Previous Article | Next Article 
Molecular and Cellular Biology, November 1998, p. 6325-6339, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
RhoA-Binding Kinase
Translocation Is
Facilitated by the Collapse of the Vimentin Intermediate Filament
Network
Wun-Chey
Sin,1
Xiang-Qun
Chen,1
Thomas
Leung,1 and
Louis
Lim1,2,*
Glaxo-IMCB Group, Institute of Molecular and
Cell Biology, Singapore 117609, Singapore,1
and
Institute of Neurology, London WC1N 1PJ, United
Kingdom2
Received 22 April 1998/Returned for modification 21 May
1998/Accepted 19 August 1998
 |
ABSTRACT |
The regulation of morphological changes in eukaryotic cells is a
complex process involving major components of the cytoskeleton including actin microfilaments, microtubules, and intermediate filaments (IFs). The putative effector of RhoA, RhoA-binding kinase
(ROK
), is a serine/threonine kinase that has been implicated in the
reorganization of actin filaments and in myosin contractility. Here, we
show that ROK
also directly affects the structural integrity of IFs.
Overexpression of active ROK
, like that of RhoA, caused the collapse
of filamentous vimentin, a type III IF. A RhoA-binding-deficient, kinase-inactive ROK
inhibited the collapse of vimentin IFs induced by RhoA in HeLa cells. In vitro, ROK
bound and phosphorylated vimentin at its head-rod domain, thereby inhibiting the assembly of
vimentin. ROK
colocalized predominantly with the filamentous vimentin network, which remained intact in serum-starved cells. Treatment of cells with vinblastine, a microtubule-disrupting agent,
also resulted in filamentous vimentin collapse and concomitant ROK
translocation to the cell periphery. ROK
translocation did not occur
when the vimentin network remained intact in vinblastine-treated cells
at 4°C or in the presence of the dominant-negative RhoAN19 mutant.
Transient translocation of ROK
was also observed in cells subjected
to heat shock, which caused the disassembly of the vimentin network.
Thus, the translocation of ROK
to the cell periphery upon
overexpression of RhoAV14 or growth factor treatment is associated with
disassembly of vimentin IFs. These results indicate that Rho effectors
known to act on microfilaments may be involved in regulating the
assembly of IFs. Vimentin when phosphorylated also exhibits reduced
affinity for the inactive ROK
. The translocation of ROK
from IFs
to the cell periphery upon action by activated RhoA and ROK
suggests
that ROK
may initiate its own cascade of activation.
 |
INTRODUCTION |
Cells often undergo dramatic
cytoskeletal changes in response to extracellular signalling cues. The
Rho subfamily of small GTP binding proteins has emerged as the major
player in the regulation of actin cytoskeleton (29, 49).
Microinjection of family members RhoA, Rac, and Cdc42 into fibroblasts
promotes formation of actin microfilament-containing stress fibers,
lamellipodia, and filopodia, respectively (42, 58, 61, 62).
They also mediate actin reorganization in various processes such as
cytokinesis, motility, and exocytosis and play an essential role in
growth control and stress responses (71). Several
serine/threonine kinases which bind directly to the activated form of
the Rho proteins, including p21 Cdc42/Rac binding p21-activated kinase
PAK (53), RhoA-binding kinase
(ROK
) (46),
and myotonic dystrophy kinase-related Cdc42-binding kinase
(48), appear to act as effectors. For example, p21-activated kinase promotes morphological changes in
actin-containing structures consistent with a role
downstream of GTPases (52, 64). ROK
, which belongs to
a family of ~160-kDa ROKs (36, 46, 54), promotes formation
of stress fibers and focal adhesion complexes (2, 37, 47),
possibly through enhancing myosin contraction by inactivating myosin
phosphatase or phosphorylating myosin light chain (MLC) itself (4,
39, 44). ROK
also appears to stimulate transcription activity
(11). Recently, RhoA effectors have also been shown to
regulate intermediate filaments (IFs). ROK
/Rho-kinase is reported to
phosphorylate glial fibrillary acidic protein (GFAP) (41),
and protein kinase N (PKN) (3) affects the state of
neurofilaments by phosphorylation (56).
The role of RhoA-induced contractility in promoting assembly of focal
adhesions and stress fibers is also being actively pursued (7). Agents that increase contractility include growth
factors such as lysophosphatidic acid (LPA) and sphingosine-1-phosphate (SPP) and microtubule (MT)-depolymerizing agents such as vinblastine (17). Treatment of cells with these agents drives the
formation of RhoA-induced phenotypes such as an increase in stress
fiber bundles and focal adhesion assembly (19, 75). All
these phenotypes can be blocked by the Clostridium botulinum
C3 exoenzyme, which ADP ribosylates RhoA and inactivates it.
Contractility inhibitors such as butanedione-2-monoxime also inhibit
RhoA-induced phenotypes (14), leading to the suggestion that
RhoA-stimulated contractility is essential for formation of stress
fibers and focal adhesion assembly.
The reorganization of actin filaments is likely to be influenced by
other components of the cytoskeleton; the increase in stress fibers
when MTs are depolymerized by vinblastine is an example (5).
Depolymerization of MTs causes the collapse of type III IFs into a
perinuclear cap (23). IFs are one of the three main
components of the cytoskeleton. Vimentin, a type III IF protein, is
found abundantly in the perinuclear region of the cells. Although IFs
appear to have a significant role in maintaining the integrity of
cytoplasm, their regulatory mechanism is not well understood. Three
separate domains can be identified in most IF proteins: the head, the
central helical coiled-coil/rod, and the nonhelical tail domain. The
central helical domain appears to interact with other rod domains via
hydrophobic interactions to form oligomers (23). However,
the head domain seems to be the regulatory region affecting the
polymerization of IFs (68). Vimentin is an excellent in
vitro target of a number of kinases, notably protein kinase A (PKA),
protein kinase C (PKC), and cdc2 (34). Reorganization of IFs
comprising vimentin during mitosis is thought to be mediated by
phosphorylation of its head domain by cdc2 (20). The
phosphorylation of vimentin by kinases, which include some RhoA
effectors (41, 56), appears to be a major mediator of the
dynamics of IFs, and the assembly of IFs is likely to affect the
stability of other major cytoskeletal systems.
Here we report that ROK
acts as a common effector of RhoA in
promoting reorganization of both microfilaments and IFs. Overexpression of ROK
caused the collapse of vimentin-containing IFs.
Regulating the state of vimentin IFs by phosphorylation appears to
provide a means of affecting the distribution of ROK
.
Endogenous ROK
colocalized preferentially with the vimentin network
in serum-starved cells. The collapse of IFs caused by activated ROK
resulted in the release of IF-bound ROK
, which was subsequently
translocated from the vimentin network to the peripheral sites. The
results suggest a novel mechanism in which the IFs are utilized by a
RhoA effector kinase to regulate its own distribution.
 |
MATERIALS AND METHODS |
Microinjection and transfection.
HeLa cells were transfected
by the calcium phosphate method (9). Microinjections and
subsequent immunostaining were carried out as described by Leung et al.
(47). Briefly, subconfluent cells plated on coverslips for
48 h in minimal essential medium with 10% fetal bovine serum
(FBS) were microinjected with plasmid DNA (50 ng/µl) by using an
Eppendorf micromanipulator system. Two hours after injection, cells
were fixed with 3.7% paraformaldehyde and incubated in
phosphate-buffered saline (PBS)-0.5% Triton X-100 for 2 h at
25°C with various primary antibodies: antihemagglutinin (anti-HA)
(Santa Cruz) and either anti-vimentin monoclonal antibody (MAb)
(vim13.2; Sigma; 1:200) or antivinculin MAb (hVIN-1; Sigma; 1:200),
followed by secondary antibodies of rhodamine-conjugated anti-rabbit
immunoglobulin G (IgG) (1:50; Boehringer Mannheim) and fluorescein
isothiocyanate (FITC)-conjugated anti-mouse IgG (1:100; Boehringer
Mannheim) for 1 h at 25°C. In some experiments, when glutathione
S-transferase (GST) fusion protein (RhoAG14V; 0.2 µg/µl)
was injected 2 to 3 h after the first plasmid injection, cells
were double stained with rabbit anti-GST and mouse antivimentin 20 min
postinjection.
Immunofluorescence microscopy.
Swiss 3T3 fibroblasts were
cultured in chamber slides in Dulbecco's modified Eagle's medium with
10% FBS. HeLa cells were cultured in minimal essential medium
containing 10% FBS. They were serum starved for 24 h and were
either left untreated or treated with SPP (Sapphire Bioscience) at 1 µM for 20 min or vinblastine (Sigma) at 50 µg/ml for 40 min.
Treated cells were washed once with PBS, fixed with 3.7%
paraformaldehyde for 20 min, and permeabilized in 0.5% Triton X-100
for 10 min. Methanol with the addition of 5 mM EDTA was also used as a
fixing agent at
20°C for 10 min. For single staining of vimentin,
antivimentin MAb (1:200; Sigma) was used. For double-staining
experiments, the fixed cells were incubated simultaneously with mouse
anti-ROK
antibody 1A1 (46) and goat antivimentin (1:50;
Sigma). The slides were washed with PBS-0.1% Triton X-100 and
incubated with appropriate secondary antibodies; FITC-conjugated
anti-mouse IgG (1:100; Boehringer Mannheim) was used for single primary
antibody staining, and FITC-conjugated anti-goat IgG (1:100; Sigma) and
tetramethyl rhodamine isothiocyanate (TRITC)-conjugated anti-mouse IgG
(1:50; Boehringer Mannheim) were used for double staining. Actin
filaments were visualized with TRITC-conjugated phalloidin (1 µg/ml;
Sigma). MTs were visualized by anti-
-tubulin MAb (TUB 2.1; Sigma;
1:200). In certain cases, the microtubular networks of the cells were
disrupted by preincubation with 0.5% Triton X-100 in 10 mM Tris (pH
7.8)-0.14 M NaCl-5 mM MgCl2 for 4 min at 37°C, as
described by Osborn and Weber (59), before fixation. In
competition experiments, the primary antibody was first incubated at
room temperature for 1 h with a fivefold excess of purified
vimentin protein or GST protein. Heat shock treatment of HeLa cells was
carried out at 43°C for 20 min. Conventional fluorescence microscopy
was done with a microscope (model Axioplan2; Carl Zeiss, Inc.) with a
40× 1.3 oil immersion objective. Confocal microscopy was performed
with a scan head (model MRC600; Bio-Rad Laboratories) connected to a
microscope (model Axiophot; Carl Zeiss, Inc.) with epifluorescence
optics.
Expression and purification of recombinant proteins.
The
recombinant proteins for various domains of ROK
were constructed as
follows. The mung bean nuclease blunt-ended NdeI fragment of
a truncated cDNA (46) containing the helical domain of
ROK
(amino acids 321 to 971) was digested with EcoRI and
subcloned into XmnI-EcoRI-digested pMal-c2 vector
(New England Biolabs) to be expressed as a 100-kDa maltose-binding
protein (MBP) fusion protein. Both the kinase and the kinase-dead
domain (KD) MBP fusion were obtained by ligating the
BamHI-XbaI fragment (amino acids 1 to 468) of
full-length ROK
or the full-length mutated ROK
construct
(47) into pMal-c2 cut with BamHI-XbaI
to be expressed as an 80-kDa protein. The
XmnI-SalI fragment of an N-terminally truncated
cDNA (46) containing the pleckstrin homology
(PH)-cysteine-rich domain of ROK
(amino acids 1059 to 1379) was
ligated to the SmaI-SalI digest of pGEX.4T1
(Pharmacia) to be expressed as a 50-kDa protein. GST-vimentin head
domain (amino acids 1 to 120) was obtained by first carrying out a PCR
on EST 535450 Bluescript clone with primers T7 and 5'
CTTCGGATCCATGTCTACCAGGTCTGTG; the PCR fragment was double digested with BamHI-XhoI and subcloned into
pGEX.4T1 vector similarly digested to be expressed as a 40-kDa protein.
The MBP and the GST fusion proteins were purified according to the
manufacturer's protocol.
For expression of GST-ROK
full-length protein in insect Sf9 cells, a
GST tag was added to the original pfast-Bac vector (Clontech) for easy
purification. The BamHI-EcoRI fragment (amino
acids 1 to 1379) of full-length ROK
in pXJ40 was subcloned into the
BamHI-EcoRI site of pfast-Bac. To clone the GST
cassette into pfast-Bac already carrying the insert, a pair of primers
(5' GAAACAAGATGTATGTCCCCTATACTAGGTTATTGG and 5'
GAATTCCGGGGATCCACGCGGAACCAG) flanking the 5' and 3' ends of the
DNA sequence encoding the GST protein was used for the PCR. The 680-bp
fragment obtained was double digested with BglII and
BamHI so that it was cloned in frame to the ROK
cDNA at
the 5' BamHI site. Purification of the GST-ROK
was
carried out as follows. Insect cells were infected at a multiplicity of
infection of 10 and harvested after 48 h. The GST fusion protein
was purified with glutathione-Sepharose (Pharmacia) according to the
manufacturer's protocol.
Purification of native proteins.
The purification of native
ROK
from rat brains was carried out as described elsewhere
(46). Crude vimentin was obtained from Swiss 3T3 cells and
further purified by one cycle of assembly-disassembly, based on the
protocol reported by Zackroff and Goldman (74).
In vitro kinase assay.
One microgram of vimentin was
incubated with 200 ng of kinase for 1 h at 30°C in a reaction
mixture containing 25 mM Tris (pH 7.0), 0.5 mM MgCl2, 10 µM ATP, and 10 µCi of [
-33P]ATP (Amersham). The
reaction was stopped by addition of an equal volume of 2× sample
buffer and then separated on a sodium dodecyl sulfate-10%
polyacrylamide gel electrophoresis (SDS-10% PAGE) gel. The
phosphorylated proteins were visualized by autoradiography with Kodak
MS film. In some instances, RhoA was preexchanged with either GTP
S
[guanosine 5'-O-(3-thiotriphosphate)] or GDP, as described
by Leung et al. (46), before being added to the kinase mixture. Quantification of the phosphorylation was carried out with an
imaging analyzer (BioImager; Kodak). The phosphorylated vimentin in the
kinase reaction was cleaved with 2-nitro-5-thiocyanobenzoic acid (NTCB)
at its sole cysteine residue, as described by Suga et al.
(67), to a 37-kDa head-rod domain and an 18-kDa tail domain.
The phosphorylated fragments were then separated by SDS-PAGE and
visualized by silver staining and autoradiography.
In vitro polymerization of IFs.
The polymerization of IFs
was carried out as described by Inagaki et al. (33).
Briefly, 5 µg of purified vimentin was first phosphorylated as
described above with 200 ng of kinase but in the presence of unlabelled
0.1 mM ATP. To initiate the polymerization, 150 mM NaCl was added and
the mixture was incubated at 25°C for 1 h. The filaments were
pelleted at 20,000 × g for 30 min. The samples were
separated by SDS-PAGE and visualized by Coomassie blue staining.
In vitro binding assay.
Exogenous vimentin (100 µg/ml) was
incubated with 1 µg of various recombinant proteins already coupled
to Sepharose beads in the presence of 100 µg of bovine serum albumin
(BSA) per ml in buffer V (1% Nonidet P-40, 0.5% deoxycholate, 50 mM
NaCl, 5 mM EDTA, 50 mM Tris [pH 7.4], 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 10 µg each of leupeptin and aprotinin
per ml). After incubation for 2 h at 4°C, the beads were washed
five times with buffer V and the bound proteins were eluted in 2×
SDS-Laemmli sample buffer. The proteins were separated on an SDS-PAGE
gel and Western transferred to a nitrocellulose filter. The filter was
probed with mouse antivimentin antibody, followed by horseradish peroxidase-conjugated anti-mouse antibody (Dako) according to standard
procedures, and the bands were visualized with ECL chemiluminescence (Amersham).
Overlay binding assay.
The assay was mainly based on the
method described by Foisner et al. (21). Briefly, purified
vimentin from Swiss 3T3 cells was partially cleaved with chymotrypsin
in 5 mM sodium borate buffer (pH 8.5) at a protease/vimentin mass ratio
of 1:400 at room temperature for 5 min. Alternatively, recombinant
GST-vimentin head domain was phosphorylated by PKA in the presence of
0.1 mM ATP as described above. The samples were then subjected to
SDS-PAGE and Western blotted to nitrocellulose filters. The filters
were first blocked in buffer containing 0.05% Triton X-100 and 3% BSA in PBS for at least 1 h and then overlaid with 1 µg of either MBP alone or MBP fusion of the ROK
KD (MBP-KD) per ml overnight in
0.05% Triton X-100-1% BSA in PBS at 4°C. For detection of bound MBP-ROK
fusion proteins, the filters were probed with anti-MBP antibody (Santa Cruz) and detected by ECL as described above.
 |
RESULTS |
ROK
induces the collapse of IFs.
Overexpressed ROK
mimicked RhoA in inducing actin reorganization (2, 37, 47).
Microinjection of a DNA plasmid encoding the active kinase domain of
ROK
into the nuclei of HeLa cells induced an increase in stress
fibers within 2 h. The microtubular network is not affected by
overexpression of both RhoA and ROK
(47, 60). However,
the activated RhoA mutant, RhoAV14, causes the collapse of vimentin IFs
into irregular thick bundles in subconfluent fibroblasts
(60). We examined whether ROK
could mediate the effects
of RhoA on the vimentin IF network. Microinjection of full-length
wild-type ROK
induced the collapse of vimentin IFs in Swiss 3T3
fibroblasts (Fig. 1A, a and
b). The IF collapse
induced by ROK
is similar to that induced by microinjection of PKA
into fibroblasts (45). A truncated ROK
consisting of the
kinase domain displayed marked increased kinase activity compared to that of the full-length ROK
(47). Microinjection of this
constitutive active kinase into fibroblasts resulted in the complete
collapse of the IF network to form a vimentin-containing arc near the
perinuclear region when the cell shape remained unchanged (Fig. 1A, c
and d). Expression of the microinjected DNA plasmids was confirmed with
anti-HA antibody which recognized the fusion tag. Microinjection of
full-length ROK
and active kinase domain of ROK
, which were previously used to demonstrate ROK
induction of stress fibers and
focal adhesions, also caused the collapse of vimentin IFs in HeLa cells
(Fig. 1A, e to h). The greater effectiveness of the kinase domain is
related to its enhanced kinase activity. Thus, fibroblasts and HeLa
cells were identical in their responses to overexpressed ROK
, and
HeLa cells were then used to facilitate analysis of RhoA-induced IF
collapse. The complete collapse of vimentin IFs induced by the
constitutively active ROK
was comparable to that induced by the
activated RhoA mutant, RhoAV14 (Fig. 1B, a and b); therefore, the
kinase activity of ROK
is sufficient for inducing the collapse of
the IF network in vivo. To determine whether ROK
is acting
downstream of RhoA in causing the collapse of vimentin IFs, a
kinase-dead, RhoA-binding-deficient mutant (ROK
K112A/N1027T/K1028T) (47) which did not cause
the collapse of IFs when overexpressed was used (Fig. 1B, c and d). To
coexpress this ROK
mutant with RhoAV14, the HA-tagged plasmid
encoding the mutant was injected into HeLa cells 2 to 3 h before
the injection of GST-RhoAV14 fusion protein. The presence of
kinase-dead, RhoA-binding-deficient ROK
abolished the RhoA-induced
IF collapse (Fig. 1B, e and f), probably through the ROK
mutant
acting as a dominant-negative inhibitor of endogenous ROK
. This
result suggests that ROK
mediates the effect of RhoA in inducing
collapse of IFs.

View larger version (65K):
[in this window]
[in a new window]

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 1.
ROK is involved in RhoA-induced collapse of IFs. (A)
Subconfluent Swiss 3T3 fibroblasts (a to d) were cultured on glass
coverslips and microinjected with plasmid encoding HA-tagged
full-length wild-type ROK (a and b) or the kinase domain of
ROK (1-543) (c and d). HeLa cells (e to h) were similarly injected
with DNA encoding full-length wild-type HA-tagged ROK (e and f) or
the kinase domain of ROK (1-543) (g and h). Two hours after
incubation, cells were fixed and double stained with anti-HA antibody
(a, c, e, and g) and antibodies against vimentin (b, d, f, and h) to
detect injected cells (arrowheads). (B) Subconfluent HeLa cells were
cultured on glass coverslips and microinjected first with plasmid
encoding kinase-dead, RhoA-binding-deficient HA-tagged
ROK K112A/N1027T/K1028T mutant (c to f). Two hours later, some of
these cells were also injected with GST-RhoAG12V and incubated for 20 min (e and f). Control cells were injected with GST-RhoAG12V (a and b)
and ROK mutant construct alone (c and d). Cells were fixed and
stained with antibodies against vimentin (b, d, and f) and double
stained with either rhodamine-conjugated anti-HA to detect cells
expressing ROK K112A/N1027T/K1028T (c) or rhodamine-conjugated
anti-GST to detect cells injected with GST-RhoAG12V (a and e).
Arrowheads indicate the injected cells located by HA or GST staining
and visualized by confocal microscopy. Bars = 15 µm.
|
|
Phosphorylation of vimentin by ROK
.
The dynamics of
vimentin IFs are regulated by phosphorylation (34), and some
of the putative kinases involved are PKA and PKC. Because kinase
activity of ROK
is needed for the collapse of IFs, we examined
whether vimentin is a substrate of ROK
. Vimentin protofilaments
purified from Swiss 3T3 fibroblasts were phosphorylated by native
ROK
purified from rat brains (Fig.
2A). Vimentin was phosphorylated less
efficiently by ROK
than by PKA, with the phosphorylation
stoichiometry of ROK
and PKA being 0.35 and 1.35 mol of phosphate
per mol of vimentin, respectively. The molar phosphate incorporated by
PKA was consistent with the value obtained by others (35).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Phosphorylation of vimentin by ROK . (A)
Phosphorylation was carried out in a standard kinase assay in the
presence of 10 µCi of [ -33P]ATP with 200 ng of
ROK or PKA and 1 µg of purified vimentin (arrow). PKA was used as
a positive control. C, negative control without kinase. (B) Kinase
assay with 200 ng of GST-ROK purified from insect cells and 1 µg
of vimentin (arrow) in the absence (lane 1) or in the presence of
RhoA-GTP S (lane 2) and RhoA-GDP (lane 3). (C) Vimentin is
phosphorylated at its head-rod domain. Vimentin phosphorylated by
ROK and PKA as described for panel A was subjected to NTCB digestion
which cleaved vimentin at its only cysteine residue to a 37-kDa
head-rod domain (black arrow) and an 18-kDa tail domain (black
arrowhead). The phosphorylated fragments were then separated by
SDS-PAGE and visualized by silver staining and autoradiography.
Undigested vimentin is indicated by a white arrowhead. (D) Effect of
phosphorylation on the state of vimentin. Vimentin (5 µg) purified
from Swiss 3T3 fibroblasts was first phosphorylated as in the standard
kinase assay with either PKA or ROK in the presence of 0.1 mM ATP.
Then it was induced to polymerize in vitro by the addition of 150 mM
NaCl, and the mixture was incubated for 1 h at 25°C. Vimentin
filaments (arrow) were pelleted at 20,000 × g for 30 min. Supernatant (S) and pellet (P) fractions were separated by
SDS-PAGE and visualized by Coomassie blue staining. C, control.
|
|
We next checked whether the phosphorylation of vimentin by ROK

could
be enhanced by the addition of RhoA-GTP

S. The kinase
activity of
native ROK

could not be further stimulated with RhoA,
possibly
because of the exposure of ROK

to RhoA-GTP

S used for
its
purification (
46). We therefore expressed recombinant
full-length
GST-ROK

(180 kDa) in insect cells and then purified it
by affinity
chromatography with glutathione-Sepharose. This GST-ROK

was active
towards vimentin (Fig.
2B, lane 1). The addition of
RhoA-GTP

S
to the kinase mixture increased the phosphorylation of
vimentin
by GST-ROK

by 3-fold (Fig.
2B, lane 2) while RhoA-GDP
increased
it 1.5-fold (Fig.
2B, lane 3), as determined by densitometry.
To localize the region phosphorylated by ROK

, vimentin was cleaved
at its only cysteine residue with NTCB (
67). Cleavage
of
mouse vimentin at this internal cysteine site (
8) results
in
a fragment of 327 amino acids spanning the head-rod region
and a
fragment of 138 amino acids including the tail domain. PKA
was used as
a control because it phosphorylates only at the head
domain of vimentin
(
25). Figure
2C shows the phosphorylation
pattern of
NTCB-digested vimentin. The two upper ROK

-phosphorylated
bands
correspond to the undigested vimentin and the head-rod domain
with an
apparent molecular mass of 37 kDa, respectively; both
are also present
in the PKA-phosphorylated preparation, which
in addition contains other
phosphorylated products. The lower
band with an apparent molecular mass
of approximately 18 kDa corresponds
to the tail region, which was not
phosphorylated by either PKA
or ROK

. Thus, ROK

, like PKA,
phosphorylated vimentin at its
N-terminal head-rod domain.
Phosphorylation of IFs usually resulted in their disassembly in vitro
(
12,
13,
35). To determine whether phosphorylation
of
vimentin affects its polymerization ability in a similar fashion,
vimentin was first phosphorylated by either PKA or ROK

and
polymerization
was then initiated in vitro by addition of 150 mM NaCl
(
33).
In preparations not treated with kinase, a substantial
amount
of vimentin was pelleted down at 20,000 ×
g in
30 min, indicating
that vimentin protofilaments had polymerized to form
filaments.
There was a marked inhibition of the polymerization of
vimentin
phosphorylated by PKA (which acted as a control) and by
ROK

,
with most of the vimentin remaining in the supernatant fraction
(Fig.
2D). Thus, ROK

affects the state of vimentin by
phosphorylation
in vitro and in vivo, the latter as shown by the
microinjection
studies.
ROK
associates with vimentin in vitro.
Certain kinases,
such as PKC, were reported to phosphorylate and to associate with
vimentin (66). To determine whether ROK
could associate
with vimentin in vitro, various domains of ROK
expressed in
Escherichia coli were incubated with vimentin (Fig. 3A and
B). Both the KD and the kinase domain of
ROK
bound to vimentin (Fig. 3B, lanes 2 and 3). Surprisingly, there
was no interaction between rod domains of ROK
and vimentin, the
coiled-coil helical domain of ROK
binding weakly to vimentin (Fig.
3B, lane 4). Vimentin did not interact with the C-terminal region of
ROK
containing the PH and the cysteine/histidine-rich domains (Fig. 3B, lane 6). The p21 binding domain has no affinity for vimentin (data
not shown). Vimentin associated with less affinity with full-length
ROK
(Fig. 3B, lane 7); this might be due to possible intramolecular
interactions between the domains of ROK
(47), preventing
full access of vimentin to its binding sites in ROK
in vitro.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Association of ROK and vimentin in vitro. (A) A
schematic diagram of ROK . BD, p21 binding domain; PH/CRD,
PH/cysteine-rich domain. (B) Purified vimentin from Swiss 3T3 cells was
incubated with MBP or GST fusion proteins containing different domains
of ROK . The lanes include MBP (lane 1), MBP-ROK kinase domain
(lane 2), MBP-ROK KD (lane 3), MBP-ROK helical coiled-coil domain
(lane 4), GST (lane 5), GST-PH/cysteine-rich domain (lane 6), and
GST-full-length ROK (lane 7). An aliquot of the original mixture was
loaded in lane M. The proteins were precipitated with amylose-Sepharose
beads (lanes 1 to 4) or glutathione-Sepharose beads (lanes 5 to 7),
separated by SDS-PAGE, analyzed by Western blotting, and monitored by
ECL to detect the bound vimentin (arrow) with antivimentin antibody.
(C) Binding of ROK to the head domain of vimentin. A filter overlay
was carried out on a nitrocellulose filter containing purified vimentin
digested in the presence or absence of chymotrypsin. The filter was
first overlaid with 1 µg of MBP or MBP-KD (kinase-dead domain of
ROK ) (amino acids 1 to 468) per ml and then probed with rabbit
anti-MBP and horseradish peroxidase-conjugated anti-rabbit IgG
antibodies. The filter was reprobed with antivimentin antibody to
confirm the location of the proteins. (D) The ROK KD has reduced
affinity for phosphorylated vimentin. GST-vimentin head domain (1 µg)
purified from E. coli was phosphorylated in the presence or
absence of ATP, subjected to the same overlay treatment with either MBP
or MBP-KD as probe as described for panel C, and immunostained with
anti-MBP antibody. Film images were digitized with a Microtek scanner,
cropped, converted to gray scale with Adobe Photoshop 4.0, and printed
with an Epson Stylus Color 800 inkjet printer.
|
|
To determine the region in vimentin involved in the association
with ROK

, a solid-phase binding assay was carried out. Limited
digestion of vimentin with chymotrypsin generates a 40-kDa fragment
which is more resistant to the digestion than is the amino terminus
(i.e., the head domain) (
21). The digested proteins were
separated
by SDS-PAGE, transferred to a nitrocellulose filter, and then
overlaid with the KD of ROK

. As shown in Fig.
3C, MBP fusion
of the
ROK

KD (amino acids 1 to 468) bound to the undigested
vimentin but
not to the chymotrypsin-digested vimentin lacking
the amino terminus.
Thus, we conclude that ROK

bound to the head
domain of vimentin, as
does PKN, another RhoA-binding serine/threonine
kinase (
56).
To determine whether the phosphorylation state
of vimentin affects
ROK

binding, an overlay on phosphorylated
and unphosphorylated
GST-vimentin head domain fusion protein was
carried out (Fig.
3D). The
binding of the kinase-inactive ROK
to vimentin was markedly reduced
upon phosphorylation of the IF
protein.
ROK
colocalizes with vimentin filaments in Swiss 3T3
fibroblasts.
We then checked whether ROK
could associate with
vimentin in intact cells. Immunolocalization was carried out on Swiss
3T3 fibroblasts and HeLa cells. The MAb to the kinase domain of ROK
recognized a single protein in both fibroblasts and HeLa cell extracts
(data not shown). ROK
was mainly cytoplasmic in HeLa cells under
most culture conditions (see Fig. 5A, a). In contrast, ROK
had a
cytoplasmic distribution in actively growing fibroblasts (Fig. 4A,
a) and was redistributed to a
filamentous structure when the cells were serum
starved for 24 h (Fig. 4A, c). The decrease of stress fibers
caused by serum deprivation is shown in Fig. 4A, b and d. The same
filamentous structure was recognized by antivimentin antibodies (Fig.
4B, a and b) when costaining was carried out. Since MTs and IFs can
coalign in some instances (28), the microtubular network was
first disrupted with Triton X-100-containing buffer before the
cells were fixed (59). The anti-ROK
and antivimentin antibodies recognized virtually identical structures (Fig. 4B, c and
d), confirming that ROK
colocalized with vimentin IFs in fibroblasts. However, the staining with anti-ROK
was more discrete than that obtained with antivimentin, dotting the filamentous network.
The staining of the filamentous network by anti-ROK
antibody was not
due to cross-reactivity of the antibody, since the staining could not
be removed with a fivefold excess of vimentin as the competing antigen
(Fig. 4C, a), which considerably reduced staining with antivimentin
(Fig. 4C, b). Anti-ROK
antibody did not cross-react with vimentin by
Western immunoblotting, even at 1-µg levels (data not shown). A
separate MAb to ROK
(2G1) also gave the same filamentous pattern in
fibroblasts (data not shown).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of ROK to vimentin IFs. (A)
Redistribution of ROK after serum starvation. Swiss 3T3 fibroblasts
grown in 10% serum-containing medium for 2 days (a and b) or serum
starved for 24 h (c and d) were fixed with methanol and stained
with anti-ROK followed by FITC-conjugated anti-mouse antibody (a and
c) or fixed with paraformaldehyde and stained with TRITC-conjugated
phalloidin (b and d) to detect actin stress fibers. (B) Confluent Swiss
3T3 fibroblasts grown in serum-free medium for 24 h were double
stained with mouse anti-ROK (a) and goat antivimentin (b).
Fibroblasts after extraction with 0.5% Triton X-100 were double
stained with mouse anti-ROK (c) or goat antivimentin (d). (C)
Anti-ROK does not cross-react with vimentin. A competition
experiment was performed by incubating the respective primary
antibodies with a fivefold excess of purified vimentin and then
staining cells with anti-ROK (a) and antivimentin (b). Bar = 15 µm.
|
|
The collapse of IFs is accompanied by ROK
translocation to the
cell periphery.
To determine the distribution of ROK
under
conditions in which IFs were collapsed, we made use of the
MT-depolymerizing agent, vinblastine. The most immediate effect of MT
disruption seems to be enhanced contractility, phosphorylation of MLC,
and RhoA-mediated increases in stress fibers and focal adhesions
(19, 40). All MT-disrupting agents are also known to cause
the collapse of type III IFs at the perinuclear cap (23). In
HeLa cells, vimentin IFs are the only IFs that collapse in the presence
of MT-disrupting agents, while keratin IFs are not affected
(22). When HeLa cells were treated with vinblastine, ROK
translocated to the submembranous zone of the cell periphery (Fig. 5A,
a and e). There was an
accompanying increase in actin stress fibers (Fig. 5A, b and f) and
vinculin staining (data not shown) in vinblastine-treated cells, as has been previously shown by others (19, 75). The IFs collapsed (Fig. 5A, c and g) and the MTs depolymerized to form paracrystals (Fig.
5A, d and h) after treatment of the cells with the drug. An identical
result was obtained with nocodazole, another MT-depolymerizing drug (data not shown). Thus, depolymerization of MTs was
accompanied by the collapse of IFs, an increase in stress fibers, and
the redistribution of ROK
to the cell edge. Translocated ROK
was more easily discernible in HeLa cells than in Swiss 3T3 fibroblasts (data not shown); it is not clear whether this is due to the large amount of cytoplasmic ROK
in serum-deprived HeLa cells compared to
that in 3T3 cells.

View larger version (96K):
[in this window]
[in a new window]

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 5.
Collapse of IFs is accompanied by ROK translocation.
(A) Vinblastine induces the collapse of IFs and the translocation of
ROK . HeLa cells were serum starved in 1% FBS overnight and left
untreated (a, b, c, and d) or treated with 50 µg of vinblastine per
ml for 40 min at 37°C (e, f, g, and h). The cells were stained with
anti-ROK (a and e), TRITC-conjugated phalloidin (b and f),
antivimentin (c and g), and antitubulin (d and h) followed by
FITC-conjugated anti-mouse IgG and visualized by immunofluorescence.
(B) HeLa cells were incubated at 4°C for 1 h (cold treatment),
and the cells were treated with 50 µg of vinblastine per ml for a
further 20 min at 4°C (a, b, and c) before fixation. Another group of
cells similarly treated was allowed to warm up to 37°C in the
presence of 50 µg of vinblastine per ml for an additional 40 min (d,
e, and f). The cells were stained with anti- -tubulin (a and d),
antivimentin (b and e), and anti-ROK (c and f), followed by
FITC-conjugated anti-mouse IgG. (C) Heat shock causes ROK to
translocate to the cell periphery. HeLa cells were heat shocked for 20 min at 43°C, fixed, and stained with anti-ROK (a), antivimentin
(b), anti- -tubulin (c), and TRITC-conjugated phalloidin (d). The
cells were allowed to recover for 2 h after heat shock and were
stained with anti-ROK (e) and antivimentin (f). Bar = 15 µm.
|
|
To determine whether the redistribution-translocation of ROK

is due
to the collapse of IFs and not to depolymerization of
MTs, we exploited
the finding that vinblastine at low temperatures
does not cause the
collapse of IFs although it is still capable
of depolymerizing MTs
(
32). The cells were incubated at 4°C
for 1 h before
being treated with 50 µg of vinblastine per ml
for a further 20 min
in the cold. The MT network was not affected
by the cold treatment in
the absence of drug (data not shown).
In the presence of vinblastine at
4°C, MTs were depolymerized
(Fig.
5B, a), but the vimentin network
remained relatively intact
(Fig.
5B, b). ROK

did not translocate to
the cell periphery under
this condition (Fig.
5B, c), and there was
also no increase in
stress fibers (data not shown). However, when the
cold- and vinblastine-treated
cells were further subjected to
vinblastine treatment at 37°C
for a further 40 min, MTs remained
depolymerized and the small
crystals previously observed in the cold
had fused to form paracrystals
of tubulin (Fig.
5B, d). The vimentin
network correspondingly
collapsed to form a perinuclear arc (Fig.
5B,
e), and ROK

translocated
to the cell periphery (Fig.
5B, f). Thus,
the translocation of
ROK

occurred only after the collapse of IFs
rather than on depolymerization
of MTs. Further evidence of this was
provided by heat shock treatment
of cells. There are a number of
cellular cytoskeletal changes
immediately after heat shock, one being
the collapse of IFs (
72).
Treatment of actively growing HeLa
cells at 43°C for 20 min caused
ROK

to translocate to the cell
edge (Fig.
5C, a) and the vimentin
network to disassemble into punctate
clusters (Fig.
5C, b). The
MT and actin networks were not apparently
affected (Fig.
5C, c
and d). This shows that the disassembly of IFs is
sufficient to
cause ROK

to translocate to the cell periphery. When
the cells
were left to recover for 2 h, the IF network started to
re-form
and ROK

ceased to concentrate at the cell periphery, showing
that this process was reversible (Fig.
5C, e and f).
ROK
has an active role in the collapse of IFs.
We next
examined whether ROK
has a direct role in causing the collapse of
IFs in vinblastine-treated cells. A plasmid encoding the
RhoA-binding-deficient, kinase-dead mutant
(ROK
K112A/N1027T/K1028T) was microinjected into HeLa
cells, and after 2 h to allow for the expression of the mutant
protein, the cells were treated with 50 µg of vinblastine per ml for
40 min. This dominant-negative ROK
inhibited vinblastine-induced
collapse of IFs (Fig. 6a and b) but did
not inhibit MT depolymerization (data not shown). This indicated that
ROK
has an active role in causing the collapse of IFs in
vinblastine-treated cells. Similarly, microinjection of the plasmid
encoding dominant-negative RhoAN19 blocked the collapse of IFs induced
by vinblastine (Fig. 6c and d), consistent with ROK
acting
downstream of RhoA in inducing IF collapse.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 6.
Kinase activity is required for vinblastine-induced
collapse of IFs. HeLa cells were microinjected with plasmid encoding
HA-tagged kinase-dead, RhoA-binding-deficient ROK K112A/N1027T/K1028T
(a and b) or HA-tagged RhoAN19 (c and d) for comparison. Two hours
after injection, cells were treated with vinblastine for 30 min,
fixed with methanol, and costained with rabbit anti-HA antibody (a and
c) and mouse antivimentin (b and d) to detect the injected cells
(arrowheads). This was followed with rhodamine-conjugated anti-rabbit
IgG and FITC-conjugated anti-mouse IgG, and cells were visualized by
immunofluorescence. Bar = 15 µm.
|
|
Redistribution of ROK
in the presence of RhoA-activating
agent.
MT-depolymerizing agents are known to activate RhoA
(19). We then tested growth factors that are known to
increase RhoA-GTP level, such as LPA and SPP (50). Treatment
of HeLa cells with SPP caused ROK
to translocate to the free edge of
subconfluent cells (Fig. 7A, a and
b). These cells also
showed an increase in stress fibers (Fig. 7A, c and d), as has been
previously shown by others. The translocation was still discernible
2 h after SPP treatment, unlike the translocation from the heat
shock treatment. Thus, activation of RhoA is necessary for ROK
to
remain membrane bound. A similar redistribution of ROK
occurred
after the addition of serum or LPA to the cells (data not shown). The
vimentin network appeared to contract partially in some SPP-treated
cells (Fig. 7A, e and f), perhaps because the stability of IFs in
growth factor-treated cells was affected by the increase in the
proportion of activated RhoA.

View larger version (118K):
[in this window]
[in a new window]

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 7.
Activation of RhoA causes a redistribution of ROK .
(A) SPP causes the translocation of ROK and affects IF stability.
HeLa cells were stimulated with SPP at 1 µM for 20 min at 37°C.
Cells were fixed with paraformaldehyde and stained with anti-ROK (a
and b) and TRITC-conjugated phalloidin (c and d). Untreated control or
SPP-treated cells were stained with antivimentin after methanol
fixation (e and f). (B) Translocation of ROK is inhibited by the
dominant-negative RhoAN19 mutant. HeLa cells were transfected with
plasmid encoding HA-tagged RhoAN19 and incubated for 24 h. The
cells were stimulated with 1 µM SPP for 20 min (a and b) or 50 µg
of vinblastine per ml for 40 min (c and d). The cells were fixed and
costained with anti-HA (a and c) and anti-ROK (b and d) to locate
the transfected cells. RhoAN19 overexpression (arrowheads) blocked the
translocation of ROK to the cell periphery (arrows). (C)
Translocated ROK overlaps with vinculin staining. HeLa cells were
transfected with full-length wild-type HA-tagged ROK and treated
with SPP as described for panel B. Cells were costained with anti-HA
(a) and antivinculin (b) to locate the transfected cells. Arrowheads
point to transfected cells located by HA staining. Bars = 15 µm.
|
|
ROK

translocation is RhoA dependent; the overexpression of RhoAN19
dominant-negative mutant abolished both SPP (Fig.
7B,
a and b)- and
vinblastine (Fig.
7B, c and d)-induced ROK

translocation.
RhoAN19
probably sequestered endogenous guanine nucleotide exchange
factors and
prevented the activation of endogenous RhoA. The dominant-negative
RacN17 and Cdc42N17 did not prevent the translocation of ROK
in
response to both factors (data not shown). The distribution
of the
translocated ROK

, when visualized by HA staining of transfected
HA-tagged full-length ROK

, appeared to overlap with that of the
more
discrete focal adhesions as determined by staining of vinculin
(Fig.
7C, a and b). Focal adhesions are increased dramatically
in the
presence of overexpressed ROK

(
47). Thus, translocated
ROK

accumulated at the cell edge undergoing active cytoskeletal
reorganization.
 |
DISCUSSION |
The RhoA binding kinases have been implicated in the
phosphorylation of the myosin binding subunit of the phosphatase and MLC, which leads to myosin contraction (4, 39, 44) and the
associated formation of stress fibers and focal adhesions (2, 37,
47). In addition to its effect on actin microfilaments, RhoA
induces changes in the IF network (60) and has recently been
shown to stabilize MTs (16). Here, we show that
overexpression of ROK
caused the collapse of the vimentin IF network
into tight bundles with no apparent disassembly of the microtubular
network, in addition to the formation of stress fibers. Since the
RhoA-binding-deficient, kinase-dead ROK
inhibits the collapse of IFs
induced by overexpression of RhoA, ROK
is probably working
downstream of RhoA in affecting the state of IFs. PKN has recently been
shown to associate with and to phosphorylate the neurofilament proteins
(56). Rho-associated kinase phosphorylates GFAP, an IF
protein expressed in astroglia (41). Thus, ROK
is part of
a rapidly enlarging family of RhoA-binding kinases that can potentially
affect the structural integrity of the IFs.
Disassembly of the vimentin IF network induced by PKA can progress from
the state of collapsed bundles to punctate clusters throughout the
cytoplasm (45). This disassembly, which probably requires
conformational changes in vimentin, is accompanied by increased
vimentin phosphorylation (13, 45) and is apparently regulated by site-specific phosphorylation at the head domain of
vimentin (13). The phosphorylation sites on the head domain of GFAP of Rho-associated kinase/ROK
and PKA are nearly identical (41, 68). While the manuscript was being reviewed, Goto et al. (27) reported that Rho-kinase (ROK
) phosphorylates
vimentin at Ser38 and Ser71, although Ser71 does not appear to be
phosphorylated in interphase cells. Since Ser38 is also one of the
major PKA phosphorylation sites (25, 68), it is then not
surprising that both ROK
and PKA can inhibit polymerization of
vimentin in vitro (Fig. 2D). Although phosphorylated vimentin often
remains soluble in vitro (12, 33), there is no increase in
soluble vimentin in fibroblasts upon PKA-induced collapse of IFs
(45), perhaps because of the presence of IF-associated
proteins, which prevents complete disassembly of the filamentous
network in vivo. Recently, the use of green fluorescent protein-tagged
vimentin showed that collapse of IF bundles did not necessarily involve reassembly near the nucleus but rather the network being pushed back
into the perinuclear region (31).
Our finding that ROK
colocalizes with intact vimentin IFs in Swiss
3T3 fibroblasts, probably in a catalytically inactive form (see above),
is in keeping with reports that many kinases appear to cluster around
their sites of action and to associate with various cellular structures
including cytoskeletal elements. Mixed-lineage kinase 2, for example,
has been found to colocalize with MTs (57), and a number of
kinases such as cyclic GMP-dependent protein kinase and PKC have a high
affinity for vimentin (51, 66, 73). When IFs were induced to
collapse by MT-disrupting agents or in the presence of RhoA-activating
factors, ROK
translocated to the cell periphery. Active RhoA is
necessary for ROK
translocation since, in SPP- and
vinblastine-treated HeLa cells, overexpression of the dominant-negative
mutant of RhoA inhibits the translocation. An intact filamentous
structure, presumably comprised largely of nonphosphorylated vimentin,
is apparently required for the continued association of ROK
with
vimentin IFs. Inactive ROK
(the kinase-dead mutant) has low affinity
for phosphorylated vimentin, suggesting that translocation of ROK
may be facilitated by its dissociation from vimentin filaments when
vimentin is phosphorylated.
In SPP-treated cells, translocated ROK
overlaps partially with
vinculin at the cell periphery. Indeed, RhoA is necessary to promote
vinculin association with the plasma membrane, and this could be
mediated by ROK
(11, 47). Several lines of evidence
suggest that membrane binding of ROK
is required for its activation.
For example, translocation of ROK
to target regions is essential for
it to induce neurite retraction in PC12 cells (38). ROCK (an
isoenzyme of ROK
) translocates to membrane-cytoskeletal complexes
upon cell stimulation (24). Once at the membrane, it is not
known whether other domains of ROK
, such as the PH domain, assist in
its anchorage, as in the case of SOS, whose PH domain is required for
membrane association (10). RhoA appears to localize
ezrin/radixin/moesin (ERM) to the apical membrane (65), and
its stimulation of ERM phosphorylation has been shown to be mediated by
ROK
(55). The latter authors suggest that ROK
has a
direct role in opening up ERM proteins to facilitate interaction with
actin, which could help in the anchoring of stress fibers.
We propose that translocation of ROK
to its sites of action may
involve its release from the IFs only when they are induced to collapse
by phosphorylation, as part of a coordinated cytoskeletal response to
extracellular stimuli (Fig. 8). In
serum-starved cells, ROK
in its inactivated form is preferentially
bound to IFs. Some ROK
may be present as unbound form in the cytosol
or at the membrane. These cells would be expected to contain much of
its RhoA in the GDP form. Exposure to serum, SPP, or LPA (the latter
two being also present in serum) results in conversion of RhoA to the
active GTP-bound form, which then activates ROK
. Because RhoA can be found in the membrane and cytosol irrespective of its state of activation (6, 43, 69, 70), it is not clear which
subcellular pool of ROK
is initially activated by RhoA. In any case,
this activated ROK
then phosphorylates vimentin, which has a reduced affinity for ROK
, thus releasing it. This released ROK
is then translocated and activated, most probably on the peripheral membrane, and acts on vimentin, resulting in yet more phosphorylation and further
release of previously bound ROK
. The collapse of IFs alone may be
sufficient to release ROK
for translocation, as heat shock induced
redistribution of ROK
to the periphery without an accompanying
increase in stress fibers. However, kinase activity of ROK
is
necessary to bring about the collapse since the kinase-dead mutant
inhibits vinblastine-induced collapse of IFs. ROK
appears to be in a
positive feedback loop such that increased amounts of ROK
could be
translocated to the cell edge, with the IFs acting as a depository for
ROK
. Receipt of additional signals that decrease the level of
RhoA-GTP, for instance, increased RhoGAP activity, will terminate the
feedback loop. The increase in contractility, which mostly results from
the phosphorylation of myosin binding subunit of phosphatase and of MLC
itself by ROK
, may be facilitated by the collapse of IFs. It is
possible that the formation of stress fibers, focal adhesions, and
contractility observed on MT disruption (19, 75) reflects
not a direct activation of Rho but rather an associated release of ROK
from IFs and its subsequent translocation (Fig. 5B) and activation.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 8.
A role for vimentin IFs as a reservoir of ROK .
Activated ROK performs many roles; two of those are shown here for
simplicity. Generation of RhoA-GTP by growth factors results in initial
activation of a free pool of ROK . Activated ROK then
phosphorylates vimentin on IFs, leading to the release of inactive
ROK , because of its reduced affinity for vimentin which is
phosphorylated. The released ROK is translocated to the periphery,
where it is activated upon binding to RhoA-GTP. This activated ROK
acts on IFs to accelerate their phosphorylation-disassembly, thus
releasing more ROK to be activated in a positive feedback loop.
Activated ROK also induces an overall increase in phosphorylated
MLC, from either the inactivation of myosin phosphatase or the
phosphorylation of MLC. These events lead to an increase in
myosin-based contractility and the subsequent formation of stress
fibers (SF) and assembly of focal adhesions (FA). It is possible that
contractility may also be enhanced by the disassembly of IFs. GAP,
GTPase-activating protein.
|
|
There is increasing evidence to suggest that regulating the dynamics of
IFs is important in various cellular processes (20, 23).
Stability of vimentin IFs is necessary for maintaining nuclear
morphology (63) and that of other cytoskeletal constituents, including actin microfilaments. Thus, unregulated destabilization of
vimentin IFs by microinjection of a mimetic peptide, whose sequence
corresponds to that of the N-terminal helical initiation 1A of
vimentin, into fibroblasts causes condensation of actin into large
aggregates and cell rounding (26). Cross-talk between IF and
other cytoskeletal components is evident, as in the treatment of
adrenal cells with calcium-calmodulin, which results in cell rounding
and the phosphorylation of both vimentin and MLC (1). In
vimentin knockout mice, which do not have an obvious phenotype but
nevertheless possess fragile fibroblasts (15, 26), it is
possible that there may be compensatory expression of other cytoskeletal elements. Furthermore, vimentin-deficient fibroblasts have
recently been shown to have impaired mechanical stability and
contractility (18).
It is clear that ROK
can influence diverse cytoskeletal events,
including contractility of myosin, the reorganization of actin
filaments, the structural status of IFs, and the regulation of ERM.
While this paper was being reviewed, it was reported that ROCK
influences the assembly of IFs, MTs, and actomyosin-based contractility
in neuronal cells (30). It is not unlikely that a common
signal can affect both the state of IFs and actomyosin contraction,
which has been proposed to underlie formation of stress fibers and
focal adhesions. Extensive IF disassembly is unlikely to occur in
normal nondividing cells; however, localized IF phosphorylation could
modulate the structure of IFs in specific areas of interphase cells
undergoing cytoskeletal changes. It is possible that ROK
has a role
in coordinating different components of the cytoskeleton, contributing
to a change in cell shape which requires the concerted movement of
major cytoskeletal elements.
 |
ACKNOWLEDGMENT |
We thank the Glaxo-Singapore Research Fund for support.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Glaxo-IMCB
Group, Institute of Molecular and Cell Biology, 30 Medical Dr.,
Singapore 117609, Singapore. Phone: (65) 874-6167. Fax: (65) 774-0742. E-mail: L.Lim{at}ion.ucl.ac.uk.
 |
REFERENCES |
| 1.
|
Almahbobi, G.,
M. Korn, and P. F. Hall.
1994.
Calcium/calmodulin induces phosphorylation of vimentin and myosin light chain and cell rounding in cultured adrenal cells.
Eur. J. Cell Biol.
63:307-315[Medline].
|
| 2.
|
Amano, M.,
K. Chihara,
K. Kimura,
Y. Fukata,
N. Nakamura,
Y. Matsuura, and K. Kaibuchi.
1997.
Formation of actin stress fibers and focal adhesions enhanced by Rho-kinase.
Science
275:1308-1311[Abstract/Free Full Text].
|
| 3.
|
Amano, M.,
H. Mukai,
Y. Ono,
K. Chihara,
T. Matsui,
Y. Hamajima,
K. Okawa,
A. Iwamatsu, and K. Kaibuchi.
1996.
Identification of a putative target for Rho as the serine-threonine kinase protein kinase N.
Science
271:648-650[Abstract].
|
| 4.
|
Amano, M.,
M. Ito,
K. Kimura,
Y. Fukata,
K. Chihara,
T. Nakano,
Y. Matsuura, and K. Kaibuchi.
1996.
Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase).
J. Biol. Chem.
271:20246-20249[Abstract/Free Full Text].
|
| 5.
|
Bershadsky, A.,
A. Chausovsky,
E. Becker,
A. Lyubimova, and B. Geiger.
1996.
Involvement of microtubules in the control of adhesion-dependent signal transduction.
Curr. Biol.
6:1279-1289[Medline].
|
| 6.
|
Boukharov, A. A., and C. M. Cohen.
1998.
Guanine nucleotide-dependent translocation of RhoA from cytosol to high affinity membrane binding sites in human erythrocytes.
Biochem. J.
330:1391-1398.
|
| 7.
|
Burridge, K.,
M. Chrzanowska-Wodnicka, and C. Zhong.
1997.
Focal adhesion assembly.
Trends Cell Biol.
7:342-347.
[Medline] |
| 8.
|
Capetanaki, Y.,
I. Kuisk,
K. Rothblum, and S. Starnes.
1990.
Mouse vimentin: structural relationship to fos, jun, CREB, and tpr.
Oncogene
5:645-655[Medline].
|
| 9.
|
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 10.
|
Chen, R.-H.,
S. Corbalan-Garcia, and D. Bar-Sagi.
1997.
The role of the PH domain in the signal-dependent membrane targeting of Sos.
EMBO J.
16:1351-1359[Medline].
|
| 11.
|
Chihara, K.,
M. Amano,
N. Nakamura,
T. Yano,
M. Shibata,
T. Tokui,
H. Ichikawa,
R. Ikebe,
M. Ikebe, and K. Kaibuchi.
1997.
Cytoskeletal rearrangements and transcriptional activation of c-fos serum response element by Rho-kinase.
J. Biol. Chem.
272:25121-25127[Abstract/Free Full Text].
|
| 12.
|
Chou, Y.-H.,
E. Rosevear, and R. D. Goldman.
1989.
Phosphorylation and disassembly of intermediate filaments in mitotic cells.
Proc. Natl. Acad. Sci. USA
86:1885-1889[Abstract/Free Full Text].
|
| 13.
|
Chou, Y.-H.,
P. Opal,
R. A. Quinlan, and R. D. Goldman.
1996.
The relative roles of specific N- and C-terminal phosphorylation sites in the disassembly of intermediate filament in mitotic BHK-21 cells.
J. Cell Sci.
109:817-826[Abstract].
|
| 14.
|
Chrzanowska-Wodnicka, M., and K. Burridge.
1996.
Rho-stimulated contractility drives the formation of stress fibers and focal adhesions.
J. Cell Biol.
133:1403-1415[Abstract/Free Full Text].
|
| 15.
|
Colucci-Guyon, E.,
M.-M. Portier,
I. Dunia,
D. Paulin,
S. Pournin, and C. Babinet.
1994.
Mice lacking vimentin develop and reproduce without an obvious phenotype.
Cell
79:679-694[Medline].
|
| 16.
|
Cook, T. A.,
T. Nagasaki, and G. G. Gundersen.
1998.
Rho guanosine triphosphatase mediates the selective stabilization of microtubules induced by lysophosphatidic acid.
J. Cell Biol.
141:175-185[Abstract/Free Full Text].
|
| 17.
|
Danowski, B. A.
1989.
Fibroblast contractility and actin organization are stimulated by microtubule inhibitors.
J. Cell Sci.
83:255-266.
|
| 18.
|
Eckes, B.,
D. Dogic,
E. Colucci-Guyon,
N. Wang,
A. Maniotis,
D. Ingber,
A. Merckling,
F. Langa,
M. Aumailley,
A. Delouvee,
V. Koteliansky,
C. Babinet, and T. Krieg.
1998.
Impaired mechanical stability, migration and contractile capacity in vimentin-deficient fibroblasts.
J. Cell Sci.
111:1897-1907[Abstract].
|
| 19.
|
Enomoto, T.
1996.
Microtubule disruption induces the formation of actin stress fibers and focal adhesions in cultured cells: possible involvement of the Rho signal cascade.
Cell Struct. Funct.
21:317-326[Medline].
|
| 20.
|
Foisner, R.
1997.
Dynamic organisation of intermediate filaments and associated proteins during the cell cycle.
Bioessays
19:297-305[Medline].
|
| 21.
|
Foisner, R.,
F. E. Leichtfried,
H. Herrmann,
J. V. Small,
D. Lawson, and G. Wiche.
1988.
Cytoskeleton-associated plectin: in situ localization, in vitro reconstitution, and binding to immobilized intermediate filament proteins.
J. Cell. Biol.
106:723-733[Abstract/Free Full Text].
|
| 22.
|
Franke, W. W.,
E. Schmid,
M. Osborn, and K. Weber.
1978.
Different intermediate-sized filaments distinguished by immunofluorescence microscopy.
Proc. Natl. Acad. Sci. USA
75:5034-5038[Abstract/Free Full Text].
|
| 23.
|
Fuchs, E., and K. Weber.
1994.
Intermediate filaments: structure, dynamics, function and disease.
Annu. Rev. Biochem.
63:345-382[Medline].
|
| 24.
|
Fujita, A.,
Y. Saito,
T. Ishizaki,
M. Maekawa,
K. Fujisawa,
F. Ushikubi, and S. Narumiya.
1997.
Integrin-dependent translocation of p160ROCK to cytoskeletal complex in thrombin-stimulated human platelets.
Biochem. J.
328:769-775.
|
| 25.
|
Geisler, N.,
M. Hatzfeld, and K. Weber.
1989.
Phosphorylation in vitro of vimentin by protein kinases A and C is restricted to the head domain.
Eur. J. Biochem.
183:441-447[Medline].
|
| 26.
|
Goldman, R. D.,
S. Khuon,
Y. H. Chou,
P. Opal, and P. M. Steinert.
1996.
The function of intermediate filaments in cell shape and cytoskeletal integrity.
J. Cell Biol.
134:971-983[Abstract/Free Full Text].
|
| 27.
|
Goto, H.,
H. Kosako,
K. Tanabe,
M. Yanagida,
M. Sakurai,
M. Amano,
K. Kaibuchi, and M. Inagaki.
1998.
Phosphorylation of vimentin by Rho-associated kinase at a unique amino-terminal site that is specifically phosphorylated during cytokinesis.
J. Biol. Chem.
273:11728-11736[Abstract/Free Full Text].
|
| 28.
|
Gyoeva, F. K., and V. I. Gelfand.
1991.
Coalignment of vimentin intermediate filaments with microtubules depends on kinesin.
Nature (London)
353:445-448[Medline].
|
| 29.
|
Hall, A.
1998.
Rho GTPases and the actin cytoskeleton.
Science
279:509-514[Abstract/Free Full Text].
|
| 30.
|
Hirose, M.,
T. Ishizaki,
N. Watanabe,
M. Uehata,
O. Kranenburg,
W. H. Moolenaar,
F. Matsumura,
M. Maekawa,
H. Bito, and S. Narumiya.
1998.
Molecular dissection of the Rho-associated protein kinase (p160ROCK)-regulated neurite remodeling in neuroblastoma N1E-115 cells.
J. Cell Biol.
141:1625-1636[Abstract/Free Full Text].
|
| 31.
|
Ho, C.-L.,
J. L. Martys,
A. Mikhailov,
G. G. Gundersen, and R. K. H. Liem.
1998.
Novel features of intermediate filament dynamics revealed by green fluorescent protein chimeras.
J. Cell Sci.
111:1767-1778[Abstract].
|
| 32.
|
Hollenbeck, P. J.,
A. D. Bershadsky,
O. Y. Pletjushkina,
I. S. Tint, and J. M. Vasiliev.
1989.
Intermediate filament collapse is an ATP-dependent and actin-dependent process.
J. Cell Sci.
92:621-631[Abstract/Free Full Text].
|
| 33.
|
Inagaki, M.,
Y. Gonda,
M. Matsuyama,
K. Nishizawa,
Y. Nishi, and C. Sato.
1988.
Intermediate filament reconstitution in vitro.
J. Biol. Chem.
263:5970-5978[Abstract/Free Full Text].
|
| 34.
|
Inagaki, M.,
Y. Matsuoka,
K. Tsujimura,
S. Ando,
T. Tokui,
T. Takahashi, and N. Inagaki.
1996.
Dynamic property of intermediate filaments: regulation by phosphorylation.
Bioessays
18:481-487.
|
| 35.
|
Inagaki, M.,
Y. Nishi,
K. Nishizawa,
M. Matsuyama, and C. Sato.
1987.
Site-specific phosphorylation induces disassembly of vimentin filaments in vitro.
Nature (London)
328:649-652[Medline].
|
| 36.
|
Ishizaki, T.,
M. Maekawa,
K. Fujisawa,
K. Okawa,
A. Iwamatsu,
A. Fujita,
N. Watanabe,
Y. Saito,
A. Kakizuka,
N. Morii, and S. Narumiya.
1996.
The small GTP-binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic dystrophy kinase.
EMBO J.
15:1885-1893[Medline].
|
| 37.
|
Ishizaki, T.,
M. Naito,
K. Fujisawa,
M. Maekawa,
N. Watanabe,
Y. Saito, and S. Narumiya.
1997.
p160ROCK, a Rho-associated coiled-coil forming protein kinase, works downstream of Rho and induces focal adhesions.
FEBS Lett.
404:118-124[Medline].
|
| 38.
|
Katoh, H.,
J. Aoki,
A. Ichikawa, and M. Negishi.
1998.
p160 RhoA-binding kinase ROK induces neurite retraction.
J. Biol. Chem.
273:2489-2492[Abstract/Free Full Text].
|
| 39.
|
Kimura, K.,
M. Ito,
M. Amano,
K. Chihara,
Y. Fukata,
M. Nakafuku,
B. Yamamori,
J. Feng,
T. Nakano,
K. Okawa,
A. Iwamatsu, and K. Kaibuchi.
1996.
Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase).
Science
273:245-248[Abstract].
|
| 40.
|
Kolodney, M. S., and E. L. Elson.
1995.
Contraction due to microtubule disruption is associated with increased phosphorylation of myosin regulatory light chain.
Proc. Natl. Acad. Sci. USA
92:10252-10256[Abstract/Free Full Text].
|
| 41.
|
Kosako, H.,
M. Amano,
M. Yanagida,
K. Tanabe,
Y. Nishi,
K. Kaibuchi, and M. Inagaki.
1997.
Phosphorylation of glial fibrillary acidic protein at the same sites by cleavage furrow kinase and Rho-associated kinase.
J. Biol. Chem.
272:10333-10336[Abstract/Free Full Text].
|
| 42.
|
Kozma, R.,
S. Ahmed,
A. Best, and L. Lim.
1995.
The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts.
Mol. Cell. Biol.
15:1942-1952[Abstract].
|
| 43.
|
Kranenburg, O.,
M. Poland,
M. Gebbink,
L. Oomen, and W. H. Moolenaar.
1997.
Dissociation of LPA-induced cytoskeletal contraction from stress fiber formation by differential localization of RhoA.
J. Cell Sci.
110:2417-2427[Abstract].
|
| 44.
|
Kureishi, Y.,
S. Kobayashi,
M. Amano,
K. Kimura,
H. Kanaide,
T. Nakano,
K. Kaibuchi, and M. Ito.
1997.
Rho-associated kinase directly induces smooth muscle contraction through myosin light chain phosphorylation.
J. Biol. Chem.
272:12257-12260[Abstract/Free Full Text].
|
| 45.
|
Lamb, N. J. C.,
A. Fernandez,
J. R. Feramisco, and W. J. Welch.
1989.
Modulation of vimentin containing intermediate filament distribution and phosphorylation in living fibroblasts by the cAMP-dependent protein kinase.
J. Cell Biol.
108:2409-2422[Abstract/Free Full Text].
|
| 46.
|
Leung, T.,
E. Manser,
L. Tan, and L. Lim.
1995.
A novel serine/threonine kinase binding the ras-related RhoA GTPases which translocates the kinase to peripheral membranes.
J. Biol. Chem.
270:29051-29054[Abstract/Free Full Text].
|
| 47.
|
Leung, T.,
X.-Q. Chen,
E. Manser, and L. Lim.
1996.
The p160 RhoA-binding kinase ROK is a member of a kinase family and is involved in the reorganization of the cytoskeleton.
Mol. Cell. Biol.
16:5313-5327[Abstract].
|
| 48.
|
Leung, T.,
X.-Q. Chen,
I. Tan,
E. Manser, and L. Lim.
1998.
Myotonic dystrophy kinase-related cdc42-binding kinase acts as a cdc42 effector in promoting cytoskeletal reorganization.
Mol. Cell. Biol.
18:130-140[Abstract/Free Full Text].
|
| 49.
|
Lim, L.,
E. Manser,
T. Leung, and C. Hall.
1996.
Regulation of phosphorylation pathways by p21 GTPases.
Eur. J. Biochem.
242:171-185[Medline].
|
| 50.
|
Machesky, L. M., and A. Hall.
1997.
Role of actin polymerization and adhesion to extracellular matrix in rac- and rho-induced cytoskeletal reorganization.
J. Cell Biol.
138:913-926[Abstract/Free Full Text].
|
| 51.
|
MacMillan-Crow, L. A., and T. M. Lincoln.
1994.
High-affinity binding and localization of the cyclic GMP-dependent protein kinase with the intermediate filament protein vimentin.
Biochemistry
33:8035-8043[Medline].
|
| 52.
|
Manser, E.,
H.-Y. Huang,
T.-H. Loo,
X.-Q. Chen,
J.-M. Dong,
T. Leung, and L. Lim.
1997.
Expression of constitutively active -PAK reveals effects of the kinase on actin and focal complexes.
Mol. Cell. Biol.
17:1129-1143[Abstract].
|
| 53.
|
Manser, E.,
T. Leung,
H. Salihuddin,
Z.-S. Zhao, and L. Lim.
1994.
A brain serine/threonine protein kinase activated by Cdc42 and Rac1.
Nature (London)
367:40-46[Medline].
|
| 54.
|
Matsui, T.,
M. Amano,
T. Yamamoto,
K. Chihara,
M. Nakafuku,
M. Ito,
T. Nakano,
K. Okawa,
A. Iwamatsu, and K. Kaibuchi.
1996.
Rho-associated kinase, a novel serine/threonine kinase, as a putative target for the small GTP binding protein Rho.
EMBO J.
15:2208-2216[Medline].
|
| 55.
|
Matsui, T.,
M. Maeda,
Y. Doi,
S. Yonemura,
M. Amano,
K. Kaibuchi,
S. Tsukita, and S. Tsukita.
1998.
Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association.
J. Cell Biol.
140:647-657[Abstract/Free Full Text].
|
| 56.
|
Mukai, H.,
M. Toshimori,
H. Shibata,
M. Kitagawa,
M. Shimakawa,
M. Miyahara,
H. Sunakawa, and Y. Ono.
1996.
PKN associates and phosphorylates the head-rod domain of neurofilament protein.
J. Biol. Chem.
271:9816-9822[Abstract/Free Full Text].
|
| 57.
|
Nagata, K.,
A. Puls,
C. Futter,
P. Aspenstrom,
E. Schaefer,
T. Nataka,
N. Hirokawa, and A. Hall.
1998.
The MAP kinase kinase kinase MLK2 co-localizes with activated JNK along microtubules and associates with kinesin superfamily motor KIF3.
EMBO J.
17:149-158[Medline].
|
| 58.
|
Nobes, C. D., and A. Hall.
1995.
Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia and filopodia.
Cell
81:53-62[Medline].
|
| 59.
|
Osborn, M., and K. Weber.
1982.
Immunofluorescence and immunocytochemical procedures with affinity purified antibodies: tubulin-containing structures.
Methods Cell Biol.
24:97-132[Medline].
|
| 60.
|
Paterson, H. F.,
A. F. Self,
M. D. Garrett,
I. Just,
K. Aktories, and A. Hall.
1990.
Microinjection of recombinant p21rho induces rapid changes in cell morphology.
J. Cell Biol.
111:1001-1007[Abstract/Free Full Text].
|
| 61.
|
Ridley, A. J., and A. Hall.
1992.
The small GTP binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors.
Cell
70:389-399[Medline].
|
| 62.
|
Ridley, A. J.,
H. F. Paterson,
C. L. Johnston,
D. Diekmann, and A. Hall.
1992.
The small GTP-binding protein rac regulates growth factor-induced membrane ruffling.
Cell
70:401-410[Medline].
|
| 63.
|
Sarria, A. J.,
J. G. Lieber,
S. K. Nordeen, and R. M. Evans.
1994.
The presence or absence of a vimentin-type intermediate filament network affects the shape of the nucleus in human SW-13 cells.
J. Cell Sci.
107:1593-1607[Abstract].
|
| 64.
|
Sells, M. A.,
U. F. Knaus,
S. Bagrodia,
D. M. Ambrose,
G. M. Bokoch, and J. Chernoff.
1997.
Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells.
Curr. Biol.
7:202-210.
|
| 65.
|
Shaw, R. J.,
M. Henry,
F. Solomon, and T. Jacks.
1998.
RhoA-dependent phosphorylation and relocalization of ERM proteins into apical membrane/actin protrusions in fibroblasts.
Mol. Biol. Cell
9:403-419[Abstract/Free Full Text].
|
| 66.
|
Spudich, A.,
T. Meyer, and L. Stryer.
1992.
Association of the beta isoform of protein kinase C with vimentin filaments.
Cell Motil. Cytoskelet.
22:250-256[Medline].
|
| 67.
|
Suga, S.,
M. Tsurudome,
S. Ohgimoto,
N. Tabata,
N. Watanabe,
M. Nishio,
M. Kawano,
H. Komada,
M. Sakurai, and Y. Ito.
1996.
Intracellular localization of antigens recognized by anti-vimentin monoclonal antibodies (mAbs): cross-reactivities of anti-vimentin mAbs with other cellular components.
Eur. J. Cell Biol.
70:84-91[Medline].
|
| 68.
|
Takai, Y.,
N. Inagaki,
O. Tsutsumi, and M. Inagaki.
1996.
Visualization and regulation of intermediate filament kinase activities.
Semin. Cell Dev. Biol.
7:741-749.
|
| 69.
|
Takaishi, K.,
T. Sasaki,
T. Kameyama,
S. Tsukita,
S. Tsukita, and Y. Takai.
1995.
Translocation of activated Rho from the cytoplasm to membrane ruffling area, cell-cell adhesion sites and cleavage furrows.
Oncogene
11:39-48[Medline].
|
| 70.
|
Takaishi, K.,
T. Sasaki,
H. Kotani,
H. Nishioka, and Y. Takai.
1997.
Regulation of cell-cell adhesion by Rac and Rho small G proteins in MDCK cells.
J. Cell Biol.
139:1047-1059[Abstract/Free Full Text].
|
| 71.
|
Van Aelst, L., and C. D'Souza-Schorey.
1997.
Rho GTPases and signaling networks.
Genes Dev.
11:2295-2322[Free Full Text].
|
| 72.
|
Welch, W. J., and J. P. Suhan.
1985.
Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after heat-shock treatment.
J. Cell Biol.
101:1198-1211[Abstract/Free Full Text].
|
| 73.
|
Wyatt, T. A.,
T. M. Lincoln, and K. B. Pryzwansky.
1991.
Vimentin is transiently colocalized with and phosphorylated by cyclic GMP-dependent protein kinase in formyl-peptide-stimulated neutrophils.
J. Biol. Chem.
266:21274-21280[Abstract/Free Full Text].
|
| 74.
|
Zackroff, R. V., and R. D. Goldman.
1979.
In vitro assembly of intermediate filaments from baby hamster kidney (BHK-21) cells.
Proc. Natl. Acad. Sci. USA
76:6226-6230[Abstract/Free Full Text].
|
| 75.
|
Zhang, Q.,
M. K. Magnusson, and D. F. Mosher.
1997.
Lysophosphatidic acid and microtubule-destabilizing agents stimulate fibronectin matrix assembly through Rho-dependent actin stress fiber formation and cell contraction.
Mol. Biol. Cell
8:1415-1425[Abstract].
|
Molecular and Cellular Biology, November 1998, p. 6325-6339, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tang, D. D.
(2009). p130 Crk-Associated Substrate (CAS) in Vascular Smooth Muscle. J CARDIOVASC PHARMACOL THER
14: 89-98
[Abstract]
-
Tang, D. D.
(2008). Intermediate filaments in smooth muscle. Am. J. Physiol. Cell Physiol.
294: C869-C878
[Abstract]
[Full Text]
-
Schmandke, A., Schmandke, A., Strittmatter, S. M.
(2007). ROCK and Rho: Biochemistry and Neuronal Functions of Rho-Associated Protein Kinases. Neuroscientist
13: 454-469
[Abstract]
-
Tamada, M., Perez, T. D., Nelson, W. J., Sheetz, M. P.
(2007). Two distinct modes of myosin assembly and dynamics during epithelial wound closure. JCB
176: 27-33
[Abstract]
[Full Text]
-
Wang, R., Li, Q.-F., Anfinogenova, Y., Tang, D. D.
(2007). Dissociation of Crk-associated substrate from the vimentin network is regulated by p21-activated kinase on ACh activation of airway smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol.
292: L240-L248
[Abstract]
[Full Text]
-
Li, Q.-F., Spinelli, A. M., Wang, R., Anfinogenova, Y., Singer, H. A., Tang, D. D.
(2006). Critical Role of Vimentin Phosphorylation at Ser-56 by p21-activated Kinase in Vimentin Cytoskeleton Signaling. J. Biol. Chem.
281: 34716-34724
[Abstract]
[Full Text]
-
Wang, R., Li, Q., Tang, D. D.
(2006). Role of vimentin in smooth muscle force development. Am. J. Physiol. Cell Physiol.
291: C483-C489
[Abstract]
[Full Text]
-
Morikage, N., Kishi, H., Sato, M., Guo, F., Shirao, S., Yano, T., Soma, M., Hamano, K., Esato, K., Kobayashi, S.
(2006). Cholesterol Primes Vascular Smooth Muscle to Induce Ca2 Sensitization Mediated by a Sphingosylphosphorylcholine-Rho-Kinase Pathway: Possible Role for Membrane Raft. Circ. Res.
99: 299-306
[Abstract]
[Full Text]
-
Loirand, G., Guerin, P., Pacaud, P.
(2006). Rho Kinases in Cardiovascular Physiology and Pathophysiology. Circ. Res.
98: 322-334
[Abstract]
[Full Text]
-
Tzima, E.
(2006). Role of Small GTPases in Endothelial Cytoskeletal Dynamics and the Shear Stress Response. Circ. Res.
98: 176-185
[Abstract]
[Full Text]
-
Marganski, W. A., Gangopadhyay, S. S., Je, H.-D., Gallant, C., Morgan, K. G.
(2005). Targeting of a Novel Ca+2/Calmodulin-Dependent Protein Kinase II Is Essential for Extracellular Signal-Regulated Kinase-Mediated Signaling in Differentiated Smooth Muscle Cells. Circ. Res.
97: 541-549
[Abstract]
[Full Text]
-
Yoneda, A., Multhaupt, H. A.B., Couchman, J. R.
(2005). The Rho kinases I and II regulate different aspects of myosin II activity. JCB
170: 443-453
[Abstract]
[Full Text]
-
Ehrenreiter, K., Piazzolla, D., Velamoor, V., Sobczak, I., Small, J. V., Takeda, J., Leung, T., Baccarini, M.
(2005). Raf-1 regulates Rho signaling and cell migration. JCB
168: 955-964
[Abstract]
[Full Text]
-
Lee, H.-H., Chien, C.-L., Liao, H.-K., Chen, Y.-J., Chang, Z.-F.
(2004). Nuclear efflux of heterogeneous nuclear ribonucleoprotein C1/C2 in apoptotic cells: a novel nuclear export dependent on Rho-associated kinase activation. J. Cell Sci.
117: 5579-5589
[Abstract]
[Full Text]
-
Kawabata, S., Usukura, J., Morone, N., Ito, M., Iwamatsu, A., Kaibuchi, K., Amano, M.
(2004). Interaction of Rho-kinase with myosin II at stress fibres. GENES CELLS
9: 653-660
[Abstract]
[Full Text]
-
Eriksson, J. E., He, T., Trejo-Skalli, A. V., Harmala-Brasken, A.-S., Hellman, J., Chou, Y.-H., Goldman, R. D.
(2004). Specific in vivo phosphorylation sites determine the assembly dynamics of vimentin intermediate filaments. J. Cell Sci.
117: 919-932
[Abstract]
[Full Text]
-
Shirao, S., Kashiwagi, S., Sato, M., Miwa, S., Nakao, F., Kurokawa, T., Todoroki-Ikeda, N., Mogami, K., Mizukami, Y., Kuriyama, S., Haze, K., Suzuki, M., Kobayashi, S.
(2002). Sphingosylphosphorylcholine Is a Novel Messenger for Rho-Kinase-Mediated Ca2+ Sensitization in the Bovine Cerebral Artery: Unimportant Role for Protein Kinase C. Circ. Res.
91: 112-119
[Abstract]
[Full Text]
-
Suzuki, T., Nakamoto, T., Ogawa, S., Seo, S., Matsumura, T., Tachibana, K., Morimoto, C., Hirai, H.
(2002). MICAL, a Novel CasL Interacting Molecule, Associates with Vimentin. J. Biol. Chem.
277: 14933-14941
[Abstract]
[Full Text]
-
Cau, J., Faure, S., Comps, M., Delsert, C., Morin, N.
(2001). A novel p21-activated kinase binds the actin and microtubule networks and induces microtubule stabilization. JCB
155: 1029-1042
[Abstract]
[Full Text]
-
Tan, I., Seow, K. T., Lim, L., Leung, T.
(2001). Intermolecular and Intramolecular Interactions Regulate Catalytic Activity of Myotonic Dystrophy Kinase-Related Cdc42-Binding Kinase {alpha}. Mol. Cell. Biol.
21: 2767-2778
[Abstract]
[Full Text]
-
Ridley, A. J.
(2001). Rho GTPases and cell migration. J. Cell Sci.
114: 2713-2722
[Abstract]
[Full Text]
-
Chou, Y.-H., Goldman, R. D.
(2000). Intermediate Filaments on the Move. JCB
150: F101-F106
[Abstract]
[Full Text]
-
Nakatani, Y., Tanioka, T., Sunaga, S., Murakami, M., Kudo, I.
(2000). Identification of a Cellular Protein That Functionally Interacts with the C2 Domain of Cytosolic Phospholipase A2alpha. J. Biol. Chem.
275: 1161-1168
[Abstract]
[Full Text]
-
Inada, H., Togashi, H., Nakamura, Y., Kaibuchi, K., Nagata, K.-i., Inagaki, M.
(1999). Balance between Activities of Rho Kinase and Type 1 Protein Phosphatase Modulates Turnover of Phosphorylation and Dynamics of Desmin/Vimentin Filaments. J. Biol. Chem.
274: 34932-34939
[Abstract]
[Full Text]
-
Meriane, M., Mary, S., Comunale, F., Vignal, E., Fort, P., Gauthier-Rouviere, C.
(2000). Cdc42Hs and Rac1 GTPases Induce the Collapse of the Vimentin Intermediate Filament Network. J. Biol. Chem.
275: 33046-33052
[Abstract]
[Full Text]
-
Guilherme, A., Emoto, M., Buxton, J. M., Bose, S., Sabini, R., Theurkauf, W. E., Leszyk, J., Czech, M. P.
(2000). Perinuclear Localization and Insulin Responsiveness of GLUT4 Requires Cytoskeletal Integrity in 3T3-L1 Adipocytes. J. Biol. Chem.
275: 38151-38159
[Abstract]
[Full Text]
-
Tan, I., Ng, C. H., Lim, L., Leung, T.
(2001). Phosphorylation of a Novel Myosin Binding Subunit of Protein Phosphatase 1 Reveals a Conserved Mechanism in the Regulation of Actin Cytoskeleton. J. Biol. Chem.
276: 21209-21216
[Abstract]
[Full Text]