INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

The vascular endothelial growth factor (VEGF) is a potent endothelial cell mitogen that plays a crucial role in the regulation of both physiologic and pathologic angiogenesis (10, 44). VEGF is involved not only in embryogenic development and differentiation of the vascular system, in wound healing, and in reproductive function but also in pathologic angiogenic processes such as proliferative retinopathies, tumor growth, arthritis, and psoriasis (10).

Numerous studies have been devoted to understanding the expression regulation of this factor, especially at the transcriptional level. A wide range of cytokines or oncogenic proteins, including interleukins 1 (31) and 6 (8), insulin-like growth factor 1 (IGF-1) (14), tumor growth factor  (TGF-) (5), c-Src (36), v-Raf (15), and Ras (46), and oxygen tension have been shown to regulate VEGF gene transcription (48). VEGF may also be posttranscriptionally regulated. The VEGF pre-mRNA undergoes alternative splicing which generates four polypeptide isoforms of 121, 165, 189, and 206 amino acids (11), the functions of which have not yet been fully defined. VEGF mRNA stability is also influenced by hypoxic conditions or by IGF-1 expression (49, 57). Finally, posttranslational modifications of VEGF isoforms, including plasmin and urokinase proteolysis or glycosylation, have been described (11, 43).

Surprisingly, very little is known about the possible translational control of VEGF messenger except for a stimulatory effect on VEGF translation in CHO cells overexpressing the cap binding protein eukaryotic initiation factor 4E (eIF4E) (25). However, the VEGF mRNA presents unusual features also found in other RNAs of viral origin or transcribed from cellular proliferation regulator genes, such as the fibroblast growth factor 2 (FGF-2) gene, the platelet-derived growth factor (PDGF) gene, or the c-myc proto-oncogene. The 5' untranslated region (UTR) of the mRNA is unusually long, as the transcription starting point is located 1,038 nucleotides (nt) upstream from the AUG initiation codon and heavily structured due to a high percentage of G and C residues. The 5' UTR region also contains three noncanonical upstream CUG codons in frame with the initiator AUG codon. All of these elements make the use of a conventional ribosome scanning model for translation initiation very difficult (26).

A cap-independent mechanism involving an internal ribosome entry site (IRES) has been identified in picornavirus messengers, which are uncapped and present a long 5' UTR (20, 41). The presence of an IRES has also been reported for many viral (cardiovirus, rhinovirus, and aphthovirus) (21) and some cellular human (Bip, FGF-2, IGF-II, eIF4G, PDGF, and c-Myc) (2, 13, 33, 37, 50, 51, 53) messengers and in Drosophila antennapedia and ultrabithorax mRNAs (39, 59). The IRESs discovered so far differ in their primary sequences but show similarities in their secondary structures which appear to be crucial to IRES function (21, 28). In several picornaviruses, the internal entry process has been shown to require cellular factors including the polypyrimidine tract binding protein (PTB) (1), which is also involved in the nuclear splicing regulatory pathway (40, 56).

We show here that the mRNA of the major angiogenic factor is translated by an internal ribosome entry process. Furthermore, we demonstrate that the VEGF 5' mRNA leader contains two independent IRESs which are able to promote efficient translation at the AUG start codon. The patterns of cellular proteins binding to the two IRESs are clearly different. These data suggest that different factors could control the activities of these IRESs.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Plasmid constructions. The VEGF cDNAs and the DNA fragment corresponding to 5' UTR of the messenger were kindly provided by J. Abraham (52) and cloned into a pKS-derived plasmid. PCR was performed with sense oligonucleotide 5'AAATCTAGAATTCGCGGAGGCTTGGGGCA3' and antisense oligonucleotide 5'GGTATCGATTGGATGGCAGTAG3' to construct a translational fusion between VEGF and chloramphenicol acetyltransferase (CAT). The amplified fragment extending from positions 1 to 1205 (corresponding to the 5' UTR and the 167 nt downstream from the AUG codon) was cloned in a previously described pSCT-derived vector (45) upstream from the CAT coding sequence, under the control of cytomegalovirus (CMV) and T7 promoters. This chimeric construct, called pVC, was expected to encode one VEGF-CAT protein of 32 kDa.

In vitro translation. Plasmids pVC, pVC90, pVC80, pVC30, and pVC30D4 were linearized downstream from the 3' end of the CAT coding sequence at the BglII site. pSCT11A (53) was linearized downstream from the 3' end of the FGF-2 coding sequence at the HindIII site. Capped or uncapped RNAs were generated in vitro, using the T7 mMessage mMachine kit (Ambion) according to the manufacturer's instructions, with or without adding m⁷GpppG (0.5 mM) to the transcription reaction. RNA transcripts were quantified by absorbance at 260 nm and ethidium bromide staining on an agarose gel, which also allowed verification of their integrity. In vitro translation in rabbit reticulocyte lysate (RRL; Promega) was performed as previously described (45), in the presence of [³⁵S]methionine (Amersham). Translation products were analyzed by polyacrylamide gel electrophoresis (PAGE) in a sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gel (45); the dried gels were scanned with a PhosphorImager apparatus (Molecular Dynamics), and quantification of the bands was performed with Imagequant software.

DNA transfection and Western immunoblotting. COS-7 monkey cells were transfected with Fugene-6 transfection reagent (Boehringer) according to manufacturer's instructions or by the DEAE-dextran method as described previously (45). Forty-eight hours after transfection, either (i) the cells were scraped in phosphate-buffered saline (PBS) and the pellets were resuspended in 1% SDS solution and sonicated or (ii) the cells were lysed in 1 ml of Tri-Reagent (Euromedex). Following the latter method and after total RNA extraction (see below), the proteins were precipitated with 1 volume of isopropanol. The protein pellet was then washed five times in 2 ml of a 0.3 M guanidine hydrochloride-95% ethanol buffer and once in 2 ml of ethanol. The protein pellet was then heated to 65°C for 20 min and resuspended in 1% SDS solution. Total proteins were quantified by the bicinchoninic acid assay (Pierce) (absorbance at 562 nm), and 10 µg of proteins from each cell lysate was used for Western immunoblotting. In summary, lysates were heated for 2 min at 95°C in SDS- and dithiothreitol (DTT)-containing sample buffer, separated in a 12.5% polyacrylamide gel, and transferred onto a nitrocellulose membrane. CAT proteins were immunodetected with rabbit polyclonal anti-CAT antibodies prepared in the laboratory (1/10,000 dilution). Antibodies were detected with an enhanced chemiluminescence kit (Amersham).

Cellular RNA purification. Total cellular RNAs were prepared by the Tri-Reagent method (Euromedex), derived from the guanidinium thiocyanate procedure (7). A total of 5 × 10⁶ transfected cells were scraped, centrifuged, and lysed in 1 ml of Tri-Reagent. RNA was extracted after addition of 0.2 ml of chloroform and precipitated with isopropanol. After an ethanol wash and precipitation, the RNA was quantified by measuring the absorbance at 260 nm and checked for integrity by electrophoresis on an agarose gel and ethidium bromide staining.

RNase mapping. A complementary-strand RNA probe was generated in vitro by T7 or T3 RNA polymerase (Promega) according to manufacturer's instructions, using a linearized DNA template and in the presence of 50 µCi of [-³²P]UTP. Probe A was transcribed by using T3 polymerase from plasmid pKSV2 linearized at the XbaI site. Probe C was transcribed by using T3 polymerase from plasmid pKSV2 linearized at the BamHI site. Probe B was transcribed by using T7 polymerase from plasmid pKSV1 linearized at the EcoRI site. ³²P-labeled RNA was purified by using the RNaid kit (Bio 101). The RNase protection experiments were performed with an RPAII kit (Ambion) according to the manufacturer's instructions. A 10-µg aliquot of total cellular RNA and a large excess (2 × 10⁶ cpm) of probe were precipitated with ethanol; 10 µg of yeast RNA can be added to the total RNA before precipitation to increase the size of the RNA pellet. All experiments described were tested with and without addition of RNA. As a control experiment, total RNA samples were incubated 15 min at 37°C in the presence of 10 U of RNase-free DNase 1 prior to the precipitation in order to avoid DNA contamination. The pellet was resuspended in 20 µl of hybridization buffer, heated at 90°C for 4 min, and incubated at 42°C for 14 h. Then 200 µl of RNase digestion buffer containing 20 U of RNase T₁ and 1 µg of RNase A were added, and the reaction mixture was incubated for 30 min at 37°C; 300 µl of inhibitor RNase buffer and 10 µg of carrier yeast RNA were then added, and the reaction mixture was precipitated at 20°C for 20 min. The pellet was resuspended in 8 µl of gel loading buffer, denatured, and fractionated on a 5% acrylamide-8 M urea gel at 200 V for 1.5 h. The gel was then fixed, dried, and autoradiographed. Control experiments showed that all probes described, used alone or only with yeast RNA, were totally digested after RNase mix treatment.

UV cross-linking assay and immunoprecipitation. Cytoplasmic extracts from COS-7 cells were prepared as previously described (53). Confluent cells were scraped in PBS and centrifuged. The cell pellet was resuspended in lysis buffer (10 mM NaCl, 10 mM Tris-HCl [pH 7.4], 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM DTT), and frozen-thawed three times. The extract was centrifuged at 12,000 × g for 10 min, and the supernatant (S10) was brought to 5% (vol/vol) glycerol and frozen in aliquots at 80°C.

Dual luciferase assay. LUCf and LUCr activities were measured by using the Dual-Luciferase reporter assay system (Promega). Transfected COS-7 cell plates (60 by 15 mm) or 24-well dishes were rinsed twice with PBS, scraped, and homogenized in 400 µl of lysis reagent provided with the kit 24 to 48 h after transfection. The lysate was cleared by a 2-min centrifugation at 4°C. Chemiluminescent signals were measured in a luminometer (Berthold) equipped with automatic injectors. A 20-µl volume of extract was incubated with 100 µl of Luciferase Assay Reagent II (Promega) for 2 s, and LUCf activity was measured for a period of 15 s; 100 µl of Stop and Glo buffer (Promega), stopping the firefly enzymatic reaction and containing the substrate for LUCr enzyme, was then injected. Luminescence corresponding to LUCr activity was measured for 15 s starting 3 s after injection.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Identification of an IRES in the 5' UTR of the VEGF mRNA. Two alternative strategies involving hairpin-containing monocistronic vectors or bicistronic vectors were used to study whether VEGF expression was translationally regulated by an internal ribosome entry process. The first approach had been successful for identification of Moloney murine leukemia virus IRES (55), and the second had been used to identify IRESs in several viral and cellular mRNAs (22, 33, 41).

View larger version (24K): [in this window] [in a new window]   FIG. 1.   Identification of an IRES in the VEGF mRNA 5' UTR. (A) Schematic representation of the chimeric constructs used for transfection experiments. pVC (construct A) corresponds to the VEGF-CAT fusion in which nt 1 to 1205 of the VEGF cDNA were fused to the CAT coding sequence (see Materials and Methods). This fusion gives rise to a chimeric VEGF-CAT protein of 32 kDa. pHVC (construct B) is derived from pVC and carries an additional 5' hairpin (G = 40 kcal/mol) downstream from the CMV promoter. pCVC (construct C) is a bicistronic vector containing the CAT gene as a first cistron upstream from the VEGF-CAT fusion in the pVC construct. pHCVC (construct D), derived from pCVC, contains a 5' hairpin (G = 40 kcal/mol) upstream from the first CAT cistron. (B) The constructs depicted in panel A were transiently transfected in COS-7 cells, and their expression was analyzed by Western immunoblotting using an anti-CAT antibody. The amount of transfected cell protein extract loaded on each lane was adjusted to the quantity of the mono- and bicistronic mRNAs present in each extract. The control (Ct) lane corresponds to untransfected COS-7 cells. The positions of CAT and VEGF-CAT proteins are indicated by arrows.

Localization of IRES A in the VEGF mRNA 5' UTR. A number of additional bicistronic constructs containing shortened intercistronic UTRs, with or without a 5' hairpin (Fig. 2A), were designed to more precisely localize the IRES structure in the VEGF mRNA 5' UTR. Identical amounts of each DNA construct were used to transfect COS-7 cells, and the level of protein synthesis was determined as described above. The same quantity of COS-7 cell protein extracts was loaded in all lanes.

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Mapping of the IRES by progressive deletions in the VEGF mRNA 5' UTR. (A) Schematic representation of the different deletions of the 5' leader performed in the bicistronic vectors pCVC and pHCVC. Only the pHCVC series is represented here. (B) Western immunoblotting was performed as described for Fig. 1B after transfection of COS-7 cells with the constructs detailed in panel A. The presence or absence of a hairpin in the vector, as well as the name of the vector, is indicated above each lane. The same quantity of COS-7 cell protein extract was loaded in all lanes. Positions of the CAT and VEGF-CAT proteins are indicated with arrows. (C) Representation of two bicistronic vectors containing another VEGF-CAT fusion in which nt 1 to 1046 (including the AUG codon) of the VEGF 5' leader are fused to the chimeric fCAT gene resulting from the translational fusion of part of the nucleolin gene with the CAT gene (9). These two plasmids were transfected in COS-7 cells, and the extracts were analyzed as described for Fig. 1B. The positions of the CAT and fCAT proteins are indicated with arrows.

Verification of the bicistronic mRNA integrity in transfected COS-7 cells. Bicistronic RNA integrity was assessed by RNase protection assays (see Materials and Methods) to rule out the possibility that the observed VEGF-CAT protein could be expressed from unexpected monocistronic mRNA generated by a cleavage or a cryptic promoter located in the VEGF 5' UTR. The protection experiments were performed with total RNA from COS-7 cells transfected with bicistronic or monocistronic constructs containing either the complete leader sequence, a deletion of the first 475 nt, or a deletion of the last 293 nt (Fig. 3A). Three probes, A, B, and C, with expected sizes of 1054, 748, and 572 nt were used for hybridization with transfected COS-7 total RNA before RNase digestion; they were expected to produce protected fragments of 1,017, 696, and 535 nt, respectively, after RNase digestion. The data presented in Fig. 3B show that the protected fragments are unique and of the expected sizes, thus demonstrating that the intercistronic region is full size in the bicistronic mRNA.

View larger version (33K): [in this window] [in a new window]   FIG. 3.   Verification of the integrity of the bicistronic mRNA by RNase protection assay. (A) Schematic representation of monocistronic vector pVC (construct 1) and bicistronic vectors pCVC and pCVC1 (constructs 2 and 3) used to generate RNA templates. The regions A', B', and C', protected by the three antisense RNA probes A, B, and C, are indicated. The RNA probes A, B, and C are slightly longer than the protected fragments because of the presence of additional nucleotides in the polylinker regions of the plasmids used as templates for the probes (see Materials and Methods). (B) Vectors shown in panel A were transfected in COS-7 cells. Total mRNAs were purified and analyzed by RNase A and T1 protection (see Materials and Methods), using the RNA probes A (1054 nt), B (748 nt), and C (572 nt), complementary to nt 1 to 1046, 1 to 745, and 475 to 1046, respectively. The first lane corresponds to a mix of the three probes alone, without RNase treatment. The RNA templates and probes used are indicated at the bottom. The fragments protected by the probes A, B, and C are notated as A' (1,017 nt), B' (690 nt), and C' (535 nt), respectively.

Characterization of the structural features of IRES A. Figure 4 shows the secondary structures, predicted by the Zuker procedure (6), of the entire or 293-bp fragment of the 5' UTR (nt 745 to 1038) demonstrated to be sufficient for IRES function (Fig. 2B). Extended base pairing is apparent all along this UTR fragment, bringing the AUG codon in the vicinity of the IRES A 5' region (nt 745 to 846). A stem-loop structure, called D5, bearing an unpaired GNRA (where N is C, G, A, or U and R is G or A; in this case GUGA) sequence is located in the first half of the leader between nt 416 and 434. This motif was shown to be common to picornavirus IRES and implicated in aphthovirus IRES function (32). Involvement of this predicted structure in the VEGF IRES activity is discussed later.

View larger version (46K): [in this window] [in a new window]   FIG. 4.   IRES A secondary predicted structures and sequence conservation in mammals. (A) Secondary structure of the complete VEGF mRNA 5' UTR predicted by the ESSA folding program (6). The 5' and 3' ends of the sequence corresponding to nt 1 and 1047, respectively, are indicated. Nucleotide positions and the IRES A predicted domains D1 to D4 are also indicated. D5 corresponds to a stem-loop structure bearing an unpaired loop-located GNRA sequence. (B) Secondary predicted structure of the IRES A. Nucleotide positions and the four domains D1 to D4 are indicated. The 5' and 3' ends of the region analyzed correspond to nt 745 to 1052, respectively. (C) Alignment of the cDNA sequence of the region corresponding to human IRES A with bovine, rat, and mouse VEGF cDNA sequences. The conserved regions are boxed. The D4 domain is indicated. Relative positions of the nucleotides aligned from the transcription start point of rat, human, and mouse cDNAs are indicated. The complete 5' UTR of bovine VEGF mRNA is not known.

cis elements involved in IRES A activity. The predicted structural data shown in Fig. 4 were used to design new deletions for further characterization of the VEGF IRES A. A new bicistronic vector was produced in which the LUCr gene was subcloned as the first cistron and the (LUCf) gene was subcloned as the second cistron (Fig. 5) to improve sensitivity and quantification of the assay. The VEGF complete or deleted 5' UTR (constructs pRVL1, pRVL2, and pRVL5), as well as new deleted fragments corresponding to removal of predicted domains D4 and D3 and the first 56 nt of IRES A (constructs pRVL2D4, pRVL3, and pRVL4, respectively), were introduced into the intercistronic region. Either a hairpin (G = 40 kcal/mol) or the encephalomyocarditis virus (EMCV) IRES (35) was introduced between the LUCr and LUCf genes as controls (construct pRHL or pREL, respectively). These plasmids were transfected in COS-7 cells as described above. The ratio between the activities of the two luciferase enzymes observed in the cell extracts was calculated and compared with the data obtained with the negative control construct pRHL (Fig. 5).

View larger version (18K): [in this window] [in a new window]   FIG. 5.   Characterization of IRES A cis-acting elements. Schematic drawing of the bicistronic vectors containing the LUCr gene as the first cistron, all or part of the VEGF mRNA leader sequence in the intercistronic region, and the LUCf gene as the second cistron. Construct pREL contains the EMCV IRES in the intercistronic region (positive control); construct pRHL contains a hairpin (G = 40 kcal/mol) in the intercistronic region (negative control). These plasmids were transfected in COS-7 cells, and luciferase activities were measured as described in Materials and Methods. On the right, the histogram and corresponding values represent the ratio between the LUCf/LUCr activities obtained with each construct and that obtained with pRHL. Each value represents the average of at least four independent transfection experiments.

Identification of cellular factors bound to VEGF 5' UTR and to IRES A. UV cross-linking experiments were performed with COS-7 cell extracts and different ³²P-labeled RNA probes corresponding to either the complete 5' UTR or deleted fragments of the 5' UTR (Fig. 6A) to identify cellular factors interacting with the VEGF 5' UTR and particularly with IRES A. As shown in Fig. 6B, the protein pattern differed according to the RNA probe used. The complete leader was able to bind at least nine proteins (Fig. 6B, lane A). Most of these proteins were able to bind to probe B, corresponding to the upstream part of the leader (lane B). In contrast, probes C, D, and E bound only a small number of proteins. Three major proteins migrating at 120, 100, and 85 kDa were detected with probes C and D, corresponding to the downstream part of the leader and both containing the IRES (lanes C and D, bands a, b, and c). Finally probe E, in which the D4 domain was deleted, was able to bind the p85 and the p120 proteins but not p100 (lane E). These results showed a correlation between the cross-linking of p100 to RNA and IRES activity and suggested a potential role of the 100-kDa protein in IRES function.

View larger version (31K): [in this window] [in a new window]   FIG. 6.   UV cross-linking of COS-7 cell proteins on the VEGF mRNA 5' UTR. (A) Drawing of the different 32P-labeled RNA probes, obtained from T7 in vitro transcription and corresponding to the complete or parts of the VEGF 5' UTR mRNA. Relative positions of the 5' and 3' ends of each probe are indicated. (B) UV cross-linking experiments performed with probes A to E. S10 COS-7 cell extracts were incubated with 106 cpm of the different probes followed by UV irradiation and treatment with RNases A and ONE (see Materials and Methods). The control (Ct) lane corresponds to proteinase K treatment of sample loaded in the first lane. Size markers are indicated. (C) 32P-labeled probes corresponding to VEGF probe A (complete 5' UTR) and to EMCV IRES were cross-linked with proteins extracted from S10 COS-7 cells, and the complex was immunoprecipitated with an anti-PTB antibody. The samples were analyzed before (CL) and after (I) immunoprecipitation. The use of a VEGF or EMCV probe is indicated above the lanes. PTB migration is indicated with an arrow.

The VEGF mRNA 5' UTR contains two distinct IRESs. It is clear from data presented in Fig. 2B and 5 that the complete 5' UTR behaved as a more efficient IRES than the IRES A fragment containing nt 745 to 1046. Furthermore, deletion of the D4 domain in the full-length 5' UTR led to a 30% reduced internal entry activity compared to that observed with the corresponding complete leader (data not shown), whereas the same deletion in the IRES A context almost abolished IRES activity. We also showed above that the binding of PTB occurred in the 5' part of the VEGF mRNA 5' UTR. These data led us to investigate the presence of a second IRES in the 5' part of the UTR.

View larger version (37K): [in this window] [in a new window]   FIG. 7.   Mapping of IRES B. (A) Schematic drawing of the bicistronic constructs containing the complete or truncated VEGF 5' UTR between the first CAT cistron and the second chimeric fCAT cistron (depicted in Fig. 2C). The 5' and 3' boundaries of the deletions are indicated. Western immunoblotting was performed (right) as described for Fig. 1B after transfection of COS-7 cells with plasmids A to E. The CAT and fCAT proteins are shown by arrows. The control (Ct) lane corresponds to untransfected cells. (B) Representation of bicistronic vectors containing a stable hairpin structure upstream from the LUCr gene (first cistron), fragments of the VEGF mRNA leader sequence in the intercistronic region, and the LUCf gene as the second cistron. The 5' and 3' boundaries of the deletions are indicated. These plasmids were transfected into COS-7 cells, and luciferase activities measured as described in Materials and Methods. On the right, the histogram and corresponding values represent the LUCf/LUCr activity ratio obtained with each construct and that obtained with pRHL. Each value represents the average of at least four independent transfection experiments.

PTB binding to IRES B is independent of IRES efficiency. As we had shown that PTB was the main protein bound to the upstream half of the VEGF RNA leader sequence (Fig. 6), we were prompted to see whether PTB interacted with IRES B. As for Fig. 6, this was investigated by UV cross-linking and immunoprecipitation experiments using several fragments of the 5' part of the leader with or without IRES activity as probes; the EMCV IRES was used as a control (Fig. 8). It was clearly apparent from these experiments that the RNA segments containing nt 91 to 189 and nt 134 to 483 were able to bind PTB with the same efficiency as the segment extending from nt 91 to 554 (Fig. 8, probes and lanes A, B, and C). In contrast, the fragment extending from nt 241 to nt 483 was no longer able to bind this protein (Fig. 8, probe and lane D). PTB binding to probe C was confirmed by immunoprecipitation with anti-PTB antibody (Fig. 8B, lane C).

View larger version (29K): [in this window] [in a new window]   FIG. 8.   UV cross-linking of COS-7 cell proteins on IRES B. (A) Top, drawing of the different 32P-labeled RNA probes, obtained from T7 in vitro transcription and corresponding to the complete or parts of the IRES B sequence. Relative positions of the 5' and 3' ends of each probe are indicated. Bottom, UV cross-linking experiments performed with probes A to D and a probe corresponding to the EMCV IRES (first lane). S10 COS-7 cell extracts were incubated with 1.5 × 106 cpm of the different probes followed by UV irradiation and treatment with RNases A and ONE (see Materials and Methods). Size markers are indicated. (B) Immunoprecipitation with an anti-PTB antibody of COS-7 cell protein extract cross-linked to EMCV and VEGF probes C and D (lane 1, 2, and 4). Lane 3 corresponds to a control immunoprecipitation of cell extract and probe C without previous cross-linking. UV cross-linking or absence of cross-linking before immunoprecipitation is indicated by a plus or a minus sign, respectively, below each lane.

Activities of the two IRESs in RRL. The ability of both IRESs to promote cap-independent translation in vitro was analyzed by using monocistronic RNA containing different fragments of the VEGF 5' UTR fused to the CAT gene. A cap-dependent control which corresponded to the leader deleted FGF-2 mRNA (53) was included. Equal amounts of uncapped and capped monocistronic mRNAs were transcribed in vitro for each construct and assayed for translation in RRL (Fig. 9B). Cap independence was evaluated by calculating the ratio of CAT expression obtained from uncapped versus capped mRNA (NC/C ratio) (Fig. 9B and C).

View larger version (39K): [in this window] [in a new window]   FIG. 9.   Activities of IRES A and IRES B in vitro. (A) Schematic drawing of the monocistronic vectors used as T7 polymerase templates. The in vitro transcriptions were performed in the presence or absence of a cap structure. In constructs A and F, the translation product is the chimeric VEGF-CAT protein depicted in Fig. 1A. In constructs B to E, the translation product is the CAT protein. In construct G, the translation product is the FGF-2 protein. (B) Identical quantities of the different capped or noncapped mRNAs were translated in RRL. The presence or absence of a cap structure in the mRNA is indicated by a plus or minus sign, respectively, below each lane, together with the construct used. (C) The lanes in panel B were quantified with PhosphorImager. The histogram indicates the ratio of the translation efficiency observed in uncapped RNA versus capped mRNA. The line corresponds to cap-independent translation initiation (ratio of 1). The experiment reported here is representative of five independent experiments.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

In this study, we demonstrate that the synthesis of VEGF, the major angiogenic factor, occurs through an internal ribosome entry site process. This observation, together with the previous discovery of an IRES in the mRNA of another important angiogenic factor, FGF-2 (53), suggests an involvement of IRES-dependent translation in the control of angiogenesis. It is also clearly apparent from our results that two IRESs are present in the 5' UTR of the VEGF mRNA and that they bind some different factors. This novel and interesting feature of VEGF mRNA suggests that VEGF expression is controlled at the translational level, probably in a specific way, by each of the two IRESs.

IRES A is located in a 293-nt-long fragment just upstream from the AUG codon (nt 745 to 1038 from the mRNA 5' end [Fig. 2]). Analysis of the cis elements involved in the activity of this IRES revealed a need for at least two elements: the 5' part of the IRES-containing fragment (IRES A 5' region, between nt 745 and 846) and the D4 domain (nt 858 to 907 [Fig. 5]). The D4 loop, containing nucleotides AGACA, differs from the sequences of the loop consensus motifs ACCC (21) and GNRA or CAAA (18, 32) conserved in picornavirus IRESs. The data from Fig. 5 also show a detectable but more marginal influence of the D3 domain (nt 917 to 1013) in IRES function. According to its AUG proximal location, this IRES seems to allow ribosome binding and translation initiation without scanning. This is reminiscent of the so-called type II IRESs described in the literature and including the cardiovirus IRESs (21).

IRES B is located in a 392-nt segment between nt 91 and 483 from the mRNA 5' end and exhibits optimal activity in the presence of nt 91 to 134 (Fig. 7). A 104-bp sequence limited by nt 379 and 483 is strictly necessary for IRES B activity. This sequence contains a predicted stem-loop structure bearing a GNRA motif, defined as an element shared by all picornavirus IRES (21, 32). The observation of such a predicted structure also suggests the presence of an IRES in this region. Although involvement of the motif would need to be confirmed, it seems that VEGF mRNA could be an example of cellular IRES the activity of which would require this unpaired GNRA sequence. Strikingly the 3' border of this IRES was located more than 500 nt from the AUG codon (position 1039). This is reminiscent of the picornavirus type I IRESs, in which the 3' border is located quite far upstream from the start codon (1). However, in IRES B, the spacer region, which does contain a second IRES, is longer than that of the picornavirus type I IRES, which is usually about 150 nt in length. Insertion of AUG codons in the poliovirus type I IRES, upstream from the authentic start codon, has demonstrated that ribosome scanning occurs from the IRES 3' border to reach the AUG codon (17). It cannot be excluded that this could be the case for VEGF IRES B, although the length of the spacer region and its predicted stable structure (Fig. 4) would argue against such a hypothesis. Alternatively, two other hypotheses can be proposed. One possibility is that the spacer region allows a jump between the IRES B and the AUG. Such a mechanism has been described for adenovirus (60) and cauliflower mosaic virus (12). In the case of adenovirus, the 5' part of the mRNA leader allows cap-independent translation to occur, while the 3' part is required for the jump. This hypothesis cannot be ruled out here. Another possibility is that the 5' part of the leader, although it contains an independent IRES, can also behave as an enhancer of IRES A. In this case, the two IRESs would together form a single super-IRES structure. Further investigations are necessary before we can choose between these hypotheses.

However, the existence of two independent IRESs is supported by their very different UV cross-linked protein patterns (Fig. 6). Interestingly, very few proteins are UV cross-linked to IRES A (Fig. 6). One, p100, seems to bind to the D4 domain, suggesting a potential role of this protein in IRES function.

Among the proteins which are bound to the 5' half of the VEGF mRNA leader (Fig. 6), most, including the PTB, are bound on the 5' part of IRES B (Fig. 8A). These experiments did not permit detection of protein whose binding was correlated to IRES B activity. This one-dimensional analysis was not, however, sufficient for conclusions to be drawn in an absence of IRES-specific protein, as different proteins may have the same electrophoretic mobility. Several proteins were bound to a polypyrimidine-rich sequence located between nt 189 and 241 (Fig. 8A; compare lanes B, C, and D). PTB is the major protein bound to the 5' part of the RNA leader, and its binding site was mapped to between nt 134 and 189, which suggests that it recognizes the short UUUC sequence present around position 172 of the leader, which corresponds to the PTB consensus binding site described for viral IRESs (19, 42). According to the predicted structural data, this consensus site is located in a paired sequence. However, whereas PTB plays a crucial role in the function of EMCV and foot-and-mouth disease IRESs (4, 23, 38), its binding to IRES B does not seem to be correlated to IRES activity. These data are consistent with several reports showing that PTB is not the universal internal entry factor and that its binding to RNA does not necessarily imply its requirement for IRES function (3, 24).

The occurrence of two IRESs in the VEGF mRNA, probably controlled by different factors, provides interesting possibilities for the regulation of VEGF expression at the translational level. As VEGF plays a central role in angiogenesis, its expression has to be finely regulated. Two independent IRES domains, sensitive to different environmental conditions or cellular contexts, could permit an additional degree of flexibility in the expression of this growth factor. It should also be mentioned that the VEGF 5' leader presents potential initiation codons located between the two IRESs, in the same open reading frame as the AUG 1039 initiation codon. It could thus be hypothesized that the upstream IRES controls the expression of longer VEGF isoforms, as has been observed for FGF-2 mRNA (53). However, the existence of such alternative VEGF isoforms remains to be demonstrated. It would also be interesting to know whether translation of the various splicing variants of VEGF mRNA is regulated differently by the two IRESs. Indeed, although we have shown that the second IRES does not extend downstream from the AUG codon, we cannot rule out that long-range interactions of IRES A or B with the downstream coding sequence of the messenger could affect or stabilize the IRES structure and influence its ribosome binding efficiency.

The discovery of IRESs in the mRNAs of two major angiogenic growth factors, VEGF and FGF-2, as well as in the mRNA of PDGF, a factor involved in vascular physiology, raises the question as to the possible involvement of this translation initiation mechanism in the control of angiogenesis. We have already shown that FGF-2 expression is translationally activated in response to stress or vascular lesion (8a, 54). Thus, the advantage of IRES-dependent regulation might be to allow an immediate response of the cell to exogenous stimuli. The control of such a process could have important repercussions in cardiovascular disease therapy.

The FGF-2 IRES seems to be constitutively activated in various transformed cell types (54), whereas c-myc is overexpressed in an IRES-dependent manner in Bloom's syndrome cells (58). The observation of an IRES-dependent translational activation of growth factor or proto-oncogene expression in tumors, added to previous descriptions of eIF4E-dependent translation enhancement (25, 27), favors the hypothesis that translational deregulation of gene expression may play a key role in cell transformation. Furthermore, it has been reported that overexpression of VEGF induces cell transformation in cooperation with FGF-2 (16). Thus, the existence of IRESs in both FGF-2 and VEGF mRNAs suggests that the processes leading to cell transformation and/or tumor neovascularization could involve an IRES-dependent activation of the expression of these angiogenic factors.