Previous Article | Next Article 
Molecular and Cellular Biology, November 1998, p. 6493-6504, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Thioredoxin Reductase Mediates Cell Death Effects
of the Combination of Beta Interferon and Retinoic Acid
Edward R.
Hofman,1
Madanamohan
Boyanapalli,1,2
Daniel J.
Lindner,1,2
Xiao
Weihua,1,2
Bret A.
Hassel,1,2
Rosemary
Jagus,3
Peter L.
Gutierrez,2 and
Dhananjaya V.
Kalvakolanu1,2,4,5,*
Department of Microbiology & Immunoogy,1
Greenebaum Cancer
Center,2
Molecular and Cellular
Biology Program,4 and
Program in
Oncology,5 School of Medicine, and
Center of
Marine Biotechnology,3 University of
Maryland, Baltimore, Maryland 21201
Received 12 March 1998/Returned for modification 5 May
1998/Accepted 3 August 1998
 |
ABSTRACT |
Interferons (IFNs) and retinoids are potent biological response
modifiers. By using JAK-STAT pathways, IFNs regulate the expression of
genes involved in antiviral, antitumor, and immunomodulatory actions.
Retinoids exert their cell growth-regulatory effects via nuclear
receptors, which also function as transcription factors. Although these
ligands act through distinct mechanisms, several studies have shown
that the combination of IFNs and retinoids synergistically inhibits
cell growth. We have previously reported that
IFN-
-all-trans-retinoic acid (RA) combination is a more potent growth suppressor of human tumor xenografts in vivo than either
agent alone. Furthermore, the IFN-RA combination causes cell death in
several tumor cell lines in vitro. However, the molecular basis for
these growth-suppressive actions is unknown. It has been suggested that
certain gene products, which mediate the antiviral actions of IFNs, are
also responsible for the antitumor actions of the IFN-RA combination.
However, we did not find a correlation between their activities and
cell death. Therefore, we have used an antisense knockout approach to
directly identify the gene products that mediate cell death and have
isolated several genes associated with retinoid-IFN-induced mortality
(GRIM). In this investigation, we characterized one of the GRIM cDNAs,
GRIM-12. Sequence analysis suggests that the GRIM-12 product is
identical to human thioredoxin reductase (TR). TR is
posttranscriptionally induced by the IFN-RA combination in human breast
carcinoma cells. Overexpression of GRIM-12 causes a small amount of
cell death and further enhances the susceptibility of cells to
IFN-RA-induced death. Dominant negative inhibitors directed against TR
inhibit its cell death-inducing functions. Interference with TR
enzymatic activity led to growth promotion in the presence of the
IFN-RA combination. Thus, these studies identify a novel function for TR in cell growth regulation.
 |
INTRODUCTION |
Interferons (IFNs) are a group of
multifunctional cytokines that stimulate antiviral, antitumor, and
immunoregulatory activities (28). Upon binding to their
receptors, IFNs activate a rapid signaling cascade wherein Janus
tyrosine kinases (JAKs) induce the tyrosine phosphorylation of
signal-transducing activators of transcription (STAT) proteins
(10). IFN-
/
activate the phosphorylation of STAT-1 and
STAT-2, which then associate with a 48-kDa DNA binding protein (p48) to
form a multimeric transcriptional complex. This complex translocates to
the nucleus, binds to the IFN-stimulated response element, and
stimulates transcription. Similarly, IFN-
induces the specific
tyrosine phosphorylation of STAT-1 alone, which binds as a dimer to GAS
(the IFN-
-activated site) and activates transcription
(10). These transcriptional complexes induce a number of
unique as well as common cellular genes whose activities may be related
to their diverse actions (58). Although a great deal is
known about the antiviral actions of IFNs (58), the
mechanisms responsible for their antitumor and immunoregulatory actions
are unclear. In vivo, they up regulate the expression of tumor-specific
antigens and natural killer cell and T-cell functions to mediate their
antitumor effects (28). In addition to these mechanisms,
IFNs directly activate growth-suppressive proteins such as pRb
(32, 48) and down regulate c-Myc in certain lymphoid tumor
cell lines (47). However, genetic evidence for a tumor
growth suppressor role exists only for certain members of the IFN
gene-regulatory factor family. Gene mutations or dysregulation of IFN
gene-regulatory factor 1 and IFN consensus sequence binding protein has
been documented in human myeloid leukemias (25, 53, 64, 66).
Since these molecules are IFN-regulated transcription factors, their
activities are necessarily dependent on either the induction of growth-
inhibitory gene products or the suppression of growth-promoting factors
(64). However, the nature of these downstream factors is
unknown. Some studies suggest that protein kinase R (PKR) and RNase L,
which inhibit viral growth in IFN-treated cells (50, 59),
also participate in growth suppression (3, 19). However,
direct evidence for the role of these factors in the antitumor action
of IFNs is lacking. Despite their strong therapeutic activity as single
agents in a number of leukemias, IFNs are less effective in the therapy
of solid tumors (18). To overcome such resistance, a number
of therapeutic approaches have been developed. Among these, the
combination of IFNs with retinoids is highly effective against several
tumors (39). The molecular basis for the potentiated
growth-suppressive action of the IFN-RA combination is unclear.
Retinoids are vitamin A derivatives that have strong influences on
metabolism, cell growth and pattern formation (36).
All-trans-retinoic acid (RA) and 9-cis-retinoic
acid (9-cRA) are two major physiological retinoids that preferentially
interact with specific nuclear receptors, which act as transcription
factors (36). Ligand-activated heteromeric complexes of RA
receptor, retinoid X receptor, and the associated coactivators up
regulate the expression of genes (17) whose promoters
contain retinoic acid response elements. Several isoforms and the
corresponding subtypes of RA receptors and retinoid X receptors
participate in a tissue and gene context-specific manner to induce gene
expression (36). Retinoids suppress cell growth of certain
primary skin dysplasias and tumor cell lines (26). However,
the gene products that mediate these effects are unknown.
Clinical reports and studies with cultured tumor cells have shown that
the IFN-RA combination is a more potent inhibitor of cell growth than
is either agent alone (39). We have observed that the
combination of human IFN-
with RA synergistically suppresses the
growth of transplanted human breast and ovarian tumor xenografts in
athymic nude mice (34). Here, we show that the IFN-RA
combination causes cell death in vitro. To identify the genes
responsible for cell death, we have used an antisense technical
knockout approach (12). In this approach specific cell
death-associated genes are identified by their ability to confer a
growth advantage in the presence of death inducers when expressed in an
antisense orientation. Using this method of cloning, we have identified several candidate genes that might participate in IFN-RA-activated cell
death. In this study we have characterized one of these genes and
identified it as human thioredoxin reductase (TR), an intracellular redox regulatory enzyme (16). We show that cellular TR
levels are posttranscriptionally enhanced by the IFN-RA
combination. Dominant negative mutants corresponding to the
dimerization domain of TR interfere with death activation.
Overexpression of one of the genes associated with retinoid-IFN-induced
mortality (GRIM-12, whose product is identical to TR) enhances cellular
susceptibility to IFN-RA-stimulated death. Thus, our studies attribute
a novel function to TR in cell growth control.
 |
MATERIALS AND METHODS |
Reagents.
Restriction and DNA-modifying enzymes (New England
Biolabs), azelaic acid (AZ), dithiothreitol, phenylmethylsulfonyl
fluoride, Triton X, imidazole, RA, sodium selenite (Sigma), G418
sulfate, isopropyl-
-D-thiogalactopyranoside (IPTG; Life
Technologies); Ni-chelation-Sepharose (Novagen), glutathione-Sepharose
(Pharmacia Biotech), nitrocellulose membranes, enhanced
chemiluminescence (ECL) reagents, and horseradish peroxidase coupled to
anti-rabbit antibodies (Amersham), human IFN-
ser (Berlex
Inc.), human IFN-
2b (Hoffmann La Roche Inc.), human and murine
IFN-
(Boehringer Mannheim), murine IFN-
(Toray
Industries), and hygromycin B (Boehringer Mannheim) were used in these
studies. Monoclonal anti-eIF-2
(57), anti-PKR
(33) and RNase L (13) were described previously. Antiactin antibodies were from Santa Cruz Biotechnology. Fresh stocks
of RA were prepared in ethanol and added to cultures under subdued
light.
Cell culture.
All estrogen-dependent cells were cultured in
phenol-red free Eagle's minimal essential medium supplemented with 5%
charcoal-stripped fetal bovine serum (CSFBS) and 10
11 M
estradiol during treatment with IFN-
and RA. The cells were grown in phenol red-free medium 24 h before treatments were
initiated. All other cell lines were cultured in media with phenol red
but supplemented with 5% CSFBS prior to treatment with IFN-
and
RA.
Cell growth assays.
Cells (2,000 cells/well) were treated
with various concentrations of IFN-
and RA in EMEM (Eagle's
minimal essential medium)-5% CSFBS in 96-well plates. Growth was
monitored for 5 to 7 days by a colorimetric assay, which monitors cell
numbers (60). Each treatment group contained six replicates.
The cells were fixed with 10% trichloroacetic acid (TCA) and were
stained with 0.4% sulforhodamine B (Sigma) in 1% acetic acid for
1 h at the end of the experiment. After the cells were washed, the
bound dye was eluted from the cells with 100 µl of Tris-HCl (pH 10.5)
and the absorbance was measured at 570 nm. One control plate was fixed with TCA 8 h after plating to determine the absorbance
representing the starting cell number. The absorbance obtained with
this plate was considered to represent 0% growth. The absorbance
obtained with untreated cells was taken as 100% growth. When expressed as a percentage of the value for untreated controls, an increase in
cell number falls on the positive scale and a decrease in cell number
(death) appears on the negative scale. This method quantitates cell
growth with an accuracy comparable to that of Coulter counting. To
determine the cell cycle distribution, cells collected after various
treatments were fixed and stained with propidium iodide as described
previously (62). The samples were analyzed by flow cytometry
(Becton-Dickinson).
Construction of the antisense expression library.
Total RNA
from the BT-20 breast tumor cell line, treated with IFN-
(500 U/ml) plus RA (1 µM) for 0, 2, 4, 8, 16, 36, 48, and 72 h, was
prepared with RNAZol B reagent (Tel-Test). These RNAs were pooled, and
total poly(A)+ RNA was isolated with the polyAtract system
(Promega). cDNA libraries were constructed with commercially available
kits (Stratagene) as recommended by the manufacturer. A 10-µg portion
of mRNA was used for preparing the cDNA library, with an oligo(dT)
primer, in the presence of a deoxynucleoside triphosphate mixture that contained 5-methyl-dCTP. After second-strand synthesis, ends and gaps
were filled with Pfu thermal DNA polymerase to ensure that the cDNA was blunt ended. The cDNAs were ligated to a synthetic double-stranded bifunctional linker, 5'-GCTTGGATCCAAGC-3'.
When attached to the 3' end of the cDNA, this linker generated a
HindIII site. Ligation at the 5' end created a
BamHI site (37). The library was then digested
with HindIII and BamHI, purified on a
Sepharose 6B column, and inserted into an episomal vector, pTKO1, which
carried markers for selection in eukaryotic (hygromycin resistance) and
bacterial (ampicillin resistance) cells (12). When cloned
into the BglII and HindIII sites of the pTKO1
episomal vector, the cDNA replaced the existing chloramphenicol
acetyltransferase gene and the cDNA was expressed in an antisense
orientation. The library was then transformed into Escherichia
coli DH10B, which takes up large plasmids with methylated DNA, and
was plated on several 150-mm-diameter plates. The bacteria were scraped
from the plates, and plasmid DNA was extracted and purified on CsCl gradients. This unamplified library was used for transfection. After
electroporation of the library (40 µg) into HeLa cells
(107), the cells were distributed among several 150-mm
plates. Drug selection was initiated with hygromycin B (200 µg/ml),
human IFN-
(3,000 U/ml), and RA (5 µM) and continued for 4 weeks. Parallel plates transfected with pTKO1 were selected similarly.
All these cells died after 10 to 12 days of selection. The medium was
changed and fresh drugs were added daily for the first week and then
every other day. At the end of 4 weeks of selection, the surviving
colonies were pooled and expanded in the presence of hygromycin B (200 µg/ml), and Hirt DNA extracts were prepared (22). DNA was
digested with DpnI and electroporated into E. coli DH10B. The resultant colonies were screened by PCR with
plasmid-specific primers to detect the presence of inserts. Inserts
were sequenced to identify the gene products.
Each individual episome was tested for cell protection against
IFN-RA-induced death in several breast carcinoma cell lines. Individual episomes (20 µg) mixed with 30 µg of salmon sperm DNA were electroporated into cells (106) in Dulbecco's minimal
essential medium with 10% FBS and 5 mM N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic
acid (BES). The electroporation conditions were 250 V, 900 µF, and 13
in a BTX electroporator. Triple selection with IFN-
(500 U/ml), RA (1 µM), and hygromycin B (100 µg/ml) was initiated after
24 h. The cells were selected for 20 days with three drugs. After
that, they were grown in medium containing hygromycin B alone. All
cells that received only pTKO1 died by 10 to 12 days of triple
selection.
Construction of dominant negative mutants.
Dominant negative
mutants were constructed by PCR with the following primers. FAD (flavin
adenine dinucleotide binding active domain) was generated with
5'-CCAAGCTTATGAACGGCCCTGAAGATC as the forward
primer and 5'-CCGAATTCTCATAAGCATTCTCATAGACGAC-3' as the reverse primer. NBD (NADPH binding domain) was prepared with 5'-CCAAGCTTATGCAATTTATTGGTCCTCACAG-3' as the
forward primer and
5'-CCGAATTCTCATGTCTTATAAACTTGATGCC-3' as the reverse primer. The ID (interface domain) was generated by using 5'-CCAAGCTTATGGTGCCTTACATCTATGCC-3' as the
forward primer and 5'-CCGAATTCTCAGCAGCCAGCCTGGAG-3'
as the reverse primer. The respective start and stop codons are
shown in boldface. PCR products were digested and cloned into the pCXN2
mammalian expression vector, in which the chicken actin promoter
regulated the expression of mutants. It also carried a neomycin
resistance marker for selection in mammalian cells. Stable
transfectants were generated by electroporation of cells with indicated
plasmids and selection with G418 (500 µg/ml). After 3 weeks of
selection, surviving clones were expanded for further studies.
Individual mutants were designated FAD, NBD, or ID. Expression of
mutants was monitored by Northern blot analysis.
Overexpression of GRIM-12.
To study the effects of
overexpression on cell growth, the GRIM-12 open reading frame (ORF),
without the untranslated region (UTR) sequences, was subcloned into
eukaryotic expression vector pCXN2. In addition, a Kozak consensus
sequence was placed upstream of ATG codon for proper translation. The
insert was checked for expression by in vitro transcription and
translation before being cloned into pCXN2 (data not presented).
Because of the removal of the UTRs, the transfected gene encodes a
~1.4-kb mRNA which can be readily distinguished from the endogenous
one by Northern blot analysis. The cells were stably transfected with
comparable concentrations of pCXN2 and GRIM-12 expression vector
separately. Multiple plates were included in the experiment and
selected for G418 resistance. At the end of 4 weeks of selection, one
set of plates was stained with Giemsa to count the number of colonies formed. In each case, drug-resistant clones growing in second set of
parallel plates were pooled and used for Northern blot, enzyme, and
growth analyses.
Northern blot analysis.
Total RNA (20 µg) was separated on
1% formaldehyde-agarose gels, transferred to a nylon membrane, and
probed with the 32P-labeled PCR product of GRIM-12 cDNA.
Prehybridization, hybridization, and washing was carried out under
stringent conditions (27).
Western blot analysis.
Total protein was extracted by
freeze-thaw method after various treatments. Total protein (10 µg)
was separated on a 10% acrylamide gel and transferred to a
polyvinylidene difluoride membrane (NEN). The membranes were incubated
with a primary antibody raised against the peptide
VVGFHVLGPNAGEVTQGFAA, derived from the native enzyme (16). After stringent washing, the membranes were incubated with anti-rabbit immunoglobulin G (IgG) antibody conjugated to horseradish peroxidase and developed with ECL reagents.
In vitro transcription and translation.
GRIM-12 was
subcloned into pBluescript KS vector (Stratagene) under the control of
the T7 promoter. Plasmid DNA (1 µg) was linearized with
HindIII, and in vitro transcription was performed with
the T7 RNA polymerase (Promega). The resultant RNA was programmed into
nuclease-treated rabbit reticulocyte lysates (Promega) in the presence
of [35S]methionine. Translation products were separated
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
(10% polyacrylamide), dried, and fluorographed.
Bacterial expression.
pET-32B (Novagen) and pGEX-2TK
(Pharmacia Biotech) were used as cloning vectors. The GRIM-12 ORF was
PCR amplified from the pTKO1-GRIM-12 cDNA clone with the forward primer
5'-CCAAGCTTATGAACGGCCCTGAAGATC-3' and the reverse
primer 5'-CCGAATTCTCAGCAGCCAGCCTGGAG-3' (start
and stop codons in boldface). These primers contained
HindIII and EcoRI sites, respectively, for
directional cloning. PCR was carried out for 10 cycles. The PCR product
was treated with T4 DNA polymerase and digested with
HindIII. It was subcloned into pET-32B at the
HindIII and XhoI sites (the sites were blunt
ended). ID was PCR amplified from pTKO1-GRIM-12 cDNA clone DNA with the forward primer 5' CCAAGCTTATGGTGCCCTACATCTATGCC 3'
and the reverse primer 5'
CCGAATTCTCAGCAGCCAGCCTGGAG 3'. These oligonucleotides
contained BamHI and EcoRI restriction
sites, respectively, for subcloning the amplified inserts. The
PCR product (535 bp) was digested with EcoRI and
BamHI and subcloned into pGEX-2TK.
pET-32B-GRIM-12 and pGEX-2TK-ID were transformed into E. coli BL21DE3, and transformants were grown in 2YT medium
(Life Technologies Inc.). A 2-liter culture was induced with IPTG (0.1 mM) at mid-log phase for 4 h at 37°C. The cells were harvested,
washed with 200 ml of buffer (20 mM Tris-HCl [pH 7.9], 500 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 0.01% Triton X, 5 mM
dithiothreitol) and suspended in 20 ml of buffer. They were sonicated,
and the clarified supernatants were passed through
Ni-chelation-Sepharose or glutathione-Sepharose 4B depending on the
fusion tag as recommended by the manufacturer. After elution, the
proteins were separated by SDS-PAGE (10% polyacrylamide) and subjected
to silver staining.
Protein interaction studies.
Purified GRIM-12 and ID
proteins were mixed and incubated for 15 min at 25°C and then for 15 min at 4°C in enzyme assay buffer. After incubation, the samples were
passed through Ni-chelation-Sepharose or glutathione-Sepharose 4B
columns, washed extensively with HEPES (pH 7.6) containing 50 mM NaCl,
and eluted. The proteins were separated by SDS-PAGE (10%
polyacrylamide). The gels were electroblotted onto a polyvinylidene
difluoride membrane, probed with TR-specific antibody, and developed
with ECL reagents to visualize the bands. Western blotting was chosen
to discern any residual nonspecific interaction through the tags.
Enzymatic assay.
TR activity was determined as described
previously (23). Cell extracts were prepared by freeze-thaw
lysis after IFN-RA treatment. A 20-µg portion of extract was
incubated with insulin, NADPH, and thioredoxin (Trx) in 0.2 M HEPES (pH
7.6) for 20 min at 37°C. The reactions were stopped with 6 M
guanidinium hydrochloride-0.4 mg of dithiobis(2-nitrobenzoic acid) per
ml in 0.2 M Tris (pH 8.0). The absorbance at 412 nm was measured. In
each case, a corresponding control without Trx was used to determine
the basal level of TR activity (due to endogenous Trx and NADPH).
Absorbance values obtained from these controls were subtracted from
those obtained with the reaction mixtures that contained Trx and NADPH.
A control reaction without cell extracts but with all the reaction
components was also used. Triplicate samples were measured for
enzymatic activity. Pure TR was used as a positive control.
PKR and RNase L assays.
PKR activity was measured by
eukaryotic protein synthesis initiation factor (eIF-2
)
phosphorylation (51). Phosphorylation of eIF-2
was
monitored by vertical slab isoelectric focusing followed by Western
blotting with eIF-2
-specific antibodies. Cell lysates were also
analyzed for the presence of PKR, eIF-2
, and actin by Western
blotting with specific antibodies. RNase L activity was monitored by
cross-linking equal amounts of cell extracts with
32P-labeled 2-5A (42) followed by SDS-PAGE (10%
polyacrylamide) and autoradiography. Levels of RNase L protein were
measured with a monoclonal antibody against human RNase L. The activity
of these enzymes in tumor samples was determined as follows. Athymic
nude mice bearing palpable human tumor xenografts (5 mm in diameter) were treated with the indicated agents for 8 weeks as described previously (34). Tumors from each treatment group were
harvested and snap frozen in liquid nitrogen, and tumor protein
extracts (50 µg) were assayed for enzymatic activity.
Nucleotide sequence accession number.
The GenBank accession
number for the sequence of GRIM-12 is AF077367.
 |
RESULTS |
The IFN-
, IFN-
, and RA combination synergistically
induces cell death in human breast carcinoma cells.
We have
previously shown that the human IFN-
-RA combination was a
stronger inhibitor of human tumor growth in athymic nude mice than
either agent alone (34). Since the IFN-
used in that study was highly species specific and these mice lacked cytotoxic T
cells, we hypothesized that growth suppression was largely due to a
direct effect of the human IFN-
-RA combination on the tumor cells rather than an activated host immune system. To directly demonstrate that the IFN-RA combination was tumoricidal in vitro, we treated several breast carcinoma cell lines with various IFNs alone
or in combination with RA and, after 1 week, measured cell growth with
sulforhodamine B (60). Increasing doses of IFN-
or
IFN-
alone did not cause significant growth inhibition in MCF-7
(an estrogen-responsive breast carcinoma cell line) in vitro (Fig.
1A). Similarly, RA (1 µM) alone did not
significantly inhibit growth. Combination of various doses of
IFN-
or IFN-
with RA caused dose-dependent growth
inhibition. When combined with RA, IFN-
or IFN-
caused
cell death at low doses (150 to 200 U/ml). Although both IFNs in
association with RA were cytotoxic in vitro, in several experiments
IFN-
was consistently a more potent inducer of cell death than
was IFN-
. To determine whether cell death could be observed in
estrogen-independent cells, we examined the effects of the IFN-RA
combination in BT-20 cells (Fig. 1B). RA alone failed to inhibit BT-20
cell growth. Unlike MCF-7, BT-20 cell growth was inhibited by
IFN-
. However, the combination of RA (1 µM) with IFN-
(100 U/ml) caused cell death. Similarly, murine IFN-
-RA induced
death in RB1, a cell line derived from a polyomavirus-transformed
murine breast tumor (Fig. 1C). Although the data in the figure depict
partial cell death, all the cells were killed by the combination after
9 days in various experiments (data not shown; see Fig. 4). To examine
whether RA also enhanced the cell growth-inhibitory actions of
IFN-
, similar growth assays were performed. IFN-
alone
did not inhibit growth, but cotreatment with RA enhanced its effect
(Fig. 1D to F). Notably, the IFN-
-RA combination did not
cause cell death even at higher doses (500 U/ml). Thus, type
I IFNs, when combined with RA, cause cytotoxicity in several tumor cell
lines.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Cells were grown in the presence of various doses of
IFNs and RA (1 µM) for 7 days. At the end of the experiment, the
cells were fixed and stained with sulforhodamine B as described in
Materials and Methods. The absorbance at 570 nm of bound dye was
quantified and expressed as a percentage of untreated controls. Each
datum point is the mean ± standard error (SE) of six replicates.
Symbols: , IFN- ; , RA plus IFN- ; , IFN- ;
, RA plus IFN- ; , IFN- ; , RA plus IFN- ;
, RA. Human MCF-7 and BT-20 and murine RB1 breast carcinoma cells
were treated with human and murine IFNs, respectively. Absorbance
values for 0 and 100% growth in this assay, respectively, are as
follows: MCF-7, 0.185 and 1.75; BT-20, 0.201 and 2.03; and RB1, 0.172 and 1.59. Values on the negative scale indicate death of initially
plated cells.
|
|
Microscopic examination of cells demonstrated a dose-dependent
cytotoxic effect. Scanning electron microscopic analyses revealed
a
phenotype consistent with programmed cell death (data not presented).
However, we did not observe classical internucleosomal fragmentation
of
genome in terminal deoxynucleotidyltransferase-mediated dUTP-biotin
nick end labeling (TUNEL) assays (data not presented). To determine
whether there was an arrest of cells in a given phase of cell
cycle
during induction of death, the cells were treated with various
agents
for 5 days, stained with propidium iodide, and analyzed
by
fluorescence-activated cell sorting. Untreated cells exhibited
a normal
cell cycle profile (Fig.
2A). Neither
IFN-

nor RA caused
cell cycle arrest, consistent with the cell
growth assays. Interestingly,
the IFN-

-RA combination also did
not cause cell cycle arrest
yet readily induced cell death (Fig.
2D).
Although in qualitative
terms the IFN-RA-treated cells appear to
show some accumulation
in G
2/M, quantitative data from
several experiments did not reveal
a significant difference from other
controls (data not presented).
The hypodiploidy seen in Fig.
2D may
represent the cell corpses
containing randomly digested subnuclear
components. Thus, cell
death occurred independently of growth arrest.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
MCF-7 cells were treated with RA (1 µM) or IFN-
(500 U/ml) or the combination for 5 days. The cells were fixed and
stained with propidium iodide after RNase A treatment.
Fluorescence-activated cell sorter and cell cycle analyses were
performed. Dead cells are indicated by a solid arrow.
|
|
IFN-RA-mediated cell death does not involve known
IFN-stimulated gene products.
We next examined whether
induction of cell death was due to an enhanced activity or expression
of IFN-stimulated gene products known to cause growth arrest and
apoptosis. Two gene products, PKR and RNase L, have been shown to
cause growth inhibition in some cell types (3, 19). The
cells were treated with various agents for 5 days, and the enzymatic
activities of these proteins were analyzed. No increase in
2',5'-oligoadenylate synthetase activity was noted after any of the
treatments (data not shown). A downstream enzyme, RNase L, cleaves
cellular RNAs after binding to 2',5'-oligoadenylates (59).
There was no change in the levels of RNase L or the 2',5'-binding
activity, an indirect measure of active enzyme (Fig.
3A and B). RNase L activity was
measured in MCF-7 cells treated in vitro (lanes C) and also in tumor
xenografts (lanes T) that regressed in vivo after IFN-RA therapy.
In all cases, RNase L activity was not significantly different from
that of untreated controls (lanes N). We also did not detect cleavage of rRNA, a characteristic of RNase L activation, in these cells (data not shown).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Activation of IFN-stimulated growth-inhibitory gene
products does not occur during IFN-RA-induced cell death. (A)
Binding of 32P-2,'5'-oligoadenylate to RNase L. (B)
Western blot analysis of RNase L. Labels above the arrows: N, no
treatment; I, IFN- ; R, RA; I+R, IFN- plus RA. Labels
below the arrows: C, cultured MCF-7; T, MCF-7 tumor xenograft in
athymic nude mice. The following doses were used: in vitro, RA (1 µM)
and IFN- (500 U/ml) for 5 days; in vivo, RA (300 µg, oral) and
IFN- (106 U, subcutaneous) every day for 40 days.
Cell or tumor extracts (70 µg) were assayed for various proteins. (C
to E) Western blot analyses of MCF-7 lysates (50 µg) with specific
antibodies: anti-PKR (C), anti-eIF-2 (D), and anti-actin (E). (F)
PKR activity as measured by phosphorylation of eIF-2 . Lanes 1 and 2 represent PKR activity in the untreated and hemin- and double-stranded
dsRNA-treated reticulocyte lysates (50 µg), respectively. Lanes 3 to
6 show PKR activity in MCF-7 lysates (50 µg) after treatment with
various agents in vitro. After vertical slab gel isoelectric focusing,
the gels were Western blotted and probed with anti-eIF-2 -specific
antibodies. The positions of phosphorylated and unphosphorylated
eIF-2 are indicated by solid and open arrowheads, respectively. The
labels above panels C to F are as explained above for panel A.
|
|
Another IFN-induced enzyme, PKR, phosphorylates eIF-2

, leading
to a cessation of polypeptide synthesis and cell growth arrest
(
50). There was no change in the levels of PKR and eIF-2

or
the enzymatic activity of PKR in MCF-7 cells (Fig.
3C, D, and
F).
Phosphorylation of eIF-2

occurred in confluent NIH 3T3 cells
but not
in subconfluent ones (
3,
50). However, phosphorylation
of
eIF-2

in MCF-7 cells treated either with IFN-

, RA, or the
combination was not different from that of untreated cells (Fig.
3F,
lanes 3 to 6). Similarly, no increase in the intratumoral
PKR activity
was observed following any treatment in MCF-7 tumors
(data not shown).
In addition, we did not detect an increase in
p53 tumor suppressor or
BAX (a promoter of cell death) or a decrease
in Bcl2 (an inhibitor of
death) under these conditions (data not
shown).
Genetic approach to isolation of cell death genes.
Because
no correlation could be found between the expression of known
growth-regulatory genes and IFN-RA-induced cell death, we
sought to identify the death-associated genes by using an antisense knockout approach (12). In principle, a death-associated
gene can be isolated by antisense inactivation of the gene. In this method, cells are transfected with an antisense cDNA library derived from tumor cells cloned in an episomal expression vector. If this library contains death-mediating gene products, the corresponding antisense RNA will inhibit the expression of that endogenous gene. Consequently, only cell clones that express the death-related antisense
mRNA will survive in the presence of the death inducer. Hirt DNA
extracts from the surviving cell clones can be isolated and transformed
into E. coli to rescue the inserts. The rescued episomes are
retransfected individually into the breast tumor cells to identify the
death-related products and eliminate false-positives isolated in the
first round of transfection.
To isolate the death-associated genes, we prepared antisense cDNA
libraries cloned in the episomal vector, pTKO1 (see Materials
and
Methods). An IFN-stimulated gene promoter drives the expression
of
antisense RNAs in this vector. This library (40 µg) was
electroporated
into HeLa cells (~50% transfection efficiency) and
selected for
resistance to hygromycin B, human IFN-

, and RA as
described in
Materials and Methods. Hirt DNA extracts were prepared
from surviving
clones, digested with
DpnI (to inactivate
unreplicated input DNA),
and transformed into
E. coli DH10B
by electroporation. A total
of 24 individual episomes were rescued in
the first round. Each
purified episome was then individually
transfected into MCF-7
and BT-20 breast carcinoma cell lines and
examined for cell protection
against IFN-RA-induced death. At the
end of two rounds of screening,
14 episomes consistently conferred
growth advantage to cells in
the presence of IFN-RA (500 U/ml plus
1 µM). Partial sequence
analyses revealed that several of these were
novel genes (data
not shown). We have named them GRIM (genes associated
with retinoid-IFN-induced
mortality). We chose one of these,
GRIM-12, for further characterization,
mainly because it contained the
largest insert. GRIM-12 clearly
protected MCF-7 cells against
IFN-RA-induced death (Fig.
4). No
surviving colonies were seen in the control plate transfected
with
pTKO1 vector alone. Thus, transfection of the GRIM-12 (in
antisense
orientation) episome conferred strong protection against
IFN-RA-induced death.

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 4.
Protection of MCF-7 cells by antisense GRIM-12 episome.
The cells were electroporated with the indicated episomes (20 µg) and
selected for 4 weeks with IFN- (500 U/ml), RA (1 µM), and
hygromycin B (100 µg/ml). Surviving cells were fixed with TCA (10%)
and stained with Giemsa.
|
|
Identification of GRIM-12 as human TR.
The GRIM-12
episome was completely sequenced on both strands. An ORF
capable of encoding a 495-amino-acid polypeptide, and long 3' and 5'
UTRs were present in this cDNA. The 5' UTR in the clone we isolated is
incomplete. The 3' UTR is 1,896 bases long. The predicted molecular
mass of the protein is 54.4 kDa. Figure 5 shows the deduced amino acid sequence
of this cDNA. Sequence analysis revealed that this cDNA was
identical to that of human TR (16), except for an arginine
in place of serine at 156, an asparagine in place of glycine at 215, and an arginine in place of serine at 491. The active center of the
enzyme appears to be formed by the cysteine residues at 57 and
62. Homology searches revealed that in addition to TR, it was
identical to a protein described as "KM-102 bone marrow-derived
reductase-like factor" (GenBank accession no. D88687) between
residues 53 and 549 (38). However, the KM-102 reductase has
an additional 52 amino acids that is unique to it. The deduced protein
sequence also exhibited a close homology to a predicted glutathione
reductase gene from Caenorhabitis elegans.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Amino acid sequence of GRIM-12. Cysteine residues of the
active site (underlined) are shown in boldface.
|
|
To examine whether the GRIM-12 cDNA contained an intact ORF, the insert
was cloned into pBluescript under the control of T7
promoter. The
cloned insert was transcribed and translated in
vitro with rabbit
reticulocyte lysates. GRIM-12 cDNA encoded a
protein that migrates as a
58-kDa species on SDS-PAGE (10% polyacrylamide)
(Fig.
6A). The ORF was also placed downstream
of a histidine tag
in pET32B vector and expressed in
E. coli. The fusion protein
was purified on Ni-chelation columns. A
78-kDa fusion protein
was expressed (Fig.
6B). This protein contained
20 kDa of tag-derived
sequences. Removal of tag sequences yielded a
58-kDa protein (data
not shown). Thus, in both eukaryotic and bacterial
expression
systems, it encodes a polypeptide of 58 kDa, which was
higher
than the predicted 54.7 kDa. This difference could be due to
posttranslational
modifications. Indeed, sequence analyses suggested
several phosphorylation
sites. However, the contributions of these
sites to the enzyme
activity remain to be determined. Bacterially
expressed fusion
protein was analyzed in Western blots with rabbit
polyclonal antibodies
specific for human TR. These antibodies readily
recognized the
fusion protein but not the tag (Fig.
6B). Thus, GRIM-12
encoded
TR.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
Identification of GRIM-12 as human TR. (A) GRIM-12 cDNA
cloned in pBluescript (pBS) vector was transcribed and translated in
vitro by using rabbit reticulocyte lysate. The protein encoded by
GRIM-12 is indicated by an arrow. (B) Expression of GRIM-12 in
bacteria. Bacterial lysates were purified on a Ni-chelation-Sepharose
column before SDS-PAGE and silver staining. (C) Western blot analysis
of the protein samples shown in panel B, using a human TR-specific
antibody.
|
|
Effect of the IFN-RA combination on the expression of
GRIM-12.
To study the effect of the IFN-RA
combination on GRIM-12, we first examined whether its mRNA levels were
inducible. Treatment of MCF-7 and BT-20 cells with the IFN-RA
combination did not induce the mRNA significantly, although a marginal
increase could be seen at 48 or 72 h (Fig.
7). Reprobing of these blots with a
glyceraldehyde 3-phosphate dehydrogenase probe confirmed the
presence of comparable amounts of RNA in all the lanes (data not
shown). Thus, the IFN-RA combination does not regulate the
transcription of GRIM-12.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
Northern blot analysis of GRIM-12 with RNA (20 µg)
derived from MCF-7 and BT-20 cells after treatment with the IFN-
(500 U/ml)-RA (1 µM) combination.
|
|
To examine whether the IFN-RA combination enhanced the expression
of GRIM-12 protein, Western blot analysis was performed.
The IFN-RA
combination induced GRIM-12 protein in a time-dependent
manner. There
was no detectable induction until 8 h posttreatment.
Between 8 and
72 h, the TR protein level increased progressively
(Fig.
8). We next determined whether an
increase in the TR protein
level correlated with an increase in
enzymatic activity. Insulin
reduction assays were performed to measure
TR activity by using
cell extracts from IFN-RA-treated cells.
Indeed, the enzymatic
activity of TR increased progressively with the
length of IFN-RA
exposure of cells (Fig.
9). The decrease in the enzymatic
activity
at 92 h posttreatment may be due to extensive cell death
at that
particular point.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 8.
Western blot analysis of cell extracts (70 µg)
prepared after IFN- (500 U/ml)-RA (1 µM) treatment as in Fig.
7. The blots were probed with TR-specific antibody.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 9.
TR activity in IFN-RA-stimulated MCF-7 cell
extracts. The cells were treated as described in the legend to Fig. 8.
TR activity was determined with 20 µg of cell extract from each
sample. Each bar represents the mean absorbance ± SE of
triplicate measurements.
|
|
Antisense inhibition of TR expression by GRIM-12.
Since the
above experiments indicated that an increase in the TR activity was
responsible for death, we determined whether cell survival was due to a
reduction of TR expression in the cells expressing the GRIM-12 episome.
Because original antisense rescue was performed in HeLa cells, we used
two stably selected pools of HeLa cells, one that expressed the pTKO1
vector alone and one that expressed the GRIM-12 antisense episome.
Northern blot analysis revealed a strong expression of antisense mRNA
only in the GRIM-12-transfected cells (Fig.
10A). To determine if antisense GRIM-12
caused a reduction in the level of TR protein, equal amounts of total
cell lysates from these cells were subjected to Western blot analysis.
Indeed, antisense expression of GRIM-12 mRNA accompanied a strong
reduction in the level of TR protein (Fig. 10B). Using the same
extracts, we also determined the enzyme activity. Cells expressing
antisense GRIM-12 had a sevenfold lower TR activity compared those from the control cells (Fig. 10C). These data indicate that antisense expression of GRIM-12 in long-term culture can repress TR expression.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 10.
Antisense expression of GRIM-12 interferes with TR
expression. HeLa cells transfected with the pTKO1 or GRIM-12 episome
were stably selected with hygromycin B for 4 weeks as described in
Materials and Methods. (A) Total RNA (40 µg) from each cell line was
used for Northern blotting. The blots were probed with
32P-labeled GRIM-12. Solid and open arrowheads indicate the
positions of antisense and sense GRIM-12 mRNAs, respectively. (B)
Expression of TR protein in the antisense GRIM-12-transfected cells.
Equal amounts of the cell extract (50 µg) from the indicated cells
were analyzed by Western blotting. Note the differences in expression
of TR protein between the two cell types. (C) TR activity of the cells
used in panels A and B. Cell extracts (20 µg) were assayed for TR as
described in the legend to Fig. 9. Each bar represents mean
absorbance ± SE of triplicate determinations.
|
|
Overexpression of GRIM-12 mutants inhibits IFN-RA-induced cell
death.
Since GRIM-12 (TR) was isolated as an activator of
IFN-RA-stimulated cell death, we next examined whether
overexpression of specific subdomains of TR in the cells would also
ablate the death induction by the IFN-RA combination. Based on its
relationships to other members of the glutathione reductase-TR family,
a modular structure of GRIM-12 was predicted (16). An
N-terminal FAD binding domain (FAD domain or active domain) and a
central NADPH binding domain (NBD) and a C-terminal interface domain
(ID) are the major functional modules of this enzyme (Fig.
11A). The FAD domain contains the
cysteine residues essential for the reduction of its substrate, Trx.
The NBD binds NADPH, an essential cofactor for redox enzymes. The
interface domain is crucial for the generation of functional enzyme via
dimerization.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 11.
Expression of various functional domains of GRIM-12
(TR) in MCF-7 cells. (A) Proposed functional domains of GRIM-12 protein
and their approximate sizes. N and C indicate the amino and carboxyl
termini, respectively, of the native protein. aa, amino acids. (B)
Northern blot analysis of total RNA (40 µg) from various cell lines
with the GRIM-12 probe. Labels above the panel indicate plasmids
transfected into the cells. V, pCXN2 vector; FAD, FAD domain; NBD,
NADPH binding domain; ID, interface domain; FL, full-length mRNA;
DN, dominant negative mutants. The lanes contained comparable amounts
of RNA as detected by the glyceraldehyde-3-phosphate
dehydrogenase probe (data not shown).
|
|
To determine whether these domains acted as dominant inhibitors of
endogenous GRIM-12 (TR), we created deletion mutants that
contained
only one domain by using region-specific oligonucleotides
and PCR.
These inserts were subcloned into an eukaryotic expression
vector,
pCXN2, which also carried a neomycin resistance gene for
selection in
mammalian cells. Recombinant vectors were then transfected
into MCF-7
and BT-20 cells, and stable cell lines were established.
Expression of
the GRIM-12 mutants was ascertained by Northern
blot analysis (Fig.
11B). Comparable amounts of mutant domains
were present in the cell
lines. As anticipated, expression of
GRIM-12 mutants was not seen in
cells that were transfected with
vector alone. No differences in the
growth rates of stable cell
lines expressing various mutants were noted
(data not presented).
To test the effects of IFN, RA, and their combination, growth assays
were performed with cell lines that expressed various
domains of
GRIM-12. Treatment with either IFN-

(500 U/ml) or
RA (1 µM) alone did not cause significant growth inhibition in
any
cell line (Fig.
12A). These
observations were consistent with
the sensitivities of the parental
cell line (Fig.
1). However,
treatment with the IFN-RA combination
induced cell death in untransfected
cells and those that were
transfected with vector alone. Expression
of the FAD domain did not
significantly inhibit the cell growth-suppressive
effect of IFN-RA.
The NADPH binding domain conferred slight protection
against
IFN-RA-induced cell death. However, the ID provided the
strongest
protection compared to other domains (Fig.
12B). Remarkably,
the
IFN-RA combination could inhibit ~60% of cell growth even
when
the ID was overexpressed. This was not a clonal effect, because
similar
data were obtained for a pooled population of 100 clones
(data not
presented). Similar results were obtained with BT-20
cells (data not
shown). These data confirmed the role of GRIM-12
as a mediator of cell
death in response to IFN-RA treatment.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 12.
Effects of IFN- (500 U/ml), RA (1 µM), and
their combination on the growth of MCF-7 cells expressing various
domains of GRIM-12. (A) Effects of the single agents on the cell growth
described in the legend to Fig. 10. (B) Effects of the IFN-RA
combination on cell growth. Growth assays were performed as described
in the legend to Fig. 1. Each bar represents the mean ± SE of six
replicate determinations in the same experiment. UT, untransfected
cells. Other notations are explained in the legend to Fig. 11B. Mean
absorbance values for 0 and 100% growth, respectively, in this
experiment are as follows: UT, 0.195 and 1.83; V, 0.210 and 2.30; FAD,
0.18 and 0.185; NBD, 0.207 and 0.211; ID, 0.17 and 1.83. (C) TR
activity of the cells shown in panel B. Each bar shows the mean ± SE of triplicate determinations. Cell extracts (25 µg) were assayed
as described in Materials and Methods. (D) Effect of AZ on IFN-RA
(IR)-induced cell death. MCF-7 cells were incubated with the indicated
agents, and growth was measured after 6 days. Note the cell death in
the IR column and its inhibition by AZ (10 µM). Mean absorbance
values for 0 and 100% growth are 0.186 and 1.52, respectively.
|
|
We next examined whether ablation of IFN-RA-suppressed cell growth
was due to a decrease in the enzymatic activity of TR in
cells
expressing the mutants. Insulin reduction assays were performed
to
detect these differences. Cells that expressed vector alone
had
the highest enzymatic activity (Fig.
12C). Cells expressing
the FAD
domain had a marginal loss of enzymatic activity. Cells
with the NBD
had intermediate inhibition of TR activity. Expression
of ID caused the
greatest reduction in enzymatic activity. Thus,
ablation of enzymatic
activity correlated well with loss of growth
suppression by the
IFN-RA combination (Fig.
12C).
Since IFN-RA-induced growth inhibition occurred in the cells
expressing the ID mutant, it is possible that the mutant acts
as
an inefficient inhibitor due to a nonnative structure. Therefore,
we examined the effect of AZ, a known chemical inhibitor of TR
(
52), on IFN-RA-induced cell death. As expected,
IFN-RA caused
cell death in MCF-7 cells. Although AZ itself was
slightly inhibitory
(7%) under the growth conditions used, it clearly
abrogated IFN-RA-stimulated
death in MCF-7 cells (Fig.
12D).
Interestingly, IFN-RA caused significant
growth inhibition (70%)
even in the presence of AZ. Thus, genetic
and chemical inhibition of TR
ablates IFN-RA-induced cell death.
Importantly, IFN-RA-induced
growth-inhibitory actions continue
to operate under both these
conditions.
The ID associates with full-length TR in vitro.
The above
results suggested that the dominant negative effect of ID was probably
due to its interaction with endogenous TR. To directly test whether ID
interacted with the full-length protein, we expressed both these
proteins separately in E. coli. Full-length GRIM-12 and ID
were expressed as His-tag fusion and glutathione S-transferase (GST) fusion proteins, respectively.
Purified proteins (Fig. 13A and B) were
tested for interaction with each other on different matrices (Fig.
13C). These proteins were incubated in HEPES (pH 7.6) and then passed
over either Ni-chelation-Sepharose (Fig. 13C, lanes 1 to 4) or
glutathione-Sepharose (lanes 6 to 9). The Sepharose-bound material was
washed extensively, eluted, and loaded on 10% polyacrylamide gels for
SDS-PAGE. The GST tag and hexahistidine tag alone were used as negative
controls to demonstrate the specificity of interaction.
Ni-chelation-Sepharose and glutathione-Sepharose were used as
additional negative controls. GST-ID (lane 3) and His-GRIM-12 (lane 9)
bound to the glutathione-Sepharose and Ni-chelation-Sepharose, respectively (Fig. 13C). The two proteins interacted with each other when coincubated. Consequently, GST-ID was pulled
down along with His-GRIM-12 by Ni-chelation-Sepharose (lane 8).
Similarly, His-GRIM-12 was pulled down along with
GST-ID by glutathione-Sepharose (lane 4). Neither
Ni-chelation-Sepharose (lane 6) nor His tag alone (lane 11)
interacted with GST-ID. Therefore, it was not pulled down
along with them. Similarly, His-tag GRIM-12 did not interact with
either glutathione-Sepharose (lane 2) or GST tag alone (lane 1). These
data show that the mutant and wild-type proteins interact with each
other in vitro in the absence of other proteins.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 13.
Binding of purified ID to GRIM-12 (TR) in vitro. ID and
GRIM-12 were expressed as GST and histidine-tagged fusion proteins in
E. coli. Pure proteins were obtained after two rounds of
chromatography on glutathione-Sepharose or Ni-chelation-Sepharose
columns. (A and B) Silver-stained SDS-PAGE gels (10% polyacrylamide)
after purification of these proteins. Overexpression of fusion protein
was performed by treating the cells with an inducer (IPTG). (C)
Equimolar amounts of purified proteins were preincubated with each
other before being subjected to chromatography on the indicated column.
The presence or absence of the proteins in the incubation mixture is
indicated by + and , respectively. Affinity matrices used for
separation after protein interaction are indicated above the arrows.
After elution, the samples were loaded and separated by SDS-PAGE (10%
polyacrylamide). Pure proteins (one-fifth of those in other lanes),
without passing over the affinity matrices, were loaded in lanes 5 and
10. After separation, the samples were Western blotted with a
TR-specific antibody. Western blotting was used to detect any
nonspecific interactions between tags and fusion protein.
|
|
GRIM-12 specifically mediates IFN-RA-induced death.
We
next examined whether ID also blocked the growth-inhibitory effects of
other cytotoxic agents. For this purpose, cell clones expressing vector
alone, FAD, or ID were treated with tumor necrosis factor alpha
(TNF-
), etoposide, or vincristine and monitored for growth
inhibition (Fig. 14). The cells were
treated with concentrations of these drugs near their 50%
inhibitory concentration. Growth of cells transfected with vector alone
was strongly inhibited by all three agents. Overexpression of either
the FAD or ID domain did not confer a growth advantage in the presence
of these agents. Therefore, TNF-
, etoposide, and vincristine did not
require GRIM-12 for inhibiting cell growth. These data suggest a
specific participation of GRIM-12 in the IFN-RA-induced cell death
pathway.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 14.
Effects of other growth inhibitors on cells expressing
various domains of GRIM-12. Cells were challenged with doses of
etoposide, TNF- , and vincristine near their IC50, and
growth assays were performed as in Fig. 1. Mean absorbance values for 0 and 100% growth, respectively, in this experiment are as follows: V,
0.19 and 2.15; FAD, 0.175 and 1.90; ID, 0.22 and 2.31. Other
notations are explained in the legend to Fig. 12.
|
|
Effect of GRIM-12 overexpression on cell growth.
Since the
above experiments indicated that interference with TR expression and
function prevents IFN-RA-induced cell death, we examined the
effect of GRIM-12 overexpression on cell growth. GRIM-12 ORF
cloned in pCXN2 vector was electroporated into MCF-7 cells, and
G418-resistant clones were selected. A parallel control with the
expression vector alone was also included. Multiple plates were used in
the experiment. One set was stained with Giemsa to determine the
colony number. Other plates were used to determine cell growth,
mRNA expression, and enzyme assay. Although drug-resistant colonies
formed in both cases, significantly fewer colonies formed in the case
of GRIM-12-transfected cells (Fig.
15A). This result suggested that cells
expressing the highest level of GRIM-12 died during selection. The
surviving drug-resistant colonies from pCXN2 (n = 1,000)- and GRIM-12 (n = 750)-transfected plates were
pooled separately, and their growth was monitored by the
sulforhodamine B assay (60). The GRIM-12-transfected
cells grew significantly slower than those transfected with the vector
alone (Fig. 15B). To determine the expression of transfected gene,
Northern blot analyses were performed with the RNAs derived from
pCXN2- and GRIM-12-transfected cells. A 1.4-kb mRNA was seen only
(Fig. 15C, solid arrowhead) in the GRIM-12-transfected cells. A larger
species of endogenous mRNA was also seen in pCXN2- and
GRIM-12-transfected cells (open arrowhead). Enzyme assays revealed
approximately 3.5-fold more enzyme activity in GRIM-12-transfected
cells than in those that expressed the vector alone (Fig. 15D). We next
examined whether GRIM-12-transfected cells were more sensitive to
IFN-RA-induced cell death. Indeed, IFN-RA caused significantly
higher cell death in GRIM-12-expressing cells than in those expressing
the vector (Fig. 15E).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 15.
Effect of GRIM-12 overexpression on cell growth. MCF-7
cells were transfected with comparable amounts of pCXN2 or GRIM-12
cloned in pCXN2 vector. The cells were selected for 4 weeks with G418.
(A) One set of plates was stained with Giemsa to determine the number
of colonies formed. The other was used for the experiments in panels B
to E. (B) Growth of different cell types. Cell growth was compared
after 6 days of growth by using the sulforhodamine B assay. Each bar
represents the fold increase in cell number ± SEM of six samples.
(C) Northern blot analysis of GRIM-12 mRNA expression. Open and solid
arrowheads indicate the positions of the endogenous and transfected
GRIM-12, respectively. (D) TR activity in the cells used in panels B
and C. Mean absorbance values ± SE of triplicate determinations
are shown. (E) Effect of IFN-RA. Equal numbers of indicated cells
were exposed to IFN-RA (500 U/ml and 1 µM) for 6 days. The growth
assay was performed as described in the legend to Fig. 1. The
percentage of dead cells corresponding to each untreated control
was monitored. Each bar represents the mean ± SE of six samples.
Mean absorbance values for 0 and 100% growth, respectively, for panels
B and E are as follows: pCXN2, 0.21 and 1.407; GRIM-12, 0.23 and
1.08.
|
|
 |
DISCUSSION |
Although IFNs robustly suppress the growth of several leukemias,
they are less effective against solid tumors like breast tumors and
melanomas (18, 28). Our studies show that combination of
IFN-
/
with RA, but not the single agents, causes cell death in vitro. At a comparable dosage, only IFN-
/
but not IFN-
causes cell death in the presence of RA (Fig. 1), suggesting that these two cytokines use different mechanisms to exert antitumor actions. Since cell death induction by the IFN-RA combination is independent of cycle arrest (Fig. 2), it appears that different gene products regulate growth arrest and death activities. Interestingly,
IFN-RA-induced death does not involve classic internucleosomal
fragmentation of the genome, a hallmark of apoptosis (data not shown).
A number of studies, including those with IFN-
, have shown that
internucleosomal DNA fragmentation is not obligatory for programmed
cell death to occur (9, 11, 55, 56, 65). Taken together,
these observations suggest that death regulation by IFNs involves
hitherto undefined pathways.
Indeed, examination of two IFN-stimulated pathways that cause
growth arrest or apoptosis (50, 59) indicated no significant changes in the levels and activities of PKR and RNase L during IFN-RA-induced cell death. In both cultured cells and regressing tumors, RNase L and PKR activities did not correlate with growth suppression (Fig. 3). No changes in the phosphorylation status of pRb
or the levels of p53, Bcl2, or Bax occurred during death (data not
presented). Consistent with these observations, IFNs induce cell death
independently of p53 in several cell lines (11, 43).
Recently, IFN-
has been shown to induce
interleukin-1
-converting enzyme gene expression in HeLa cells that
undergo apoptosis (7), indicating that caspases may be
crucial for IFN-
-induced cell death. Indeed, STAT1 is required
for basal expression of certain caspases (31). However,
IFN-
alone or in combination with RA did not cause cytotoxicity
in the cell lines used in this study (Fig. 1). Even though IFNs failed
to induce the death of the human breast carcinoma cells used in our
study, TNF-
did so rapidly (data not shown). Since TNF-
induces
cell death by using caspases (5, 41), activation of caspases
appears to be normal in these cells. Strikingly, a longer exposure to
the IFN-RA combination (3 to 4 days) than to TNF-
(6 to 8 h) is required for death induction. Therefore, IFN-
-RA-induced
cell death may differ from the known pathways and utilize some
undefined gene products.
To identify the functionally relevant death-associated gene products,
we used the antisense technical knockout strategy (12). In
this approach, specific GRIM are inactivated by antisense gene products, thus providing a growth advantage to transfected cells in the presence of the IFN-RA combination. The library used in the
present study was generated with the RNAs isolated from untreated cells
as well as those treated with the IFN-RA combination. Thus, genes
expressed at all stages of the cell death process were included in the
library without a bias for those expressed only after treatment. Because an IFN-stimulated promoter drives the expression of the antisense inserts, a functional JAK-STAT pathway is required
(12). Therefore, antisense RNAs directed against the
genes encoding IFN receptor chains, JAKs, or STATs cannot account
for cell survival in the presence of IFN-RA. In fact, cDNAs
corresponding to these products have not been rescued in our studies or
in other studies (11). Consistent with the possibility that
multiple gene products participate in IFN-RA-induced cell death, we
have rescued at least 14 different cDNAs by this approach (data not
shown). GRIM-12, the cDNA characterized in this study, protected
cells from IFN-RA-induced death when expressed in antisense
orientation (Fig. 4 and data not shown). Sequence analysis of this
cDNA revealed that it was identical to the gene encoding human TR
(16). The transcription of GRIM-12 mRNA was not induced in
these cells by IFN-RA treatment. However, its expression was
enhanced at a posttranscriptional level. The up regulation of the
GRIM-12 protein level corresponded to an increase in its enzymatic
activity, which also reached its maximum during cell death. Thus, there
appears to be a direct correlation between enzymatic activity and cell
death. The relationship between inhibition of TR gene expression by
antisense knockout and cell survival in long-term culture was
established by the expression of antisense mRNA, suppression of TR
expression (protein), and corresponding loss of enzyme activity in the
cells that expressed antisense GRIM-12 (Fig. 10).
The observation that antisense mRNA conferred death resistance by
ablating TR expression was further confirmed by using dominant negative
inhibitors derived from GRIM-12 cDNA (Fig. 12B). Expression of the
FAD domain (active site) alone did not confer significant resistance to
IFN-RA-induced death. However, expression of the NBD and ID
imparted resistance, with the latter conferring the greatest degree of
resistance against IFN-RA-induced death. NBD may interfere with
optimal activities of other death-associated redox enzymes by
sequestering NADPH. Since the ID of TR is required to generate a
functional dimeric enzyme, its overexpression may strongly inhibit
enzyme activity and also cell death. The FAD domain does not
significantly interfere with cell death because it may not inhibit
enzymatic activity strongly. The differential sensitivity of
transfectants to cell death was not due to a difference in the levels
of endogenous TR and mutant domains of GRIM-12 (Fig. 11). Due to a lack
of a specific antibody that detects all these mutants, we were unable
to demonstrate the expression of the mutant proteins. However,
enzyme assays revealed that overexpression of ID strongly interfered
with enzymatic activity. They also suggest that inhibition of enzymatic
activity is required for interference with death induction. It is
likely that ID inhibits the activity by binding to the full-length
enzyme, although the exact in vivo conformation of the mutant ID
molecule is uncertain. Interaction of purified ID with full-length TR
in vitro (Fig. 13) provides support for this hypothesis. The
interaction between these proteins is not mediated by their respective
expression tags, because tags alone do not bind to full-length TR or ID
(Fig. 13C). More importantly, a direct role for TR in
IFN-RA-mediated cell death was supported by several observations
(Fig. 15). (i) Overexpression of GRIM-12 per se resulted in the
formation of fewer colonies compared to control vector alone (13% less
than the control value; i.e., cells expressing the highest level of
GRIM-12 probably died during the isolation of stable cell lines). (ii)
The clones that survived and expressed TR grew relatively slowly.
(iii) Cell death was augmented by IFN-RA in GRIM-12-expressing
cells compared to those expressing vector alone. (iv) A known activator
(selenite) and an inhibitor (AZ) of TR activity augmented and
suppressed IFN-RA induced cell death, respectively. The failure of
ID to interfere with the growth-inhibitory actions of TNF-
,
vincristine, and etoposide suggests a specific role for GRIM-12 (TR) in
IFN-RA-inducible cell death (Fig. 14).
In mammalian cells, glutathione reductase and TR reduce their
respective substrates, glutathione and Trx, to maintain the intracellular redox state. They then transfer electrons to several cellular transcription factors, including those involved in DNA synthesis. The TR-Trx system is highly conserved from E. coli to mammals. Trx, an ~11-kDa protein, has the conserved
sequence Trp-Cys-Gly-Pro-Cys-Lys. Based on the ability of exogenous and transfected Trx to stimulate cell growth, it has been proposed that the
TR-Trx system acts as a growth promoter (15). Trx is also
known as adult T-cell-derived leukemic growth factor, because it has
been isolated as a stimulant of leukemic cell growth (63). In contrast, results presented in this study and those of others (12) indicate that TR and Trx are growth inhibitors.
Although Trx prevents apoptosis in murine WEHI cells (2), it
inhibited the growth of certain hepatoma cells (49). These
conflicting observations raise the question of how a growth-promoting
molecule participates in cell death. A major difference between our
studies and others is the presence of selection pressure exerted by
cytotoxic agents. Thus, in the absence of growth inhibitors, TR-Trx may participate in normal cell growth processes. However, in the presence of inhibitory pressure (e.g., from IFNs or IFN-RA), the TR-Trx system may activate factors that culminate in cell death. Furthermore, studies with overexpressed Trx might represent a supraphysiological condition, wherein Trx activates only progrowth pathways. Unlike such
studies, our studies and those of Deiss and Kimchi (12) lowered the physiological TR or Trx level to provide a growth advantage. That said, TR might also use substrates other than Trx for
inducing death. Indeed, mammalian TR also reduces compounds like
selenite, alloxan, vitamin K and 5,5'-dithiobis(2-nitrobenzoic acid) in
vitro (4, 23, 24). Selenite has been shown to inhibit cell
growth, and dietary selinium has been shown to reduce the incidence of
tumors (61). Indeed, the addition of selenite to growth
media augmented the IFN-RA-induced cell death compared to that in
control cultures. Furthermore, selenite as a single agent also caused
some growth inhibition compared to that in untreated cells in the
present studies (data not shown). Based on these observations, we
suggest that TR-Trx acts as a "yin-yang" regulatory system in
growth control (20). In an analogous manner, depending on
the physiologic status of the cell, the proto-oncogene myc can act as a growth promoter or as a mediator of cell death (21, 44). Irrespective of which mechanism is operative, our studies assign a novel function to TR in IFN-RA-induced death pathways.
Since IFN-
/
and IFN-
use shared signal transducers
(10) to regulate cellular functions, they may also use
certain common pathways to inhibit cell growth. Thus, GRIM-12 (TR) and
Trx (12) may represent converging points of the death
pathway used by these closely related yet functionally distinct
cytokines. More importantly, the choice of target (TR or Trx) activated
during death induction appears to be influenced by the coactivating
ligand. In our study, cell death was induced by a combination of
IFN-
and RA, whereas in the earlier study it was
IFN-
alone (12). Despite these close similarities,
other GRIMs are not identical to DAP (death-associated protein) genes
induced by IFN-
for killing the cells (30). Although
IFN-
/
and IFN-
use overlapping signal transduction pathways and induce similar downstream genes, each of them also induces
unique cellular genes. Consequently, they may also induce different
death programs. Thus, the cell growth-inhibitory actions of
IFN-
/
and IFN-
may not be identical.
The roles of oxidoreductases in growth control are less well
appreciated, largely because they modify cellular substrates with
groups that have a relatively short half-life (46). Unlike protein kinases, these enzymes do not add stable prosthetic groups to
their substrates, thus making it difficult to assess their specific
roles in growth or death processes. Although the downstream molecular
events that mediate TR-Trx-induced growth inhibition or cell death are
still unclear, genetic studies by ourselves and others illustrate novel
mechanisms of cell death involving oxidoreductases. One level at which
Trx may influence the IFN-induced inhibitory growth pathways is via
modulation of JAK function. Recent studies have shown that the redox
status of JAKs is essential for their activity (14). The
reduced state promotes JAK activity, and the oxidized state inhibits
it. Expression of the TR dominant negative inhibitors may alter the
redox state of JAKs and therefore confer resistance to IFN-RA
treatment. Similarly, suppression of Trx levels may ablate
growth-inhibitory effects of IFN-
(12). Interference
with JAK function may inhibit the ability of IFNs to induce
growth-regulatory genes such as interleukin-1
-converting enzyme or
WAF/Cip1 (7, 8) and therefore may enhance cell survival.
Oxidative conditions activate NF-
B, which induces the anti-apoptotic
gene products (1). Indeed, treatment of cells with Trx
inhibits the DNA binding of NF-
B and cotransfection of Trx gene
suppresses NF-
B-dependent gene expression (29, 54).
Dominant negative inhibition of TR function may also activate the
NF-
B-dependent cell survival program. Therefore, these cells may
become resistant to IFN-RA. Future studies should resolve these
questions.
Lastly, a formal link exists between TR and p53 tumor suppressor
activity. For example, human p53 normally induces gene expression and
growth inhibition in Schizosaccharomyces pombe but fails to exert these effects in mutants lacking TR (6). Consistent
with a role for TR-Trx in growth control, deletion of Trx genes in yeast leads to an increase in the mitotic cycle and DNA replication rates (40). TR also inhibited gene induction from
MluI cell cycle (MCB) boxes present in the promoters of
genes that regulate yeast cell growth (35). More
importantly, a number of p53-induced cell death gene products are
oxidoreductases (45). These observations underscore the
importance of redox factors in cell growth inhibition and death.
Finally, despite the abrogation of cell death by ID mutant of TR,
~60% of the IFN-RA-induced growth inhibition still occurred. One
explanation of this observation is that ID of GRIM-12 may be an
inefficient repressor of IFN-RA-induced growth inhibition. Consequently, near 100% growth did not occur in these cells. If that
were the situation, a strong inhibitor of TR should completely inhibit
IFN-RA-induced growth-suppressive actions. Although AZ, a known
inhibitor of TR (52), prevented IFN-RA-induced cell death, it failed to counteract the growth-inhibitory effects
completely. Thus, a genetic and a chemical inhibitor of TR both block
the IFN-RA-induced death pathway. The fact that the IFN-RA
combination continues to inhibit cell growth despite TR inhibition
suggests the induction of other GRIM-12 (TR)-independent cell
growth-suppressive pathways. Since overexpression of GRIM-12 alone does
not kill a majority of transfected cells, ligand-induced
posttranslational modifications and expression of other
IFN-RA-induced death regulators are necessary for death to occur,
in addition to an increase in TR levels. Indeed, isolation of other
GRIMs supports this hypothesis.
 |
ACKNOWLEDGMENTS |
We thank Ernest Borden, Eric Angell, and Wang Ling for helpful
suggestions, and we thank Adi Kimchi and Garth Powis for providing pTKO1 and the TR-specific antibody, respectively.
These studies were supported by grants from the National Cancer
Institute to D.V.K. E.R.H. thanks the US-Army Breast Cancer Program for a graduate fellowship. D.J.L. is a fellow of Karl C. Dod
foundation.
E.R.H. and M.B. contributed equally to this study.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology & Immunology, Greenebaum Cancer Center, University
of Maryland School of Medicine, Baltimore, MD 21201. Phone:
(410) 328-1396. Fax: (410) 328-1397. E-mail:
dkalvako{at}umaryland.edu.
 |
REFERENCES |
| 1.
|
Baichwal, V. R., and P. A. Baeuerle.
1997.
Activate NF-kappa B or die?
Curr. Biol.
7:R94-R96[Medline].
|
| 2.
|
Baker, A.,
C. M. Payne,
M. M. Briehl, and G. Powis.
1997.
Thioredoxin, a gene found overexpressed in human cancer, inhibits apoptosis in vitro and in vivo.
Cancer Res.
57:5162-5167[Abstract/Free Full Text].
|
| 3.
|
Barber, G. N.,
M. Wambach,
S. Thompson,
R. Jagus, and M. G. Katze.
1995.
Mutants of the RNA-dependent protein kinase (PKR) lacking double-stranded RNA binding domain I can act as transdominant inhibitors and induce malignant transformation.
Mol. Cell. Biol.
15:3138-3146[Abstract].
|
| 4.
|
Bjornstedt, M.,
S. Kumar, and A. Holmgren.
1995.
Selenite and selenodiglutathione: reactions with thioredoxin systems.
Methods Enzymol.
252:209-219[Medline].
|
| 5.
|
Boldin, M. P.,
T. M. Goncharov,
Y. V. Goltsev, and D. Wallach.
1996.
Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death.
Cell
85:803-815[Medline].
|
| 6.
|
Casso, D., and D. Beach.
1996.
A mutation in a thioredoxin reductase homolog suppresses p53-induced growth inhibition in the fission yeast Schizosaccharomyces pombe.
Mol. Gen. Genet.
252:518-529[Medline].
|
| 7.
|
Chin, Y. E.,
M. Kitagawa,
K. Kuida,
R. A. Flavell, and X. Y. Fu.
1997.
Activation of the STAT signaling pathway can cause expression of caspase 1 and apoptosis.
Mol. Cell. Biol.
17:5328-5337[Abstract].
|
| 8.
|
Chin, Y. E.,
M. Kitagawa,
W. C. Su,
Z. H. You,
Y. Iwamoto, and X. Y. Fu.
1996.
Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1.
Science
272:719-722[Abstract].
|
| 9.
|
Cohen, G. M.,
X. M. Sun,
R. T. Snowden,
D. Dinsdale, and D. N. Skilleter.
1992.
Key morphological features of apoptosis may occur in the absence of internucleosomal DNA fragmentation.
Biochem. J.
286:331-334.
|
| 10.
|
Darnell, J. E., Jr.,
I. M. Kerr, and G. R. Stark.
1994.
Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science
264:1415-1421[Abstract/Free Full Text].
|
| 11.
|
Deiss, L. P.,
E. Feinstein,
H. Berissi,
O. Cohen, and A. Kimchi.
1995.
Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death.
Genes Dev.
9:15-30[Abstract/Free Full Text].
|
| 12.
|
Deiss, L. P., and A. Kimchi.
1991.
A genetic tool used to identify thioredoxin as a mediator of a growth inhibitory signal.
Science
252:117-120[Abstract/Free Full Text].
|
| 13.
|
Dong, B., and R. H. Silverman.
1995.
2-5A-dependent RNase molecules dimerize during activation by 2-5A.
J. Biol. Chem.
270:4133-4137[Abstract/Free Full Text].
|
| 14.
|
Duhe, R. J.,
G. A. Evans,
R. A. Erwin,
R. A. Kirken,
G. W. Cox, and W. L. Farrar.
1998.
Nitric oxide and thiol redox regulation of Janus kinase activity.
Proc. Natl. Acad. Sci. USA
95:126-131[Abstract/Free Full Text].
|
| 15.
|
Gallegos, A.,
J. R. Gasdaska,
C. W. Taylor,
G. D. Paine-Murrieta,
D. Goodman,
P. Y. Gasdaska,
M. Berggren,
M. M. Briehl, and G. Powis.
1996.
Transfection with human thioredoxin increases cell proliferation and a dominant-negative mutant thioredoxin reverses the transformed phenotype of human breast cancer cells.
Cancer Res.
56:5765-5770[Abstract/Free Full Text].
|
| 16.
|
Gasdaska, P. Y.,
J. R. Gasdaska,
S. Cochran, and G. Powis.
1995.
Cloning and sequencing of a human thioredoxin reductase.
FEBS Lett.
373:5-9[Medline].
|
| 17.
|
Glass, C. K.,
D. W. Rose, and M. G. Rosenfeld.
1997.
Nuclear receptor coactivators.
Curr. Opin. Cell Biol.
9:222-232[Medline].
|
| 18.
|
Gutterman, J. U.
1994.
Cytokine therapeutics: lessons from interferon a.
Proc. Natl. Acad. Sci. USA
91:1198-1205[Abstract/Free Full Text].
|
| 19.
|
Hassel, B. A.,
A. Zhou,
C. Sotomayor,
A. Maran, and R. H. Silverman.
1993.
A dominant negative mutant of 2-5A-dependent RNase suppresses antiproliferative and antiviral effects of interferon.
EMBO J.
12:3297-3304[Medline].
|
| 20.
|
Heppell-Parton, A.,
A. Cahn,
A. Bench,
N. Lowe,
H. Lehrach,
G. Zehetner, and P. Rabbitts.
1995.
Thioredoxin, a mediator of growth inhibition, maps to 9q31.
Genomics
26:379-381[Medline].
|
| 21.
|
Hermeking, H., and D. Eick.
1994.
Mediation of c-Myc-induced apoptosis by p53.
Science
265:2091-2093[Abstract/Free Full Text].
|
| 22.
|
Hirt, B.
1967.
Selective extraction of polyoma DNA from infected mouse cell cultures.
J. Mol. Biol.
26:365-369[Medline].
|
| 23.
|
Holmgren, A., and M. Bjornstedt.
1995.
Thioredoxin and thioredoxin reductase.
Methods Enzymol.
252:199-208[Medline].
|
| 24.
|
Holmgren, A., and C. Lyckeborg.
1980.
Enzymatic reduction of alloxan by thioredoxin and NADPH-thioredoxin reductase.
Proc. Natl. Acad. Sci. USA
77:5149-5152[Abstract/Free Full Text].
|
| 25.
|
Holtschke, T.,
J. Lohler,
Y. Kanno,
T. Fehr,
N. Giese,
F. Rosenbauer,
J. Lou,
K. P. Knobeloch,
L. Gabriele,
J. Waring,
M. F. Bachmann,
R. M. Zinkernagel,
H. C. Morse,
K. Ozato, and I. Horak.
1996.
Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene.
Cell
87:307-317[Medline].
|
| 26.
|
Hong, W. K., and L. M. Itri.
1994.
Retinoids and human cancer, p. 597-630.
In
M. B. Sporn, A. B. Roberts, and D. S. Goodman (ed.), The retinoids: biology, chemistry and medicine, 2nd ed. Raven Press, New York, N.Y.
|
| 27.
|
Kalvakolanu, D. V.,
S. K. Bandyopadhyay,
M. L. Harter, and G. C. Sen.
1991.
Inhibition of interferon-inducible gene expression by adenovirus E1A proteins: block in transcriptional complex formation.
Proc. Natl. Acad. Sci. USA
88:7459-7463[Abstract/Free Full Text].
|
| 28.
|
Kalvakolanu, D. V., and E. C. Borden.
1996.
An overview of the interferon system: signal transduction and mechanisms of action.
Cancer Investig.
14:25-53[Medline].
|
| 29.
|
Kim, I. Y., and T. C. Stadtman.
1997.
Inhibition of NF-kappaB DNA binding and nitric oxide induction in human T cells and lung adenocarcinoma cells by selenite treatment.
Proc. Natl. Acad. Sci. USA
94:12904-12907[Abstract/Free Full Text].
|
| 30.
|
Kimchi, A.
1998.
DAP genes: novel apoptotic genes isolated by a functional approach to gene cloning.
Biochim. Biophys. Acta
1377:F13-F33[Medline].
|
| 31.
|
Kumar, A.,
M. Commane,
T. W. Flickinger,
C. M. Horvath, and G. R. Stark.
1997.
Defective TNF-alpha-induced apoptosis in STAT1-null cells due to low constitutive levels of caspases.
Science
278:1630-1632[Abstract/Free Full Text].
|
| 32.
|
Kumar, R., and I. Atlas.
1992.
Interferon alpha induces the expression of retinoblastoma gene product in human Burkitt lymphoma Daudi cells: role in growth regulation.
Proc. Natl. Acad. Sci. USA
89:6599-6603[Abstract/Free Full Text].
|
| 33.
|
Laurent, A. G.,
B. Krust,
J. Galabru,
J. Svab, and A. G. Hovanessian.
1985.
Monoclonal antibodies to an interferon-induced Mr 68,000 protein and their use for the detection of double-stranded RNA-dependent protein kinase in human cells.
Proc. Natl. Acad. Sci. USA
82:4341-4345[Abstract/Free Full Text].
|
| 34.
|
Lindner, D. J.,
E. C. Borden, and D. V. Kalvakolanu.
1997.
Synergistic antitumor effects of a combination of interferons and retinoic acid on human tumor cells in vitro and in vivo.
Clin. Cancer Res.
3:931-937[Abstract].
|
| 35.
|
Machado, A. K.,
B. A. Morgan, and G. F. Merrill.
1997.
Thioredoxin reductase-dependent inhibition of MCB cell cycle box activity in Saccharomyces cerevisiae.
J. Biol. Chem.
272:17045-17054[Abstract/Free Full Text].
|
| 36.
|
Mangelsdorf, D. J., and R. M. Evans.
1995.
The RXR heterodimers and orphan receptors.
Cell
83:841-850[Medline].
|
| 37.
|
Meissner, P. S.,
W. P. Sisk, and M. L. Berman.
1987.
Bacteriophage lambda cloning system for the construction of directional cDNA libraries.
Proc. Natl. Acad. Sci. USA
84:4171-4175[Abstract/Free Full Text].
|
| 38.
|
Miranda-Vizuete, A., and G. Spyrou.
1997.
The novel oxidoreductase KDRF (KM-102-derived reductase-like factor) is identical with human thioredoxin reductase.
Biochem. J.
325:287-288.
|
| 39.
|
Moore, D. M.,
D. V. Kalvakolanu,
S. M. Lippman,
J. J. Kavanagh,
W. K. Hong,
E. C. Borden,
M. Paredes-Espinoza, and I. H. Krakoff.
1994.
Retinoic acid and interferon in human cancer: mechanistic and clinical studies.
Semin. Hematol.
31:31-37[Medline].
|
| 40.
|
Muller, E. G.
1991.
Thioredoxin deficiency in yeast prolongs S phase and shortens the G1 interval of the cell cycle.
J. Biol. Chem.
266:9194-9202[Abstract/Free Full Text].
|
| 41.
|
Muzio, M.,
A. M. Chinnaiyan,
F. C. Kischkel,
K. O'Rourke,
A. Shevchenko,
J. Ni,
C. Scaffidi,
J. D. Bretz,
M. Zhang,
R. Gentz,
M. Mann,
P. H. Krammer,
M. E. Peter, and V. M. Dixit.
1996.
FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex.
Cell
85:817-827[Medline].
|
| 42.
|
Nolan-Sorden, N. L.,
K. Lesiak,
B. Bayard,
P. F. Torrence, and R. H. Silverman.
1990.
Photochemical crosslinking in oligonucleotide-protein complexes between a bromine-substituted 2-5A analog and 2-5A-dependent RNase by ultraviolet lamp or laser.
Anal. Biochem.
184:298-304[Medline].
|
| 43.
|
Ossina, N. K.,
A. Cannas,
V. C. Powers,
P. A. Fitzpatrick,
J. D. Knight,
J. R. Gilbert,
E. M. Shekhtman,
L. D. Tomei,
S. R. Umansky, and M. C. Kiefer.
1997.
Interferon-gamma modulates a p53-independent apoptotic pathway and apoptosis-related gene expression.
J. Biol. Chem.
272:16351-16357[Abstract/Free Full Text].
|
| 44.
|
Packham, G., and J. L. Cleveland.
1995.
c-Myc and apoptosis.
Biochim. Biophys. Acta
1242:11-28[Medline].
|
| 45.
|
Polyak, K.,
Y. Xia,
J. L. Zweier,
K. W. Kinzler, and B. Vogelstein.
1997.
A model for p53-induced apoptosis.
Nature
389:300-305[Medline].
|
| 46.
|
Powis, G.,
M. Briehl, and J. Oblong.
1995.
Redox signalling and the control of cell growth and death.
Pharmacol. Ther.
68:149-173[Medline].
|
| 47.
|
Raveh, T.,
A. G. Hovanessian,
E. F. Meurs,
N. Sonenberg, and A. Kimchi.
1996.
Double-stranded RNA-dependent protein kinase mediates c-Myc suppression induced by type I interferons.
J. Biol. Chem.
271:25479-25484[Abstract/Free Full Text].
|
| 48.
|
Resnitzky, D.,
N. Tiefenbrun,
H. Berissi, and A. Kimchi.
1992.
Interferons and interleukin 6 suppress phosphorylation of the retinoblastoma protein in growth-sensitive hematopoietic cells.
Proc. Natl. Acad. Sci. USA
89:402-406[Abstract/Free Full Text].
|
| 49.
|
Rubartelli, A.,
N. Bonifaci, and R. Sitia.
1995.
High rates of thioredoxin secretion correlate with growth arrest in hepatoma cells.
Cancer Res.
55:675-680[Abstract/Free Full Text].
|
| 50.
|
Samuel, C. E.,
K. L. Kuhen,
C. X. George,
L. G. Ortega,
R. Rende-Fournier, and H. Tanaka.
1997.
The PKR protein kinase an interferon-inducible regulator of cell growth and differentiation.
Int. J. Hematol.
65:227-237[Medline].
|
| 51.
|
Savinova, O., and R. Jagus.
1997.
Use of vertical slab isoelectric focusing and immunoblotting to evaluate steady-state phosphorylation of eIF2 alpha in cultured cells.
Methods
11:419-425[Medline].
|
| 52.
|
Schallreuter, K. U., and J. M. Wood.
1987.
Azelaic acid as a competitive inhibitor of thioredoxin reductase in human melanoma cells.
Cancer Lett.
36:297-305[Medline].
|
| 53.
|
Schmidt, M.,
S. Nagel,
J. Proba,
C. Thiede,
M. Ritter,
J. F. Waring,
F. Rosenbauer,
D. Huhn,
B. Wittig,
I. Horak, and A. Neubauer.
1998.
Lack of interferon consensus sequence binding protein (ICSBP) transcripts in human myeloid leukemias.
Blood
91:22-29[Abstract/Free Full Text].
|
| 54.
|
Schulze-Osthoff, K.,
H. Schenk, and W. Droge.
1995.
Effects of thioredoxin on activation of transcription factor NF-kappa B.
Methods Enzymol.
252:253-264[Medline].
|
| 55.
|
Schulze-Osthoff, K.,
H. Walczak,
W. Droge, and P. H. Krammer.
1994.
Cell nucleus and DNA fragmentation are not required for apoptosis.
J. Cell Biol.
127:15-20[Abstract/Free Full Text].
|
| 56.
|
Schwartz, L. M.,
S. W. Smith,
M. E. Jones, and B. A. Osborne.
1993.
Do all programmed cell deaths occur via apoptosis?
Proc. Natl. Acad. Sci. USA
90:980-984[Abstract/Free Full Text].
|
| 57.
|
Scorsone, K. A.,
R. Panniers,
A. G. Rowlands, and E. C. Henshaw.
1987.
Phosphorylation of eukaryotic initiation factor 2 during physiological stresses which affect protein synthesis.
J. Biol. Chem.
262:14538-14543[Abstract/Free Full Text].
|
| 58.
|
Sen, G. C., and R. M. Ransohoff.
1997.
Transcriptional regulation in the interferon system.
Chapman & Hall and Landes Bioscience, Austin, Tex.
|
| 59.
|
Silverman, R. H.
1997.
2-5A dependent Rnase L: a regulated endoribonuclease in the interferon system, p. 515-551.
In
G. D'Alessio, and J. F. Riordan (ed.), Ribonucleases: structure and functions. Academic Press, Inc., New York, N.Y.
|
| 60.
|
Skehan, P.,
R. Storeng,
D. Scudiero,
A. Monks,
J. McMahon,
D. Vistica,
J. T. Warren,
H. Bokesch,
S. Kenney, and M. R. Boyd.
1990.
New colorimetric cytotoxicity assay for anticancer-drug screening.
J. Natl. Cancer Inst.
82:1107-1112[Abstract/Free Full Text].
|
| 61.
|
Spyrou, G.,
M. Bjornstedt,
S. Skog, and A. Holmgren.
1996.
Selenite and selenate inhibit human lymphocyte growth via different mechanisms.
Cancer Res.
56:4407-4412[Abstract/Free Full Text].
|
| 62.
|
Studzinski, G. P. (ed.).
1995.
Cell growth and apoptosis: a practical approach.
IRL Press, Oxford, United Kingdom.
|
| 63.
|
Tagaya, Y.,
Y. Maeda,
A. Mitsui,
N. Kondo,
H. Matsui,
J. Hamuro,
N. Brown,
K. Arai,
T. Yokota,
H. Wakasugi, et al.
1989.
ATL-derived factor (ADF), an IL-2 receptor/Tac inducer homologous to thioredoxin: possible involvement of dithiol-reduction in the IL-2 receptor induction.
EMBO J.
8:757-764[Medline].
|
| 64.
|
Taniguchi, T.,
M. S. Lamphier, and N. Tanaka.
1997.
IRF1: the transcription factor linking interferon response and oncogenesis.
Biochim. Biophys. Acta
1333:M9-M17[Medline].
|
| 65.
|
Ucker, D. S.,
P. S. Obermiller,
W. Eckhart,
J. R. Apgar,
N. A. Berger, and J. Meyers.
1992.
Genome digestion is a dispensable consequence of physiological cell death mediated by cytotoxic T lymphocytes.
Mol. Cell. Biol.
12:3060-3069[Abstract/Free Full Text].
|
| 66.
|
Willman, C. L.,
C. E. Sever,
M. G. Pallavicini,
H. Harada,
N. Tanaka,
M. L. Slovak,
H. Yamamoto,
K. Harada,
T. C. Meeker,
A. F. List, and T. Taniguchi.
1993.
Deletion of IRF-1, mapping to chromosome 5q31.1, in human leukemia and preleukemic myelodysplasia.
Science
259:968-971[Abstract].
|
Molecular and Cellular Biology, November 1998, p. 6493-6504, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kalakonda, S., Nallar, S. C., Gong, P., Lindner, D. J., Goldblum, S. E., Reddy, S. P., Kalvakolanu, D. V.
(2007). Tumor Suppressive Protein Gene Associated with Retinoid-Interferon-Induced Mortality (GRIM)-19 Inhibits src-Induced Oncogenic Transformation at Multiple Levels. Am. J. Pathol.
171: 1352-1368
[Abstract]
[Full Text]
-
Nalvarte, I., Damdimopoulos, A. E., Nystom, C., Nordman, T., Miranda-Vizuete, A., Olsson, J. M., Eriksson, L., Bjornstedt, M., Arner, E. S. J., Spyrou, G.
(2004). Overexpression of Enzymatically Active Human Cytosolic and Mitochondrial Thioredoxin Reductase in HEK-293 Cells: EFFECT ON CELL GROWTH AND DIFFERENTIATION. J. Biol. Chem.
279: 54510-54517
[Abstract]
[Full Text]
-
Huang, G., Lu, H., Hao, A., Ng, D. C. H., Ponniah, S., Guo, K., Lufei, C., Zeng, Q., Cao, X.
(2004). GRIM-19, a Cell Death Regulatory Protein, Is Essential for Assembly and Function of Mitochondrial Complex I. Mol. Cell. Biol.
24: 8447-8456
[Abstract]
[Full Text]
-
Damdimopoulos, A. E., Miranda-Vizuete, A., Treuter, E., Gustafsson, J.-A., Spyrou, G.
(2004). An Alternative Splicing Variant of the Selenoprotein Thioredoxin Reductase Is a Modulator of Estrogen Signaling. J. Biol. Chem.
279: 38721-38729
[Abstract]
[Full Text]
-
Wittke, I., Wiedemeyer, R., Pillmann, A., Savelyeva, L., Westermann, F., Schwab, M.
(2003). Neuroblastoma-Derived Sulfhydryl Oxidase, a New Member of the Sulfhydryl Oxidase/Quiescin6 Family, Regulates Sensitization to Interferon {gamma}-Induced Cell Death in Human Neuroblastoma Cells. Cancer Res.
63: 7742-7752
[Abstract]
[Full Text]
-
Rishi, A. K., Zhang, L., Boyanapalli, M., Wali, A., Mohammad, R. M., Yu, Y., Fontana, J. A., Hatfield, J. S., Dawson, M. I., Majumdar, A. P. N., Reichert, U.
(2003). Identification and Characterization of a Cell Cycle and Apoptosis Regulatory Protein-1 as a Novel Mediator of Apoptosis Signaling by Retinoid CD437. J. Biol. Chem.
278: 33422-33435
[Abstract]
[Full Text]
-
Zhang, J., Yang, J., Roy, S. K., Tininini, S., Hu, J., Bromberg, J. F., Poli, V., Stark, G. R., Kalvakolanu, D. V.
(2003). The cell death regulator GRIM-19 is an inhibitor of signal transducer and activator of transcription 3. Proc. Natl. Acad. Sci. USA
100: 9342-9347
[Abstract]
[Full Text]
-
Anestal, K., Arner, E. S. J.
(2003). Rapid Induction of Cell Death by Selenium-compromised Thioredoxin Reductase 1 but Not by the Fully Active Enzyme Containing Selenocysteine. J. Biol. Chem.
278: 15966-15972
[Abstract]
[Full Text]
-
Xia, L., Nordman, T., Olsson, J. M., Damdimopoulos, A., Bjorkhem-Bergman, L., Nalvarte, I., Eriksson, L. C., Arner, E. S. J., Spyrou, G., Bjornstedt, M.
(2003). The Mammalian Cytosolic Selenoenzyme Thioredoxin Reductase Reduces Ubiquinone. A NOVEL MECHANISM FOR DEFENSE AGAINST OXIDATIVE STRESS. J. Biol. Chem.
278: 2141-2146
[Abstract]
[Full Text]
-
Lindner, D. J., Ma, X., Hu, J., Karra, S., Kalvakolanu, D. V.
(2002). Thioredoxin Reductase Plays a Critical Role in IFN Retinoid-mediated Tumor-Growth Control in Vivo. Clin. Cancer Res.
8: 3210-3218
[Abstract]
[Full Text]
-
Seo, T., Lee, D., Shim, Y. S., Angell, J. E., Chidambaram, N. V., Kalvakolanu, D. V., Choe, J.
(2002). Viral Interferon Regulatory Factor 1 of Kaposi's Sarcoma-Associated Herpesvirus Interacts with a Cell Death Regulator, GRIM19, and Inhibits Interferon/Retinoic Acid-Induced Cell Death. J. Virol.
76: 8797-8807
[Abstract]
[Full Text]
-
Ma, X., Hu, J., Lindner, D. J., Kalvakolanu, D. V.
(2002). Mutational Analysis of Human Thioredoxin Reductase 1. EFFECTS ON p53-MEDIATED GENE EXPRESSION AND INTERFERON AND RETINOIC ACID-INDUCED CELL DEATH. J. Biol. Chem.
277: 22460-22468
[Abstract]
[Full Text]
-
Fearnley, I. M., Carroll, J., Shannon, R. J., Runswick, M. J., Walker, J. E., Hirst, J.
(2001). GRIM-19, a Cell Death Regulatory Gene Product, Is a Subunit of Bovine Mitochondrial NADH:Ubiquinone Oxidoreductase (Complex I). J. Biol. Chem.
276: 38345-38348
[Abstract]
[Full Text]
-
Guo, X., Nanus, D. M, Ruiz, A., Rando, R. R, Bok, D., Gudas, L. J
(2001). Reduced Levels of Retinyl Esters and Vitamin A in Human Renal Cancers. Cancer Res.
61: 2774-2781
[Abstract]
[Full Text]
-
Menter, D. G., Sabichi, A. L., Lippman, S. M.
(2000). Selenium Effects on Prostate Cell Growth. Cancer Epidemiol. Biomarkers Prev.
9: 1171-1182
[Abstract]
[Full Text]
-
Sun, Q.-A., Wu, Y., Zappacosta, F., Jeang, K.-T., Lee, B. J., Hatfield, D. L., Gladyshev, V. N.
(1999). Redox Regulation of Cell Signaling by Selenocysteine in Mammalian Thioredoxin Reductases. J. Biol. Chem.
274: 24522-24530
[Abstract]
[Full Text]
-
Gudkov, A. V., Roninson, I. B., Brown;, R., Kimchi, A., Cohen, O., Kissil, J., Raveh, T., Inbal, B., Levy-Strumpf, N., Berissi, H., Deiss;, L.
(1999). Functional Approaches to Gene Isolation in Mammalian Cells. Science
285: 299a-299
[Full Text]
-
Angell, J. E., Lindner, D. J., Shapiro, P. S., Hofmann, E. R., Kalvakolanu, D. V.
(2000). Identification of GRIM-19, a Novel Cell Death-regulatory Gene Induced by the Interferon-beta and Retinoic Acid Combination, Using a Genetic Approach. J. Biol. Chem.
275: 33416-33426
[Abstract]
[Full Text]
-
Ma, X., Karra, S., Guo, W., Lindner, D. J., Hu, J., Angell, J. E., Hofmann, E. R., Reddy, S. P. M., Kalvakolanu, D. V.
(2001). Regulation of Interferon and Retinoic Acid-induced Cell Death Activation through Thioredoxin Reductase. J. Biol. Chem.
276: 24843-24854
[Abstract]
[Full Text]