INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Cells often undergo dramatic cytoskeletal changes in response to extracellular signalling cues. The Rho subfamily of small GTP binding proteins has emerged as the major player in the regulation of actin cytoskeleton (29, 49). Microinjection of family members RhoA, Rac, and Cdc42 into fibroblasts promotes formation of actin microfilament-containing stress fibers, lamellipodia, and filopodia, respectively (42, 58, 61, 62). They also mediate actin reorganization in various processes such as cytokinesis, motility, and exocytosis and play an essential role in growth control and stress responses (71). Several serine/threonine kinases which bind directly to the activated form of the Rho proteins, including p21 Cdc42/Rac binding p21-activated kinase PAK (53), RhoA-binding kinase  (ROK) (46), and myotonic dystrophy kinase-related Cdc42-binding kinase (48), appear to act as effectors. For example, p21-activated kinase promotes morphological changes in actin-containing structures consistent with a role downstream of GTPases (52, 64). ROK, which belongs to a family of ~160-kDa ROKs (36, 46, 54), promotes formation of stress fibers and focal adhesion complexes (2, 37, 47), possibly through enhancing myosin contraction by inactivating myosin phosphatase or phosphorylating myosin light chain (MLC) itself (4, 39, 44). ROK also appears to stimulate transcription activity (11). Recently, RhoA effectors have also been shown to regulate intermediate filaments (IFs). ROK/Rho-kinase is reported to phosphorylate glial fibrillary acidic protein (GFAP) (41), and protein kinase N (PKN) (3) affects the state of neurofilaments by phosphorylation (56).

The role of RhoA-induced contractility in promoting assembly of focal adhesions and stress fibers is also being actively pursued (7). Agents that increase contractility include growth factors such as lysophosphatidic acid (LPA) and sphingosine-1-phosphate (SPP) and microtubule (MT)-depolymerizing agents such as vinblastine (17). Treatment of cells with these agents drives the formation of RhoA-induced phenotypes such as an increase in stress fiber bundles and focal adhesion assembly (19, 75). All these phenotypes can be blocked by the Clostridium botulinum C3 exoenzyme, which ADP ribosylates RhoA and inactivates it. Contractility inhibitors such as butanedione-2-monoxime also inhibit RhoA-induced phenotypes (14), leading to the suggestion that RhoA-stimulated contractility is essential for formation of stress fibers and focal adhesion assembly.

The reorganization of actin filaments is likely to be influenced by other components of the cytoskeleton; the increase in stress fibers when MTs are depolymerized by vinblastine is an example (5). Depolymerization of MTs causes the collapse of type III IFs into a perinuclear cap (23). IFs are one of the three main components of the cytoskeleton. Vimentin, a type III IF protein, is found abundantly in the perinuclear region of the cells. Although IFs appear to have a significant role in maintaining the integrity of cytoplasm, their regulatory mechanism is not well understood. Three separate domains can be identified in most IF proteins: the head, the central helical coiled-coil/rod, and the nonhelical tail domain. The central helical domain appears to interact with other rod domains via hydrophobic interactions to form oligomers (23). However, the head domain seems to be the regulatory region affecting the polymerization of IFs (68). Vimentin is an excellent in vitro target of a number of kinases, notably protein kinase A (PKA), protein kinase C (PKC), and cdc2 (34). Reorganization of IFs comprising vimentin during mitosis is thought to be mediated by phosphorylation of its head domain by cdc2 (20). The phosphorylation of vimentin by kinases, which include some RhoA effectors (41, 56), appears to be a major mediator of the dynamics of IFs, and the assembly of IFs is likely to affect the stability of other major cytoskeletal systems.

Here we report that ROK acts as a common effector of RhoA in promoting reorganization of both microfilaments and IFs. Overexpression of ROK caused the collapse of vimentin-containing IFs. Regulating the state of vimentin IFs by phosphorylation appears to provide a means of affecting the distribution of ROK. Endogenous ROK colocalized preferentially with the vimentin network in serum-starved cells. The collapse of IFs caused by activated ROK resulted in the release of IF-bound ROK, which was subsequently translocated from the vimentin network to the peripheral sites. The results suggest a novel mechanism in which the IFs are utilized by a RhoA effector kinase to regulate its own distribution.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Microinjection and transfection. HeLa cells were transfected by the calcium phosphate method (9). Microinjections and subsequent immunostaining were carried out as described by Leung et al. (47). Briefly, subconfluent cells plated on coverslips for 48 h in minimal essential medium with 10% fetal bovine serum (FBS) were microinjected with plasmid DNA (50 ng/µl) by using an Eppendorf micromanipulator system. Two hours after injection, cells were fixed with 3.7% paraformaldehyde and incubated in phosphate-buffered saline (PBS)-0.5% Triton X-100 for 2 h at 25°C with various primary antibodies: antihemagglutinin (anti-HA) (Santa Cruz) and either anti-vimentin monoclonal antibody (MAb) (vim13.2; Sigma; 1:200) or antivinculin MAb (hVIN-1; Sigma; 1:200), followed by secondary antibodies of rhodamine-conjugated anti-rabbit immunoglobulin G (IgG) (1:50; Boehringer Mannheim) and fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG (1:100; Boehringer Mannheim) for 1 h at 25°C. In some experiments, when glutathione S-transferase (GST) fusion protein (RhoAG14V; 0.2 µg/µl) was injected 2 to 3 h after the first plasmid injection, cells were double stained with rabbit anti-GST and mouse antivimentin 20 min postinjection.

Immunofluorescence microscopy. Swiss 3T3 fibroblasts were cultured in chamber slides in Dulbecco's modified Eagle's medium with 10% FBS. HeLa cells were cultured in minimal essential medium containing 10% FBS. They were serum starved for 24 h and were either left untreated or treated with SPP (Sapphire Bioscience) at 1 µM for 20 min or vinblastine (Sigma) at 50 µg/ml for 40 min. Treated cells were washed once with PBS, fixed with 3.7% paraformaldehyde for 20 min, and permeabilized in 0.5% Triton X-100 for 10 min. Methanol with the addition of 5 mM EDTA was also used as a fixing agent at 20°C for 10 min. For single staining of vimentin, antivimentin MAb (1:200; Sigma) was used. For double-staining experiments, the fixed cells were incubated simultaneously with mouse anti-ROK antibody 1A1 (46) and goat antivimentin (1:50; Sigma). The slides were washed with PBS-0.1% Triton X-100 and incubated with appropriate secondary antibodies; FITC-conjugated anti-mouse IgG (1:100; Boehringer Mannheim) was used for single primary antibody staining, and FITC-conjugated anti-goat IgG (1:100; Sigma) and tetramethyl rhodamine isothiocyanate (TRITC)-conjugated anti-mouse IgG (1:50; Boehringer Mannheim) were used for double staining. Actin filaments were visualized with TRITC-conjugated phalloidin (1 µg/ml; Sigma). MTs were visualized by anti--tubulin MAb (TUB 2.1; Sigma; 1:200). In certain cases, the microtubular networks of the cells were disrupted by preincubation with 0.5% Triton X-100 in 10 mM Tris (pH 7.8)-0.14 M NaCl-5 mM MgCl₂ for 4 min at 37°C, as described by Osborn and Weber (59), before fixation. In competition experiments, the primary antibody was first incubated at room temperature for 1 h with a fivefold excess of purified vimentin protein or GST protein. Heat shock treatment of HeLa cells was carried out at 43°C for 20 min. Conventional fluorescence microscopy was done with a microscope (model Axioplan2; Carl Zeiss, Inc.) with a 40× 1.3 oil immersion objective. Confocal microscopy was performed with a scan head (model MRC600; Bio-Rad Laboratories) connected to a microscope (model Axiophot; Carl Zeiss, Inc.) with epifluorescence optics.

Expression and purification of recombinant proteins. The recombinant proteins for various domains of ROK were constructed as follows. The mung bean nuclease blunt-ended NdeI fragment of a truncated cDNA (46) containing the helical domain of ROK (amino acids 321 to 971) was digested with EcoRI and subcloned into XmnI-EcoRI-digested pMal-c2 vector (New England Biolabs) to be expressed as a 100-kDa maltose-binding protein (MBP) fusion protein. Both the kinase and the kinase-dead domain (KD) MBP fusion were obtained by ligating the BamHI-XbaI fragment (amino acids 1 to 468) of full-length ROK or the full-length mutated ROK construct (47) into pMal-c2 cut with BamHI-XbaI to be expressed as an 80-kDa protein. The XmnI-SalI fragment of an N-terminally truncated cDNA (46) containing the pleckstrin homology (PH)-cysteine-rich domain of ROK (amino acids 1059 to 1379) was ligated to the SmaI-SalI digest of pGEX.4T1 (Pharmacia) to be expressed as a 50-kDa protein. GST-vimentin head domain (amino acids 1 to 120) was obtained by first carrying out a PCR on EST 535450 Bluescript clone with primers T7 and 5' CTTCGGATCCATGTCTACCAGGTCTGTG; the PCR fragment was double digested with BamHI-XhoI and subcloned into pGEX.4T1 vector similarly digested to be expressed as a 40-kDa protein. The MBP and the GST fusion proteins were purified according to the manufacturer's protocol.

Purification of native proteins. The purification of native ROK from rat brains was carried out as described elsewhere (46). Crude vimentin was obtained from Swiss 3T3 cells and further purified by one cycle of assembly-disassembly, based on the protocol reported by Zackroff and Goldman (74).

In vitro kinase assay. One microgram of vimentin was incubated with 200 ng of kinase for 1 h at 30°C in a reaction mixture containing 25 mM Tris (pH 7.0), 0.5 mM MgCl₂, 10 µM ATP, and 10 µCi of [-³³P]ATP (Amersham). The reaction was stopped by addition of an equal volume of 2× sample buffer and then separated on a sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-10% PAGE) gel. The phosphorylated proteins were visualized by autoradiography with Kodak MS film. In some instances, RhoA was preexchanged with either GTPS [guanosine 5'-O-(3-thiotriphosphate)] or GDP, as described by Leung et al. (46), before being added to the kinase mixture. Quantification of the phosphorylation was carried out with an imaging analyzer (BioImager; Kodak). The phosphorylated vimentin in the kinase reaction was cleaved with 2-nitro-5-thiocyanobenzoic acid (NTCB) at its sole cysteine residue, as described by Suga et al. (67), to a 37-kDa head-rod domain and an 18-kDa tail domain. The phosphorylated fragments were then separated by SDS-PAGE and visualized by silver staining and autoradiography.

In vitro polymerization of IFs. The polymerization of IFs was carried out as described by Inagaki et al. (33). Briefly, 5 µg of purified vimentin was first phosphorylated as described above with 200 ng of kinase but in the presence of unlabelled 0.1 mM ATP. To initiate the polymerization, 150 mM NaCl was added and the mixture was incubated at 25°C for 1 h. The filaments were pelleted at 20,000 × g for 30 min. The samples were separated by SDS-PAGE and visualized by Coomassie blue staining.

In vitro binding assay. Exogenous vimentin (100 µg/ml) was incubated with 1 µg of various recombinant proteins already coupled to Sepharose beads in the presence of 100 µg of bovine serum albumin (BSA) per ml in buffer V (1% Nonidet P-40, 0.5% deoxycholate, 50 mM NaCl, 5 mM EDTA, 50 mM Tris [pH 7.4], 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 10 µg each of leupeptin and aprotinin per ml). After incubation for 2 h at 4°C, the beads were washed five times with buffer V and the bound proteins were eluted in 2× SDS-Laemmli sample buffer. The proteins were separated on an SDS-PAGE gel and Western transferred to a nitrocellulose filter. The filter was probed with mouse antivimentin antibody, followed by horseradish peroxidase-conjugated anti-mouse antibody (Dako) according to standard procedures, and the bands were visualized with ECL chemiluminescence (Amersham).

Overlay binding assay. The assay was mainly based on the method described by Foisner et al. (21). Briefly, purified vimentin from Swiss 3T3 cells was partially cleaved with chymotrypsin in 5 mM sodium borate buffer (pH 8.5) at a protease/vimentin mass ratio of 1:400 at room temperature for 5 min. Alternatively, recombinant GST-vimentin head domain was phosphorylated by PKA in the presence of 0.1 mM ATP as described above. The samples were then subjected to SDS-PAGE and Western blotted to nitrocellulose filters. The filters were first blocked in buffer containing 0.05% Triton X-100 and 3% BSA in PBS for at least 1 h and then overlaid with 1 µg of either MBP alone or MBP fusion of the ROK KD (MBP-KD) per ml overnight in 0.05% Triton X-100-1% BSA in PBS at 4°C. For detection of bound MBP-ROK fusion proteins, the filters were probed with anti-MBP antibody (Santa Cruz) and detected by ECL as described above.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

ROK induces the collapse of IFs. Overexpressed ROK mimicked RhoA in inducing actin reorganization (2, 37, 47). Microinjection of a DNA plasmid encoding the active kinase domain of ROK into the nuclei of HeLa cells induced an increase in stress fibers within 2 h. The microtubular network is not affected by overexpression of both RhoA and ROK (47, 60). However, the activated RhoA mutant, RhoAV14, causes the collapse of vimentin IFs into irregular thick bundles in subconfluent fibroblasts (60). We examined whether ROK could mediate the effects of RhoA on the vimentin IF network. Microinjection of full-length wild-type ROK induced the collapse of vimentin IFs in Swiss 3T3 fibroblasts (Fig. 1A, a and b). The IF collapse induced by ROK is similar to that induced by microinjection of PKA into fibroblasts (45). A truncated ROK consisting of the kinase domain displayed marked increased kinase activity compared to that of the full-length ROK (47). Microinjection of this constitutive active kinase into fibroblasts resulted in the complete collapse of the IF network to form a vimentin-containing arc near the perinuclear region when the cell shape remained unchanged (Fig. 1A, c and d). Expression of the microinjected DNA plasmids was confirmed with anti-HA antibody which recognized the fusion tag. Microinjection of full-length ROK and active kinase domain of ROK, which were previously used to demonstrate ROK induction of stress fibers and focal adhesions, also caused the collapse of vimentin IFs in HeLa cells (Fig. 1A, e to h). The greater effectiveness of the kinase domain is related to its enhanced kinase activity. Thus, fibroblasts and HeLa cells were identical in their responses to overexpressed ROK, and HeLa cells were then used to facilitate analysis of RhoA-induced IF collapse. The complete collapse of vimentin IFs induced by the constitutively active ROK was comparable to that induced by the activated RhoA mutant, RhoAV14 (Fig. 1B, a and b); therefore, the kinase activity of ROK is sufficient for inducing the collapse of the IF network in vivo. To determine whether ROK is acting downstream of RhoA in causing the collapse of vimentin IFs, a kinase-dead, RhoA-binding-deficient mutant (ROKK112A/N1027T/K1028T) (47) which did not cause the collapse of IFs when overexpressed was used (Fig. 1B, c and d). To coexpress this ROK mutant with RhoAV14, the HA-tagged plasmid encoding the mutant was injected into HeLa cells 2 to 3 h before the injection of GST-RhoAV14 fusion protein. The presence of kinase-dead, RhoA-binding-deficient ROK abolished the RhoA-induced IF collapse (Fig. 1B, e and f), probably through the ROK mutant acting as a dominant-negative inhibitor of endogenous ROK. This result suggests that ROK mediates the effect of RhoA in inducing collapse of IFs.

View larger version (65K): [in this window] [in a new window]   View larger version (78K): [in this window] [in a new window]   FIG. 1.   ROK is involved in RhoA-induced collapse of IFs. (A) Subconfluent Swiss 3T3 fibroblasts (a to d) were cultured on glass coverslips and microinjected with plasmid encoding HA-tagged full-length wild-type ROK (a and b) or the kinase domain of ROK(1-543) (c and d). HeLa cells (e to h) were similarly injected with DNA encoding full-length wild-type HA-tagged ROK (e and f) or the kinase domain of ROK(1-543) (g and h). Two hours after incubation, cells were fixed and double stained with anti-HA antibody (a, c, e, and g) and antibodies against vimentin (b, d, f, and h) to detect injected cells (arrowheads). (B) Subconfluent HeLa cells were cultured on glass coverslips and microinjected first with plasmid encoding kinase-dead, RhoA-binding-deficient HA-tagged ROKK112A/N1027T/K1028T mutant (c to f). Two hours later, some of these cells were also injected with GST-RhoAG12V and incubated for 20 min (e and f). Control cells were injected with GST-RhoAG12V (a and b) and ROK mutant construct alone (c and d). Cells were fixed and stained with antibodies against vimentin (b, d, and f) and double stained with either rhodamine-conjugated anti-HA to detect cells expressing ROKK112A/N1027T/K1028T (c) or rhodamine-conjugated anti-GST to detect cells injected with GST-RhoAG12V (a and e). Arrowheads indicate the injected cells located by HA or GST staining and visualized by confocal microscopy. Bars = 15 µm.

Phosphorylation of vimentin by ROK. The dynamics of vimentin IFs are regulated by phosphorylation (34), and some of the putative kinases involved are PKA and PKC. Because kinase activity of ROK is needed for the collapse of IFs, we examined whether vimentin is a substrate of ROK. Vimentin protofilaments purified from Swiss 3T3 fibroblasts were phosphorylated by native ROK purified from rat brains (Fig. 2A). Vimentin was phosphorylated less efficiently by ROK than by PKA, with the phosphorylation stoichiometry of ROK and PKA being 0.35 and 1.35 mol of phosphate per mol of vimentin, respectively. The molar phosphate incorporated by PKA was consistent with the value obtained by others (35).

View larger version (45K): [in this window] [in a new window]   FIG. 2.   Phosphorylation of vimentin by ROK. (A) Phosphorylation was carried out in a standard kinase assay in the presence of 10 µCi of [-33P]ATP with 200 ng of ROK or PKA and 1 µg of purified vimentin (arrow). PKA was used as a positive control. C, negative control without kinase. (B) Kinase assay with 200 ng of GST-ROK purified from insect cells and 1 µg of vimentin (arrow) in the absence (lane 1) or in the presence of RhoA-GTPS (lane 2) and RhoA-GDP (lane 3). (C) Vimentin is phosphorylated at its head-rod domain. Vimentin phosphorylated by ROK and PKA as described for panel A was subjected to NTCB digestion which cleaved vimentin at its only cysteine residue to a 37-kDa head-rod domain (black arrow) and an 18-kDa tail domain (black arrowhead). The phosphorylated fragments were then separated by SDS-PAGE and visualized by silver staining and autoradiography. Undigested vimentin is indicated by a white arrowhead. (D) Effect of phosphorylation on the state of vimentin. Vimentin (5 µg) purified from Swiss 3T3 fibroblasts was first phosphorylated as in the standard kinase assay with either PKA or ROK in the presence of 0.1 mM ATP. Then it was induced to polymerize in vitro by the addition of 150 mM NaCl, and the mixture was incubated for 1 h at 25°C. Vimentin filaments (arrow) were pelleted at 20,000 × g for 30 min. Supernatant (S) and pellet (P) fractions were separated by SDS-PAGE and visualized by Coomassie blue staining. C, control.

ROK associates with vimentin in vitro. Certain kinases, such as PKC, were reported to phosphorylate and to associate with vimentin (66). To determine whether ROK could associate with vimentin in vitro, various domains of ROK expressed in Escherichia coli were incubated with vimentin (Fig. 3A and B). Both the KD and the kinase domain of ROK bound to vimentin (Fig. 3B, lanes 2 and 3). Surprisingly, there was no interaction between rod domains of ROK and vimentin, the coiled-coil helical domain of ROK binding weakly to vimentin (Fig. 3B, lane 4). Vimentin did not interact with the C-terminal region of ROK containing the PH and the cysteine/histidine-rich domains (Fig. 3B, lane 6). The p21 binding domain has no affinity for vimentin (data not shown). Vimentin associated with less affinity with full-length ROK (Fig. 3B, lane 7); this might be due to possible intramolecular interactions between the domains of ROK (47), preventing full access of vimentin to its binding sites in ROK in vitro.

View larger version (27K): [in this window] [in a new window]   FIG. 3.   Association of ROK and vimentin in vitro. (A) A schematic diagram of ROK. BD, p21 binding domain; PH/CRD, PH/cysteine-rich domain. (B) Purified vimentin from Swiss 3T3 cells was incubated with MBP or GST fusion proteins containing different domains of ROK. The lanes include MBP (lane 1), MBP-ROK kinase domain (lane 2), MBP-ROK KD (lane 3), MBP-ROK helical coiled-coil domain (lane 4), GST (lane 5), GST-PH/cysteine-rich domain (lane 6), and GST-full-length ROK (lane 7). An aliquot of the original mixture was loaded in lane M. The proteins were precipitated with amylose-Sepharose beads (lanes 1 to 4) or glutathione-Sepharose beads (lanes 5 to 7), separated by SDS-PAGE, analyzed by Western blotting, and monitored by ECL to detect the bound vimentin (arrow) with antivimentin antibody. (C) Binding of ROK to the head domain of vimentin. A filter overlay was carried out on a nitrocellulose filter containing purified vimentin digested in the presence or absence of chymotrypsin. The filter was first overlaid with 1 µg of MBP or MBP-KD (kinase-dead domain of ROK) (amino acids 1 to 468) per ml and then probed with rabbit anti-MBP and horseradish peroxidase-conjugated anti-rabbit IgG antibodies. The filter was reprobed with antivimentin antibody to confirm the location of the proteins. (D) The ROK KD has reduced affinity for phosphorylated vimentin. GST-vimentin head domain (1 µg) purified from E. coli was phosphorylated in the presence or absence of ATP, subjected to the same overlay treatment with either MBP or MBP-KD as probe as described for panel C, and immunostained with anti-MBP antibody. Film images were digitized with a Microtek scanner, cropped, converted to gray scale with Adobe Photoshop 4.0, and printed with an Epson Stylus Color 800 inkjet printer.

ROK colocalizes with vimentin filaments in Swiss 3T3 fibroblasts. We then checked whether ROK could associate with vimentin in intact cells. Immunolocalization was carried out on Swiss 3T3 fibroblasts and HeLa cells. The MAb to the kinase domain of ROK recognized a single protein in both fibroblasts and HeLa cell extracts (data not shown). ROK was mainly cytoplasmic in HeLa cells under most culture conditions (see Fig. 5A, a). In contrast, ROK had a cytoplasmic distribution in actively growing fibroblasts (Fig. 4A, a) and was redistributed to a filamentous structure when the cells were serum starved for 24 h (Fig. 4A, c). The decrease of stress fibers caused by serum deprivation is shown in Fig. 4A, b and d. The same filamentous structure was recognized by antivimentin antibodies (Fig. 4B, a and b) when costaining was carried out. Since MTs and IFs can coalign in some instances (28), the microtubular network was first disrupted with Triton X-100-containing buffer before the cells were fixed (59). The anti-ROK and antivimentin antibodies recognized virtually identical structures (Fig. 4B, c and d), confirming that ROK colocalized with vimentin IFs in fibroblasts. However, the staining with anti-ROK was more discrete than that obtained with antivimentin, dotting the filamentous network. The staining of the filamentous network by anti-ROK antibody was not due to cross-reactivity of the antibody, since the staining could not be removed with a fivefold excess of vimentin as the competing antigen (Fig. 4C, a), which considerably reduced staining with antivimentin (Fig. 4C, b). Anti-ROK antibody did not cross-react with vimentin by Western immunoblotting, even at 1-µg levels (data not shown). A separate MAb to ROK (2G1) also gave the same filamentous pattern in fibroblasts (data not shown).

View larger version (78K): [in this window] [in a new window]   FIG. 4.   Localization of ROK to vimentin IFs. (A) Redistribution of ROK after serum starvation. Swiss 3T3 fibroblasts grown in 10% serum-containing medium for 2 days (a and b) or serum starved for 24 h (c and d) were fixed with methanol and stained with anti-ROK followed by FITC-conjugated anti-mouse antibody (a and c) or fixed with paraformaldehyde and stained with TRITC-conjugated phalloidin (b and d) to detect actin stress fibers. (B) Confluent Swiss 3T3 fibroblasts grown in serum-free medium for 24 h were double stained with mouse anti-ROK (a) and goat antivimentin (b). Fibroblasts after extraction with 0.5% Triton X-100 were double stained with mouse anti-ROK (c) or goat antivimentin (d). (C) Anti-ROK does not cross-react with vimentin. A competition experiment was performed by incubating the respective primary antibodies with a fivefold excess of purified vimentin and then staining cells with anti-ROK (a) and antivimentin (b). Bar = 15 µm.

The collapse of IFs is accompanied by ROK translocation to the cell periphery. To determine the distribution of ROK under conditions in which IFs were collapsed, we made use of the MT-depolymerizing agent, vinblastine. The most immediate effect of MT disruption seems to be enhanced contractility, phosphorylation of MLC, and RhoA-mediated increases in stress fibers and focal adhesions (19, 40). All MT-disrupting agents are also known to cause the collapse of type III IFs at the perinuclear cap (23). In HeLa cells, vimentin IFs are the only IFs that collapse in the presence of MT-disrupting agents, while keratin IFs are not affected (22). When HeLa cells were treated with vinblastine, ROK translocated to the submembranous zone of the cell periphery (Fig. 5A, a and e). There was an accompanying increase in actin stress fibers (Fig. 5A, b and f) and vinculin staining (data not shown) in vinblastine-treated cells, as has been previously shown by others (19, 75). The IFs collapsed (Fig. 5A, c and g) and the MTs depolymerized to form paracrystals (Fig. 5A, d and h) after treatment of the cells with the drug. An identical result was obtained with nocodazole, another MT-depolymerizing drug (data not shown). Thus, depolymerization of MTs was accompanied by the collapse of IFs, an increase in stress fibers, and the redistribution of ROK to the cell edge. Translocated ROK was more easily discernible in HeLa cells than in Swiss 3T3 fibroblasts (data not shown); it is not clear whether this is due to the large amount of cytoplasmic ROK in serum-deprived HeLa cells compared to that in 3T3 cells.

View larger version (96K): [in this window] [in a new window]   View larger version (100K): [in this window] [in a new window]   FIG. 5.   Collapse of IFs is accompanied by ROK translocation. (A) Vinblastine induces the collapse of IFs and the translocation of ROK. HeLa cells were serum starved in 1% FBS overnight and left untreated (a, b, c, and d) or treated with 50 µg of vinblastine per ml for 40 min at 37°C (e, f, g, and h). The cells were stained with anti-ROK (a and e), TRITC-conjugated phalloidin (b and f), antivimentin (c and g), and antitubulin (d and h) followed by FITC-conjugated anti-mouse IgG and visualized by immunofluorescence. (B) HeLa cells were incubated at 4°C for 1 h (cold treatment), and the cells were treated with 50 µg of vinblastine per ml for a further 20 min at 4°C (a, b, and c) before fixation. Another group of cells similarly treated was allowed to warm up to 37°C in the presence of 50 µg of vinblastine per ml for an additional 40 min (d, e, and f). The cells were stained with anti--tubulin (a and d), antivimentin (b and e), and anti-ROK (c and f), followed by FITC-conjugated anti-mouse IgG. (C) Heat shock causes ROK to translocate to the cell periphery. HeLa cells were heat shocked for 20 min at 43°C, fixed, and stained with anti-ROK (a), antivimentin (b), anti--tubulin (c), and TRITC-conjugated phalloidin (d). The cells were allowed to recover for 2 h after heat shock and were stained with anti-ROK (e) and antivimentin (f). Bar = 15 µm.

ROK has an active role in the collapse of IFs. We next examined whether ROK has a direct role in causing the collapse of IFs in vinblastine-treated cells. A plasmid encoding the RhoA-binding-deficient, kinase-dead mutant (ROKK112A/N1027T/K1028T) was microinjected into HeLa cells, and after 2 h to allow for the expression of the mutant protein, the cells were treated with 50 µg of vinblastine per ml for 40 min. This dominant-negative ROK inhibited vinblastine-induced collapse of IFs (Fig. 6a and b) but did not inhibit MT depolymerization (data not shown). This indicated that ROK has an active role in causing the collapse of IFs in vinblastine-treated cells. Similarly, microinjection of the plasmid encoding dominant-negative RhoAN19 blocked the collapse of IFs induced by vinblastine (Fig. 6c and d), consistent with ROK acting downstream of RhoA in inducing IF collapse.

View larger version (75K): [in this window] [in a new window]   FIG. 6.   Kinase activity is required for vinblastine-induced collapse of IFs. HeLa cells were microinjected with plasmid encoding HA-tagged kinase-dead, RhoA-binding-deficient ROKK112A/N1027T/K1028T (a and b) or HA-tagged RhoAN19 (c and d) for comparison. Two hours after injection, cells were treated with vinblastine for 30 min, fixed with methanol, and costained with rabbit anti-HA antibody (a and c) and mouse antivimentin (b and d) to detect the injected cells (arrowheads). This was followed with rhodamine-conjugated anti-rabbit IgG and FITC-conjugated anti-mouse IgG, and cells were visualized by immunofluorescence. Bar = 15 µm.

Redistribution of ROK in the presence of RhoA-activating agent. MT-depolymerizing agents are known to activate RhoA (19). We then tested growth factors that are known to increase RhoA-GTP level, such as LPA and SPP (50). Treatment of HeLa cells with SPP caused ROK to translocate to the free edge of subconfluent cells (Fig. 7A, a and b). These cells also showed an increase in stress fibers (Fig. 7A, c and d), as has been previously shown by others. The translocation was still discernible 2 h after SPP treatment, unlike the translocation from the heat shock treatment. Thus, activation of RhoA is necessary for ROK to remain membrane bound. A similar redistribution of ROK occurred after the addition of serum or LPA to the cells (data not shown). The vimentin network appeared to contract partially in some SPP-treated cells (Fig. 7A, e and f), perhaps because the stability of IFs in growth factor-treated cells was affected by the increase in the proportion of activated RhoA.

View larger version (118K): [in this window] [in a new window]   View larger version (68K): [in this window] [in a new window]   FIG. 7.   Activation of RhoA causes a redistribution of ROK. (A) SPP causes the translocation of ROK and affects IF stability. HeLa cells were stimulated with SPP at 1 µM for 20 min at 37°C. Cells were fixed with paraformaldehyde and stained with anti-ROK (a and b) and TRITC-conjugated phalloidin (c and d). Untreated control or SPP-treated cells were stained with antivimentin after methanol fixation (e and f). (B) Translocation of ROK is inhibited by the dominant-negative RhoAN19 mutant. HeLa cells were transfected with plasmid encoding HA-tagged RhoAN19 and incubated for 24 h. The cells were stimulated with 1 µM SPP for 20 min (a and b) or 50 µg of vinblastine per ml for 40 min (c and d). The cells were fixed and costained with anti-HA (a and c) and anti-ROK (b and d) to locate the transfected cells. RhoAN19 overexpression (arrowheads) blocked the translocation of ROK to the cell periphery (arrows). (C) Translocated ROK overlaps with vinculin staining. HeLa cells were transfected with full-length wild-type HA-tagged ROK and treated with SPP as described for panel B. Cells were costained with anti-HA (a) and antivinculin (b) to locate the transfected cells. Arrowheads point to transfected cells located by HA staining. Bars = 15 µm.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The RhoA binding kinases have been implicated in the phosphorylation of the myosin binding subunit of the phosphatase and MLC, which leads to myosin contraction (4, 39, 44) and the associated formation of stress fibers and focal adhesions (2, 37, 47). In addition to its effect on actin microfilaments, RhoA induces changes in the IF network (60) and has recently been shown to stabilize MTs (16). Here, we show that overexpression of ROK caused the collapse of the vimentin IF network into tight bundles with no apparent disassembly of the microtubular network, in addition to the formation of stress fibers. Since the RhoA-binding-deficient, kinase-dead ROK inhibits the collapse of IFs induced by overexpression of RhoA, ROK is probably working downstream of RhoA in affecting the state of IFs. PKN has recently been shown to associate with and to phosphorylate the neurofilament proteins (56). Rho-associated kinase phosphorylates GFAP, an IF protein expressed in astroglia (41). Thus, ROK is part of a rapidly enlarging family of RhoA-binding kinases that can potentially affect the structural integrity of the IFs.

Disassembly of the vimentin IF network induced by PKA can progress from the state of collapsed bundles to punctate clusters throughout the cytoplasm (45). This disassembly, which probably requires conformational changes in vimentin, is accompanied by increased vimentin phosphorylation (13, 45) and is apparently regulated by site-specific phosphorylation at the head domain of vimentin (13). The phosphorylation sites on the head domain of GFAP of Rho-associated kinase/ROK and PKA are nearly identical (41, 68). While the manuscript was being reviewed, Goto et al. (27) reported that Rho-kinase (ROK) phosphorylates vimentin at Ser38 and Ser71, although Ser71 does not appear to be phosphorylated in interphase cells. Since Ser38 is also one of the major PKA phosphorylation sites (25, 68), it is then not surprising that both ROK and PKA can inhibit polymerization of vimentin in vitro (Fig. 2D). Although phosphorylated vimentin often remains soluble in vitro (12, 33), there is no increase in soluble vimentin in fibroblasts upon PKA-induced collapse of IFs (45), perhaps because of the presence of IF-associated proteins, which prevents complete disassembly of the filamentous network in vivo. Recently, the use of green fluorescent protein-tagged vimentin showed that collapse of IF bundles did not necessarily involve reassembly near the nucleus but rather the network being pushed back into the perinuclear region (31).

Our finding that ROK colocalizes with intact vimentin IFs in Swiss 3T3 fibroblasts, probably in a catalytically inactive form (see above), is in keeping with reports that many kinases appear to cluster around their sites of action and to associate with various cellular structures including cytoskeletal elements. Mixed-lineage kinase 2, for example, has been found to colocalize with MTs (57), and a number of kinases such as cyclic GMP-dependent protein kinase and PKC have a high affinity for vimentin (51, 66, 73). When IFs were induced to collapse by MT-disrupting agents or in the presence of RhoA-activating factors, ROK translocated to the cell periphery. Active RhoA is necessary for ROK translocation since, in SPP- and vinblastine-treated HeLa cells, overexpression of the dominant-negative mutant of RhoA inhibits the translocation. An intact filamentous structure, presumably comprised largely of nonphosphorylated vimentin, is apparently required for the continued association of ROK with vimentin IFs. Inactive ROK (the kinase-dead mutant) has low affinity for phosphorylated vimentin, suggesting that translocation of ROK may be facilitated by its dissociation from vimentin filaments when vimentin is phosphorylated.

In SPP-treated cells, translocated ROK overlaps partially with vinculin at the cell periphery. Indeed, RhoA is necessary to promote vinculin association with the plasma membrane, and this could be mediated by ROK (11, 47). Several lines of evidence suggest that membrane binding of ROK is required for its activation. For example, translocation of ROK to target regions is essential for it to induce neurite retraction in PC12 cells (38). ROCK (an isoenzyme of ROK) translocates to membrane-cytoskeletal complexes upon cell stimulation (24). Once at the membrane, it is not known whether other domains of ROK, such as the PH domain, assist in its anchorage, as in the case of SOS, whose PH domain is required for membrane association (10). RhoA appears to localize ezrin/radixin/moesin (ERM) to the apical membrane (65), and its stimulation of ERM phosphorylation has been shown to be mediated by ROK (55). The latter authors suggest that ROK has a direct role in opening up ERM proteins to facilitate interaction with actin, which could help in the anchoring of stress fibers.

We propose that translocation of ROK to its sites of action may involve its release from the IFs only when they are induced to collapse by phosphorylation, as part of a coordinated cytoskeletal response to extracellular stimuli (Fig. 8). In serum-starved cells, ROK in its inactivated form is preferentially bound to IFs. Some ROK may be present as unbound form in the cytosol or at the membrane. These cells would be expected to contain much of its RhoA in the GDP form. Exposure to serum, SPP, or LPA (the latter two being also present in serum) results in conversion of RhoA to the active GTP-bound form, which then activates ROK. Because RhoA can be found in the membrane and cytosol irrespective of its state of activation (6, 43, 69, 70), it is not clear which subcellular pool of ROK is initially activated by RhoA. In any case, this activated ROK then phosphorylates vimentin, which has a reduced affinity for ROK, thus releasing it. This released ROK is then translocated and activated, most probably on the peripheral membrane, and acts on vimentin, resulting in yet more phosphorylation and further release of previously bound ROK. The collapse of IFs alone may be sufficient to release ROK for translocation, as heat shock induced redistribution of ROK to the periphery without an accompanying increase in stress fibers. However, kinase activity of ROK is necessary to bring about the collapse since the kinase-dead mutant inhibits vinblastine-induced collapse of IFs. ROK appears to be in a positive feedback loop such that increased amounts of ROK could be translocated to the cell edge, with the IFs acting as a depository for ROK. Receipt of additional signals that decrease the level of RhoA-GTP, for instance, increased RhoGAP activity, will terminate the feedback loop. The increase in contractility, which mostly results from the phosphorylation of myosin binding subunit of phosphatase and of MLC itself by ROK, may be facilitated by the collapse of IFs. It is possible that the formation of stress fibers, focal adhesions, and contractility observed on MT disruption (19, 75) reflects not a direct activation of Rho but rather an associated release of ROK from IFs and its subsequent translocation (Fig. 5B) and activation.

View larger version (10K): [in this window] [in a new window]   FIG. 8.   A role for vimentin IFs as a reservoir of ROK. Activated ROK performs many roles; two of those are shown here for simplicity. Generation of RhoA-GTP by growth factors results in initial activation of a free pool of ROK. Activated ROK then phosphorylates vimentin on IFs, leading to the release of inactive ROK, because of its reduced affinity for vimentin which is phosphorylated. The released ROK is translocated to the periphery, where it is activated upon binding to RhoA-GTP. This activated ROK acts on IFs to accelerate their phosphorylation-disassembly, thus releasing more ROK to be activated in a positive feedback loop. Activated ROK also induces an overall increase in phosphorylated MLC, from either the inactivation of myosin phosphatase or the phosphorylation of MLC. These events lead to an increase in myosin-based contractility and the subsequent formation of stress fibers (SF) and assembly of focal adhesions (FA). It is possible that contractility may also be enhanced by the disassembly of IFs. GAP, GTPase-activating protein.

There is increasing evidence to suggest that regulating the dynamics of IFs is important in various cellular processes (20, 23). Stability of vimentin IFs is necessary for maintaining nuclear morphology (63) and that of other cytoskeletal constituents, including actin microfilaments. Thus, unregulated destabilization of vimentin IFs by microinjection of a mimetic peptide, whose sequence corresponds to that of the N-terminal helical initiation 1A of vimentin, into fibroblasts causes condensation of actin into large aggregates and cell rounding (26). Cross-talk between IF and other cytoskeletal components is evident, as in the treatment of adrenal cells with calcium-calmodulin, which results in cell rounding and the phosphorylation of both vimentin and MLC (1). In vimentin knockout mice, which do not have an obvious phenotype but nevertheless possess fragile fibroblasts (15, 26), it is possible that there may be compensatory expression of other cytoskeletal elements. Furthermore, vimentin-deficient fibroblasts have recently been shown to have impaired mechanical stability and contractility (18).

It is clear that ROK can influence diverse cytoskeletal events, including contractility of myosin, the reorganization of actin filaments, the structural status of IFs, and the regulation of ERM. While this paper was being reviewed, it was reported that ROCK influences the assembly of IFs, MTs, and actomyosin-based contractility in neuronal cells (30). It is not unlikely that a common signal can affect both the state of IFs and actomyosin contraction, which has been proposed to underlie formation of stress fibers and focal adhesions. Extensive IF disassembly is unlikely to occur in normal nondividing cells; however, localized IF phosphorylation could modulate the structure of IFs in specific areas of interphase cells undergoing cytoskeletal changes. It is possible that ROK has a role in coordinating different components of the cytoskeleton, contributing to a change in cell shape which requires the concerted movement of major cytoskeletal elements.