1039 initiation codon. It could thus be
hypothesized that the upstream IRES controls the expression of longer
VEGF isoforms, as has been observed for FGF-2 mRNA
(53). However, the existence of such alternative VEGF
isoforms remains to be demonstrated. It would also be interesting to
know whether translation of the various splicing variants of VEGF
mRNA is regulated differently by the two IRESs. Indeed,
although we have shown that the second IRES does not extend
downstream from the AUG codon, we cannot rule out that long-range
interactions of IRES A or B with the downstream coding sequence of the
messenger could affect or stabilize the IRES structure and influence
its ribosome binding efficiency.
The discovery of IRESs in the mRNAs of two major angiogenic growth
factors, VEGF and FGF-2, as well as in the mRNA of PDGF, a factor
involved in vascular physiology, raises the question as to the possible
involvement of this translation initiation mechanism in the control of
angiogenesis. We have already shown that FGF-2 expression is
translationally activated in response to stress or vascular lesion
(8a, 54). Thus, the advantage of IRES-dependent regulation
might be to allow an immediate response of the cell to exogenous
stimuli. The control of such a process could have important
repercussions in cardiovascular disease therapy.
The FGF-2 IRES seems to be constitutively activated in various
transformed cell types (54), whereas c-myc is
overexpressed in an IRES-dependent manner in Bloom's syndrome cells
(58). The observation of an IRES-dependent translational
activation of growth factor or proto-oncogene expression in tumors,
added to previous descriptions of eIF4E-dependent translation
enhancement (25, 27), favors the hypothesis that
translational deregulation of gene expression may play a key role in
cell transformation. Furthermore, it has been reported that
overexpression of VEGF induces cell transformation in cooperation with
FGF-2 (16). Thus, the existence of IRESs in both FGF-2 and
VEGF mRNAs suggests that the processes leading to cell
transformation and/or tumor neovascularization could involve an
IRES-dependent activation of the expression of these angiogenic
factors.
 |
ACKNOWLEDGMENTS |
We thank B. Michot for predicted secondary structures, F. Bayard
and J. Plouet for helpful discussions, and D. Warwick for English
proofreading. We thank J. Abraham for the gift of the VEGF cDNA and
promoter region and J. G. Patton for sending the anti-PTB
antibody.
This work was supported by grants from the Association pour la
Recherche contre le Cancer, the Ligue Nationale contre le Cancer, the
Conseil Regional de Midi-Pyrenées, the European Community Biotechnology program (subprogram Cell Factory, Actions de Recherches Concertées, contract 94/99-181). I. Huez received fellowships from the Ministère de l'Education Nationale et de la Recherche Scientifique. L. Créancier received a fellowship from the
European Community Biotechnology program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: INSERM U397,
Endocrinologie et Communication Cellulaire, Institut
Fédératif de Recherche Louis Bugnard, CHU Rangueil, Ave.
Jean Poulhès, 31403 Toulouse cedex 04, France. Phone: 33 (5) 61 32 21 44. Fax: 33 (5) 61 32 21 41. E-mail:
pratsh{at}rangueil.inserm.fr.
 |
REFERENCES |
| 1.
|
Belsham, G. J., and N. Sonenberg.
1996.
RNA-protein interactions in regulation of picornavirus RNA translation.
Microbiol. Rev.
60:499-511[Abstract/Free Full Text].
|
| 2.
|
Bernstein, J.,
O. Sella,
S. Y. Le, and O. Elroy-Stein.
1997.
PDGF2/c-sis mRNA leader contains a differentiation-linked internal ribosomal entry site (D-IRES).
J. Biol. Chem.
272:9356-9362[Abstract/Free Full Text].
|
| 3.
|
Borman, A.,
M. T. Howell,
J. G. Patton, and R. J. Jackson.
1993.
The involvement of a spliceosome component in internal initiation of human rhinovirus RNA translation.
J. Gen. Virol.
74:1775-1788[Abstract/Free Full Text].
|
| 4.
|
Borovjagin, A.,
T. Pestova, and I. Shatsky.
1994.
Pyrimidine tract binding protein strongly stimulates in vitro encephalomyocarditis virus RNA translation at the level of preinitiation complex formation.
FEBS Lett.
351:299-302[Medline].
|
| 5.
|
Brogi, E.,
T. Wu,
A. Namiki, and J. M. Isner.
1994.
Indirect angiogenic cytokines upregulate VEGF and bFGF gene expression in vascular smooth muscle cells, whereas hypoxia upregulates VEGF expression only.
Circulation
90:649-652[Abstract/Free Full Text].
|
| 6.
|
Chetouani, F.,
P. Monestie,
P. Thebault,
C. Gaspin, and B. Michot.
1997.
ESSA: an integrated and interactive computer tool for analysing RNA secondary structure.
Nucleic Acids Res.
25:3514-3522[Abstract/Free Full Text].
|
| 7.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 8.
|
Cohen, T.,
D. Nahari,
L. W. Cerem,
G. Neufeld, and B. Z. Levi.
1996.
Interleukin 6 induces the expression of vascular endothelial growth factor.
J. Biol. Chem.
271:736-741[Abstract/Free Full Text].
|
| 8a.
| Concina, P., et al. Unpublished results.
|
| 9.
|
Creancier, L.,
H. Prats,
C. Zanibellato,
F. Amalric, and B. Bugler.
1993.
Determination of the functional domains involved in nucleolar targeting of nucleolin.
Mol. Biol. Cell.
4:1239-1250[Abstract].
|
| 10.
|
Ferrara, N., and T. Davis-Smyth.
1997.
The biology of vascular endothelial growth factor.
Endocrine Rev.
18:4-25[Abstract/Free Full Text].
|
| 11.
|
Ferrara, N., and B. Keyt.
1997.
Vascular endothelial growth factor: basic biology and clinical implications.
EXS
79:209-232[Medline].
|
| 12.
|
Futterer, J.,
Z. Kiss-Laszlo, and T. Hohn.
1993.
Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA.
Cell
73:789-802[Medline].
|
| 13.
|
Gan, W., and R. E. Rhoads.
1996.
Internal initiation of translation directed by the 5'-untranslated region of the mRNA for eIF4G, a factor involved in the picornavirus-induced switch from cap-dependent to internal initiation.
J. Biol. Chem.
271:623-626[Abstract/Free Full Text].
|
| 14.
|
Goad, D. L.,
J. Rubin,
H. Wang,
A. H. Tashjian, Jr., and C. Patterson.
1996.
Enhanced expression of vascular endothelial growth factor in human SaOS-2 osteoblast-like cells and murine osteoblasts induced by insulin-like growth factor I.
Endocrinology
137:2262-2268[Abstract].
|
| 15.
|
Grugel, S.,
G. Finkenzeller,
K. Weindel,
B. Barleon, and D. Marme.
1995.
Both v-Ha-Ras and v-Raf stimulate expression of the vascular endothelial growth factor in NIH 3T3 cells.
J. Biol. Chem.
270:25915-25919[Abstract/Free Full Text].
|
| 16.
|
Guerrin, M.,
E. Scotet,
F. Malecaze,
E. Houssaint, and J. Plouet.
1997.
Overexpression of vascular endothelial growth factor induces cell transformation in cooperation with fibroblast growth factor 2.
Oncogene
14:463-471[Medline].
|
| 17.
|
Hellen, C. U.,
T. V. Pestova, and E. Wimmer.
1994.
Effect of mutations downstream of the internal ribosome entry site on initiation of poliovirus protein synthesis.
J. Virol.
68:6312-6322[Abstract/Free Full Text].
|
| 18.
|
Hoffman, M. A., and A. C. Palmenberg.
1995.
Mutational analysis of the J-K stem-loop region of the encephalomyocarditis virus IRES.
J. Virol.
69:4399-4406[Abstract].
|
| 19.
|
Iizuka, N.,
H. Yonekawa, and A. Nomoto.
1991.
Nucleotide sequences important for translation initiation of enterovirus RNA.
J. Virol.
65:4867-4873[Abstract/Free Full Text].
|
| 20.
|
Jackson, R. J.
1988.
RNA translation. Picornaviruses break the rules.
Nature
334:292-293[Medline].
|
| 21.
|
Jackson, R. J., and A. Kaminski.
1995.
Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond.
RNA
1:985-1000[Medline].
|
| 22.
|
Jang, S. K.,
H. G. Krausslich,
M. J. Nicklin,
G. M. Duke,
A. C. Palmenberg, and E. Wimmer.
1988.
A segment of the 5' nontranslated region of encephalomycarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J. Virol.
62:2636-2643[Abstract/Free Full Text].
|
| 23.
|
Kaminski, A.,
S. L. Hunt,
J. G. Patton, and R. J. Jackson.
1995.
Direct evidence that polypyrimidine tract binding protein (PTB) is essential for internal initiation of translation of encephalomyocarditis virus RNA.
RNA
1:924-938[Abstract].
|
| 24.
|
Kaminski, A., and R. J. Jackson.
1998.
The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute.
RNA
4:626-638[Abstract].
|
| 25.
|
Kevil, C. G.,
A. De Benedetti,
D. K. Payne,
L. L. Coe,
F. S. Laroux, and J. S. Alexander.
1996.
Translational regulation of vascular permeability factor by eukaryotic initiation factor 4E: implications for tumor angiogenesis.
Int. J. Cancer
65:785-790[Medline].
|
| 26.
|
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241[Abstract/Free Full Text].
|
| 27.
|
Lazaris-Karatzas, A.,
K. S. Montine, and N. Sonenberg.
1990.
Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap.
Nature
345:544-547[Medline].
|
| 28.
|
Le, S. Y., and J. V. Maizel, Jr.
1997.
A common RNA structural motif involved in the internal initiation of translation of cellular mRNAs.
Nucleic Acids Res.
25:362-369[Abstract/Free Full Text].
|
| 29.
|
Leung, D. W.,
G. Cachianes,
W. J. Kuang,
D. V. Goeddel, and N. Ferrara.
1989.
Vascular endothelial growth factor is a secreted angiogenic mitogen.
Science
246:1306-1309[Abstract/Free Full Text].
|
| 30.
|
Levy, A. P.,
N. S. Levy,
S. Wegner, and M. A. Goldberg.
1995.
Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia.
J. Biol. Chem.
270:13333-13340[Abstract/Free Full Text].
|
| 31.
|
Li, J.,
M. A. Perrella,
J. C. Tsai,
S. F. Yet,
C. M. Hsieh,
M. Yoshizumi,
C. Patterson,
W. O. Endege,
F. Zhou, and M. E. Lee.
1995.
Induction of vascular endothelial growth factor gene expression by interleukin-1 beta in rat aortic smooth muscle cells.
J. Biol. Chem.
270:308-312[Abstract/Free Full Text].
|
| 32.
|
Lopez de Quinto, S., and E. Martinez-Salas.
1997.
Conserved structural motifs located in distal loops of aphthovirus internal ribosome entry site domain 3 are required for internal initiation of translation.
J. Virol.
71:4171-4175[Abstract].
|
| 33.
|
Macejak, D. J., and P. Sarnow.
1991.
Internal initiation of translation mediated by the 5' leader of a cellular mRNA.
Nature
353:90-94[Medline].
|
| 34.
|
Meerovitch, K.,
J. Pelletier, and N. Sonenberg.
1989.
A cellular protein that binds to the 5'-noncoding region of poliovirus RNA: implications for internal translation initiation.
Genes Dev.
3:1026-1034[Abstract/Free Full Text].
|
| 35.
|
Molla, A.,
S. K. Jang,
A. V. Paul,
Q. Reuer, and E. Wimmer.
1992.
Cardioviral internal ribosomal entry site is functional in a genetically engineered dicistronic poliovirus.
Nature
356:255-257[Medline].
|
| 36.
|
Mukhopadhyay, D.,
L. Tsiokas,
X. M. Zhou,
D. Foster,
J. S. Brugge, and V. P. Sukhatme.
1995.
Hypoxic induction of human vascular endothelial growth factor expression through c-Src activation.
Nature
375:577-581[Medline].
|
| 37.
|
Nanbru, C.,
I. Lafon,
S. Audigier,
M. C. Gensac,
S. Vagner,
G. Huez, and A. C. Prats.
1997.
Alternative translation of the proto-oncogene c-myc by an internal ribosome entry site.
J. Biol. Chem.
272:32061-32066[Abstract/Free Full Text].
|
| 38.
|
Niepmann, M.,
A. Petersen,
K. Meyer, and E. Beck.
1997.
Functional involvement of polypyrimidine tract-binding protein in translation initiation complexes with the internal ribosome entry site of foot-and-mouth disease virus.
J. Virol.
71:8330-8339[Abstract].
|
| 39.
|
Oh, S.-K.,
M. P. Scott, and P. Sarnow.
1992.
Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding.
Genes Dev.
6:1643-1653[Abstract/Free Full Text].
|
| 40.
|
Patton, J. G.,
S. A. Mayer,
P. Tempst, and B. Nadal-Ginard.
1991.
Characterization and molecular cloning of polypyrimidine tract-binding protein: a component of a complex necessary for pre-mRNA splicing.
Genes Dev.
5:1237-1251[Abstract/Free Full Text].
|
| 41.
|
Pelletier, J., and N. Sonenberg.
1988.
Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA.
Nature
334:320-325[Medline].
|
| 42.
|
Pestova, T. V.,
C. U. Hellen, and E. Wimmer.
1991.
Translation of poliovirus RNA: role of an essential cis-acting oligopyrimidine element within the 5' nontranslated region and involvement of a cellular 57-kilodalton protein.
J. Virol.
65:6194-6204[Abstract/Free Full Text].
|
| 43.
|
Plouet, J.,
F. Moro,
S. Bertagnolli,
N. Coldeboeuf,
H. Mazarguil,
S. Clamens, and F. Bayard.
1997.
Extracellular cleavage of the vascular endothelial growth factor 189-amino acid form by urokinase is required for its mitogenic effect.
J. Biol. Chem.
272:13390-13396[Abstract/Free Full Text].
|
| 44.
|
Plouet, J.,
J. Schilling, and D. Gospodarowicz.
1989.
Isolation and characterization of a newly identified endothelial cell mitogen produced by AtT-20 cells.
EMBO J.
8:3801-3806[Medline].
|
| 45.
|
Prats, A. C.,
S. Vagner,
H. Prats, and F. Amalric.
1992.
cis-acting elements involved in the alternative translation initiation process of human basic fibroblast growth factor mRNA.
Mol. Cell. Biol.
12:4796-4805[Abstract/Free Full Text].
|
| 46.
|
Rak, J.,
J. Filmus,
G. Finkenzeller,
S. Grugel,
D. Marme, and R. S. Kerbel.
1995.
Oncogenes as inducers of tumor angiogenesis.
Cancer Metastasis Rev.
14:263-277[Medline].
|
| 47.
|
Shima, D. T.,
M. Kuroki,
U. Deutsch,
Y. S. Ng,
A. P. Adamis, and P. A. D'Amore.
1996.
The mouse gene for vascular endothelial growth factor. Genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory sequences.
J. Biol. Chem.
271:3877-3883[Abstract/Free Full Text].
|
| 48.
|
Shweiki, D.,
A. Itin,
D. Soffer, and E. Keshet.
1992.
Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis.
Nature
359:843-845[Medline].
|
| 49.
|
Stein, I.,
M. Neeman,
D. Shweiki,
A. Itin, and E. Keshet.
1995.
Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes.
Mol. Cell. Biol.
15:5363-5368[Abstract].
|
| 50.
|
Stoneley, M.,
F. E. Paulin,
J. P. Le Quesne,
S. A. Chappell, and A. E. Willis.
1998.
C-Myc 5' untranslated region contains an internal ribosome entry segment.
Oncogene
16:423-428[Medline].
|
| 51.
|
Teerink, H.,
H. O. Voorma, and A. A. Thomas.
1995.
The human insulin-like growth factor II leader 1 contains an internal ribosomal entry site.
Biochim. Biophys. Acta
1264:403-408[Medline].
|
| 52.
|
Tischer, E.,
R. Mitchell,
T. Hartman,
M. Silva,
D. Gospodarowicz,
J. C. Fiddes, and J. A. Abraham.
1991.
The human gene for vascular endothelial growth factor. Multiple protein forms are encoded through alternative exon splicing.
J. Biol. Chem.
266:11947-11954[Abstract/Free Full Text].
|
| 53.
|
Vagner, S.,
M. C. Gensac,
A. Maret,
F. Bayard,
F. Amalric,
H. Prats, and A. C. Prats.
1995.
Alternative translation of human fibroblast growth factor 2 mRNA occurs by internal entry of ribosomes.
Mol. Cell. Biol.
15:35-44[Abstract].
|
| 54.
|
Vagner, S.,
C. Touriol,
B. Galy,
S. Audigier,
M. C. Gensac,
F. Amalric,
F. Bayard,
H. Prats, and A. C. Prats.
1996.
Translation of CUG- but not AUG-initiated forms of human fibroblast growth factor 2 is activated in transformed and stressed cells.
J. Cell Biol.
135:1391-1402[Abstract/Free Full Text].
|
| 55.
|
Vagner, S.,
A. Waysbort,
M. Marenda,
M. C. Gensac,
F. Amalric, and A. C. Prats.
1995.
Alternative translation initiation of the Moloney murine leukemia virus mRNA controlled by internal ribosome entry involving the p57/PTB splicing factor.
J. Biol. Chem.
270:20376-20383[Abstract/Free Full Text].
|
| 56.
|
Valcarcel, J., and F. Gebauer.
1997.
Post-transcriptional regulation: the dawn of PTB.
Curr. Biol.
7:R705-R708[Medline].
|
| 57.
|
Warren, R. S.,
H. Yuan,
M. R. Matli,
N. Ferrara, and D. B. Donner.
1996.
Induction of vascular endothelial growth factor by insulin-like growth factor 1 in colorectal carcinoma.
J. Biol. Chem.
271:29483-29488[Abstract/Free Full Text].
|
| 58.
|
West, M. J.,
N. F. Sullivan, and A. E. Willis.
1995.
Translational upregulation of the c-myc oncogene in Bloom's syndrome cell lines.
Oncogene
11:2515-2524[Medline].
|
| 59.
|
Ye, X.,
P. Fong,
N. Iizuka,
D. Choate, and D. R. Cavener.
1997.
Ultrabithorax and antennapedia 5' untranslated regions promote developmentally regulated internal translation initiation.
Mol. Cell. Biol.
17:1714-1721[Abstract].
|
| 60.
|
Yueh, A., and R. J. Schneider.
1996.
Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells.
Genes Dev.
10:1557-1567[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 1998, p. 6178-6190, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Birk, D. M., Barbato, J., Mureebe, L., Chaer, R. A.
(2009). Basic Science Review: Current Insights on the Biology and Clinical Aspects of VEGF Regulation. VASC ENDOVASCULAR SURG
42: 517-530
[Abstract]
-
Wang, X., Zhao, Y., Xiao, Z., Chen, B., Wei, Z., Wang, B., Zhang, J., Han, J., Gao, Y., Li, L., Zhao, H., Zhao, W., Lin, H., Dai, J.
(2009). Alternative Translation of OCT4 by an Internal Ribosome Entry Site and its Novel Function in Stress Response. Stem Cells
27: 1265-1275
[Abstract]
[Full Text]
-
Wang, G., Guo, X., Silveyra, P., Kimball, S. R., Floros, J.
(2009). Cap-independent translation of human SP-A 5'-UTR variants: a double-loop structure and cis-element contribution. Am. J. Physiol. Lung Cell. Mol. Physiol.
296: L635-L647
[Abstract]
[Full Text]
-
Karaa, Z. S., Iacovoni, J. S., Bastide, A., Lacazette, E., Touriol, C., Prats, H.
(2009). The VEGF IRESes are differentially susceptible to translation inhibition by miR-16. RNA
15: 249-254
[Abstract]
[Full Text]
-
Zhao, X., Chen, J., Lei, L., Hu, G., Xiong, Y., Xu, J., Li, Q., Yang, X., Chang, C. C.Y., Song, B., Chang, T., Li, B.
(2009). The optional long 5'-untranslated region of human ACAT1 mRNAs impairs the production of ACAT1 protein by promoting its mRNA decay. Acta Biochim Biophys Sin
41: 30-41
[Abstract]
[Full Text]
-
Malabanan, K. P., Kanellakis, P., Bobik, A., Khachigian, L. M.
(2008). Activation Transcription Factor-4 Induced by Fibroblast Growth Factor-2 Regulates Vascular Endothelial Growth Factor-A Transcription in Vascular Smooth Muscle Cells and Mediates Intimal Thickening in Rat Arteries Following Balloon Injury. Circ. Res.
103: 378-387
[Abstract]
[Full Text]
-
Bastide, A., Karaa, Z., Bornes, S., Hieblot, C., Lacazette, E., Prats, H., Touriol, C.
(2008). An upstream open reading frame within an IRES controls expression of a specific VEGF-A isoform. Nucleic Acids Res
36: 2434-2445
[Abstract]
[Full Text]
-
Vumbaca, F., Phoenix, K. N., Rodriguez-Pinto, D., Han, D. K., Claffey, K. P.
(2008). Double-Stranded RNA-Binding Protein Regulates Vascular Endothelial Growth Factor mRNA Stability, Translation, and Breast Cancer Angiogenesis. Mol. Cell. Biol.
28: 772-783
[Abstract]
[Full Text]
-
Cobbold, L. C., Spriggs, K. A., Haines, S. J., Dobbyn, H. C., Hayes, C., de Moor, C. H., Lilley, K. S., Bushell, M., Willis, A. E.
(2008). Identification of Internal Ribosome Entry Segment (IRES)-trans-Acting Factors for the Myc Family of IRESs. Mol. Cell. Biol.
28: 40-49
[Abstract]
[Full Text]
-
Galban, S., Kuwano, Y., Pullmann, R. Jr., Martindale, J. L., Kim, H. H., Lal, A., Abdelmohsen, K., Yang, X., Dang, Y., Liu, J. O., Lewis, S. M., Holcik, M., Gorospe, M.
(2008). RNA-Binding Proteins HuR and PTB Promote the Translation of Hypoxia-Inducible Factor 1{alpha}. Mol. Cell. Biol.
28: 93-107
[Abstract]
[Full Text]
-
Thomas, J. D., Johannes, G. J.
(2007). Identification of mRNAs that continue to associate with polysomes during hypoxia. RNA
13: 1116-1131
[Abstract]
[Full Text]
-
Bornes, S., Prado-Lourenco, L., Bastide, A., Zanibellato, C., Iacovoni, J. S., Lacazette, E., Prats, A.-C., Touriol, C., Prats, H.
(2007). Translational Induction of VEGF Internal Ribosome Entry Site Elements During the Early Response to Ischemic Stress. Circ. Res.
100: 305-308
[Abstract]
[Full Text]
-
Bert, A. G., Grepin, R., Vadas, M. A., Goodall, G. J.
(2006). Assessing IRES activity in the HIF-1{alpha} and other cellular 5' UTRs. RNA
12: 1074-1083
[Abstract]
[Full Text]
-
Connolly, E., Braunstein, S., Formenti, S., Schneider, R. J.
(2006). Hypoxia Inhibits Protein Synthesis through a 4E-BP1 and Elongation Factor 2 Kinase Pathway Controlled by mTOR and Uncoupled in Breast Cancer Cells. Mol. Cell. Biol.
26: 3955-3965
[Abstract]
[Full Text]
-
Cherradi, N., Lejczak, C., Desroches-Castan, A., Feige, J.-J.
(2006). Antagonistic Functions of Tetradecanoyl Phorbol Acetate-Inducible-Sequence 11b and HuR in the Hormonal Regulation of Vascular Endothelial Growth Factor Messenger Ribonucleic Acid Stability by Adrenocorticotropin. Mol. Endocrinol.
20: 916-930
[Abstract]
[Full Text]
-
Schepens, B., Tinton, S. A., Bruynooghe, Y., Beyaert, R., Cornelis, S.
(2005). The polypyrimidine tract-binding protein stimulates HIF-1{alpha} IRES-mediated translation during hypoxia. Nucleic Acids Res
33: 6884-6894
[Abstract]
[Full Text]
-
Hong, G. K., Kumar, P., Wang, L., Damania, B., Gulley, M. L., Delecluse, H.-J., Polverini, P. J., Kenney, S. C.
(2005). Epstein-Barr Virus Lytic Infection Is Required for Efficient Production of the Angiogenesis Factor Vascular Endothelial Growth Factor in Lymphoblastoid Cell Lines. J. Virol.
79: 13984-13992
[Abstract]
[Full Text]
-
JIMENEZ, J., JANG, G. M., SEMLER, B. L., WATERMAN, M. L.
(2005). An internal ribosome entry site mediates translation of lymphoid enhancer factor-1. RNA
11: 1385-1399
[Abstract]
[Full Text]
-
Thomson, A. M., Cahill, C. M., Cho, H.-H., Kassachau, K. D., Epis, M. R., Bridges, K. R., Leedman, P. J., Rogers, J. T.
(2005). The Acute Box cis-Element in Human Heavy Ferritin mRNA 5'-Untranslated Region Is a Unique Translation Enhancer That Binds Poly(C)-binding Proteins. J. Biol. Chem.
280: 30032-30045
[Abstract]
[Full Text]
-
Mitchell, S. A., Spriggs, K. A., Bushell, M., Evans, J. R., Stoneley, M., Le Quesne, J. P.C., Spriggs, R. V., Willis, A. E.
(2005). Identification of a motif that mediates polypyrimidine tract-binding protein-dependent internal ribosome entry. Genes Dev.
19: 1556-1571
[Abstract]
[Full Text]
-
Park, E.-H., Lee, J. M., Blais, J. D., Bell, J. C., Pelletier, J.
(2005). Internal Translation Initiation Mediated by the Angiogenic Factor Tie2. J. Biol. Chem.
280: 20945-20953
[Abstract]
[Full Text]
-
Dobson, T., Minic, A., Nielsen, K., Amiott, E., Krushel, L.
(2005). Internal initiation of translation of the TrkB mRNA is mediated by multiple regions within the 5' leader. Nucleic Acids Res
33: 2929-2941
[Abstract]
[Full Text]
-
Zhou, W., Edelman, G. M., Mauro, V. P.
(2005). A positive feedback vector for identification of nucleotide sequences that enhance translation. Proc. Natl. Acad. Sci. USA
102: 6273-6278
[Abstract]
[Full Text]
-
Pages, G., Pouyssegur, J.
(2005). Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors. Cardiovasc Res
65: 564-573
[Abstract]
[Full Text]
-
Jang, G. M., Leong, L. E.-C., Hoang, L. T., Wang, P. H., Gutman, G. A., Semler, B. L.
(2004). Structurally Distinct Elements Mediate Internal Ribosome Entry within the 5'-Noncoding Region of a Voltage-gated Potassium Channel mRNA. J. Biol. Chem.
279: 47419-47430
[Abstract]
[Full Text]
-
Marano, R. J., Brankov, M., Rakoczy, P. E.
(2004). Discovery of a Novel Control Element within the 5'-Untranslated Region of the Vascular Endothelial Growth Factor: REGULATION OF EXPRESSION USING SENSE OLIGONUCLEOTIDES. J. Biol. Chem.
279: 37808-37814
[Abstract]
[Full Text]
-
Martineau, Y., Le Bec, C., Monbrun, L., Allo, V., Chiu, I.-M., Danos, O., Moine, H., Prats, H., Prats, A.-C.
(2004). Internal Ribosome Entry Site Structural Motifs Conserved among Mammalian Fibroblast Growth Factor 1 Alternatively Spliced mRNAs. Mol. Cell. Biol.
24: 7622-7635
[Abstract]
[Full Text]
-
Segrelles, C., Ruiz, S., Santos, M., Martinez-Palacio, J., Lara, M. F., Paramio, J. M.
(2004). Akt mediates an angiogenic switch in transformed keratinocytes. Carcinogenesis
25: 1137-1147
[Abstract]
[Full Text]
-
Bornes, S., Boulard, M., Hieblot, C., Zanibellato, C., Iacovoni, J. S., Prats, H., Touriol, C.
(2004). Control of the Vascular Endothelial Growth Factor Internal Ribosome Entry Site (IRES) Activity and Translation Initiation by Alternatively Spliced Coding Sequences. J. Biol. Chem.
279: 18717-18726
[Abstract]
[Full Text]
-
Warnakulasuriyarachchi, D., Cerquozzi, S., Cheung, H. H., Holcik, M.
(2004). Translational Induction of the Inhibitor of Apoptosis Protein HIAP2 during Endoplasmic Reticulum Stress Attenuates Cell Death and Is Mediated via an Inducible Internal Ribosome Entry Site Element. J. Biol. Chem.
279: 17148-17157
[Abstract]
[Full Text]
-
Bonnal, S., Schaeffer, C., Creancier, L., Clamens, S., Moine, H., Prats, A.-C., Vagner, S.
(2003). A Single Internal Ribosome Entry Site Containing a G Quartet RNA Structure Drives Fibroblast Growth Factor 2 Gene Expression at Four Alternative Translation Initiation Codons. J. Biol. Chem.
278: 39330-39336
[Abstract]
[Full Text]
-
Rabadan-Diehl, C., Volpi, S., Nikodemova, M., Aguilera, G.
(2003). Translational Regulation of the Vasopressin V1b Receptor Involves an Internal Ribosome Entry Site. Mol. Endocrinol.
17: 1959-1971
[Abstract]
[Full Text]
-
Chappell, S. A., Mauro, V. P.
(2003). The Internal Ribosome Entry Site (IRES) Contained within the RNA-binding Motif Protein 3 (Rbm3) mRNA Is Composed of Functionally Distinct Elements. J. Biol. Chem.
278: 33793-33800
[Abstract]
[Full Text]
-
Bates, D. O., Jones, R. O. P.
(2003). The Role of Vascular Endothelial Growth Factor in Wound Healing. INT J LOW EXTREM WOUNDS
2: 107-120
[Abstract]
-
Jefferson, L. S., Kimball, S. R.
(2003). Amino Acids as Regulators of Gene Expression at the Level of mRNA Translation. J. Nutr.
133: 2046S-2051
[Abstract]
[Full Text]
-
Zhou, W., Edelman, G. M., Mauro, V. P.
(2003). Isolation and identification of short nucleotide sequences that affect translation initiation in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
100: 4457-4462
[Abstract]
[Full Text]
-
Roguin, A., Avivi, A., Nitecki, S., Rubinstein, I., Levy, N. S., Abassi, Z. A., Resnick, M. B., Lache, O., Melamed-Frank, M., Joel, A., Hoffman, A., Nevo, E., Levy, A. P.
(2003). Restoration of blood flow by using continuous perimuscular infiltration of plasmid DNA encoding subterranean mole rat Spalax ehrenbergi VEGF. Proc. Natl. Acad. Sci. USA
100: 4644-4648
[Abstract]
[Full Text]
-
Brasey, A., Lopez-Lastra, M., Ohlmann, T., Beerens, N., Berkhout, B., Darlix, J.-L., Sonenberg, N.
(2003). The Leader of Human Immunodeficiency Virus Type 1 Genomic RNA Harbors an Internal Ribosome Entry Segment That Is Active during the G2/M Phase of the Cell Cycle. J. Virol.
77: 3939-3949
[Abstract]
[Full Text]
-
Boussadia, O., Niepmann, M., Creancier, L., Prats, A.-C., Dautry, F., Jacquemin-Sablon, H.
(2003). Unr Is Required In Vivo for Efficient Initiation of Translation from the Internal Ribosome Entry Sites of both Rhinovirus and Poliovirus. J. Virol.
77: 3353-3359
[Abstract]
[Full Text]
-
Kim, J. H., Paek, K. Y., Choi, K., Kim, T.-D., Hahm, B., Kim, K.-T., Jang, S. K.
(2003). Heterogeneous Nuclear Ribonucleoprotein C Modulates Translation of c-myc mRNA in a Cell Cycle Phase-Dependent Manner. Mol. Cell. Biol.
23: 708-720
[Abstract]
[Full Text]
-
Holcik, M., Gordon, B. W., Korneluk, R. G.
(2003). The Internal Ribosome Entry Site-Mediated Translation of Antiapoptotic Protein XIAP Is Modulated by the Heterogeneous Nuclear Ribonucleoproteins C1 and C2. Mol. Cell. Biol.
23: 280-288
[Abstract]
[Full Text]
-
Chung, J., Bachelder, R. E., Lipscomb, E. A., Shaw, L. M., Mercurio, A. M.
(2002). Integrin ({alpha}6{beta}4) regulation of eIF-4E activity and VEGF translation: a survival mechanism for carcinoma cells. JCB
158: 165-174
[Abstract]
[Full Text]
-
Milanini-Mongiat, J., Pouyssegur, J., Pages, G.
(2002). Identification of Two Sp1 Phosphorylation Sites for p42/p44 Mitogen-activated Protein Kinases. THEIR IMPLICATION IN VASCULAR ENDOTHELIAL GROWTH FACTOR GENE TRANSCRIPTION. J. Biol. Chem.
277: 20631-20639
[Abstract]
[Full Text]
-
Lang, K. J. D., Kappel, A., Goodall, G. J.
(2002). Hypoxia-inducible Factor-1alpha mRNA Contains an Internal Ribosome Entry Site That Allows Efficient Translation during Normoxia and Hypoxia. Mol. Biol. Cell
13: 1792-1801
[Abstract]
[Full Text]
-
Shmulevitz, M., Yameen, Z., Dawe, S., Shou, J., O'Hara, D., Holmes, I., Duncan, R.
(2002). Sequential Partially Overlapping Gene Arrangement in the Tricistronic S1 Genome Segments of Avian Reovirus and Nelson Bay Reovirus: Implications for Translation Initiation. J. Virol.
76: 609-618
[Abstract]
[Full Text]
-
Kim, Y. K., Back, S. H., Rho, J., Lee, S. H., Jang, S. K.
(2001). La autoantigen enhances translation of BiP mRNA. Nucleic Acids Res
29: 5009-5016
[Abstract]
[Full Text]
-
Schneider, R., Kozak, M.
(2001). New Ways of Initiating Translation in Eukaryotes?. Mol. Cell. Biol.
21: 8238-8246
[Full Text]
-
Huez, I., Bornes, S., Bresson, D., Creancier, L., Prats, H.
(2001). New Vascular Endothelial Growth Factor Isoform Generated by Internal Ribosome Entry Site-Driven CUG Translation Initiation. Mol. Endocrinol.
15: 2197-2210
[Abstract]
[Full Text]
-
Treins, C., Giorgetti-Peraldi, S., Murdaca, J., Van Obberghen, E.
(2001). Regulation of Vascular Endothelial Growth Factor Expression by Advanced Glycation End Products. J. Biol. Chem.
276: 43836-43841
[Abstract]
[Full Text]
-
Hennecke, M., Kwissa, M., Metzger, K., Oumard, A., Kroger, A., Schirmbeck, R., Reimann, J., Hauser, H.
(2001). Composition and arrangement of genes define the strength of IRES-driven translation in bicistronic mRNAs. Nucleic Acids Res
29: 3327-3334
[Abstract]
[Full Text]
-
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text]
-
Mitchell, S. A., Brown, E. C., Coldwell, M. J., Jackson, R. J., Willis, A. E.
(2001). Protein Factor Requirements of the Apaf-1 Internal Ribosome Entry Segment: Roles of Polypyrimidine Tract Binding Protein and upstream of N-ras. Mol. Cell. Biol.
21: 3364-3374
[Abstract]
[Full Text]
-
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text]
-
Venkatesan, A., Dasgupta, A.
(2001). Novel Fluorescence-Based Screen To Identify Small Synthetic Internal Ribosome Entry Site Elements. Mol. Cell. Biol.
21: 2826-2837
[Abstract]
[Full Text]
-
Créancier, L., Mercier, P., Prats, A.-C., Morello, D.
(2001). c-myc Internal Ribosome Entry Site Activity Is Developmentally Controlled and Subjected to a Strong Translational Repression in Adult Transgenic Mice. Mol. Cell. Biol.
21: 1833-1840
[Abstract]
[Full Text]
-
Owens, G. C., Chappell, S. A., Mauro, V. P., Edelman, G. M.
(2001). Identification of two short internal ribosome entry sites selected from libraries of random oligonucleotides. Proc. Natl. Acad. Sci. USA
98: 1471-1476
[Abstract]
[Full Text]
-
Zhou, W., Edelman, G. M., Mauro, V. P.
(2001). Transcript leader regions of two Saccharomyces cerevisiae mRNAs contain internal ribosome entry sites that function in living cells. Proc. Natl. Acad. Sci. USA
98: 1531-1536
[Abstract]
[Full Text]
-
Creancier, L., Morello, D., Mercier, P., Prats, A.-C.
(2000). Fibroblast Growth Factor 2 Internal Ribosome Entry Site (IRES) Activity Ex Vivo and in Transgenic Mice Reveals a Stringent Tissue-specific Regulation. JCB
150: 275-281
[Abstract]
[Full Text]
-
Holcik, M., Korneluk, R. G.
(2000). Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol. Cell. Biol.
20: 4648-4657
[Abstract]
[Full Text]
-
Cazzola, M., Skoda, R. C.
(2000). Translational pathophysiology: a novel molecular mechanism of human disease. Blood
95: 3280-3288
[Abstract]
[Full Text]
-
Pozner, A., Goldenberg, D., Negreanu, V., Le, S.-Y., Elroy-Stein, O., Levanon, D., Groner, Y.
(2000). Transcription-Coupled Translation Control of AML1/RUNX1 Is Mediated by Cap- and Internal Ribosome Entry Site-Dependent Mechanisms. Mol. Cell. Biol.
20: 2297-2307
[Abstract]
[Full Text]
-
Goldstaub, D., Gradi, A., Bercovitch, Z., Grosmann, Z., Nophar, Y., Luria, S., Sonenberg, N., Kahana, C.
(2000). Poliovirus 2A Protease Induces Apoptotic Cell Death. Mol. Cell. Biol.
20: 1271-1277
[Abstract]
[Full Text]
-
Chappell, S. A., Edelman, G. M., Mauro, V. P.
(2000). A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity. Proc. Natl. Acad. Sci. USA
97: 1536-1541
[Abstract]
[Full Text]
-
Lopez-Lastra, M., Ulrici, S., Gabus, C., Darlix, J.-L.
(1999). Identification of an Internal Ribosome Entry Segment in the 5' Region of the Mouse VL30 Retrotransposon and Its Use in the Development of Retroviral Vectors. J. Virol.
73: 8393-8402
[Abstract]
[Full Text]
-
Uteza, Y., Rouillot, J.-S., Kobetz, A., Marchant, D., Pecqueur, S., Arnaud, E., Prats, H., Honiger, J., Dufier, J.-L., Abitbol, M., Neuner-Jehle, M.
(1999). Intravitreous transplantation of encapsulated fibroblasts secreting the human fibroblast growth factor 2 delays photoreceptor cell degeneration in Royal College of Surgeons rats. Proc. Natl. Acad. Sci. USA
96: 3126-3131
[Abstract]
[Full Text]
-
Pages, G., Berra, E., Milanini, J., Levy, A. P., Pouyssegur, J.
(2000). Stress-activated Protein Kinases (JNK and p38/HOG) Are Essential for Vascular Endothelial Growth Factor mRNA Stability. J. Biol. Chem.
275: 26484-26491
[Abstract]
[Full Text]
-
Hudder, A., Werner, R.
(2000). Analysis of a Charcot-Marie-Tooth Disease Mutation Reveals an Essential Internal Ribosome Entry Site Element in the Connexin-32 Gene. J. Biol. Chem.
275: 34586-34591
[Abstract]
[Full Text]
-
Giraud, S., Greco, A., Brink, M., Diaz, J.-J., Delafontaine, P.
(2001). Translation Initiation of the Insulin-like Growth Factor I Receptor mRNA Is Mediated by an Internal Ribosome Entry Site. J. Biol. Chem.
276: 5668-5675
[Abstract]
[Full Text]