Previous Article | Next Article 
Molecular and Cellular Biology, November 1998, p. 6436-6446, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Residues in the Swi5 Zinc Finger Protein That
Mediate Cooperative DNA Binding with the Pho2 Homeodomain
Protein
Leena T.
Bhoite and
David J.
Stillman*
Division of Molecular Biology and Genetics,
Department of Oncological Sciences, Huntsman Cancer Institute,
University of Utah Health Sciences Center, Salt Lake City, Utah 84132
Received 29 January 1998/Returned for modification 30 March
1998/Accepted 20 August 1998
 |
ABSTRACT |
The Swi5 zinc finger and the Pho2 homeodomain DNA-binding proteins
bind cooperatively to the HO promoter.
Pho2 (also known as Bas2 or Grf10)
activates transcription of diverse genes, acting with multiple distinct
DNA-binding proteins. We have performed a genetic screen to identify
amino acid residues in Swi5 that are required for synergistic
transcriptional activation of a reporter construct in vivo. Nine unique
amino acid substitutions within a 24-amino-acid region of Swi5,
upstream of the DNA-binding domain, reduce expression of promoters that
require both Swi5 and Pho2 for activation. In vitro DNA binding
experiments show that the mutant Swi5 proteins bind DNA normally, but
some mutant Swi5 proteins (resulting from SWI5* mutations)
show reduced cooperative DNA binding with Pho2. In vivo experiments
show that these SWI5* mutations sharply reduce expression
of promoters that require both SWI5 and PHO2,
while expression of promoters that require SWI5 but are
PHO2 independent is largely unaffected. This suggests that these SWI5* mutations do not affect the ability of Swi5 to
bind DNA or activate transcription but specifically affect the region of Swi5 required for interaction with Pho2. Two-hybrid experiments show
that amino acids 471 to 513 of Swi5 are necessary and sufficient for
interaction with Pho2 and that the SWI5* point mutations
cause a severe reduction in this two-hybrid interaction.
Analysis of promoter activation by these mutants suggests that this
small region of Swi5 has at least two distinct functions, conferring specificity for activation of the HO promoter and for
interaction with Pho2.
| |
INTRODUCTION |
Specific interactions between
multiple transcription factors are often required to achieve complex
patterns of gene regulation. The importance of cooperative DNA binding
by transcription factors containing identical or homologous subunits
has long been recognized, but only more recently has cooperative
binding of proteins with heterologous DNA-binding domains been studied.
In vitro DNA binding experiments have shown that the Swi5 and Pho2
DNA-binding proteins bind cooperatively to the HO promoter
(6). The SWI5 gene was first identified by its
requirement for expression of the HO gene that encodes an
endonuclease that initiates mating type switching in yeast. The
PHO2 gene was originally identified as a transcriptional activator of the PHO5 acid phosphatase gene, and activation
of PHO5 requires the cooperative binding of the Pho2
homeodomain and the Pho4 basic helix-loop-helix protein (2).
PHO2 (also known as BAS2 or GRF10) was
subsequently shown to activate HIS4 and various
ADE genes, and at these target genes Pho2 interacts with
Bas1, a Myb-like DNA-binding protein (9, 39, 42). Thus,
Pho2, a homeodomain protein, interacts with at least three different
partners, the Swi5 zinc finger protein, the Pho4 basic helix-loop-helix
protein, and the Bas1 Myb-like protein.
Transcriptional regulation of the HO gene by SWI5
is highly complex (16, 30). Swi5 recognizes two sites in the
HO promoter, called site A and site B, located approximately
1,800 and 1,300 nucleotides, respectively, upstream from the
transcription start site (24, 37). Swi5 binds to both of
these sites with relatively low affinity, and binding by Pho2 is
extremely weak. In vitro binding studies have shown that Swi5 and Pho2
bind each of these sites cooperatively, leading to the production of
high-affinity ternary complexes. Mutations that eliminate Swi5 binding
at either of these sites sharply reduce HO expression,
indicating that both sites are required for HO transcription
(24). Although PHO2 is required for activation of
either an HO-lacZ reporter or a heterologous reporter gene
containing only the Swi5 and Pho2 binding sites from site B [the
HO(site B)-lacZ reporter], a pho2
mutation does not affect expression of the endogenous HO
gene (6, 24). However, mutations in the Swi5 binding sites
that reduce, but do not eliminate, Swi5 binding render the
HO promoter completely PHO2 dependent
(24). These results suggest a complex role for Pho2 in
activation of HO gene expression. The genetic data also suggests that a physical interaction between proteins bound at site A
(
1800) and site B (1300) is required for activation of HO transcription (24).
The nuclear localization of Swi5 is cell cycle regulated and has been
shown to play an important role in the transcriptional regulation of
HO (27, 37). Swi5 accumulates in the cytoplasm during G2, enters the nucleus only during anaphase after
the inactivation of Clb/Cdc28 protein kinase, and is then rapidly
degraded during G1. More recently, SWI5 has been
shown to be responsible for activating a wide variety of early
G1-specific genes such as EGT2 (22), ASH1 (3), CDC6 (32),
RME1 (40), and SIC1 (21,
41). However, HO is specifically transcribed in mother
cells only in late G1, when it requires the additional
transcription factor complex SBF (16, 30).
Yeast has another zinc finger transcription factor, Ace2, which is very
similar to Swi5 (8, 10). Despite the fact that the
DNA-binding domains of Swi5 and Ace2 are nearly identical and the two
proteins recognize the same DNA sequences in vitro, SWI5 and
ACE2 can activate different genes in vivo (10,
11). SWI5, but not ACE2, activates
HO expression, while ACE2 activates expression of
the CTS1 gene. It is likely that the cooperative binding of
Swi5 and Pho2 contributes to the specific activation of HO
by SWI5 but not by ACE2.
In vitro characterization of the cooperative interaction between Swi5
and Pho2 has revealed several interesting features. First, in vitro
experiments do not detect Swi5-Pho2 interaction in the absence of DNA
(5). Second, although DNA-binding modules of both proteins
are sufficient for DNA binding, they are insufficient for cooperative
DNA binding (4). Swi5 requires a region N-terminal to the
DNA-binding domain for synergistic interactions with Pho2, and Pho2
requires a region C-terminal to the homeodomain to interact with Swi5.
This interaction is likely to be flexible since promoter mutations that
alter the spacing between the protein binding sites are tolerated
(4). To better understand the interactive surfaces of the
two proteins, in this paper we describe a genetic screen to identify
residues in Swi5 that are specifically defective in cooperative binding
with Pho2. By both in vitro and in vivo assays, we show that specific
mutations within a 24-amino-acid region (positions 482 to 505)
preceding the zinc finger DNA-binding domain of Swi5 alter cooperative
binding with Pho2 at the HO promoter.
| |
MATERIALS AND METHODS |
Strains.
The yeast strains used in this study are listed in
Table 1, and all are isogenic either in
the W303 or K765 background. Strains DY2406 with the a1 mutation in the
HO promoter [HO(a1)] (24) and DY1641 with a
lexA-lacZ reporter integrated at the URA3 locus (20) have been described. The strains with the integrated
SWI5* mutants (expressing point mutations) were constructed
by first constructing strains with a swi5::URA3
disruption by using BamHI-cleaved M3405. Transformation was
then performed to replace the disrupted allele with the various
SWI5* mutations, with 5-fluoro-orotic acid used to screen
for loss of the swi5::URA3 allele. Standard genetic methods were used for strain construction and gene replacement (33, 35), and gene replacements were confirmed by Southern analysis.
Plasmids.
The plasmids used in this study are listed in
Table 2. In many cases, multiple steps
were involved in plasmid construction, and details of plasmid
construction are available on request. The HO(site
B)-lacZ reporter plasmid M1853 (4) and the
CTS1(46)-lacZ reporter plasmid M1912
(11) have been previously described, and M3403 and M3404 are
YIp versions of these reporters. Plasmid M3202 is a pRS313
(36) derivative with the BamHI site in the polylinker destroyed and contains the SWI5 gene (1031 to
+2435) with two BamHI sites introduced by site-directed
mutagenesis using primers F373 (5' GTATTATTTACGGATCCAGGAATTG 3')
and F378 (5' TTAATGTGGGATCCGAATTGAGG 3'). The first
BamHI site at codons 396 and 397 is translationally silent,
and the second BamHI site at residues 509 and 510 introduces a serine-to-threonine change at residue 510.
Plasmids M2024 and M2025 that express His-tagged Swi5 and Pho2
proteins, respectively, in
Escherichia coli have been
described
previously (
6). Plasmid M3113 is identical to
plasmid M2024,
except that the
ClaI site in the vector
backbone has been destroyed
with T4 DNA polymerase. All of the
SWI5* point mutants from the
pRS313 vector backbone were
cloned into the M3113
E. coli expression
vector as
SalI-
ClaI fragments, with the exception of M3637
(the
R484G mutant) and M3638 (the R484S mutant), which were generated
by site-directed mutagenesis. Oligonucleotides F435 (5'
GGAAATAACAAATCCACTTTCAGGCTC
3') and F435 (5'
GGAAATAACAAAGCTACTTTCAGGCTC 3') were used to
introduce mutations
R484G and R484S, respectively.
Alanine substitutions in Swi5 (positions 482 to 505) were introduced by
site-directed mutagenesis. Oligonucleotides F454 (5'
ATTTCCGAAGCGCCTTCTCCC 3'), F455 (5' GAAACGCCTGCTCCCGTTCTT
3'),
F456 (5' CGAAGGAAGAGCTCCTCAATTC 3'), and F457
(5' GTTATTTCCGAAGCGCCTGCTCCCGTTC
3') were used to introduce
the single mutations T490A, S492A,
and S505A and the double mutation
T490A,S492A, respectively. To
introduce multiple alanine mutations,
combinations of the above
oligonucleotides were used in the
site-directed mutagenesis reactions.
Plasmid M3895 expressing LexA-Swi5(WT, 471-513) (LexA-wild-type Swi5
region of amino acids 471 to 513) was constructed by
PCR amplification
of the region with oligonucleotides F542 (5'
ACAGACAATGAATTCGATGATAATGAGG 3') and F543 (5'
TGTGTGGATCCCCTTAATGTGTGTG
3'), cleavage of the product with
EcoRI and
BamHI at sites created
with the
primers, and cloning of the fragment into the YEp(
HIS3)
plasmid pLexA202+PL (
34). The same PCR strategy was used to
create LexA-Swi5(471-513) fusion constructs with single point
mutations
[e.g., LexA-Swi5(E482K,471-513)]. Plasmid M3913, which
expresses a
GAD-Pho2 fusion protein with amino acids 5 to 559
of Pho2, contains an
EcoRI-
SalI
PHO2 fragment from M3570
(
PHO2 in pRS316) cloned into the YEp(
LEU2)
plasmid pGAD-C3 (
19).
Isolation of SWI5* mutants.
Residues 358 to 530 of SWI5 were PCR amplified with oligonucleotides F283
(5' TATTCAGAGAAACCTTTGGGCCTGG 3') and F375 (5'
GAGTTTTCTTGTGATTTTTGAGGG 3') by using an error-prone mutagenesis
protocol (23). The reaction mixture contained 16.6 mM
(NH4)2SO4, 67 mM Tris (pH 8.8), 170 µg of bovine serum albumin per ml, 100 mM 
-mercaptoethanol, 1 mM
TTP, 1 mM dGTP, 1 mM dCTP, 200 µM dATP, 5 ng of
KpnI-linearized M2667 DNA (SWI5 in YEplac112)
template per ml, and 5 U of Taq polymerase. Reactions were
performed in a 100-µl volume by using amplification conditions of 15 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min.
Typically, the PCR products from several reaction mixtures were pooled,
and then approximately 300 ng of product was directly
transformed,
along with the gapped plasmid (
BamHI-digested M3202,
with a
HIS3 marker), into yeast strain DY4174 (
MATa
swi5 ace2) carrying the M1853
HO(site
B)-
lacZ reporter plasmid (
URA3 marker).
His
+ Ura
+ transformants were screened for white
colony color by using the
chromogenic substrate
5-bromo-4-chloro-3-indolyl-
-
D-galactopyranoside
(X-Gal)
in a blue versus white colony lift assay (
11).
Rho
mutations that affect blue colony color were
eliminated by screening
for growth on glycerol medium. White colonies,
deficient in activating
the
HO(site B)-
lacZ
reporter, were grown on medium containing
5-fluoro-orotic acid to
select for loss of the
URA3 [
HO(site
B)-
lacZ]
reporter and then mated to strain DY1133
(
MAT
swi5 ace2) carrying
the M1912
CTS1(46)-
lacZ reporter. A blue versus white
colony assay
for
lacZ activity was performed on the
resulting diploids, and
SWI5 mutants that were unable to
activate the
CTS1(46)-
lacZ reporter
were
considered to contain
swi5 null mutations and were
discarded.
In vitro DNA binding assays.
The Pho2, wild-type Swi5, and
various mutant Swi5 proteins were expressed in E. coli as
histidine-tagged fusion proteins and purified by HiTrap (Pharmacia)
nickel column chromatography as described earlier (4). Gel
retardation assays were performed with an HO(site B) probe
from plasmid M1403 as described previously (24). For band
shifts involving Swi5 and Pho2, a range of Swi5 concentrations was used
such that a linear relationship existed between the amount of Swi5
added and the amount of binary complex. For comparative purposes with
the mutant Swi5 proteins, each set of band shifts also included
wild-type Swi5 as a standard control. The amount of complex formed by
each Swi5 mutant was determined with ImageQuant software on a Molecular
Dynamics phosphorimager and converted to a percentage relative to
wild-type Swi5 binding, which was normalized to 100%.
Quantitation of RNA levels.
Cells were grown in yeast
extract-peptone-dextrose (YEPD) medium and harvested in early log
phase, and total RNA was isolated as described previously
(10). S1 nuclease protection assays were performed
essentially as described previously (18) with oligonucleotides specific for HO (F376, 5'
GCCCTGTGTGACATTTATGACGCGGGCAGCGGAGCCATCTGCGCACATAACGTAAGAGTTAGCCCACCGC 3'), SIC1 (F444, 5'
CGACCCAATGGTTCCTGCTCTTCCCTTACTGTTCCATTATCATGACTTTCAAATTGGAATAGTGTCCTCTGACAGT 3'), and CMD1 (F393, 5'
GGGCAAAGGCTTCTTTGAATTCAGCAATTTGTTCTTCGGTGGAGCC 3').
Quantitative analysis was performed with ImageQuant software and a Molecular Dynamics phosphorimager. Radioactivity in each band was
measured, the background level from the corresponding position of the
no-RNA lane was subtracted, and the value for HO or
SIC1 was normalized by dividing by the value for the
CMD1 internal control.
Other methods.
Site-directed mutagenesis was performed as
described previously (1), and all mutations were confirmed
by dideoxy sequencing. Extracts were prepared and quantitative assays
for -galactosidase activity were performed with the chromogenic
reagent o-nitrophenyl--D-galactopyranoside (ONPG) as described earlier (7).
| |
RESULTS |
Isolation of Swi5 point mutants defective for interaction with
Pho2.
Deletion analysis demonstrated that the DNA-binding domains
of Swi5 and Pho2 are not sufficient for cooperative DNA binding at the
HO promoter (4). Amino acids 537 to 632 comprise
the Swi5 zinc finger DNA-binding domain, and an N-terminal region that
includes part of the first zinc finger (amino acids 394 to 609) was
shown to be required for interaction with Pho2 in vitro. To more
precisely identify the Pho2-interacting region of Swi5, we decided to
isolate Swi5 point mutations that interfered in vivo with the
cooperative interaction with Pho2 at the HO promoter. Our
strategy combined PCR-mediated random mutagenesis with plasmid gap
repair (28) to generate a mutagenized plasmid library of SWI5.
The screen used the
HO(site B)-
lacZ reporter,
which contains 31 nucleotides from the site B region of the
HO promoter. This
reporter is expressed in a
SWI5
PHO2 strain but not in strains
with either a
swi5 or
pho2 mutation (Fig.
1). We
reasoned that
an amino acid change in the Pho2 interaction domain of
Swi5 would
disrupt the ability of Swi5 to activate this reporter, and
we
thus screened for colonies that were white in the presence of
the
chromogenic substrate X-Gal. Clearly, the vast majority of
these
SWI5 mutations would be null alleles, so we devised a
secondary
screen to identify
SWI5* mutants that were capable
of binding
DNA and activating transcription in vivo. For this secondary
screen,
we used the
CTS1(46)-
lacZ reporter, which
contains a 46-bp region
of the
CTS1 promoter inserted into
the
CYC1 promoter (Fig.
1).
This reporter can be activated
by Swi5 but in a
PHO2-independent
manner (
11).
[The
CTS1(46)-
lacZ reporter can also be
activated
by Ace2, so the experiments were conducted with an
ace2 mutant
to make the reporter completely
SWI5
dependent.]
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Activity of reporters in SWI5* mutants.
Yeast strains were independently transformed with the
HO(site B)-lacZ and the
CTS1(46)-lacZ reporters, and
transformants were grown in selective medium and assayed for
-galactosidase activity. Three independent transformants were
assayed, and standard errors are shown. The normalized levels are also
shown, as percentages of the wild-type level. All of the strains are
ace2 mutants, and the SWI5* mutant alleles are
present at the native SWI5 locus. The following strains were
used: DY4854, DY1923, DY1143, DY1985, DY4684, DY4686, DY4852, DY4688,
DY4690, DY4692, DY4695, DY4696, and DY4698.
|
|
A preliminary screen in which residues 358 to 680 of Swi5 were
mutagenized was conducted; this large region (approximately
1 kb) was
chosen because of available restriction sites and the
deletion analysis
that indicated that the Pho2 interaction region
was within amino acids
394 to 609 of Swi5. Several mutations that
were unable to activate the
HO(site B)-
lacZ reporter were isolated
(e.g.,
F485S, Q498R, and S505P), and these residues mapped outside
the zinc
finger DNA-binding domain. As expected, mutations in
the DNA-binding
domain that failed to activate the
HO(site
B)-
lacZ reporter also failed to activate the
CTS1(46)-
lacZ reporter, suggesting
that the
DNA-binding domain of Swi5 may be distinct from the Pho2
interaction
region of Swi5 (data not shown). Based on these results,
and the fact
that Swi5 derivatives consisting of just the zinc
finger region of Swi5
(amino acids 523 to 632) do not bind cooperatively
with Pho2
(
12), we decided to limit our mutagenesis to a smaller
region. Site-directed mutagenesis was performed to introduce two
restriction sites needed for gap repair (
28), allowing us to
limit our mutagenesis to a region containing amino acids 358 to
530.
A total of 20,000 yeast transformants containing plasmids with
potential mutations in amino acids 358 to 530 of Swi5 were
screened,
and 1,000 candidates with decreased expression of the
HO(site B)-
lacZ reporter were identified. As
described in Materials
and Methods, a large number of colonies with
apparent
swi5 null
mutations were eliminated after screening
with the
CTS1(46)-
lacZ reporter. We selected 25 clones that were specifically defective
in activation of the
HO(site B)-
lacZ reporter and retained at
least
50% activity at the
CTS1(46)-
lacZ reporter.
These clones
were subjected to DNA sequence analysis. Some clones had
single
mutations, while other clones had multiple amino acid
substitutions.
Among the clones with multiple mutations, those with
single amino
acid substitutions were generated either by subcloning or
by site-directed
mutagenesis. We focused on nine unique mutations
(derived from
15 clones, since some mutations were recovered
multiple times)
clustered in a 24-amino-acid region spanning
residues 482 to 505,
preceding the DNA-binding domain of Swi5, as shown
in Fig.
1.
Most of the mutations were transitions and a few were
transversions,
which was consistent with the conditions of mutagenesis
employed
(
23). The high fraction of transition mutations,
coupled with
the nature of the genetic code, limits the spectrum of
amino acid
substitutions. For example, the Q498R mutation was recovered
four
times as the result of a CAA-to-CGA change. The other
single-nucleotide
transition mutations result in a TAA stop codon or a
synonymous
CAG glutamine codon.
In vivo analysis of Swi5 point mutants.
We next analyzed the
in vivo activity of the putative Pho2 interaction-defective Swi5
mutants. To avoid any possible complications due to copy number
of the SWI5* mutants present on YCp plasmids, gene
replacement methods were used to introduce the various SWI5* mutants at the SWI5 locus in place of the wild-type allele.
These strains were transformed with the HO(site
B)-lacZ reporter, and extracts were prepared for
quantitative -galactosidase assays to measure promoter activity. As
shown in Fig. 1, this reporter is dependent on both SWI5 and
PHO2, since mutation of either of these genes results in a
20-fold drop in promoter activity. Importantly, the activity of all the
SWI5* mutants is similar to that of the SWI5 pho2
mutant, or, as in the case of the S483G, R484G, and R484S mutants, only
marginally higher. Although this phenotype is consistent with mutations
that debilitate Swi5-Pho2 interaction, mutations leading to an unstable
protein or transcriptionally inactive Swi5 could also cause a similar
phenotype. Western immunoblot analysis showed that the various Swi5
mutants accumulated to approximately the same level as wild-type Swi5
(data not shown). We used the PHO2-independent
CTS1(46)-lacZ reporter to determine whether the SWI5* mutants were transcriptionally active. Quantitative
measurements showed that all the mutants activated
CTS1(46)-lacZ as efficiently as wild-type
SWI5 did, with the exception of the S505P mutant, which
exhibited less than 50% activity (Fig. 1). This data suggests that
none of the substitutions drastically alter the stability or the
transcriptional ability of Swi5 and suggests that these nine residues
within a 24-amino-acid patch are specifically involved in interactions
with Pho2.
We next examined the ability of the
SWI5* mutants to
activate the native chromosomal
HO gene. A quantitative S1
nuclease protection
assay was used to measure
HO expression,
and the level of
CMD1 mRNA was used as an internal control.
A
swi5 mutation reduces
HO expression nearly
100-fold (Fig.
2A, lane 2). A
pho2 mutation
has little effect on expression from the
native
HO promoter (lane
3), as described previously
(
24). Interestingly, four of the
nine
SWI5*
mutants, the V494A, S497P, Q498R, and S505P mutants,
show a marked
reduction in
HO expression, with levels reduced
to less than
50% of the wild-type
SWI5 levels (Fig.
2A, compare
lanes
13, 14, 15, and 16 with lane 4; all strains contain an
ace2 mutation).
View larger version (84K):
[in this window]
[in a new window]
|
FIG. 2.
SWI5* mutations specifically affect
HO expression. S1 nuclease protection assays using probes
specific for HO (A) and SIC1 (B) were performed
with the CMD1 probe as the internal control by using yeast
strains which contained the wild-type SWI5 gene or Pho2
interaction-defective SWI5* mutants at the SWI5
locus. RNAs from the following strains were prepared: DY150 (lane 1),
DY161 (lane 2), DY1921 (lane 3), DY4854 (lane 4), DY1923 (lane 5),
DY1936 (lane 6), DY1143 (lane 7), DY4684 (lane 8), DY4686 (lane 9),
DY4852 (lane 10), DY4688 (lane 11), DY4690 (lane 12), DY4692 (lane 13),
DY4695 (lane 14), DY4696 (lane 15), and DY4698 (lane 16). The numbers
below lanes 1 to 7 indicate HO mRNA levels, normalized to
that of wild type (lane 1, 100%). For lanes 4 to 16, the strains with
the SWI5* mutations all contained an ace2
mutation, and the HO mRNA levels shown below these lanes are
normalized to that of the ace2 strain (lane 4, 100%). The
ACE2 and PHO2 genotypes are indicated at the top
of the lanes. WT, wild type.
|
|
We analyzed
SIC1 gene expression in these mutants to
determine whether these
SWI5* mutations specifically
altered
HO expression
or whether they also affected
regulation of another
SWI5-regulated
G
1 phase
gene. The
SIC1 gene is expressed in early
G
1 phase of
the cell cycle, with both Swi5 and Ace2
contributing to activation
(
21,
41). This can be seen in
Fig.
2B, where
swi5 (lane 2)
and
ace2 (lane 4)
mutations reduce
SIC1 expression, and
SIC1
expression
is further reduced in the
swi5 ace2 double mutant
(lane 7). Since
the
SWI5* mutants were integrated in an
ace2 mutant background,
most of the residual
SIC1
expression observed is
SWI5 dependent.
As shown in Fig.
2B,
all of the
SWI5* mutants, with the possible
exception of the
V494A mutant, were able to activate
SIC1 to levels
comparable to that of wild-type
SWI5 alone (compare lanes 8 to
16 with lane 4).
Reduced expression of the HO(a1) promoter by the Pho2
interaction-defective Swi5 mutants.
The HO promoter
contains two binding sites for Swi5, site A at 1800 and site B at
1300. Although a pho2 mutation has little effect on the
native HO promoter, mutations that modestly reduce Swi5
binding to either of these sites render the promoter entirely PHO2 dependent (24). These results suggest that
Pho2 promotes Swi5 binding to the compromised sites via cooperative
interactions and that interaction between these sites is needed for
HO expression (24). This model predicts that
mutations interfering with the cooperative binding between Swi5 and
Pho2 would fail to activate HO expression in a strain with a
mutant HO promoter that is PHO2 dependent. To
confirm the nature of Pho2 interaction-defective Swi5 mutants, we
integrated all the point mutations at the native SWI5 locus
in a strain with the a1 mutation in the HO promoter.
The
HO(a1) mutant promoter has a 2-nucleotide substitution
that reduces Swi5 binding in vitro, but Pho2 is able to stimulate
Swi5
binding due to the cooperative interactions (
24). A
quantitative
S1 nuclease protection assay was used to measure
expression from
the
HO(a1) mutant promoter (Fig.
3).
HO(a1) expression is
turned
off in a
swi5 mutant strain (lane 11) and reduced to
about 5%
of the wild-type level in a
pho2 mutant (lane 12).
Importantly,
all of the
SWI5* point mutants show a major
defect in activation
of the
HO(a1) promoter despite the
presence of Pho2 (lanes 2 to
10), except for those with substitutions
at residue 484 (lanes
4 and 5). The R484G and R484S mutant Swi5
proteins partially activated
the
HO(a1) promoter, suggesting
that these Swi5 proteins may retain
some ability to interact with Pho2.
These results corroborate
a critical role for residues 482 to 505 of
Swi5 in cooperative
interactions with Pho2.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
SWI5* mutations reduce expression from the
HO(a1) promoter. Yeast strains which contained the wild-type
SWI5 gene or Pho2 interaction-defective SWI5*
mutants at the SWI5 locus along with the
PHO2-dependent HO(a1) mutant promoter were
constructed. S1 nuclease protection assays using probes specific for
HO and the CMD1 probe (internal control) were
performed on RNA extracted from the following strains: DY5031 (lane 1),
DY4905 (lane 2), DY4907 (lane 3), DY4909 (lane 4), DY4911 (lane 5),
DY4913 (lane 6), DY4915 (lane 7), DY4917 (lane 8), DY4919 (lane
9), DY4921 (lane 10), DY4843 (lane 11), and DY2406 (lane 12). The
numbers below the lanes indicate the HO mRNA levels,
normalized to that of a wild-type strain with the HO(a1)
promoter (lane 1, 100%). The PHO2 genotype is given at the
top of the lanes. WT, wild type.
|
|
In vitro defects in cooperative DNA binding.
Two different
assays, the lacZ reporter assay and S1 nuclease analysis,
have shown that at least some of the Swi5 point mutants fit the
criteria of being specifically defective for cooperative interaction
with Pho2 in vivo. Although these mutations do not map to the zinc
finger DNA-binding domain of Swi5, subtle alterations in the
DNA-binding ability of the Swi5 mutants could also impair cooperative
interactions with Pho2 in vivo. To examine this possibility, we used quantitative band shift analysis to study the DNA-binding properties of the Swi5 mutants in vitro. All of the mutants were purified from E. coli as His-tagged fusion proteins as
described previously (4). First, the independent binding of
each Swi5 mutant protein to the HO(site B) probe, without
Pho2, was examined (Fig.
4A, C, and E).
Several protein concentrations were tested for each mutant Swi5
protein, and each gel included similar concentrations of wild-type Swi5
as a standard. Quantitative analysis showed that the nine mutant
proteins yield levels of protein-DNA complex similar to that seen with
the wild-type Swi5 protein. This indicates that there is no apparent
defect in the ability of the Swi5 mutants to bind HO DNA, at
least in the absence of Pho2.
View larger version (75K):
[in this window]
[in a new window]
|
FIG. 4.
DNA binding by mutant Swi5 proteins, without and with
Pho2. (A to C) DNA binding to HO promoter DNA by Swi5 alone.
(D to F) DNA binding to HO promoter DNA by Swi5 in the
presence of 8.1 ng of Pho2. Each panel illustrates an independent gel
retardation assay using mutant Swi5 proteins, with wild-type Swi5
included in each assay as a standard internal control. The experiments
in panels A and B, C and D, and E and F were conducted in pairs, at the
same time with the same probe and the same preparations of purified
proteins. Thus, direct comparisons can be made within each set of
paired panels. (A and B) The following amounts of Swi5 were added to
each binding reaction mixture: 73, 145, 290, and 580 ng of wild-type
Swi5 (lanes 2 to 5, respectively); 88, 175, 350, and 700 ng of
Swi5(E482K) (lanes 6 to 9, respectively); 38, 75, 150, and 300 ng of
Swi5(S483G) (lanes 10 to 13, respectively); 83, 165, 330, and 660 ng of
Swi5(R484G) (lanes 14 to 17, respectively). (C and D) The following
amounts of Swi5 were added to each binding reaction mixture: 20, 40, 80, and 160 ng of wild-type Swi5 (lanes 2 to 5, respectively); 17, 34, 75, and 150 ng of Swi5(R484S) (lanes 6 to 9, respectively); 22, 43, 85, and 170 ng of Swi5(F485S) (lanes 10 to 13, respectively); 32, 63, 125, and 250 ng of Swi5(V494A) (lanes 14 to 17, respectively). (E and F) The
following amounts of Swi5 were added to each binding reaction mixture:
73, 145, 290, and 580 ng of wild-type Swi5 (lanes 2 to 5, respectively); 55, 110, 220, and 440 ng of Swi5(S497P) (lanes 6 to 9, respectively); 62, 123, 245, and 490 ng of Swi5(Q498R) (lanes 10 to 13, respectively); 42, 83, 165, and 330 ng of Swi5(S505P) (lanes 14 to 17, respectively). Lane 1 in all panels has no added protein. The reaction
mixtures in lane 18 (panels A, C, D, and E) and lane 19 (panels B and
F) contained 73 ng of Swi5 protein only. WT, wild type.
|
|
We next determined whether the cooperative binding of the Swi5 mutants
with Pho2 was altered (Fig.
4B, D, and F). We used
the same protein
concentrations that gave a linear relationship
between the amount of
Swi5 added and the amount of Swi5-DNA complex
formed and the same
labeled
HO DNA probe. Quantitative analysis
revealed
differences in the amount of ternary complex (Swi5-Pho2-DNA)
formed by
the Swi5 mutants, and we divided the mutants into three
broad
categories (classes A to C) (Table
3).
Two adjacent mutants
in class A, the S497P and Q498R mutants, showed
the strongest
defect in interaction with Pho2, with 95 and 85%
reductions, respectively,
in the amount of ternary complex formed (Fig.
4F, lanes 6 to 13).
Three mutants in class B, the E482K, S483G, and
F485S mutants,
showed a modest reduction (about 30%) in cooperative
binding of
Pho2 (Fig.
4B, lanes 6 to 13, and 4D, lanes 10 to 13). The
last
category of Swi5 mutants, class C, showed no apparent change in
the cooperative DNA binding with Pho2 in vitro. Two of these mutants
(the R484G and R484S mutants) have substitutions at the same residue,
and these two mutations were the least defective in activating
the
HO(a1) promoter (Fig.
3). We also noted that the other two
class C mutants, the V494A and S505P mutants, both overlap
potential
cyclin-dependent kinase (CDK) phosphorylation sites
(see below).
Mutations in potential CDK phosphorylation sites of Swi5.
The
V494A and S505P mutations of Swi5 are unusual in that they cause
significant reduction in expression of both the HO(a1) promoter and the HO(site B)-lacZ reporter, yet
the in vitro DNA binding experiments show no defect in cooperative
interactions between the V494A and S505P mutants with Pho2. There
are at least two ways to explain these differences. One is that these
mutations cause a specific defect in activation of HO that
is independent of Pho2 interaction. The other possibility is that in
vivo modifications of Swi5, such as phosphorylation, might influence
the ability of Swi5 to interact with Pho2 in vivo, while the lack of
phosphorylation of E. coli-expressed Swi5 may permit
interaction with Pho2 under in vitro conditions.
Earlier studies have shown that Swi5 phosphorylation regulates its
subcellular localization in vivo, and three residues (S522,
S646, and
S664) can be phosphorylated by Cdc28 CDKs in vitro (
27).
More recently, Measday et al. (
26) have shown that Swi5 is
also
a target for phosphorylation by the Pho85 CDK. Various consensus
sequences have been proposed for phosphorylation sites for CDKs,
including S/T-P-X-K/R for Cdc28 (
27) and S/T-P-X-N (where N
is any hydrophobic amino acid) for Pho85 CDK (
21,
28). Swi5
contains several potential Pho85 CDK phosphorylation sites dispersed
throughout the length of the protein. Interestingly, three of
these putative Pho85 CDK sites are located in the
Pho2-interacting
region of Swi5, including two sites that overlap the
V494A and
S505P mutations (Fig.
5).
Although the V494A mutation is within
the SPVL sequence, the
valine-to-alanine substitution does not
alter the nature of this site
as a potential phosphorylation site,
based on the current consensus
sequence. The S505P substitution,
however, alters the phosphorylatable
serine within this site.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Swi5 residues important for interaction with Pho2. The
diagram shows the Swi5 protein, with residues 545 to 632 comprising the
three zinc fingers of Swi5 indicated. The region of amino acids 471 to
511 is expanded, and the 482-to-505 region important for Pho2
interaction is shaded. The primary amino acid sequence of Swi5 from
residues 471 to 511 is shown, amino acid substitutions that reduce
interaction with Pho2 are in boldface type, and those residues that
affect expression of the native HO locus are indicated with
a star. The putative phosphorylation sites for the Pho85 CDK are
overlined, and putative phosphorylated residues (T490, S492, and S505)
that were mutated to alanines have a box beneath them.
|
|
Thus it was reasonable to investigate whether mutations at these
potential phosphorylation sites alter the ability of Swi5
to activate
both
PHO2-dependent and
PHO2-independent
reporters
in vivo. We used site-directed mutagenesis to convert the
phosphorylatable
serine or threonine residues to alanines in the three
consensus
sites and expressed them on YCp vector backbones either as
single-
or multiple-mutant combinations. Immunoblots showed that these
proteins with alanine mutations accumulated to approximately the
same
level as the wild type did (data not shown). Table
4 shows
a comparison of the Swi5 alanine
mutants that were analyzed for
their ability to activate
HO(site B)-
lacZ and
CTS1(46)-
lacZ reporters.
We noted two
intriguing features of these mutants. First, although
all three
substitutions (at T490, S492, and S505) map within the
Pho2 interaction
region of Swi5, none of the alanine mutations
reduced the activity of
the
PHO2-dependent reporter
HO(site
B)-
lacZ indicating that they did not interfere with Pho2
interaction.
In contrast, the S492A mutation, either alone or in
combination
with the T490A and S505A mutations, significantly
stimulated expression
from both reporters. This experiment also
demonstrates that alanine
substitutions at all three putative
phosphorylation sites lead
to a striking fourfold increase in the level
of the
HO(site B)-
lacZ reporter in comparison
with a twofold increase in activity of
the
CTS1(46)-
lacZ reporter. Interestingly, the
HO(site B)-
lacZ reporter is also
PHO2
dependent whereas the latter reporter is
not. Finally, we note that the
S505P and S505A mutants have quite
different phenotypes, demonstrating
that alanine substitution
mutations do not always indicate the
importance of a particular
amino acid residue.
Two-hybrid analysis of Swi5-Pho2 interactions.
The previous
experiments show that mutations in specific residues of Swi5 between
amino acids 480 and 505 alter the ability of Swi5 to bind DNA
cooperatively with Pho2, but they do not address whether this region is
sufficient for interaction with Pho2. We used two-hybrid interactions
(15) to address this question. We generated a plasmid that
expresses the LexA DNA-binding domain fused in frame to a 42-amino-acid
region of wild-type Swi5 (amino acids 471 to 513). This
LexA-Swi5(471-513) fusion protein is unable to activate transcription
of a lacZ reporter containing LexA binding sites in the
promoter, either in a PHO2 strain (Fig.
6, line 2) or in a pho2 strain
(data not shown). This suggests that the amino acid 471-to-513 region
of Swi5 does not contain an activation domain. This experiment also
suggests that although this region can interact with Pho2 (see below),
native Pho2 does not provide the activation domain function for the
Swi5-Pho2 heterodimer. It has been previously shown that Pho2 lacks an
activation domain (17), and we have identified an activation
domain present near the N terminus of Swi5 (unpublished observations).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
Two-hybrid analysis of Swi5-Pho2 interactions. Strain
DY1641 was transformed with bait and prey plasmids (HIS3 and
LEU2 markers, respectively), and transformants were grown in
selective medium and assayed for -galactosidase activity. Three
independent transformants were assayed, and standard errors are shown.
The normalized levels are also shown as a percentage of the wild-type
level. The LexA-Swi5 plasmids contain amino acids 471 to 513 of Swi5
fused in frame to the LexA DNA-binding domain. The following plasmids
were used: M1921, M3895, M3896, M3897, M3899, M3900, M3901, M3902,
M3903, M3917, M3918, M3931, M3466, and M3913.
|
|
Since Pho2 apparently lacks an endogenous activation domain, we
constructed a plasmid that expresses a Gal4 activation domain
(GAD)
fused to Pho2 for use in two-hybrid experiments. As shown
in Fig.
6,
expression of the LexA-Swi5(WT,471-513) bait along
with the
GAD-Pho2 prey leads to strong activation of the two-hybrid
reporter
(line 3). Expression of either the LexA-Swi5(WT,471-513)
(line 2) prey
alone or the GAD-Pho2 prey alone (line 1) does not
lead to activation.
This experiment clearly demonstrates that
this 42-amino-acid region of
Swi5 is sufficient for interaction
with Pho2. In these experiments,
Swi5 lacking its own DNA-binding
domain is able to interact with Pho2.
In contrast, in vitro experiments
were unable to detect any in vitro
interaction between Swi5 and
Pho2 in the absence of DNA (
5).
The success of the present
experiment may reflect the greater
sensitivity of two-hybrid assays
(
14), or it is possible
that another DNA-binding domain, LexA,
can substitute for that of Swi5.
In summary, this two-hybrid experiment
clearly demonstrates that this
42-amino-acid region of Swi5 is
sufficient for interaction with Pho2.
We next determined whether specific mutations in
LexA-Swi5(471-513) affect the two-hybrid interaction with
GAD-Pho2. To that
end, we constructed plasmids expressing
LexA-Swi5 fusions containing
each of the nine single amino acid
substitutions and tested them
in the two-hybrid assay with GAD-Pho2
(Fig.
6). The V494A, S497P,
and Q498R substitutions resulted in a
dramatic drop in reporter
activity to levels comparable to those of
LexA-Swi5 without GAD-Pho2,
suggesting a complete loss of interaction
between LexA-Swi5(471-513)
and GAD-Pho2. The E482K, S483G, and F485S
mutations activate the
reporter at slightly higher levels, indicating
weak interactions
with GAD-Pho2 in the two-hybrid assay. Interestingly,
the three
substitution mutants that retain cooperative interactions
with
Pho2 in vitro, the R484G, R484S, and S505P mutants, show
two-hybrid
interaction with GAD-Pho2 nearly as strong as that of
wild-type
LexA-Swi5(471-513). This implies that these three
mutations only
marginally affect the ability of
LexA-Swi5(471-513) to interact
with GAD-Pho2 in vivo.
Western immunoblot analysis (data not shown)
shows that the three
mutant LexA fusions (the V494A, S497P, and
Q498R mutants) with the most
severely reduced two-hybrid interaction
are expressed at the same level
as that of wild-type LexA-Swi5(471-513).
This demonstrates that these
three amino acid residues play an
important role in
interactions of Swi5 with the Pho2 homeodomain
protein. In summary, the
two-hybrid experiments support our contention
that a small region
of Swi5 between residues 471 and 513 is both
necessary and
sufficient for interaction with Pho2.
In a previous experiment (Table
4), we showed that alanine
substitutions in the three potential phosphorylation sites in
Swi5(471-513) causes a fourfold increase in activity of the
PHO2-dependent
reporter
HO(site
B)-
lacZ reporter, with only a modest increase
in
CTS1(46)-
lacZ, a
PHO2-independent
reporter. We thus considered
the possibility that changes in the
phosphorylation state of this
region of Swi5 might alter its
interaction with Pho2. To test
the hypothesis, we constructed a plasmid
expressing LexA-Swi5(T490A,S492A,S505A,471-513),
with alanine
substitutions in all three putative phosphorylation
sites. In the
two-hybrid assay with GAD-Pho2, activation by he
LexA-Swi5(T490A,S492A,S505,471-513) fusion protein was 1.4 times
higher than that by wild-type LexA-Swi5(471-513) (Fig.
6, lines
3 and
13), although both proteins were expressed at similar levels
(data not
shown). This result supports the idea that mutation
of the
phosphorylation sites may increase the ability of Swi5
to interact with
Pho2 and thus alter the activation of the
HO(site
B)-
lacZ reporter in vivo.
| |
DISCUSSION |
The Swi5 zinc finger protein and the Pho2 homeodomain bind
cooperatively to the HO promoter at both Swi5 binding sites
in the promoter, site A at 1800 and site B at 1300 (6,
24). We have previously shown that cooperative interactions at
the HO promoter require additional regions of each
protein in addition to the DNA-binding domains. Deletion analysis
mapped the interaction domain of Swi5 to a region N-terminal to the
zinc fingers and that of Pho2 to a region C-terminal to the homeodomain
(4). Interestingly, the two proteins do not interact in
solution in the absence of DNA (5), and promoter mutation
studies indicate that there is flexibility in the binding of the
two proteins (4). In this study, we have explored the
binding interface of Swi5 for Pho2. Genetic screens were used to
identify a short stretch of Swi5, residues 482 to 505 preceding the
DNA-binding domain, that is required for interaction with Pho2. Both in
vitro and in vivo analyses show that some of these residues are
critical for the Swi5-Pho2 interaction. Two-hybrid assays, using
wild-type and mutant versions of LexA-Swi5(471-513), demonstrate that
this region of Swi5 is necessary and sufficient for interaction with Pho2. We believe that these mutations in Swi5 change amino acid residues that either make critical contacts with Pho2 or disrupt the
integrity of the Swi5 surface that interacts with Pho2.
The key to our strategy in mapping the Pho2 interaction-specific
residues of Swi5 was the use of two SWI5-dependent reporter constructs that differ in their requirement for PHO2 (Fig.
1). The HO(site B)-lacZ reporter requires both
SWI5 and PHO2 for activation, but the
CTS1(46)-lacZ reporter is efficiently expressed
in a SWI5 pho2 strain and is thus PHO2
independent. This allowed us to distinguish between SWI5*
mutants that were specifically defective in Pho2 binding from the
mutants that were transcriptionally defective, unstable, or unable to
bind DNA.
We identified nine unique mutations that clustered between residues 482 and 505 of Swi5. The location of these residues is consistent with our
earlier deletion analysis, in which Swi5(384-709), but not
Swi5(496-709), was able to bind DNA cooperatively with Pho2
(4). The nuclear magnetic resonance solution structure of a
Swi5 fragment showed that the first zinc finger has a -strand and an
-helix that are not observed in other zinc finger structures (13, 31). Amino acids 471 to 513 of Swi5, lacking the zinc finger DNA-binding domain or the additional structural elements in the
first zinc finger, is sufficient for interaction with Pho2 in a
two-hybrid assay. This demonstrates that the DNA-binding and Pho2
interaction domains of Swi5 are functionally and structurally distinct.
Yeast has two zinc finger proteins, Swi5 and Ace2, that have nearly
identical DNA-binding domains. Although both proteins bind in vitro to
site B within the HO promoter with the same affinity, only
Swi5 activates HO transcription (10, 11).
Chimeras containing portions of Ace2 and Swi5 have been constructed,
and these experiments show that amino acids 394 to 521 of Swi5 are
required for activation of HO (25). Thus, the
Pho2 interaction region of Swi5 (amino acids 482 to 505), defined
in this study, lies within the region of Swi5 (amino acids 394 to 521),
mapped by the chimeric analysis, that is required for
promoter-specific activation of HO. Because of the overlap
of the Pho2 interaction region and the HO specificity region
of Swi5, it is possible that mutations in this region could also affect
promoter specificity of the Swi5 transcription factor (see below).
Although the screen was designed to identify mutations that affect
interaction with Pho2, one could expect to recover mutations that
specifically affect activation of the HO gene since an
HO UAS fragment was used in the primary screen.
We have classified the SWI5* mutations based upon in vitro
DNA binding studies (Table 5). We first
examined the ability of the Swi5 mutant proteins purified from E. coli to bind to the HO promoter in the absence of Pho2.
All of the mutants showed normal DNA-binding activity. However, there
were major differences in the ability of the Swi5 mutant proteins to
bind DNA cooperatively with Pho2. Table 5 shows that for most Swi5
mutants there is a good correlation between the ability to interact
with Pho2, either in the in vitro DNA binding assay or the in vivo
two-hybrid assay, and the ability to activate transcription of
PHO2-dependent promoters.
The class A mutations, S497P and Q498R, are at adjacent positions, and
caused the strongest defect in cooperative binding with Pho2 in vitro.
These two mutations also caused a significant drop in two-hybrid
interaction with Pho2, as well as loss of activation of the
PHO2-dependent promoters, HO(site
B)-lacZ and HO(a1). Although the S497P mutation
is a structurally severe mutation in comparison to the Q498R mutation,
both substitutions have comparably severe effects in both in
vitro and in vivo assays. These results suggest that residues
S497 and Q498 are critical components of the Pho2-interactive surface
of Swi5.
The class B mutations, E482K, S483G, and F485S, cause a moderate
reduction in cooperative DNA binding with Pho2 in vitro. This apparent
defect in Pho2 interaction is enhanced in the in vivo assays (Table 5).
These mutations caused a strong defect in the two-hybrid assay and in
activation of HO(site B)-lacZ and HO(a1), although the defect is not as pronounced as that
caused by the class A mutations.
The four class C mutations R484G, R484S, V494A, and S505P
result in mutants that retain most of their cooperative interactions with Pho2 in the in vitro assay. However, there are some striking differences among these mutants in the in vivo assays (Table 5). First,
for the R484G and R484S mutants, the in vitro phenotype is consistent
with a strong two-hybrid interaction with Pho2 and activation of the
PHO2-dependent HO(a1) promoter. Based on
these results, the poor activation of the HO(site
B)-lacZ reporter used in the initial screen is surprising.
We suggest that the HO(site B)-lacZ reporter
assay is the most sensitive in vivo assay because this reporter has a
single Swi5 binding site. In contrast, the HO(a1) promoter
has two Swi5 binding sites, and although one Swi5 binding site has
substitution mutations, interactions with Pho2 promote strong binding
(24). Thus it is possible that a mutation at residue R484
very modestly reduces interaction with Pho2 and that the different
assays have different degrees of sensitivity.
The other class C mutations, V494A and S505P, caused significantly
reduced expression of the PHO2-dependent promoters,
HO(site B)-lacZ and HO(a1), despite
resulting in mutants with normal DNA binding with Pho2 in the in vitro
assay (Table 5). The V494A and S505P class C mutants have one very
different phenotype, since the V494A mutant fails to interact
with Pho2 in the two-hybrid assay while the S505P mutant shows
a strong two-hybrid interaction. As described above, the
DNA-binding domain of Swi5 is not sufficient to activate HO,
and regions of Swi5 overlapping the Pho2 interaction domain are
required for promoter-specific activation of HO (11, 25). We suggest that the S505P substitution mutant probably does
not fit the criterion of being defective in interacting with Pho2, and
phosphorylation of the S505 residue may not be a crucial component of
the Pho2-interactive surface. Serine 505 might be required for
activating the HO promoter, and thus the S505P
mutation affects activation of both native HO and
HO(a1). The V494A mutant also affects expression of native
HO. However, the defect of the V494A mutant in interacting
with Pho2 in the two-hybrid assay suggests a dual role, with valine 494 being required for both interaction with Pho2 and for specific
activation of the HO promoter. This result suggests that
this region of Swi5 has multiple functions, conferring specific
activation of the HO promoter and interacting with Pho2, and
that these two distinct functions may overlap in one region of the Swi5
protein.
How can we reconcile the observation that for some of the
SWI5* mutants, such as the V494A mutant, the in vitro
DNA-binding activity does not fully correlate with the in vivo
phenotype? We have previously shown that the Swi5-Pho2-DNA ternary
complex is significantly more stable in vitro than either the Swi5-DNA or Pho2-DNA binary complex (6). Moreover, additional
modifications such as phosphorylation may influence Swi5-Pho2
interaction in vivo, and this sensitivity might be partly lost in in
vitro assays using proteins purified after expression in
E. coli. Swi5 is heavily phosphorylated in vivo
(22), and more recently it has been shown to be
phosphorylated in vitro by Pho85 CDK (21). The Pho2
interaction region of Swi5(482-505) contains three potential
phosphorylation sites for the Pho85 CDK (Fig. 5), and the S505P
mutation alters one of these phosphorylatable serine residues.
Additionally, conversion of the three phosphorylatable residues to
alanines caused a striking increase in activity of Swi5 as a
transcriptional activator. Specifically, the S492A mutation, singly or
in combination with the T490A and S505A mutations, caused a
significantly greater increase in activation of the
PHO2-dependent HO(site B)-lacZ
reporter than of the CTS1 (46)-lacZ reporter. It
is conceivable that the phosphorylation status of this region of Swi5
might influence its ability to interact with Pho2.
Combinatorial control, involving cooperative interactions between
DNA-binding proteins, is an important mechanism in transcriptional regulation. Specific interactions between two DNA-binding proteins allow different combinations of transcription factors to act at different genes. Pho2 interacts with at least three different partner
proteins, the Swi5 zinc finger protein, the Pho4 basic helix-loop-helix protein, and the Bas1 Myb-like protein.
Acting with these different partner proteins, Pho2 activates
transcription of many different genes. We are unable to find any
significant sequence similarities with either Pho4 or Bas1 to the
region of Swi5 required for interaction with Pho2. Distinct regions of
Pho2 may interact with these three proteins, or the interaction motif may be sufficiently degenerate that it cannot be identified by inspection. It is also possible that the interaction regions of Swi5,
Pho4, and Bas1 may have similar structures without obvious sequence
similarities. The in vivo and in vitro analyses presented here show
that it is possible to identify single amino acid residues in Swi5 that
are critical for Pho2 interaction and to provide new tools for the role
of protein-protein interactions in combinatorial control of gene
expression.
| |
ACKNOWLEDGMENTS |
We thank members of the Stillman lab for helpful discussions and
Rob Brazas, Bob Dutnall, and Helen McBride for comments on the
manuscript.
Oligonucleotide synthesis and DNA sequencing were performed at the
Huntsman Cancer Institute DNA/Peptide and DNA Sequencing Facilities,
respectively, which are supported in part by NCI grant 5 P30 CA42014.
The present work was supported by grants from the National Institutes
of Health.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Molecular Biology and Genetics, Department of Oncological Sciences,
Huntsman Cancer Institute, University of Utah Health Sciences Center,
50 N. Medical Dr., Room 5C334 SOM, Salt Lake City, UT 84132. Phone: (801) 581-5429. Fax: (801) 581-3607. E-mail:
stillman{at}genetics.utah.edu.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. E. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1987.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Barbaric, S.,
M. Munsterkotter,
J. Svaren, and W. Horz.
1996.
The homeodomain protein Pho2 and the basic-helix-loop-helix protein Pho4 bind DNA cooperatively at the yeast PHO5 promoter.
Nucleic Acids Res.
24:4479-4486[Abstract/Free Full Text].
|
| 3.
|
Bobola, N.,
R. P. Jansen,
T. H. Shin, and K. Nasmyth.
1996.
Asymmetric accumulation of Ash1p in postanaphase nuclei depends on a myosin and restricts yeast mating-type switching to mother cells.
Cell
84:699-709[Medline].
|
| 4.
|
Brazas, R. M.,
L. T. Bhoite,
M. D. Murphy,
Y. Yu,
Y. Chen,
D. W. Neklason, and D. J. Stillman.
1995.
Determining the requirements for cooperative DNA binding by Swi5p and Pho2p (Grf10p/Bas2p) at the HO promoter.
J. Biol. Chem.
270:29151-29161[Abstract/Free Full Text].
|
| 5.
|
Brazas, R. M., and D. J. Stillman.
1993.
Identification and purification of a protein that binds DNA cooperatively with the yeast SWI5 protein.
Mol. Cell. Biol.
13:5524-5537[Abstract/Free Full Text].
|
| 6.
|
Brazas, R. M., and D. J. Stillman.
1993.
The Swi5 zinc finger and the Grf10 homeodomain proteins bind DNA cooperatively at the Yeast HO promoter.
Proc. Natl. Acad. Sci. USA
90:11237-11241[Abstract/Free Full Text].
|
| 7.
|
Breeden, L., and K. Nasmyth.
1987.
Cell cycle control of the yeast HO gene: cis- and trans-acting regulators.
Cell
48:389-397[Medline].
|
| 8.
|
Butler, G., and D. J. Thiele.
1991.
ACE2, an activator of yeast metallothionein expression which is homologous to SWI5.
Mol. Cell. Biol.
11:476-485[Abstract/Free Full Text].
|
| 9.
|
Daignan-Fornier, B., and G. R. Fink.
1992.
Coregulation of purine and histidine biosynthesis by the transcriptional activators BAS1 and BAS2.
Proc. Natl. Acad. Sci. USA
89:6746-6750[Abstract/Free Full Text].
|
| 10.
|
Dohrmann, P. R.,
G. Butler,
K. Tamai,
S. Dorland,
J. R. Greene,
D. J. Thiele, and D. J. Stillman.
1992.
Parallel pathways of gene regulation: the homologous regulators SWI5 and ACE2 differentially control transcription of HO and chitinase.
Genes Dev.
6:93-104[Abstract/Free Full Text].
|
| 11.
|
Dohrmann, P. R.,
W. P. Voth, and D. J. Stillman.
1996.
Role of negative regulation in promoter specificity of the homologous transcriptional activators Ace2p and Swi5p.
Mol. Cell. Biol.
16:1746-1758[Abstract].
|
| 12.
|
Dutnall, R. N.
1995.
Structural and functional studies of a zinc finger DNA-binding domain. Ph.D. Dissertation.
University of Cambridge, Cambridge, United Kingdom.
|
| 13.
|
Dutnall, R. N.,
D. Neuhaus, and D. Rhodes.
1996.
The solution structure of the first zinc finger domain of SWI5: a novel structural extension to a common fold.
Structure
4:599-611[Medline].
|
| 14.
|
Estojak, J.,
R. Brent, and E. A. Golemis.
1995.
Correlation of two-hybrid affinity data with in vitro measurements.
Mol. Cell. Biol.
15:5820-5829[Abstract].
|
| 15.
|
Fields, S., and O. Song.
1989.
A novel genetic system to detect protein-protein interactions.
Nature
340:245-246[Medline].
|
| 16.
|
Herskowitz, I.,
B. Andrews,
W. Kruger,
J. Ogas,
A. Sil,
C. Coburn, and C. Peterson.
1992.
Integration of multiple regulatory inputs in the control of HO expression in yeast, p. 949-974.
In
S. L. McKnight, and K. R. Yamamoto (ed.), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 17.
|
Hirst, K.,
F. Fisher,
P. C. McAndrew, and C. R. Goding.
1994.
The transcription factor, the Cdk, its cyclin and their regulator: directing the transcriptional response to a nutritional signal.
EMBO J.
13:5410-5420[Medline].
|
| 18.
|
Iyer, V., and K. Struhl.
1996.
Absolute mRNA levels and transcriptional initiation rates in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5208-5212[Abstract/Free Full Text].
|
| 19.
|
James, P.,
J. Halladay, and E. A. Craig.
1996.
Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast.
Genetics
144:1425-1436[Abstract].
|
| 20.
|
Kasten, M. M.,
D. E. Ayer, and D. J. Stillman.
1996.
SIN3-dependent transcriptional repression by interaction with the Mad1 DNA-binding protein.
Mol. Cell. Biol.
16:4215-4221[Abstract].
|
| 21.
|
Knapp, D.,
L. Bhoite,
D. J. Stillman, and K. Nasmyth.
1996.
The transcription factor Swi5 regulates expression of the cyclin kinase inhibitor p40-SIC1.
Mol. Cell. Biol.
16:5701-5707[Abstract].
|
| 22.
|
Kovacech, B.,
K. Nasmyth, and T. Schuster.
1996.
EGT2 gene transcription is induced predominantly by Swi5 in early G1.
Mol. Cell. Biol.
16:3264-3274[Abstract].
|
| 23.
|
Leung, D. W.,
E. Chen, and D. V. Goeddel.
1989.
A method for random mutagenesis of a defined DNA segment using a modified polymerase chain reaction.
Technique J. Methods Cell Mol. Biol.
1:11-15.
|
| 24.
|
McBride, H. J.,
R. M. Brazas,
Y. Yu,
K. Nasmyth, and D. J. Stillman.
1997.
Long-range interactions at the HO promoter.
Mol. Cell. Biol.
17:2669-2678[Abstract].
|
| 25.
| McBride, H. J., and D. J. Stillman.
Regions of the homologous Swi5p and Ace2p transcription factors
required for specific activation of the yeast HO and
CTS1 genes identified with chimeric fusions. Submitted for
publication.
|
| 26.
| Measday, V., H. J. McBride, J. Moffat, D. J. Stillman, and B. Andrews. Interactions between the Pho85p/Pcl2p
cyclin dependent kinase and the Swi5p transcription factor. Submitted
for publication.
|
| 27.
|
Moll, T.,
G. Tebb,
U. Surana,
H. Robitsch, and K. Nasmyth.
1991.
The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae transcription factor SWI5.
Cell
66:743-758[Medline].
|
| 28.
|
Muhlrad, D.,
R. Hunter, and R. Parker.
1992.
A rapid method for localized mutagenesis of yeast genes.
Yeast
8:79-82[Medline].
|
| 29.
|
Nasmyth, K.
1985.
At least 1400 base pairs of 5'-flanking DNA is required for the correct expression of the HO gene in yeast.
Cell
42:213-223[Medline].
|
| 30.
|
Nasmyth, K.
1993.
Regulating the HO endonuclease in yeast.
Curr. Opin. Genet. Dev.
3:286-294[Medline].
|
| 31.
|
Neuhaus, D.,
Y. Nakaseko,
J. W. R. Schwabe, and A. Klug.
1992.
Solution structures of two zinc-finger domains from SWI5, obtained using two-dimensional 1H NMR spectroscopy; a zinc finger structure with a third strand of -sheet.
J. Mol. Biol.
228:637-651[Medline].
|
| 32.
|
Piatti, S.,
C. Lengauer, and K. Nasmyth.
1995.
Cdc6 is an unstable protein whose de novo synthesis in G1 is important for the onset of S phase and for preventing a `reductional' anaphase in the budding yeast Saccharomyces cerevisiae.
EMBO J.
14:3788-3799[Medline].
|
| 33.
|
Rothstein, R.
1991.
Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast.
Methods Enzymol.
194:281-302[Medline].
|
| 34.
|
Ruden, D. M.,
J. Ma,
K. Li,
K. Wood, and M. Ptashne.
1992.
Generating yeast transcriptional activators containing no yeast protein sequences.
Nature
350:250-252.
|
| 35.
|
Sherman, F.
1991.
Getting started with yeast.
Methods Enzymol.
194:1-21[Medline].
|
| 36.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 37.
|
Tebb, G.,
T. Moll,
C. Dowser, and K. Nasmyth.
1993.
SWI5 instability may be necessary but is not sufficient for asymmetric HO expression in yeast.
Genes Dev.
7:517-528[Abstract/Free Full Text].
|
| 38.
|
Thomas, B. J., and R. Rothstein.
1989.
Elevated recombination rates in transcriptionally active DNA.
Cell
56:619-630[Medline].
|
| 39.
|
Tice-Baldwin, K.,
G. R. Fink, and K. T. Arndt.
1989.
BAS1 has a Myb motif and activates HIS4 transcription only in combination with BAS2.
Science
246:931-935[Abstract/Free Full Text].
|
| 40.
|
Toone, W. M.,
A. L. Johnson,
G. R. Banks,
J. H. Toyn,
D. Stuart,
C. Wittenberg, and L. H. Johnston.
1995.
Rme1, a negative regulator of meiosis, is also a positive activator of G1 cyclin gene expression.
EMBO J.
14:5824-5832[Medline].
|
| 41.
|
Toyn, J. H.,
A. L. Johnson,
J. D. Donovan,
W. M. Toone, and L. H. Johnson.
1996.
The Swi5 transcription factor of Saccharomyces cerevisiae controls exit from mitosis by induction of the cdk-inhibitor Sic1 in telophase.
Genetics
145:85-96[Abstract].
|
| 42.
|
Zhang, F.,
M. Kirouac,
N. Zhu,
A. G. Hinnebusch, and R. J. Rolfes.
1997.
Evidence that complex formation by Bas1p and Bas2p (Pho2p) unmasks the activation function of Bas1p in an adenine-repressible step of ADE gene transcription.
Mol. Cell. Biol.
17:3272-3283[Abstract].
|
Molecular and Cellular Biology, November 1998, p. 6436-6446, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sbia, M., Parnell, E. J., Yu, Y., Olsen, A. E., Kretschmann, K. L., Voth, W. P., Stillman, D. J.
(2008). Regulation of the Yeast Ace2 Transcription Factor during the Cell Cycle. J. Biol. Chem.
283: 11135-11145
[Abstract]
[Full Text]
-
Biswas, D., Takahata, S., Xin, H., Dutta-Biswas, R., Yu, Y., Formosa, T., Stillman, D. J.
(2008). A Role for Chd1 and Set2 in Negatively Regulating DNA Replication in Saccharomyces cerevisiae. Genetics
178: 649-659
[Abstract]
[Full Text]
-
Biswas, D., Dutta-Biswas, R., Stillman, D. J.
(2007). Chd1 and yFACT Act in Opposition in Regulating Transcription. Mol. Cell. Biol.
27: 6279-6287
[Abstract]
[Full Text]
-
Mitra, D., Parnell, E. J., Landon, J. W., Yu, Y., Stillman, D. J.
(2006). SWI/SNF Binding to the HO Promoter Requires Histone Acetylation and Stimulates TATA-Binding Protein Recruitment.. Mol. Cell. Biol.
26: 4095-4110
[Abstract]
[Full Text]
-
Biswas, D., Yu, Y., Mitra, D., Stillman, D. J.
(2006). Genetic Interactions Between Nhp6 and Gcn5 With Mot1 and the Ccr4-Not Complex That Regulate Binding of TATA-Binding Protein in Saccharomyces cerevisiae. Genetics
172: 837-849
[Abstract]
[Full Text]
-
Voth, W. P., Olsen, A. E., Sbia, M., Freedman, K. H., Stillman, D. J.
(2005). ACE2, CBK1, and BUD4 in Budding and Cell Separation. Eukaryot Cell
4: 1018-1028
[Abstract]
[Full Text]
-
Shapira, M., Segal, E., Botstein, D.
(2004). Disruption of Yeast Forkhead-associated Cell Cycle Transcription by Oxidative Stress. Mol. Biol. Cell
15: 5659-5669
[Abstract]
[Full Text]
-
Yu, Y., Eriksson, P., Bhoite, L. T., Stillman, D. J.
(2003). Regulation of TATA-Binding Protein Binding by the SAGA Complex and the Nhp6 High-Mobility Group Protein. Mol. Cell. Biol.
23: 1910-1921
[Abstract]
[Full Text]
-
Formosa, T., Ruone, S., Adams, M. D., Olsen, A. E., Eriksson, P., Yu, Y., Rhoades, A. R., Kaufman, P. D., Stillman, D. J.
(2002). Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevisiae Cause Dependence on the Hir/Hpc Pathway: Polymerase Passage May Degrade Chromatin Structure. Genetics
162: 1557-1571
[Abstract]
[Full Text]
-
Bhoite, L. T., Allen, J. M., Garcia, E., Thomas, L. R., Gregory, I. D., Voth, W. P., Whelihan, K., Rolfes, R. J., Stillman, D. J.
(2002). Mutations in the Pho2 (Bas2) Transcription Factor That Differentially Affect Activation with Its Partner Proteins Bas1, Pho4, and Swi5. J. Biol. Chem.
277: 37612-37618
[Abstract]
[Full Text]
-
Hannum, C., Kulaeva, O. I., Sun, H., Urbanowski, J. L., Wendus, A., Stillman, D. J., Rolfes, R. J.
(2002). Functional Mapping of Bas2. IDENTIFICATION OF ACTIVATION AND Bas1-INTERACTION DOMAINS. J. Biol. Chem.
277: 34003-34009
[Abstract]
[Full Text]
-
Bhoite, L. T., Yu, Y., Stillman, D. J.
(2001). The Swi5 activator recruits the Mediator complex to the HO promoter without RNA polymerase II. Genes Dev.
15: 2457-2469
[Abstract]
[Full Text]
-
Yu, Y., Eriksson, P., Stillman, D. J.
(2000). Architectural Transcription Factors and the SAGA Complex Function in Parallel Pathways To Activate Transcription. Mol. Cell. Biol.
20: 2350-2357
[Abstract]
[Full Text]
-
McBride, H. J., Yu, Y., Stillman, D. J.
(1999). Distinct Regions of the Swi5 and Ace2 Transcription Factors Are Required for Specific Gene Activation. J. Biol. Chem.
274: 21029-21036
[Abstract]
[Full Text]
Top
Abstract
Introduction
