Previous Article | Next Article 
Molecular and Cellular Biology, November 1998, p. 6767-6776, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Characterization of Novel Parent-Specific Epigenetic
Modifications Upstream of the Imprinted Mouse H19
Gene
Piroska E.
Szabó,
Gerd P.
Pfeifer, and
Jeffrey
R.
Mann*
Division of Biology, Beckman Research
Institute of the City of Hope, Duarte, California 91010
Received 11 May 1998/Returned for modification 22 June
1998/Accepted 7 August 1998
 |
ABSTRACT |
Genomic imprinting results in parent-specific monoallelic
expression of a small number of genes in mammals. The identity of imprints is unknown, but much evidence points to a role for DNA methylation. The maternal alleles of the imprinted H19 gene
are active and hypomethylated; the paternal alleles are inactive and hypermethylated. Roles for other epigenetic modifications are suggested
by allele-specific differences in nuclease hypersensitivity at
particular sites. To further analyze the possible epigenetic mechanisms
determining monoallelic expression of H19, we have conducted in vivo dimethylsulfate and DNase I footprinting of regions
upstream of the coding sequence in parthenogenetic and androgenetic
embryonic stem cells. These cells carry only maternally and paternally
derived alleles, respectively. We observed the presence of
maternal-allele-specific dimethylsulfate and DNase I footprints at the
promoter indicative of protein-DNA interactions at a CCAAT box and at
binding sites for transcription factors Sp1 and AP-2. Also, at the
boundary of a region further upstream for which existent differential
methylation has been suggested to constitute an imprint, we observed a
number of strand-specific dimethylsulfate reactivity differences
specific to the maternal allele, along with an unusual chromatin
structure in that both strands of maternally derived DNA were strongly
hypersensitive to DNase I cutting over a distance of 100 nucleotides.
We therefore reveal the existence of novel parent-specific epigenetic
modifications, which in addition to DNA methylation, could constitute
imprints or maintain monoallelic expression of H19.
 |
INTRODUCTION |
Imprinted genes are expressed from
only one parental allele (6). While imprints are laid down
in the germ line, for some imprinted genes additional modifications
appear to be required after fertilization for the induction of
monoallelic expression (21, 42). The epigenetic
modifications that constitute imprints and which regulate monoallelic
expression are yet to be determined, but there is much evidence that
DNA methylation plays a role in at least maintaining monoallelic
expression (23). Also, at least one model proposes a role
for transcription factor DNA binding. It has been suggested that such
factors could be imprint "readers" in that their
imprint-dependent binding constitutes an additional epigenetic
modification which is necessary for monoallelic expression, or protein
factor-DNA binding could constitute the imprint itself (12).
However, differential allele-specific transcription factor binding has
not been described for any autosomal imprinted gene.
One of the best-studied imprinted genes is H19, which is
expressed from only the maternal allele in somatic cells. Two lines of
evidence suggest that a 4-kb domain upstream of the coding sequence is
important in conferring imprinting on this gene. First, a number of
CpGs, between kb
2 and
4 in this domain, are methylated in sperm
but not in oocytes. This methylation persists paternally throughout
preimplantation development; and thereby could constitute an imprint
which leads to monoallelic expression (45). Second, in
transgenic mice, a DNA fragment comprised of this domain, the H19 coding sequence, and two downstream enhancers is
expressed like the endogenous gene, that is, only when inherited
maternally, although this occurs only when multiple copies are
integrated (3, 13, 36). Also consistent with the possibility
that this domain determines H19 imprinting is that in
H19 knockout mice, imprinting of a neomycin selection
cassette is not conferred when the coding sequence is deleted along
with 10 kb of upstream sequence (22) but is conferred when
only the coding sequence is deleted (38). In differentiated
tissues, it is of interest that the promoter contains
nuclease-hypersensitive sites when maternally inherited (3,
16). Also, additional CpGs in the paternally inherited domain are
methylated (3, 44), and this pronounced difference in
parent-specific methylation in differentiated tissues is also observed
at other sites, including the promoter region (3, 15). While
the differential methylation at the promoter is imparted after
fertilization and therefore does not constitute the imprint, it is not
known when in development the parent-specific differences in nuclease
hypersensitivity are conferred, and it remains possible that they are
already present in the gametes. In addition, it has been noted
that simple sequence repeats are often associated with regions of
imprinted genes that exhibit differential DNA methylation, and these
repeats may facilitate the inactivation of one of the parental
alleles (30). For the mouse H19 gene, one such
repeat is located at kb
1.3 to
1.7 from the transcription start
site (45).
To shed further light on the possible epigenetic mechanisms determining
monoallelic expression of H19, we have used a
ligation-mediated PCR (LMPCR) genomic sequencing technique
(29, 35) to conduct footprinting and methylation analyses of
various regions upstream of the coding sequence, including the putative
imprinting region, in parthenogenetic (PG) and androgenetic (AG)
embryonic stem (ES) cells. These cells were used because they (i) are
diploid and contain only maternally and paternally derived genomes,
respectively, (ii) retain imprints as assessed by the developmental
potential of chimeras (4, 25-27), (iii) are representative
of an early undifferentiated stage of mouse development, being derived
from, and similar in developmental potency to, the primitive ectoderm of peri-implantation-stage blastocysts (5, 10), (iv) exhibit parent-specific differential methylation of at least some sites upstream of the H19 coding region that are differentially
methylated in differentiated tissues, while retaining a relatively very
low level of expression of H19 as exists in the primitive
ectoderm (1, 41, 42), and (v) can be obtained in sufficient
quantity for conducting LMPCR.
The analyses reveal significant differences in binding of transcription
factors, chromatin structure, and methylation between the maternally
and paternally derived upstream regions of the H19 gene that
have not been previously described and implicate these epigenetic
modifications in imprinting and regulation of monoallelic expression of
H19.
 |
MATERIALS AND METHODS |
ES cells.
The type, name, and passage number at DNA
collection of the ES cell lines used were as follows: PG (two maternal
genomes), LG.1, passage 13; wild-type, WT (one maternal and one
paternal genome), W9.5, passage 11; and AG (two paternal genomes),
LB.4, passage 10. The derivation and culture conditions for these cell lines have been previously described (26, 41). For each type of cell line, the methylation and expression of imprinted genes were
found to be consistent between independently derived cell lines
(41).
Treatment of ES cells with reagents for in vivo
footprinting.
In preparing ES cells for treatment, STO feeder
cells were removed from trypsinized cell suspensions by differential
adherence to tissue culture plates. This results in an ES purity of at
least 97% by cell number (41). The following descriptions
are for a washed ES cell pellet of ~15 × 106 cells
obtained from one semiconfluent 10-cm-diameter dish. Treatments and
isolation of DNA were performed as previously described
(33), with the following modifications.
(i) DMS treatment.
The ES cell pellet was resuspended in 6 ml of serum-free medium containing 0.2% dimethylsulfate (DMS) and was
incubated for 5 min at room temperature (RT). The action of DMS was
stopped by adding ice-cold Dulbecco's phosphate-buffered saline with
calcium and magnesium (DPBS) to a volume of 50 ml, followed by
centrifugation at 250 × g for 3 min to pellet the
cells. After two washes with 20 ml of ice-cold DPBS, the pellet was
dissolved in 10 ml of buffer A containing 1% Nonidet P-40
(33), and then the DNA was isolated. As a control, genomic
DNA was isolated from untreated ES cells (33), and then 80 to 100 µg was treated with DMS (28).
(ii) DNase I treatment.
The ES cell pellet was resuspended
in 5 ml of ice-cold solution I containing lysolecithin (0.25 mg/ml) to
permeabilize cells (32). The cells were immediately
pelleted, then resuspended in solution II containing DNase I (1 µg/ml; Boehringer Mannheim catalog no. 104132), and incubated for 1 to 6 min at RT to obtain an optimal nicking frequency of one nick every
200 to 800 nucleotides, as assessed by alkaline gel electrophoresis
after DNA purification and before LMPCR. Cells were pelleted and
resuspended in 2 ml of buffer C containing proteinase K (600 µg/ml),
then 2 ml of buffer B was added, and the sample was incubated at 37°C
overnight (33). As a control, 40 µg of genomic DNA
isolated from untreated ES cells as described above was mixed with 10 µg of DNase I per ml in a 200-µl reaction volume and incubated at
RT for 5 min.
(iii) KMnO4 treatment.
The ES cell pellet was
resuspended in 2 ml of PBS containing 20 mM KMnO4. After 2 min at RT, the reaction was stopped by addition of 50 ml of ice-cold
DPBS. The cells were pelleted and resuspended in 10 ml of buffer B
containing 1.0 M
-mercaptoethanol, then 10 ml of buffer C containing
proteinase K (600 µg/ml) was added, and the sample was incubated at
37°C for 3 h (33). As an in vitro control,
KMnO4 treatment of 20 µg of DNA was performed in the
presence of fresh 20 mM KMnO4 for 2 min at RT in a reaction volume of 100 µl. The reaction was stopped by adding
2-mercaptoethanol to a concentration of 1 M. After ethanol
precipitation, 1 M piperidine was used to cleave the DNA at sites of
KMnO4 modifications, and the samples were used in LMPCR.
Other treatments.
For methylation analysis at C residues,
genomic DNA was isolated from ES cells as described above, and 80 to
100 µg was treated with hydrazine in the presence of NaCl
(28). As a control, a reaction was performed with 0.5 µg
of H19 lambda clone DNA mixed with 80 µg of tRNA. The
amount of lambda DNA was adjusted before LMPCR to match the copy number
of H19 sequences in genomic DNA. For analysis of C+T and G+A
modifications, 80 to 100 µg of DNA was treated with hydrazine and
formic acid, respectively (28).
LMPCR.
LMPCRs were performed as previously described
(33), with the following modifications. The Sequenase
reaction with the first primer was carried out at 49°C for 15 min. To
increase reaction specificity, DNase I-treated samples were isolated on
paramagnetic beads by using biotinylated primers before LMPCR
(43). The PCR in which the second primer was included was
carried out at 95, 65, and 74°C for 23 cycles. Following a booster
step with an additional aliquot of Taq polymerase, the
reaction was extracted with phenol-chloroform, and then the PCR product
was precipitated. The product was run on a denaturing 8%
polyacrylamide gel, then electroblotted to a nylon membrane, and
hybridized at 65°C overnight with a runoff probe made on an isolated
PCR fragment by using the third primer.
The primers (the first primer in each series was biotinylated) and
their sequences (in parentheses; 5'-3') were K1
(GGGGGTTAGCCACTCGTAG), K2 (CCACTCGTAGGCTGTTCATACTCCG),
K3 (GTATGAGACCCATGCCCTCAAATTCC), L1
(CCACCTCCACCCTGTATCG), L2 (CCCTGTATCGTTCCAGCGCACGTT),
L3 (GCCTCACCCCACACCCGCA), M1
(TCTAAGGGATTCCAAAGTGG), M2
(TGTGGTGAGGCTGTCTTTGGAGAATT), M3 (TTTGGAGAATTTCAGGACGGGTGCG), N1 (CCAGACTCCAGATGCCGA),
N2 (GGTGCTCCTCGGACCCCACG), N3
(ACCCCACGACTCTCCTCCAGCTCTC), I1 (TGCCTACAGTTCCCGAATC),
I2 (CGAATCACCACAAGGAAAGAAAAAGG), I3
(GAAAGAAAAAGGTTGGTGAGAAAAATAGAG), J1
(GTGACCCCCCTGAGGTACT), J2 (TGAGGTACTGAACTTGGGTGACCCAC),
J3 (GTGACCCACAGCATTGCCATTTG), O1
(GCTCTCCCATCTTCCCCA), O2 (TCCCATCTTCCCCGGTTTCCCCG),
O3 (CCCCCCACCCCCCTCCCACA), Q1
(GTGGTGGCAGTTGGTCTCT), Q2 (TGTCTCCCATCACCCCCCACAT),
Q3 (CCCACATCACCCTTGCTATACTCCC), TY1
(GCTGACACCCAAGGCTTG), TY2 (GACACCCAAGGCTTGATGTAGGATTC),
TY3 (CTATCCGAAGCTGGCAGCTGAGC), Z1
(CGGCTCAGGGCTGCAA), Z2 (GCTGCAAACAATTCTGAAACTGCATTC), and Z3 (GCATTCTCTCTCAATGGGGCTCAGC).
 |
RESULTS |
Chromatin and methylation analysis.
Intact ES cells were
treated with two agents that are sensitive to chromatin structure and
protein-DNA interactions. DNase I nicks DNA inside permeabilized cells
with a specificity similar to that in isolated DNA, but this nicking is
inhibited at positions where protein factors are bound (32).
DMS reacts with protein-bound DNA with either a lower or higher rate of
N-7 methylation of G residues (14). After DNA isolation,
piperidine was used to cleave DNA at the modified G bases. LMPCR was
then used to amplify gene-specific sequences and visualize, at
single-nucleotide resolution, cuts made by DNase I or derived from DMS
modification (29, 35). DNase I footprints usually appear as
areas of protection on sequencing gels, while DMS footprints are
stronger or weaker single-G bands compared to isolated DNA controls.
Methylation of C bases in the whole population of chromosomes was also
investigated at single-nucleotide resolution. DNA was isolated from PG
ES cells and AG ES cells, modified with hydrazine in the presence of
sodium chloride, and cleaved with piperidine. Methylation inhibits
modification; therefore, bands corresponding to methylated cytosines
are missing from the sequencing gels while unmethylated cytosines are
present.
Analysis of the H19 promoter.
An approximately
350-bp-long region containing the H19 promoter (segment A
[Fig. 1]) was analyzed by using five
primer sets, K, L, M, N, and O. The proximal promoter fragment contains
several CpG dinucleotides. Compared to unmethylated cloned DNA, AG
ES cells show heavy methylation at all of these sites, while PG ES cells show bands at these positions, suggesting no or partial methylation (Fig. 2 and
3). Using Southern blot analysis
(41), we obtained similar data for one of these sites with
the methylation-sensitive restriction enzyme SmaI. The data
obtained by the genomic sequencing method indicate that this
differential methylation extends to all CpG sites in the promoter
region that we examined.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
Map of the 4-kb region upstream of the H19
gene. The A, B, C, and D segments have been analyzed by in vivo
footprinting. Approximate locations of LMPCR primer sets K, L, M, N, O,
Q, TY, Z, I, and J are indicated by horizontal arrows. The scale
underneath shows the distances from the transcription start site. R,
EcoRI sites.
|
|

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 2.
In vivo footprinting of the proximal H19
promoter in PG ES cells, WT ES cells, and AG ES cells. Methylation
(Meth.), genomic DNase I footprinting (DNA-se I), and in vivo DMS
footprinting (DMS) analyses were conducted. The N primer set was used
for LMPCR analysis of the upper strand. Pg, PG ES cells; Wt, WT ES
cells; Ag, AG ES cells. Open and filled circles indicate unmethylated
and fully methylated CpGs, respectively, representing PG ES cells on
the left and AG ES cells on the right; grey bars indicate partial DNase
I footprints in PG ES cells; black bars indicate complete protection;
black and open squares indicate increases and decreases, respectively,
in DMS reactivity; A, AG ES cells; P, PG ES cells; brackets on the
right side show consensus binding sites for transcription factors.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Summary of the promoter footprinting data. Primary data
were taken from experiments with the K, L, M, N, and O primer sets. (A)
Maternal chromosome, PG ES cells; (B) paternal chromosome, AG ES cells.
Circles around the DNA sequences indicate consensus sequences for
transcription factors. Striped bars indicate partial DNase I
footprints; black bars indicate complete protection; arrows pointing up
or down indicate increased DNase I sensitivity of the in vivo-treated
versus the in vitro-treated samples; filled or open squares indicate
increases or decreases, respectively, in DMS reactivity; open or closed
circles stand for hypomethylated or hypermethylated CpGs, respectively;
grey circles stand for partially methylated sites.
|
|
DNase I footprinting revealed binding of protein factors in the
H19 promoter at three Sp1 sites, one CCAAT box sequence, and
one AP-2 site in PG ES cells (Fig.
2 and
3). The second Sp1 site
(nucleotides [nt]

49 to

44) exhibited complete protection by
the
factor, while all other sites were partially protected. DMS
footprinting results supported occupation of two Sp1 sites and
the AP-2
consensus site by protein factors. In AG ES cells, there
was a weak
protection near the first Sp1-like site and the CCAAT
box. LMPCR
performed on the lower strand of the proximal promoter
region showed
similar methylation differences and confirmed the
footprints (data not
shown and Fig.
3).
The more distal promoter region had a similar hypomethylation of CpGs
in PG ES cells and methylation in AG ES cells (Fig.
3 to
5). A C/EBP
consensus site near bp

180 was partially protected
from DNase I
cleavage (Fig.
3 and
4). Binding of two additional
protein factors in
PG ES cells is suggested by in the vivo DMS
footprinting data (Fig.
3A
and
5).

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 4.
In vivo footprinting of the H19 promoter in
PG ES cells and AG ES cells. The upper strand of the region between nt
129 and 225 was analyzed. The O primer set was used in LMPCR. The
bracket on the right indicates the C/EBP recognition sequence, and the
black rectangle indicates the protection at this site by a protein
factor in PG, AG, and WT ES cells. For other details, see the legend to
Fig. 2.
|
|

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
In vivo footprinting of the distal H19
promoter in PG ES cells and AG ES cells. The lower strand of the region
between nt 202 and 347 was analyzed. The K primer set was used in
the LMPCR. Open squares indicate protection from DMS modification in PG
ES cells. For other details, see the legend to Fig. 2.
|
|
The WT ES cells showed an intermediate protection/reactivity in the
methylation analysis and the DNase I or DMS footprinting
compared to PG
ES cells and AG ES cells. This is the expected
result in cells
containing both maternal and paternal chromosomes
(Fig.
2 and
5).
Analysis of the G-rich repetitive region.
Analysis of the
upper strand of segment B (Fig. 1), which carries the short tandem
repeat sequence [(G)GGGGTATA]32 (45), is shown
in Fig. 6A. This area does not contain
CpG dinucleotides, which is reflected in the identical hydrazine
modification pattern of C's between the cell lines. A very similar
modification pattern was obtained with DMS. DNase I generated a pattern
in vivo which was different from the in vitro cleavage pattern but
identical between all three cell lines. The T and A nucleotides at the
5' ends of the repeats usually have decreased DNase I cleavage
intensities in vivo compared to the rest of the sequence (Fig. 6B).

View larger version (69K):
[in this window]
[in a new window]

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Footprinting of the G-rich repetitive region located at
kb 1.3 to 1.4. (A) Autoradiogram. The Q primer set was used for
LMPCR. Filled bars on the right show perfect repeats; open bars show
partially homologous repeats. For other details, see legend to Fig. 2.
(B) Summary of the analysis. Arrows pointing up or down indicate
increased or decreased DNase I sensitivity of the in vivo-treated
versus the in vitro-treated samples. No major differences in DNase I
patterns were observed between PG, WT, and AG ES cells.
|
|
Analysis of the far upstream paternally methylated region.
We
analyzed a portion of the ~2-kb upstream paternally methylated region
with primer sets TY and Z (segment C [Fig. 1]). One of the CpG's in
this area is HhaI site 3 (44), which is
methylated in AG ES cells and unmethylated in PG ES cells (Fig.
7). Some CpG sites showed differential
methylation; others were methylated on both alleles. The in vivo DNase
I patterns were different from the in vitro patterns but identical
between cell lines with the exception of a hypersensitive site mapping
to a C/EBP recognition sequence. The same recognition sequence had
increased DMS modification in PG ES cells. C/EBP is a liver- and
adipocyte-specific transcription factor (11, 17).
Differences in DMS and DNase I reactivity at two C/EBP consensus sites
(Fig. 3A, 4, and 7) may indicate that these sites are somehow marked
for liver-specific expression of H19 (15). We
observed similar methylation differences on the lower strand with
primer set Z but found no differences in DMS or DNase I patterns
between cell lines (data not shown).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 7.
Footprinting of the differentially methylated region.
The upper strand is shown. The TY primer set was used. The C/EBP site
is indicated on the right. For other details, see the legend to Fig.
2.
|
|
Analysis of the boundary of the methylated region.
We analyzed
a 200-bp sequence at the 5' boundary of the 2-kb upstream paternally
methylated region with primer sets I and J (segment D [Fig. 1]).
Analysis of the upper strand is shown in Fig.
8A. At a CpG site designated
HhaI-1 (45), there is complete methylation in AG
ES cells, while a very strong band present in PG ES cells indicates
that the site is fully unmethylated in these cells. All other CpG sites
are completely methylated in AG ES cells and either unmethylated or
only partially methylated in PG ES cells. The DNase I and DMS
modification patterns for this region differ between PG ES cells
and AG ES cells. The maternal chromosomes of the H19 gene
have a series of DNase I-hypersensitive sites (from nt
3962 to
3843) that are much weaker or missing from the paternal
chromosomes. Several bands have reduced intensity in the DMS ladder in
PG ES cells, which could indicate binding of protein factors at these
sites. On the opposite strand (Fig. 8B), an area of increased DNase I
reactivity is seen between nt
3956 and
3848. The DMS modification
patterns on the lower strand were similar between naked DNA and AG ES
cells treated with DMS in vivo (Fig. 8B). However, some G's on this
strand were hyperreactive in PG ES cells compared to naked DNA or AG ES
cells, which suggests protein binding at several positions in the area.
However, DNase I hypersensitivity at the same sequences contradicts
this possibility and instead suggests an altered DNA structure at these
sites. WT DNA always exhibited intermediate intensities. A summary of DNase I and DMS footprinting experiments of the area between nt
4034
and
3840 is shown in Fig. 9. The DNase
I hyperreactivity spanning 40 nt (between nt
3948 and
3908) on both
strands suggested an unusual chromatin or DNA structure. To determine
if this structure would consist of melted DNA, we analyzed the same
region with the oxidative agent KMNO4. KMNO4
oxidizes pyrimidine bases, mostly T's, preferentially in
single-stranded or melted DNA (39). Reactivities of in vivo-
and in vitro-treated samples were equal for all of the three cell lines
(data not shown); therefore, we can exclude stable melting of these
sequences.

View larger version (120K):
[in this window]
[in a new window]
|
FIG. 8.
Footprinting of the far upstream boundary of the
differentially methylated sequences. (A) Upper strand, the J primer set
used for LMPCR; (B) lower strand, the I primer set used. Filled and
open squares indicate increases and decreases, respectively, in DMS
reactivity in PG ES cells; dashed lines indicate the regions with the
highest DNase I sensitivity. For other details, see the legend to Fig.
2.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 9.
Summary of the analysis of the far upstream sequences.
(A) Maternal chromosome, PG ES cells; (B) paternal chromosome, AG ES
cells. Arrows pointing up or down indicate increased or decreased DNase
I sensitivity of the in vivo-treated versus the in vitro-treated
samples; shorter arrows indicate lower DNase I sensitivity in AG cells
compared to PG cells; filled or open squares indicate increases or
decreases, respectively, in DMS reactivity; open or closed circles
indicate hypomethylated or hypermethylated CpGs, respectively; grey
circles stand for partially methylated sites; brackets indicate the
sequences analyzed.
|
|
 |
DISCUSSION |
Previous observations of parent-specific methylation and
experiments with transgenic mice have strongly suggested an important role for regions upstream of the H19 coding sequence in
conferring monoallelic expression on this gene. Here we have examined
some specific upstream sequences to determine if there exist additional parent-specific differences in chromatin structure that might also be
involved in H19 imprinting.
Previous studies of H19 methylation were performed with
methylation-sensitive restriction enzymes, which allow detection of the
methylation status at a limited number of CpGs (3, 15, 16,
41). In addition, sodium bisulfite genomic sequencing revealed
the methylation status at single-nucleotide resolution on individual
maternal and paternal chromosomes (31, 44). Using a
different sequencing method, we extend these previous analyses, showing
the mean methylation level of the whole population of chromosomes at
single-nucleotide resolution. This analysis has essentially confirmed
the previous findings of hypo- and hypermethylation of maternally and
paternally derived sequences, respectively, upstream of H19.
It is significant that much of the paternal chromosome-specific methylation in AG ES cells must be laid down quickly during their derivation and early passage, as it has been shown that the CpGs in the
H19 promoter are not paternally methylated in blastocysts (9, 44). This rapid de novo methylation occurs before the high-expression phase of H19, while its expression level is
very low in all three types of ES cell. Thus, it is conceivable that this methylation is a response to the intrinsic state of paternal chromatin structure and may be prevented by transcription factor binding to the maternal chromosome.
Aside from differential methylation, we now describe the presence of a
number of other differential epigenetic modifications at various
regions upstream of the H19 coding sequence. The in vivo
footprints were observed almost exclusively in PG ES cells or on
maternally derived alleles of H19. When footprints were observed in AG ES cells, they were always weaker than the corresponding PG footprints. Partial footprints in AG ES cells at the CCAAT box and
one Sp1 site perhaps may be explained by a lack of fully methylated
CpGs near these sequences (Fig. 3B) and/or by the methylation independence of Sp1 binding (18).
The G-rich repetitive region at kb
1.3 (45) did not appear
different in respect to the two parental chromosomes by DMS and DNase I
footprinting. While these observations suggest that this repeat may not
play a role in maintaining monoallelic expression of the H19
gene, they do not preclude the possibility that it has some role in
initiation. Repeat elements are typically associated with imprinted
genes (30), and it has been suggested that possible differences in their chromatin structure in the female and male germ
lines may lead to different levels of methylation, which in turn leads
to differential allelic expression (7).
In contrast to the negative observations for the repeat element, at the
boundary of a far upstream region thought to harbor H19
imprints, we observed a localized region of DNase I hypersensitivity specific to maternally derived alleles and present on both strands of
the DNA. This is most likely indicative of the presence of an unusual
chromatin structure at this site. While further work is required to
determine the precise nature of this structure, its presence raises the
question of whether it might function after fertilization to inhibit
methylation nearby, for example, in the putative imprinting region, and
ultimately at more distant sites such as the promoter.
We provide the first evidence that transcription factors
preferentially interact with the maternal allele of
H19. The footprints within an approximately 100-bp
region at the H19 promoter coincided with five transcription
factor binding consensus sequences: two Sp1, one Sp1-like, one AP-2,
and one CAATT box. These data suggest that binding at these sites is a
requirement for maternal H19 expression and are consistent
with the results of previous H19 promoter mapping studies in
which a 127-bp fragment containing all five binding elements resulted
in the highest level of reporter gene expression in hepatoma cells
(46). Of interest are the similarities between these
findings for the autosomal H19 gene and those for X-linked
genes which exhibit monoallelic but random expression in XX somatic
cells. The active allele of the human phosphoglycerate kinase-1 gene
promoter is unmethylated and exhibits protein binding at a CCAAT
sequence, an NF-1-like binding sequence, and at two GC boxes, each of
which contains two Sp1 binding sequences. On the other hand, the
inactive allele shows the opposite configuration: it is methylated and
exhibits no protein binding at any of these sites (32, 34).
Similar results were obtained for the human X-linked hypoxanthine
guanine phosphoribosyltransferase gene (19) and the mouse
inactive X-specific transcript gene (20).
While differences in parent-specific methylation and the
additional differences in chromatin structure that we have
described in this study might be involved in maintaining
parent-specific expression of H19, challenges remaining are
to determine if one of these epigenetic modifications determines the
others and to establish their relationship to the primary
determinant of monoallelic expression, the imprint, as imparted
in the germ line. For example, it is possible that the unusual
chromatin structure in the far upstream region of the
H19 maternal allele is specific to oogenesis and
somehow inhibits any potential for methylation in its vicinity before
and after fertilization. Its absence in spermatogenesis and from the
paternal allele after fertilization could then allow a gradual
methylation at these sites by default.
The maternal allele-specific binding of transcription factors we have
observed in upstream region of the H19 gene is consistent with the suggestion that protein factor-DNA binding could serve as an
imprint (12) and could result from maternal germ
line-specific expression of the relevant factors. Models such as this
need not be considered unlikely on the basis that protein factor-DNA
binding might be unstable throughout cell division (12).
Female germ cells are arrested in meiosis I in the early fetus until
just prior to ovulation in the adult, while male germ cells are
arrested in mitosis in the early fetus until the early neonatal stage. This arrest could render differential transcription factor binding very
stable in the germ line over long periods of developmental time and
therefore able to inhibit the laying down of secondary or downstream
epigenetic modifications which might ultimately be responsible
for maintaining or stabilizing monoallelic expression in
somatic cells. On this point, it has been suggested that transcription factors bound to promoter elements could outcompete nucleosomes and DNA
methyltransferase and thereby inhibit methylation (2, 34).
Indeed, Sp1 binding functions in a chromatin-dependent manner to
augment human
-globin promoter activity (37) to protect the CpG island of the mouse adenine phosphoribosyltransferase gene and its human homolog in transgenes from methylation and to cause demethylation of artificially methylated sequences
(8, 24). Also, it is worth pointing out that the
differential methylation in gametes that is suggested to constitute
imprints (40) would almost certainly be laid down during the
time that at least the female germ line is arrested in cell division.
Elucidation of these various possibilities may become possible by
extending the analyses we have performed here for PG and AG ES cells to
the female and male germ lines of mice. This is a challenging prospect
given the small amounts of material that can be recovered in respect to
these cell lineages.
 |
ACKNOWLEDGMENT |
This work was supported by Public Health Service grant RO1GM48103-04A2
from the National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Biology, Beckman Research Institute of the City of Hope, 1450 East
Duarte Road, Duarte CA 91010. Phone: (626) 301-8813. Fax: (626)
358-7703. E-mail: jmann{at}nwc.net.
 |
REFERENCES |
| 1.
|
Allen, N. D.,
S. C. Barton,
K. Hilton,
M. L. Norris, and M. A. Surani.
1994.
A functional analysis of imprinting in parthenogenetic embryonic stem cells.
Development
120:1473-1482[Abstract].
|
| 2.
|
Antequera, F., and A. Bird.
1993.
CpG islands, p. 169-185.
In
J. P. Jost, and H. P. Saluz (ed.), DNA methylation: molecular biology and functional significance. Birkhäuser Verlag, Basel, Switzerland.
|
| 3.
|
Bartolomei, M. S.,
A. L. Webber,
M. E. Brunkow, and S. M. Tilghman.
1993.
Epigenetic mechanisms underlying the imprinting of the mouse H19 gene.
Genes Dev.
7:1663-1673[Abstract/Free Full Text].
|
| 4.
|
Barton, S. C.,
A. C. Ferguson-Smith,
R. Fundele, and M. A. Surani.
1991.
Influence of paternally imprinted genes on development.
Development
113:679-688[Abstract].
|
| 5.
|
Beddington, R. S. P., and E. J. Robertson.
1989.
An assessment of the developmental potential of embryonic stem cells in the midgestation mouse embryo.
Development
105:733-737[Abstract/Free Full Text].
|
| 6.
|
Beechey, C. V., and B. M. Cattanach.
1997.
Genetic and physical imprinting map of the mouse.
Mouse Genome
95:100-105.
|
| 7.
|
Bestor, T. H., and B. Tycko.
1996.
Creation of genomic methylation patterns.
Nat. Genet.
12:363-367[Medline].
|
| 8.
|
Brandeis, M.,
D. Frank,
I. Keshet,
Z. Siegfried,
M. Mendelsohn,
A. Nemes,
V. Temper,
A. Razin, and H. Cedar.
1994.
Sp1 elements protect a CpG island from de novo methylation.
Nature
371:435-438[Medline].
|
| 9.
|
Brandeis, M.,
T. Kafri,
M. Ariel,
J. R. Chaillet,
J. McCarrey,
A. Razin, and H. Cedar.
1993.
The ontogeny of allele-specific methylation associated with imprinted genes in the mouse.
EMBO J.
12:3669-3677[Medline].
|
| 10.
|
Brook, F. A., and R. L. Gardner.
1997.
The origin and efficient derivation of embryonic stem cells in the mouse.
Proc. Natl. Acad. Sci. USA
94:5709-5712[Abstract/Free Full Text].
|
| 11.
|
Christy, R. J.,
V. W. Yang,
J. M. Ntambi,
D. E. Geiman,
W. H. Landschulz,
A. D. Friedman,
A. D. Nakabeppu,
T. J. Kelly, and M. D. Lane.
1989.
Differentiation-induced gene expression in 3T3-L1 preadipocytes: CCAT/enhancer binding protein interacts with and activates the promoters of two adipocyte-specific genes.
Genes Dev.
3:1323-1335[Abstract/Free Full Text].
|
| 12.
|
Efstratiadis, A.
1994.
Parental imprinting of autosomal mammalian genes.
Curr. Opin. Genet. Dev.
4:265-280[Medline].
|
| 13.
|
Elson, D. A., and M. S. Bartolomei.
1997.
A 5' differentially methylated sequence and the 3'-flanking region are necessary for H19 transgene imprinting.
Mol. Cell. Biol.
17:309-317[Abstract].
|
| 14.
|
Ephrussi, A.,
G. M. Church,
S. Tonegawa, and W. Gilbert.
1985.
B lineage specific interactions of an immunoglobulin enhancer with cellular factors in vivo.
Science
227:134-140[Abstract/Free Full Text].
|
| 15.
|
Feil, R.,
J. Walter,
N. D. Allen, and W. Reik.
1994.
Developmental control of allelic methylation in the imprinted mouse Igf2 and H19 genes.
Development
120:2933-2943[Abstract].
|
| 16.
|
Ferguson-Smith, A. C.,
H. Sasaki,
B. M. Cattanach, and M. A. Surani.
1993.
Parental-origin-specific epigenetic modification of the mouse H19 gene.
Nature
362:751-755[Medline].
|
| 17.
|
Friedman, A. D.,
W. H. Landschulz, and S. L. McKnight.
1989.
CCAAT/enhancer binding protein activates the promoter of the serum albumin gene in cultured hepatoma cells.
Genes Dev.
3:1314-1322[Abstract/Free Full Text].
|
| 18.
|
Höller, M.,
G. Westin,
J. Jiricny, and W. Schaffner.
1988.
Sp1 transcription factor binds DNA and activates transcription even when the binding site is CpG methylated.
Genes Dev.
2:1127-1135[Abstract/Free Full Text].
|
| 19.
|
Hornstra, I. K., and T. P. Yang.
1992.
Multiple in vivo footprints are specific to the active allele of the X-linked human hypoxanthine phosphoribosyltransferase gene 5' region: implications for X chromosome inactivation.
Mol. Cell. Biol.
12:5345-5354[Abstract/Free Full Text].
|
| 20.
|
Komura, J.,
S. A. Sheardown,
N. Brockdorff,
J. Singer-Sam, and A. D. Riggs.
1997.
In vivo ultraviolet footprinting and dimethyl sulfate footprinting of the 5' region of the expressed and silent Xist alleles.
J. Biol. Chem.
272:10975-10980[Abstract/Free Full Text].
|
| 21.
|
Latham, K. E.,
A. S. Doherty,
C. D. Scott, and R. M. Schultz.
1994.
Igf2r and Igf2 gene expression in androgenetic, gynogenetic, and parthenogenetic preimplantation mouse embryos: absence of regulation by genomic imprinting.
Genes Dev.
8:290-299[Abstract/Free Full Text].
|
| 22.
|
Leighton, P. A.,
R. S. Ingram,
J. Eggenschwiler,
A. Efstratiadis, and S. M. Tilghman.
1995.
Disruption of imprinting caused by deletion of the H19 gene region in mice.
Nature
375:34-39[Medline].
|
| 23.
|
Li, E.,
C. Beard, and R. Jaenisch.
1993.
Role for DNA methylation in genomic imprinting.
Nature
366:362-365[Medline].
|
| 24.
|
Macleod, D.,
J. Charlton,
J. Mullins, and A. P. Bird.
1994.
Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island.
Genes Dev.
8:2282-2292[Abstract/Free Full Text].
|
| 25.
|
Mann, J. R.
1992.
Properties of androgenetic and parthenogenetic mouse embryonic stem cell lines; are genetic imprints conserved?
Semin. Dev. Biol.
3:77-85.
|
| 26.
|
Mann, J. R.,
I. Gadi,
M. L. Harbison,
S. J. Abbondanzo, and C. L. Stewart.
1990.
Androgenetic mouse embryonic stem cells are pluripotent and cause skeletal defects in chimeras: implications for genetic imprinting.
Cell
62:251-260[Medline].
|
| 27.
|
Mann, J. R., and C. L. Stewart.
1991.
Development to term of mouse androgenetic aggregation chimeras.
Development
113:1325-1333[Abstract].
|
| 28.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 29.
|
Mueller, P. R., and B. Wold.
1989.
In vivo footprinting of a muscle-specific enhancer by ligation mediated PCR.
Science
246:780-786[Abstract/Free Full Text].
|
| 30.
|
Neumann, B.,
P. Kubicka, and D. P. Barlow.
1995.
Characteristics of imprinted genes.
Nat. Genet.
9:12-13[Medline].
|
| 31.
|
Olek, A., and J. Walter.
1997.
The pre-implantation ontogeny of the H19 methylation imprint.
Nat. Genet.
17:275-276[Medline].
|
| 32.
|
Pfeifer, G. P., and A. D. Riggs.
1991.
Chromatin differences between active and inactive X chromosomes revealed by genomic footprinting of permeabilized cells using DNaseI and ligation-mediated PCR.
Genes Dev.
5:1102-1113[Abstract/Free Full Text].
|
| 33.
|
Pfeifer, G. P.,
J. Singer-Sam, and A. D. Riggs.
1993.
Analysis of methylation and chromatin structure.
Methods Enzymol.
225:567-583[Medline].
|
| 34.
|
Pfeifer, G. P.,
S. D. Steigerwald,
R. S. Hansen,
S. M. Gartler, and A. D. Riggs.
1990.
Polymerase chain reaction-aided genomic sequencing of an X chromosome-linked CpG island: methylation patterns suggest clonal inheritance, CpG site autonomy, and an explanation of activity state stability.
Proc. Natl. Acad. Sci. USA
87:8252-8256[Abstract/Free Full Text].
|
| 35.
|
Pfeifer, G. P.,
S. D. Steigerwald,
P. R. Mueller,
B. Wold, and A. D. Riggs.
1989.
Genomic sequencing and methylation analysis by ligation mediated PCR.
Science
246:810-813[Abstract/Free Full Text].
|
| 36.
|
Pfeifer, K.,
P. A. Leighton, and S. M. Tilghman.
1996.
The structural H19 gene is required for transgene imprinting.
Proc. Natl. Acad. Sci. USA
93:13876-13883[Abstract/Free Full Text].
|
| 37.
|
Pondel, M. D.,
S. Murphy,
L. Pearson,
C. Craddock, and N. J. Proudfoot.
1995.
Sp1 functions in a chromatin-dependent manner to augment human -globin promoter activity.
Proc. Natl. Acad. Sci. USA
92:7237-7241[Abstract/Free Full Text].
|
| 38.
|
Ripoche, M.-A.,
C. Kress,
F. Poirier, and L. Dandolo.
1997.
Deletion of the H19 transcription unit reveals the existence of a putative imprinting control element.
Genes Dev.
11:1596-1604[Abstract/Free Full Text].
|
| 39.
|
Rubin, C. M., and C. W. Schmid.
1980.
Pyrimidine-specific chemical reactions useful for DNA sequencing.
Nucleic Acids Res.
8:4613-4619[Abstract/Free Full Text].
|
| 40.
|
Shemer, R., and A. Razin.
1996.
Establishment of imprinted methylation patterns during development, p. 215-229.
In
V. E. A. Russo, R. A. Martienssen, and A. D. Riggs (ed.), Epigenetic mechanisms of gene regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Szabó, P., and J. R. Mann.
1994.
Expression and methylation of imprinted genes during in vitro differentiation of mouse parthenogenetic and androgenetic embryonic stem cell lines.
Development
120:1651-1660[Abstract].
|
| 42.
|
Szabó, P. E., and J. R. Mann.
1995.
Allele-specific expression and total expression levels of imprinted genes during early mouse development: implications for imprinting mechanisms.
Genes Dev.
9:3097-3108[Abstract/Free Full Text].
|
| 43.
|
Törmänen, V. T.,
P. M. Swiderski,
B. E. Kaplan,
G. P. Pfeifer, and A. D. Riggs.
1992.
Extension product capture improves genomic sequencing and DNase I footprinting by ligation-mediated PCR.
Nucleic Acids Res.
20:5487-5488[Free Full Text].
|
| 44.
|
Tremblay, K. D.,
K. L. Duran, and M. S. Bartolomei.
1997.
A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development.
Mol. Cell. Biol.
17:4322-4329[Abstract].
|
| 45.
|
Tremblay, K. D.,
J. R. Saam,
R. S. Ingram,
S. M. Tilghman, and M. S. Bartolomei.
1995.
A paternal-specific methylation imprint marks the alleles of the mouse H19 gene.
Nat. Genet.
9:407-413[Medline].
|
| 46.
|
Yoo-Warren, H.,
V. Pachnis,
R. S. Ingram, and S. M. Tilghman.
1988.
Two regulatory domains flank the mouse H19 gene.
Mol. Cell. Biol.
8:4707-4715[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 1998, p. 6767-6776, Vol. 18, No. 11
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yoon, Y. S., Jeong, S., Rong, Q., Park, K.-Y., Chung, J. H., Pfeifer, K.
(2007). Analysis of the H19ICR Insulator. Mol. Cell. Biol.
27: 3499-3510
[Abstract]
[Full Text]
-
O'Neill, M. J.
(2005). The influence of non-coding RNAs on allele-specific gene expression in mammals. Hum Mol Genet
14: R113-R120
[Abstract]
[Full Text]
-
Szabo, P. E., Pfeifer, G. P., Mann, J. R.
(2004). Parent-of-Origin-Specific Binding of Nuclear Hormone Receptor Complexes in the H19-Igf2 Imprinting Control Region. Mol. Cell. Biol.
24: 4858-4868
[Abstract]
[Full Text]
-
Park, K.-Y., Sellars, E. A., Grinberg, A., Huang, S.-P., Pfeifer, K.
(2004). The H19 Differentially Methylated Region Marks the Parental Origin of a Heterologous Locus without Gametic DNA Methylation. Mol. Cell. Biol.
24: 3588-3595
[Abstract]
[Full Text]
-
Coombes, C., Arnaud, P., Gordon, E., Dean, W., Coar, E. A., Williamson, C. M., Feil, R., Peters, J., Kelsey, G.
(2003). Epigenetic Properties and Identification of an Imprint Mark in the Nesp-Gnasxl Domain of the Mouse Gnas Imprinted Locus. Mol. Cell. Biol.
23: 5475-5488
[Abstract]
[Full Text]
-
Kaffer, C. R., Grinberg, A., Pfeifer, K.
(2001). Regulatory Mechanisms at the Mouse Igf2/H19 Locus. Mol. Cell. Biol.
21: 8189-8196
[Abstract]
[Full Text]
-
BURNS, J. L., JACKSON, D. A., HASSAN, A. B.
(2001). A view through the clouds of imprinting. FASEB J.
15: 1694-1703
[Abstract]
[Full Text]
-
Jones, B. K., Levorse, J., Tilghman, S. M.
(2001). Deletion of a nuclease-sensitive region between the Igf2 and H19 genes leads to Igf2 misregulation and increased adiposity. Hum Mol Genet
10: 807-814
[Abstract]
[Full Text]
-
Horike, S.-i., Mitsuya, K., Meguro, M., Kotobuki, N., Kashiwagi, A., Notsu, T., Schulz, T. C., Shirayoshi, Y., Oshimura, M.
(2000). Targeted disruption of the human LIT1 locus defines a putative imprinting control element playing an essential role in Beckwith-Wiedemann syndrome. Hum Mol Genet
9: 2075-2083
[Abstract]
[Full Text]
-
Kearns, M., Preis, J., McDonald, M., Morris, C., Whitelaw, E.
(2000). Complex patterns of inheritance of an imprinted murine transgene suggest incomplete germline erasure. Nucleic Acids Res
28: 3301-3309
[Abstract]
[Full Text]
-
Kaffer, C. R., Srivastava, M., Park, K.-Y., Ives, E., Hsieh, S., Batlle, J., Grinberg, A., Huang, S.-P., Pfeifer, K.
(2000). A transcriptional insulator at the imprinted H19/Igf2 locus. Genes Dev.
14: 1908-1919
[Abstract]
[Full Text]
-
Doherty, A. S., Mann, M. R.W., Tremblay, K. D., Bartolomei, M. S., Schultz, R. M.
(2000). Differential Effects of Culture on Imprinted H19 Expression in the Preimplantation Mouse Embryo. Biol. Reprod.
62: 1526-1535
[Abstract]
[Full Text]
-
Schmidt, J. V., Levorse, J. M., Tilghman, S. M.
(1999). Enhancer competition between H19 and Igf2 does not mediate their imprinting. Proc. Natl. Acad. Sci. USA
96: 9733-9738
[Abstract]
[Full Text]
-
Khosla, S., Aitchison, A., Gregory, R., Allen, N. D., Feil, R.
(1999). Parental Allele-Specific Chromatin Configuration in a Boundary-Imprinting-Control Element Upstream of the Mouse H19 Gene. Mol. Cell. Biol.
19: 2556-2566
[Abstract]
[Full Text]