Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 6897-6909, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Classification of gas5 as a Multi-Small-Nucleolar-RNA
(snoRNA) Host Gene and a Member of the 5'-Terminal
Oligopyrimidine Gene Family Reveals Common Features of snoRNA
Host Genes
Christine M.
Smith
and
Joan A.
Steitz*
Department of Molecular Biophysics and Biochemistry,
Howard Hughes Medical Institute, Yale University, New Haven,
Connecticut
Received 10 July 1998/Accepted 18 August 1998
 |
ABSTRACT |
We have identified gas5 (growth arrest-specific
transcript 5) as a non-protein-coding multiple small nucleolar RNA
(snoRNA) host gene similar to UHG (U22 host gene). Encoded
within the 11 introns of the mouse gas5 gene are nine (10 in human) box C/D snoRNAs predicted to function in the 2'-O-methylation
of rRNA. The only regions of conservation between mouse and human
gas5 genes are their snoRNAs and 5'-end sequences. Mapping
the 5' end of the mouse gas5 transcript demonstrates that
it possesses an oligopyrimidine tract characteristic of the 5'-terminal
oligopyrimidine (5'TOP) class of genes. Arrest of cell growth or
inhibition of translation by cycloheximide, pactamycin, or
rapamycin
which specifically inhibits the translation of 5'TOP
mRNAs
results in accumulation of the gas5 spliced RNA.
Classification of gas5 as a 5'TOP gene provides an
explanation for why it is a growth arrest specific transcript: while
the spliced gas5 RNA is normally associated with ribosomes
and rapidly degraded, during arrested cell growth it accumulates in
mRNP particles, as has been reported for other 5'TOP messages.
Strikingly, inspection of the 5'-end sequences of currently known
snoRNA host gene transcripts reveals that they all exhibit features of
the 5'TOP gene family.
 |
INTRODUCTION |
In the nucleolus of eukaryotic
cells, ribosomal DNA is transcribed by RNA polymerase I into long
precursor (pre-rRNA) transcripts, which are modified by methylation and
pseudo-uridylation, cleaved to yield 18S, 5.8S, and 28S rRNAs, and then
assembled into the mature large and small ribosomal subunits prior to
export to the cytoplasm (for reviews see references 22,
26, and 77). A large number of small
nucleolar ribonucleoprotein (snoRNP) particles have emerged as key
players in this biosynthetic process. Currently more than 70 snoRNA
species have been identified (for reviews see references 51,
75, and 82). All snoRNAs, with the
exception of MRP RNA, can be divided into two classes: those that
possess boxes C (RUGAUGA) and D (CUGA), which are required for
association with the abundant nucleolar autoantigen fibrillarin (see
reference 51), and those that possess boxes H
(ANANNA) and ACA, which mediate the binding of Gar1 protein (4, 8,
24, 37). Only a few snoRNAs have been found to be required for
growth in yeast (U3 [6, 29], U14
[43], MRP [14, 73], snR10
[80, 81], and snR30 [5, 54]) or for
specific pre-rRNA cleavage events in Xenopus oocytes (U3
[34, 72], U8 [63], and U22 [85]).
Recently, box C/D snoRNAs and box H/ACA snoRNAs were found to target
specific sites in pre-rRNA for 2'-O-methylation and pseudouridylation, respectively (for reviews see references 46, 48, 62,
75, and 82). These modification reactions
are mediated by extensive regions (10 to 21 nt) of complementarity
between the so-called "antisense" snoRNAs and sequences flanking
the rRNA sites to be modified. Specifically, U24, U20, and U25 were
shown to direct site-specific ribose methylation of pre-rRNA in HeLa
cells (39), yeast (13), and Xenopus
oocytes (87), respectively, and snR8, snR3, snR33, and snR5
(among others) were demonstrated to target pre-rRNA for
pseudouridylation in yeast (23, 57). The presence of ~200
modified nucleotides in vertebrate rRNA (47) suggests that
more than half of the antisense snoRNAs remain to be identified.
A unique feature of snoRNAs is that most are encoded within the introns
of protein-coding genes (reviewed in reference 51). This economic use of introns is commonplace among intron-rich organisms, such as vertebrates, where antisense snoRNAs have been found
to be exclusively intron encoded. By contrast, in Saccharomyces cerevisiae many snoRNAs are produced from independent
transcription units. A vertebrate host gene intron encodes only a
single snoRNA, whereas in yeast and plants, some snoRNA genes are
located in polycistronic arrays without exons separating the snoRNA
sequences (41). In all species investigated, the
intron-encoded snoRNAs are transcribed from their host genes by RNA
polymerase II as portions of the pre-mRNA. The functional snoRNAs are
then produced by exonucleolytic trimming that follows either splicing
(12, 38, 86) or endonucleolytic cleavage of intron sequences
(9, 10).
The mode by which snoRNA sequences became inserted into the introns of
their host genes is not known. Interestingly, the host gene for a
particular snoRNA can differ even among closely related vertebrates,
suggesting that intron-encoded snoRNAs may be highly mobile genetic
elements (see reference 51). Likewise, the reason particular genes have been chosen as hosts for intron-encoded snoRNAs
has been unclear. Initially, it appeared that all snoRNA host genes
generate protein products that function in ribosome biogenesis or in
translation; ribosomal proteins (rp) L1, L5, L7a, S8, nucleolin, and
eIF4AI are a few examples (see references 66, 68,
67, 59, 58, and 24, respectively). Such
genetic organization could provide coregulation of protein components of the translational machinery and snoRNAs, which contribute to rRNA
maturation (76). However, the discovery of other snoRNA host
genes lacking obvious ribosome-related functions (for example, ATP
synthase
[39]) suggested that host genes may have
been chosen merely to meet the need for transcription rates high enough to produce a sufficient level of snoRNAs (~104
copies/cell) to base pair with the cell's nascent pre-rRNA molecules.
UHG (U22 host gene) is an unusual snoRNA host gene because
it does not appear to specify a protein product. It generates, in
addition to U22, seven different box C/D antisense snoRNAs (U25 to U31)
(84). Comparison of mouse and human UHG sequences revealed that its introns are more conserved than its exons, suggesting that the snoRNAs may be the only functional portions of the transcript. Both human and mouse UHG messages are riddled with stop
codons in all three reading frames; the longest open reading frames
(ORFs) would produce peptides of 51 and 40 amino acids for human and mouse UHG, respectively. Nonetheless, the UHG
transcript resembles a typical rp mRNA in that it begins with a C
residue, is spliced and polyadenylated, and is associated with
ribosomes. However, unlike rp mRNAs, the spliced UHG RNA is
almost undetectable in HeLa cells. Inhibition of translation in HeLa
cells with the initiation inhibitor pactamycin or elongation inhibitors
cycloheximide or puromycin results in a 15-fold increase in the level
of spliced UHG transcript (84). This link between
the levels of UHG RNA and active translation, in conjunction
with its numerous stop codons, suggests that it may be a candidate for
the nonsense-mediated decay pathway (49, 84).
Here we report the identification of a second member of the
UHG class of snoRNA host genes. Growth arrest-specific
transcript 5 (gas5) was initially discovered in a screen for
potential tumor suppressor genes expressed at high levels during growth
arrest (74). The murine gas5 gene produces a
ubiquitous, polyadenylated, alternatively spliced message which is
almost undetectable in actively growing cells yet is highly expressed
in cells undergoing serum starvation or density arrest (15,
16). We demonstrate that gas5 is a multi-snoRNA host
gene which encodes 9 (in mouse) or 10 (in human) antisense snoRNAs. By
mapping the 5' end of the gas5 transcript and comparing it
with other known snoRNA host genes, we observe that all known snoRNA
host genes exhibit characteristics which define the 5'TOP (terminal
oligopyrimidine) class of genes. We provide evidence that membership in
the 5'TOP family explains why the abundance of the gas5
spliced product is growth dependent. Furthermore, the discovery that
all snoRNA host genes contain 5'TOP sequences may illuminate why
certain genes have been selected to serve as snoRNA host genes.
 |
MATERIALS AND METHODS |
Cloning mouse and human gas5 genes.
The partial
sequence of U80 was obtained by a reverse transcriptase PCR cloning
approach (61) in which cDNAs were generated by first
ligating an antisense oligonucleotide complementary to the T3 promoter
(5'-TTTAGTGAGGGTTAAT-3'dA) onto the 3' ends of RNAs isolated
from HeLa cells by immunoprecipitation with anti-fibrillarin (anti-fb)
antibodies (see below) followed by primer extension using a sense T3
primer (5'-ATTAACCCTCACTAAA). cDNAs between 70 and 90 nucleotides in length were gel purified and subjected to PCR using the
T3 primer and oligonucleotide 124 (5'-GTGAACAATCCAACGCTGA) which corresponds to residues 3607 to 3631 of 28S rRNA. The
resulting PCR product(s) was cloned into pGEM-3Z and sequenced.
To obtain a complete sequence for the mouse gas5 gene, PCR
was performed between intron 1 (158, 5'-GACGTAGGATCCTGCTGGATATGTGCAACT) and intron 4 (159, 5'-TCATCGAAGCTTGTTAACGACCACTAGCTC) and between intron 1 (160, 5'-GACGTAGGATCCGTATGCAATTTCCTGAGT) and intron 3 (161, 5'-TCATCGAAGCTTAGCAAATATGATGTCATC) using mouse genomic
DNA (Clontech Laboratories). The PCR products were cloned into
BamHI-HindIII-digested pGEM-3Z. Cloning of
these segments provided complete sequences for U74 and U75 and
confirmed that intron 4 does not contain a consensus box C sequence.
The mouse gas5 promoter was also recloned by PCR from mouse
genomic DNA (Clontech Laboratories) by using primers upstream of the
TATA box (173, 5'-CTTGAGGAGGAGTCTGAG) and complementary to
intron 1 (166, 5'-TCAGTTGTCCCTACCAACATAGCCT). PCR products
were ligated into the pCR2.1 TA vector (Invitrogen). The promoter was
found to differ from the reported gas5 sequence (G instead
of A) at position
2 upstream of the gas5 transcription start site (see Fig. 3b).
Human
gas5 was cloned in multiple steps. First, PCR between
U44 and U81 snoRNA sequences (using primers 151, 5'-GATGATAGCAAATGCTGAC,
and 150, 5'-AGTAATCAGTGAGAGAGTTCAAG)
was performed on HeLa genomic
DNA, and the product was cloned
into the pCR2.1 TA vector (Invitrogen).
Second, primer extension using
a primer complementary to human
exon 11 (184, 5'-TTTCAAGCAGTAAGCTGCATGC) was used to generate
a cDNA from
oligo(dT) (Boehringer Mannheim)-selected RNA from
HeLa cells treated
with 20 µg of cycloheximide/ml for 12 h. The
cDNA was extended
at its 3' end with dATP (200 µM) by using terminal
deoxynucleotidyltransferase (Gibco BRL); PCR was performed using
an
oligo(dT) primer and the 184 oligonucleotide. PCR was then
performed
between exon 2 and U44 using primer 190 (5'-CCTGTGAGGTATGGTGCTGG)
and primer 152 (5'-GTCAGCATTTGCTATCATC). To obtain the
5' and
3' sequences of the human
gas5 gene, cDNAs were
generated with
either primer 184 (and subsequently tailed with dTTP) or
an oligo(dT)
primer, respectively, and PCR was then performed with an
oligo(dA)
primer and primer 184 (for the 5' end) or oligo(dT) primer
and
primer 190 (for the 3' end). (The presence of the 5'TOP sequence
necessitated tailing the cDNA with dT instead of dA since the
oligo(dT)
primer was found to base pair within the 5'TOP cDNA
sequence during the
PCR.) Finally, PCR was performed on HeLa genomic
DNA between exons 1 (200, 5'-GCTTTTTTCGAGGTAGGAGTCG) and 2 (201,
5'-CTGTCCATAAGGTGCTATCC) and exons 11 (202, 5'-GCATGCAGCTTACTGCTTG)
and 12 (199, 5'-CTAGCTTGGGTGAGGCAAGAC) to obtain complete intron
1 (U74) and
intron 11 (U81) sequences,
respectively.
RNA isolation and Northern analysis.
Nuclear RNA for
Northern analysis of snoRNAs was isolated from NIH 3T3 cells which were
washed twice with cold phosphate-buffered saline (PBS) and sonicated
three times with a Branson sonicator on setting 3 for 30 sec in NET-2
buffer containing 400 mM NaCl. Extracts were centrifuged in a Beckman
SS-34 rotor for 10 min at 10,000 rpm. The supernatant was subjected to
immunoprecipitation using anti-fb or anti-Sm antibodies (83)
after removal of aliquots for total RNA samples. RNA was isolated by
treatment with 7 mM Tris (pH 7.5), 0.7 mM EDTA, 20 mM NaCl, 0.7%
sodium dodecyl sulfate and 30 µg of proteinase K (Beckman)/ml for 30 min at 37°C followed by PCA (phenol-chloroform-isoamylalcohol,
50:48:2) extraction (twice) and EtOH precipitation. RNA was
electrophoresed on a 6% polyacrylamide gel (total RNA lanes contained
~1 × 104 cells/lane; anti-fb and anti-Sm RNA lanes
contained ~2 × 105 cells/lane), transferred to a
Zeta-probe (Bio-Rad) membrane, and hybridized using oligonucleotides
complementary to predicted snoRNA sequences (U74,
5'-TCAGTTGTCCCTACCAACATAGCCT; U75,
5'-TCTGTCCACTACTCTCATACCATCA; U76,
5'-TCAAGAGTAGCAAATATGATGTCATC; intron 4, 5'-TCCTCAGATACGCAGAAACAATG and
5'-GACTTCAGATCTCCCACCCACTCCT; U44,
5'-TCAGATAGAGCTAATAAGAT; U78,
5'-TCAGCTCAGACATTTGATCAACATC; U79,
5'-TCTTATTCAGAGAGATTCCCA; U80,
5'-GATACATCAGATAGGAGCGAAAGAC; U47,
5'-TCATTTGGCAGAATCATCTACATC; and U81,
5'-AGTAATCAGTGAGAGAGTTCAAG). Northern blots of HeLa and mouse total RNA and anti-fb RNA were probed by using an oligonucleotide complementary to U77, 5'-AATCTGCTGAACTATGCAACCATCA. All
probes were 5'-end labeled with [
-32P]ATP and T4
polynucleotide kinase (Pharmacia).
Cellular RNA for Northern analyses of spliced
gas5 RNA
was obtained from NIH 3T3 cells washed in PBS and resuspended in a
solution containing 20 mM HEPES (pH 7.9), 4 mM MgCl
2, 500 mM KCl,
0.5% Nonidet P-40, 5 mM dithiothreitol, and 400 U RNasin
(Boehringer
Mannheim). Samples were then centrifuged in a Beckman SS-34
rotor
for 6 min at 12,000 rpm. For cycloheximide, serum starvation,
and
density arrest time courses, total RNA was treated with
proteinase
K and extracted with PCA (as described above) and then
fractionated
on 1% agarose gels containing 2.2 M formaldehyde (17 µg
of RNA/lane
for cycloheximide and serum starvation time courses, 4 µg
of RNA/lane
for pactamycin and rapamycin time courses, and 10 µg of
RNA/lane
for density arrest time course), transferred to a Zeta-probe
membrane
(Bio-Rad), and probed for
gas5 and
UHG
spliced RNAs,
rpS16 and

-actin mRNAs, and U75 snoRNA.
gas5,
UHG, and
rpS16 probes were
made
by Klenow (Promega) filling of annealed oligonucleotides
(mouse
gas5,
5'-CCTTTCGGAGCTGTGCGGCATTCTGAGCAGGAATGGCAGTGTGGACCTCTGTGATGGGACATCTTGTGGGAT
and
5'-GCTTCCTGACGAGTCCTCGTAAGCCTTCATCCTCCTTTGCCACAGAACTGGCTGTGAGATCCCACAAGATGTCC;
mouse
UHG,
5'-TTTCCTTGTTCGGGGTTTGAGGTGCCACCTTACAAAAGGATGGGTGTACGCTCTCTTTTCAG
AATGTGGTTC
and
5'-CGTGTTATTTGTAAAATTGAACAGGCCTGGCTCCAAAGTGTAAAGGGCTTTGAGATGAACCACATTCTGAAA;
and mouse
rpS16,
5'-CGCGGCGCTGCGGTGTGGAGCTCGTGCTTGTGCTCGGAGCTATGCCGTCCAAGGGTCCGCTGCAGTCCGTGCAGGTCTTCGGACGC
AAGAAAACTCTCGCTGTGGCCCACTGCA
and
5'-AGCAAAACAGGCTCCAGTAAGTTGTACTGCAGCGCGCGCGGCTCGATCATCTCCAGGGGACGTCCGTTCACCTTGATGAGCCCATTTCCCCGTTTCCAGTCCGCCA
CAGCGAG)
in 10 µl of 50 mM Tris (pH 7.5) and 10 mM MgCl
2,
0.5
U of Klenow fragment (Promega) and 50 µCi of
[

-
32P]dCTP, and 50 µCi of
[

-
32P]TTP.

-Actin (human), 18S
(
Xenopus), and 28S (
Xenopus) probes
were made by
random priming of
BamHI-
NcoI-digested
pCITE-p

Act
(a generous gift from George Farr),
PstI-
BamHI-digested pxlrDNA
(a generous gift from
Barbara Sollner-Webb), and
BamHI-
EcoRI-digested
pxlrDNA, respectively, using Prim-a-Gene (Promega) and 50 µCi
of [

-
32P]dATP. The data shown in Fig.
5 are
representitive of two independent
experiments and were
quantitated by PhosphorImager analysis. For
all but the density arrest
time course, the levels of U75 are
approximately equivalent, providing
an internal control verifying
that equal amounts of RNA were indeed
loaded in each lane. The
increase in U75 during density arrest is
discussed in the
text.
Mapping the gas5 transcription start site.
NIH
3T3 cells (~20 × 106) were treated with 20 µg of
cycloheximide/ml for 2 h, and cellular RNA was obtained as
described above. Following EtOH precipitation, mRNA was isolated using
oligo(dT) beads (Boehringer Mannheim) and used in primer extension
reactions (89) with a
[
-32P]ATP-5'-end-labeled primer complementary to
gas5 exon 1 (172, 5'-CTGCTCAGAATGCCGCAC). The
dideoxy sequencing ladder was created by using Sequenase (U.S.
Biochemicals) on the plasmid containing the gas5 promoter
(see above).
Cell culture, growth arrest, and inhibition of translation.
Mouse embryo NIH 3T3 cells (American Type Culture Collection) were
maintained at 37°C in monolayer in Dulbecco's modified Eagle medium
supplemented with 10% calf serum (Gibco BRL), 0.4 mM glutamine, and 1 mg of penicillin-streptomycin/ml. Cells were seeded at low density and
split when they were 60 to 80% confluent. For serum starvation
experiments, cells were washed twice with PBS, and media containing
0.5% calf serum and 0.4 mM glutamine (but no penicillin-streptomycin)
were added. For density arrest experiments, cells were grown to
confluency and incubated an additional 12 to 24 h. For inhibition
of translation experiments, cells were treated with 20 µg of
cycloheximide (Sigma)/ml, 280 ng of pactamycin (National Cancer
Institute)/ml, or 20 ng of rapamycin (Sigma)/ml for 0 to 12 h. RNA
was isolated as described above.
Sucrose gradients.
Cell extracts were prepared as described
above for cellular RNA from NIH 3T3 cells which were growing
(~60 × 106 cells), serum starved (~45 × 106 cells) for 12 h, treated with cycloheximide for
12 h (~15 × 106 cells), or incubated at
confluency for 24 h (~15 × 106 cells). Sucrose
gradients were made with 10 and 50% sucrose (Sigma) in a solution
containing 10 mM HEPES (pH 7.4), 5 mM MgCl2, and 500 mM KCl
by using a Biocomp gradient master. Gradients were centrifuged for
10 h at 32,000 rpm in a Beckman SW41 rotor. Gradients were
fractionated by hand (into 15 fractions), and RNA was isolated by
treatment with proteinase K-sodium dodecyl sulfate, PCA extraction, and
EtOH precipitation as described above. Optical density readings (at 260 nm) were made on fractions prior to RNA isolation. Isolated RNA was
then electrophoresed on a 1% formaldehyde-agarose gel, as described
above, for 6 h at 120 W, transferred to Zeta-blot (Bio-Rad), and
probed for gas5 and UHG spliced RNAs,
rpS16 and
-actin mRNAs, and 18S and 28S rRNAs, as
described above.
Nucleotide sequence accession numbers.
Sequences of
the mouse gas5 snoRNAs have been deposited in GenBank
(accession no. AJ224029 to AJ224035).
 |
RESULTS |
gas5 encodes 10 box C/D snoRNAs.
During an
analysis of antisense snoRNAs predicted to direct 2'-O-methylation of
rRNA, we obtained the partial sequence of a novel human box C/D snoRNA
(U80) with complementarity to nucleotides 1610 to 1624 of 28S rRNA. A
GenBank database search produced a 92% match of this sequence to a
region within the ninth intron of the murine gas5 gene
(16, 74). Inspection of the two database entries for murine
gas5 (exons 1 to 3, GenBank accession no. X67267; exons 4 to
12, GenBank accession no. X67268) revealed that six additional introns
contained box C, D', and D sequences along with regions of
complementarity to 18S or 28S rRNAs, indicating that gas5
could be a multi-snoRNA host gene similar to UHG.
To characterize the
gas5 gene in its entirety, a region
extending from the promoter to the fourth intron was cloned from mouse
genomic DNA and sequenced; two more snoRNA sequences, located
within
the first and third introns, then became apparent. The
primary
structure of the mouse
gas5 gene depicting the positions
of
the nine intron-encoded snoRNAs

named U74, U75, U76, U44, U78,
U79,
U80, U47, and U81

is presented in Fig.
1a. Transcription
followed by alternative
splicing (of the seventh exon) and polyadenylation
produced two
transcripts containing either 11 or 12 exons (
16).
The fifth
and tenth introns of murine
gas5 had been previously
reported to contain snoRNA sequences homologous to human U44 and
U47,
respectively (
39). The fourth intron of the mouse
gas5 gene contains four box D sequences, but no consensus
box C sequence.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
gas5 is a multi-snoRNA host gene. (a) Black
boxes represent the 12 exons of mouse gas5; cross-hatched
boxes represent the snoRNA sequences present within nine of its
introns. Numbers above and below the gene are the lengths of exons and
introns, respectively. The alternative splicing event that results in
the inclusion of the seventh exon is indicated. (b) Northern analyses
were performed on mouse total RNA (T) and RNA isolated by
immunoprecipitation with anti-fb ( fb) antibodies by using probes
derived from intronic sequences of gas5. (The same blot was
probed for U75 and U79, indicating that the less-efficient
immunoprecipitation of U75 is not due to underloading of the lane.)
Each intron except the fourth and seventh produces a stable RNA species
between 60 and 90 nucleotides long. The nine mouse gas5
anti-fb immunoprecipitable RNAs are named U74, U75, U76, U44, U78, U79,
U80, U47, and U81. The human gas5 gene encodes, in addition
to the nine murine snoRNAs, a tenth snoRNA (U77) within intron 4 (data
not shown). The sizes of the human exons, in order, are 30, 53, 36, 40, 30, 38, 77 or 38 (alternatively spliced), 54, 30, 23, 48, and 210 nucleotides and introns are 916, 194, 191, 321, 281, 307, 188, 523, 167, 179, and 205 nucleotides.
|
|
Genomic and cDNA clones of the human
gas5 homologue were
obtained by PCR (see Materials and Methods). The genomic organization
of human
gas5 is very similar to that of the mouse gene:
both
contain 11 introns and encode the same nine snoRNAs in
corresponding
introns; however, an additional snoRNA (named U77) is
encoded
within the fourth intron of the human gene. In addition, each
gene possesses a small intron (123 nucleotides in mouse and 167
nucleotides in human) which does not contain a snoRNA-like sequence;
in
human
gas5, the snoRNA-less intron is the ninth intron,
while
in the mouse gene it is the seventh. By sequencing two human
gas5 cDNAs, we found that, like mouse
gas5, the
human homologue is
alternatively spliced. For both genes, the
alternative splicing
events involve the seventh exon: in the mouse gene
there is an
alternative 3' splice acceptor, which serves to include the
seventh
exon, whereas in the human homologue, an alternative 5' splice
donor is located within the seventh exon (see Fig.
4a).
To demonstrate that stable RNA species are produced from the
gas5 introns, Northern analyses were performed.
Oligonucleotides
complementary to the nine predicted murine
snoRNAs were used to
probe total RNA and RNA isolated by
immunoprecipitation with anti-fb
(Fig.
1b) or anti-Sm antibodies (data
not shown) from NIH 3T3
cells. As expected, each intron generates a
detectable anti-fb
immunoprecipitable RNA species. While no stable RNA
is generated
from the fourth intron of mouse
gas5, Northern
analysis of HeLa
cell RNA confirms that U77 is produced from the fourth
intron
of the human gene (data not shown). The 10 RNAs range in length
from 60 to 85 nucleotides and appear to be of an abundance
(~10
4 copies/cell) similar to that of other antisense
snoRNAs (see
reference
51).
The sequences of human and mouse
gas5 snoRNAs are compared
in Fig.
2. Each snoRNA possesses boxes C,
D', and D along with
extensive complementarity (ranging from 10 to 16 bp) to highly
conserved regions of either 18S or 28S rRNA. For 8 of the
10 snoRNAs,
reported sites of rRNA ribose methylation (
47)
reside within
these regions of complementarity; we predict that
C
3810, G
1597,
and A
397 (targeted by
U74, U80, and U81, respectively) in 28S
rRNA are methylated residues
not yet reported. The snoRNA encoded
within the ninth intron of
gas5, U80, is unusual in that it exhibits
two regions of
complementarity and therefore has the potential
to target two sites in
28S (A
1522 and G
1597) for methylation;
interestingly, the human U77 snoRNA targets the same residue
(A
1522)
for methylation as the upstream site in both human
and mouse U80
(Fig.
2). Similar to the other members of this
class of snoRNAs,
in each known case the methylated rRNA residue
is located opposite
the snoRNA residue precisely five nucleotides
upstream of box
D or D'. Since U24 and U25 snoRNAs were previously
demonstrated
to be required to site-specifically target rRNA for
2'-O-methylation
(
39,
87), the
gas5 snoRNAs are
strongly implicated in the
2'-O-methylation of pre-rRNA.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
Sequences of gas5 intron-encoded snoRNAs.
Human sequences above are aligned with mouse homologues below; and
* designate identities and deletions, respectively. Boxes C, D', and
D are outlined. Regions of complementarity to rRNA are presented above
the snoRNAs, with the rRNA residues targeted for methylation indicated
(47). Closed and open circles indicate reported and
predicted sites of rRNA methylation, respectively. The arrows denote
terminal base pairing potential.
|
|
gas5 contains a 5'TOP sequence.
To precisely map
the transcription start site of the gas5 gene, we performed
primer extension analysis on oligo(dT)-selected mRNA from NIH 3T3 cells
by using a probe to the first exon of mouse gas5. Figure
3a shows that the major transcription
start site is located at two adjacent cytidine residues within the
sequence TCTCGGCCTTTC; a small fraction of
transcripts commences at the guanosine residue preceding the two
cytidine residues. The transcription start site(s) is located 29 and 30 nucleotides downstream of the TATA box and 32 and 33 nucleotides
upstream of a strong (according to reference 40)
translation start site, as shown in Fig. 3b. The first intron is
located two nucleotides upstream of this AUG codon. Two human
gas5 cDNAs were analyzed by 5' rapid amplification of cDNA
ends and show that the 5' ends of the human and mouse transcripts are
almost identical (CUUUUCG versus CCUUUCG,
respectively). The human spliced gas5 RNA also
exhibits a short (33 nucleotides) putative 5' untranslated region
(5'UTR).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
gas5 is member of the 5'TOP gene family. (a)
Extension of a deoxyoligonucleotide primer complementary to mouse
gas5 (lane 5) was performed using mRNA isolated from NIH 3T3
cells treated with cycloheximide. The products were run adjacent to a
sequencing ladder of DNA containing the mouse gas5 exon 1 and promoter (lanes 1 to 4). (b) The transcription start site maps to
two adjacent cytidine residues located 29 and 30 nucleotides downstream
of a TATA box and 32 and 33 nucleotides upstream of a consensus
translation start site. The TATA element, transcription start sites,
and translation start site are boxed; the position of the first intron
of the mouse gas5 gene is indicated.
|
|
Recently, a number of genes, including all of those encoding vertebrate
ribosomal proteins, were classified as members of
the 5'TOP family (for
reviews see references
2 and
52).
The
salient features of this gene class are (i) a tract of 4 to 13
pyrimidines, occasionally interrupted by one or two guanosine
residues,
surrounding a cytidine transcription start site, and
(ii) a short 5'UTR
where a translation initiation site conforming
to the consensus
(
40) is located at the first AUG of the message.
Since the
gas5 transcript in both human and mouse contains a
seven-nucleotide
5' oligopyrimidine tract, a consensus translation
start site,
and a short 5'UTR, its sequence suggests that it is a
member of
the 5'TOP gene
family.
gas5 appears to be non-protein coding.
Although
indirect, the most compelling evidence that UHG does not
specify a protein product is that the exons are not conserved between
its human and mouse homologues (84). To compare human and
mouse gas5 genes, three sequence categories were analyzed: (i) exons, (ii) intron regions in which no snoRNA sequences are located, and (iii) snoRNA-containing sequences. The percentage of
identity of each pair of corresponding regions (e.g., human exon 1 with
mouse exon 1) is presented in Fig. 4a.
Most highly conserved are the first seven nucleotides at the 5' end of
the gas5 transcript (86% identical) and the snoRNA
sequences (72 to 93% identical), whereas the average identity between
exons and intron regions not encoding snoRNAs is only 49 and 46%,
respectively. Interestingly, the second most highly conserved region of
gas5 encompasses a site of alternative splicing: the seventh
exon and preceding intron are 68% identical (Fig. 4a). Similar to
gas5, the 5' end (first 10 nucleotides) of UHG is
conserved in mouse and human (84). Together, these
observations suggest that the only functional regions of
gas5 and UHG are their 5'TOP sequences and
intron-encoded snoRNAs.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
gas5 appears to be non-protein coding. (a)
Comparison of human and mouse gas5 genes with the Genetics
Computer Group software (20) GAP program shows that the only
conserved portions are the 5'TOP tract and the intron-encoded snoRNA
sequences. Indicated above are the percentages of identity between
respective exon (shaded boxes) and snoRNA (filled boxes) sequences;
below are the percentages of identity for the portions of intron
external to snoRNA sequences (open boxes). The mouse and human
gas5 5'TOP sequences (cross-hatched boxes) are 86%
identical over seven nucleotides. The dotted line denotes regions in
which corresponding introns are not the same length. (b) ORFs of mouse
and human spliced gas5 RNAs. Short and long vertical bars
represent start and stop codons, respectively, in all three frames. The
cross-hatched boxes denote the most likely reading frames. The length
in nucleotides of the spliced RNAs is indicated below each diagram.
|
|
While in vitro translation of a
gas5 transcript yielded an
8-kDa polypeptide (
16), attempts to identify an in vivo
protein
product of the mouse
gas5 gene have been
unsuccessful (
64a).
Presented in Fig.
4b is an analysis of
the protein coding potential
for mouse and human spliced
gas5 RNAs. A strong translation start
context
(
40)

GNN
AUGG preceded by a stop
codon

surrounds the
first AUG codons in both transcripts. Because of
the multitude
of stop codons, peptides of only 23 amino acids (mouse)
or 50
amino acids (human) could be produced from these AUG codons. In
the human
gas5 transcript, the first ORF is the longest,
whereas
in the mouse RNA, the longest ORF (39 amino acids) would start
at the third AUG codon, which is predicted to be only an adequate
translation start site. While the peptides resulting from the
first
ORFs of the human and mouse transcripts are only 26% homologous,
an
analysis of a partial rat
gas5 clone (
64b)
reveals that it
could produce a 23-amino acid peptide that is 74%
identical to
the predicted mouse
peptide.
Translation inhibition and growth arrest result in accumulation of
spliced gas5 RNA.
Despite the unlikelihood that
gas5 produces a functional protein product, its spliced RNA
is polyadenylated and associated with ribosomes (16). Thus,
we suspected that the almost undetectable levels previously reported
for the gas5 transcript (15, 16) could be a
result of its degradation via a pathway linked to translation, as
appears to be the case for UHG (84). Northern
analysis was performed on RNA isolated from NIH 3T3 cells treated for
up to 12 h with the translation elongation or initiation
inhibitors cycloheximide or pactamycin. The results, presented in Fig.
5a, indicate that the low level of
gas5 RNA increases dramatically in cells in which
translation has been arrested for 12 h (12-fold with
cycloheximide, compare lanes 1 and 5; 18-fold with pactamycin, compare
lanes 6 and 10). UHG behaves similarly under these
conditions (Fig. 5a) (84). In addition, a sevenfold increase
in the level of the gas5 spliced RNA was observed when cells
were treated with the 5'TOP-specific translation inhibitor rapamycin
(compare lanes 11 and 15); in contrast, UHG did not
accumulate under these conditions. For each experiment, the levels of
-actin and rpS16 mRNAs, which were examined as controls,
did not change dramatically. Since U75 (a snoRNA encoded within
gas5; Fig. 5) and U22 (a snoRNA encoded within
UHG; data not shown) are abundant, gas5 and
UHG are indeed transcribed, but their spliced products are
rapidly degraded in a translation-dependent manner.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
Accumulation of spliced gas5 RNA in (a)
translation-inhibited or (b) growth-arrested cells. Northern analysis,
using probes for gas5 and UHG spliced transcripts
as well as U75 snoRNA, -actin, and rpS16 mRNAs, was
performed on total RNA isolated from NIH 3T3 cells treated with 20 µg
of cycloheximide/ml (lanes 1 to 5), 280 ng of pactamycin/ml (lanes 6 to
10) or 20 ng of rapamycin/ml (lanes 11 to 15) for 0 (untreated), 1, 2, 5, and 12 h (a) or growth arrested by either contact inhibition
(lanes 1 to 5) or serum starvation (lanes 6 to 10) for 0 (growing), 12, 24, 36, and 48 h (b). For each timecourse, equal amounts of RNA
were loaded in the lanes (the internal controls show that lane 8 in
panel a was underloaded). The progressive increase in mobility of the
gas5 and UHG transcripts upon cycloheximide and
pactamycin treatment may reflect poly(A) tail shortening.
|
|
Increased levels of spliced
gas5 RNA have been shown to
result from posttranscriptional regulation in growth-arrested cells
(
15,
16). We performed Northern analyses to assess the
gas5 levels in NIH 3T3 cells growth arrested by contact
inhibition
compared to levels after serum starvation (Fig.
5b, lanes 1 to
5 versus lanes 6 to 10, respectively). As expected, both conditions
generate increased levels of spliced
gas5 RNA while levels
of

-actin and
rpS16 mRNAs remain constant or decrease.
However,
the effects of density arrest and serum starvation are not
identical:
in density-arrested cells, the level of spliced
gas5 RNA increases
5.4-fold and the level of U75 increases
3.0-fold (average of two
experiments; compare lanes 1 and 5); when
cells are cultured in
media containing low levels of serum, the level
of spliced
gas5 RNA increases 2.5-fold while the level of
U75 remains constant
(average of two experiments; compare lanes 6 and
10). Under both
conditions, the observed increases in spliced
gas5 RNA relative
to U75 are consistent with previous
reports that the
gas5 message
is regulated
posttranscriptionally (
15,
16). In contrast to
gas5, the level of the
UHG message is not
increased by either
serum starvation or density arrest (Fig.
5b);
however, as with
U75, the level of U22 (encoded in
UHG)
increases in density-arrested
cells (data not
shown).
gas5 spliced RNA shifts into mRNP particles during
growth arrest.
Messenger RNAs belonging to the 5'TOP gene family
have been shown to shift from polysomes into submonosomal (or messenger ribonucleoprotein [mRNP]) particles during periods of growth arrest in a process which is reversed when cell growth resumes (reviewed in
references 2 and 52). The
classification of gas5 as a 5'TOP gene prompted us to ask
whether its apparent upregulation in growth-arrested cells is
correlated with a shift of its spliced RNA into stable submonosomal
particles, where it does not undergo translation and degradation. Using
density gradient centrifugation, we compared the distribution of
gas5 RNA in extracts from growing NIH 3T3 cells with that of
either serum-starved cells or cells whose growth was arrested at
confluency. We also examined the gas5 transcript in cells
that were growing but in which translation had been halted by
cycloheximide treatment. Northern blots of RNA isolated from each
gradient fraction were probed for spliced gas5 RNA and for
rpS16 and
-actin mRNAs (Fig.
6a); 18S and 28S rRNAs were also analyzed
(data not shown) to monitor the migration of 40S and 60S ribosomal
subunits, as well as the monosome-polysome region. Quantitated data for
the spliced gas5 RNA are shown in Fig. 6b.

View larger version (54K):
[in this window]
[in a new window]

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Spliced gas5 RNA shifts away from ribosomes
during growth arrest. (a) Northern blots of RNA from 10 to 50% sucrose
gradient fractions of extracts from NIH 3T3 cells density arrested,
serum starved, growing, or treated with cycloheximide. The
distributions of spliced gas5 RNA and rpS16 and
-actin mRNAs, along with 18S and 28S rRNAs (data not shown), were
analyzed. The top, bottom, and fraction numbers for each gradient are
indicated. The dark smear in fractions 9 to 12 of the -actin profile
during serum starvation is an artifact introduced during the blotting
procedure; note that this profile otherwise mimics the -actin
profile during cycloheximide treatment. (b) Quantitation of Northern
signals (by PhosphorImaging) of spliced gas5 RNA from
density-arrested cells, serum-starved cells, growing cells, and cells
treated with cycloheximide. The positions of ribosomal small subunits
(40S) and large subunits (60S) were determined from the profiles of 18S
and 28S rRNAs. For each fraction, the percentage of gas5 was
determined with respect to the total amount of gas5 RNA in
the gradient. The dotted line indicates that the normalized level of
gas5 RNA in growing cells cannot be compared directly to
that in density-arrested and cycloheximide-treated cells, since a
portion of the spliced gas5 RNA (presumably that associated
with ribosomes) has been degraded.
|
|
As expected for a 5'TOP transcript, over 90% of the spliced
gas5 RNA is located in submonosomal fractions (3 through 7)
when
cell growth is halted by either density arrest or serum starvation
(Fig.
6a and b). Even though the rate of transcription of the
gas5 gene may be augmented during density arrest (Fig.
5b),
the
fraction of
gas5 spliced RNA present in the submonosomal
fractions
is comparable to that observed during serum starvation. In
growing
cells, the spliced
gas5 RNA is located mostly in
submonosomal
fractions (4 through 7) but is also present in fraction
10, which
corresponds to 80S (monosomes) (Fig.
6a and b). In contrast,
when
elongation is inhibited by cycloheximide, 30% of the spliced
gas5 RNA is trapped at approximately 80S, as expected for a
message
that contains only short ORFs. The
rpS16 mRNA
behaves comparably
to
gas5 RNA (Fig.
6a): in
density-arrested or serum-starved cells,
rpS16 mRNA is found
predominantly in the submonosomal region and
is absent from polysomes,
whereas in growing cells it is distributed
between the submonosomal and
polysomal fractions (fractions 12
to 15). The non-5'TOP

-actin mRNA
remains associated with heavy
polysomes in growing and growth-arrested
cells (Fig.
6a).
Previous analyses of 5'TOP mRNAs employed gradient conditions that
optimally discriminate between polysomes and submonosomal
particles
(
1,
25,
33,
44,
53,
65). For spliced
gas5 RNA,
which is likely to accommodate only a single ribosome due
to its
numerous stop codons, it was necessary to devise conditions
that could
distinguish between monosomes and submonosomal particles.
By using 10 to 50% sucrose gradients and extended centrifugation
times, we
separated the submonosomal region into two distinct
peaks. During
density-arrested growth, increased levels of both
spliced
gas5 RNA and
rpS16 mRNA are found predominantly
in fractions
that comigrate with 40S subunits (fraction 7), while
levels in
lighter mRNP particles (fraction 4) are less affected.
Similar
observations were made when the distribution of rp mRNAs from
differentiated mouse myoblasts or rabbit reticulocyte lysate were
analyzed by high-resolution sucrose gradients (
27).
 |
DISCUSSION |
gas5 is a non-protein-coding multi-snoRNA host
gene.
We have identified gas5 as the second member of
the UHG class of snoRNA host genes. Ten box C/D snoRNAs
(designated U74, U75, U76, U77 [human only], U44, U78, U79, U80, U47,
and U81 [Fig. 1 and 2]) are encoded within the 11 introns of the
gas5 gene; 8 of the 10 are novel species (U74 to U81). Each
snoRNA exhibits extensive complementarity to 18S or 28S rRNA and is
predicted to function in 2'-O-methylation of pre-rRNA (13, 39,
87). Alignment of the human and mouse gas5
intron-encoded snoRNAs reveals little variation within the regions
exhibiting complementarity to rRNA and the box C, D', and D sequences
(Fig. 2), consistent with evidence suggesting that these are
functionally relevant portions of the snoRNAs (13, 39).
Considering the overall similarity between human and mouse
gas5 genes, it was surprising to find that U77 is encoded
within the fourth intron of human gas5 yet is not present in
the mouse gene. In human cells, both U77 and U80 appear to be capable
of targeting the same residue in 28S rRNA (A1552) for
methylation; it is not known, however, whether they participate equally
in this process. Since the two residues targeted by U80
(A1552 and G1597) are adjacent in the secondary
structure of 28S rRNA (47), it seems that U80 could simultaneously guide methylation of these sites. If this is the case,
it is unclear why a redundant mechanism to modify A1552 would be present in humans while absent in mice. (Northern analysis of
RNA from NIH 3T3 cells [data not shown] indicates that a U77 homolog
is not present in mouse.)
Similar to
UHG, sequence comparison of human and mouse
gas5 genes indicates that the only regions of conservation
are their
snoRNAs and 5' end (Fig.
4a); in addition, the presence of
only
short ORFs and numerous stop codons suggests that
gas5
does not
generate a protein product (Fig.
4b). Since both the
gas5 exons
and non-snoRNA-containing intron segments range
from 35 to 68%
identity, these regions of the gene appear to have
diverged at
equivalent rates. (A similar range of identity is found for
corresponding
introns of mouse and human

-globin and rat and human

-actin
genes.) To address whether the secondary structures of the
gas5 and
UHG spliced transcripts share any common
structural features,
these RNA sequences were analyzed by MulfFold
(
31); however,
no conserved folds were
found.
Recently, two additional non-protein-coding snoRNA host genes, called
U17HG and
U19HG, have been characterized
(references
64 and
7,
respectively). Similar to
gas5 and
UHG, the exon
portions of
U17HG are not conserved between human and mouse
(
64).
The
U17HG and
U19HG spliced RNAs
are polyadenylated and contain
numerous stop codons; however, they do
not appear to associate
with polysomes (
7,
64). Why do the
spliced
gas5 and
UHG RNAs
associate with
ribosomes if they do not produce functional protein
products?
Previously, increased levels of
UHG spliced RNA were
observed after treatment of HeLa cells with translation inhibitors
(
84). The same response has been observed here for
gas5 by using
the translation inhibitors cycloheximide,
pactamycin, and rapamycin
(Fig.
5a). The presence of numerous stop
codons in both spliced
RNAs (Fig.
4) (
84) suggests that
nonsense-mediated decay

a process
known to require active translation
(
49)

may be utilized by
the cell to dispose of the exon
portions of these transcripts.
The fate of the nonconserved (and likely
nonfunctional) peptide
products which could be generated from the short
ORFs of
gas5 and
UHG is not
known.
gas5 is a member of the 5'TOP gene family.
The
members of the 5'TOP gene family include all ribosomal proteins, as
well as protein synthesis elongation factors and a number of genes
without apparent ribosome-related functions (e.g., ATP synthase C
subunit, nucleoside diphosphate kinase, and hnRNPA1) (see
references 2, 11, and 52).
Although the number of genes in this family is small, together the
5'TOP mRNAs can comprise >15% of the total mRNA in the cell. 5'TOP
genes are classified according to their unusual pyrimidine-rich
5'-terminal sequence and also by whether their mRNAs accumulate in mRNP
particles during arrested cell growth. Mapping the 5' end of the
gas5 transcript demonstrates that it commences at a cytidine
residue followed by five pyrimidines (Fig. 3). Since gas5
contains sequence characteristics of the 5'TOP gene family, we
investigated whether it is present in mRNP particles when cells are
serum starved or arrested at confluency. Indeed, when the distribution
of the spliced gas5 mRNA was analyzed by sucrose gradient
centrifugation, it was found to accumulate in submonosomal fractions
during growth arrest (Fig. 6).
That
gas5 is a member of the 5'TOP gene class explains the
previously reported posttranscriptional accumulation of its spliced
RNA
in growth-arrested cells. In growing cells, active translation
leads to
rapid degradation of the spliced
gas5 RNA, whereas
inhibition
of translation causes the level of
gas5
transcript to rise. Likewise
in growth-arrested cells, the spliced
gas5 RNA accumulates, apparently
because it is sequestered
in mRNP particles and is not translated.
Presented in Fig.
7 is a model which summarizes our
findings.
The observation of a growth-arrested submonosomal peak at 40S
for both
rpS16 and
gas5 transcripts (Fig.
6)
might indicate that
these mRNPs can associate with the small ribosomal
subunit but
not engage the 60S to form active ribosomes. It is
important to
note that a principal difference between the regulation of
spliced
gas5 RNA and the protein-coding 5'TOP mRNAs is that
translation
of the latter does not result in rapid degradation.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 7.
Why is a non-protein-coding snoRNA host gene a
growth-arrest-specific transcript? In growing cells, spliced
gas5 RNA is translated and consequently degraded. When
translation is inhibited, the levels of gas5 increase.
Likewise, when cell growth is arrested, gas5 RNA shifts from
monosomes into submonosomal particles, where it is sequestered from
active ribosomes and therefore accumulates.
|
|
An additional characteristic of 5'TOP mRNAs is that their translation
is specifically inhibited by the immunosuppressant rapamycin
(
32). Rapamycin has been shown to inhibit phosphorylation
p70
S6k, which in turn prevents phosphorylation of S6,
possibly resulting
in decreased affinity of 5'TOP mRNAs for the
translation machinery
(see reference
52). As
expected, treatment of NIH 3T3 cells
with rapamycin results in an
increase in the level of
gas5 spliced
RNA, presumably
because it not translated and degraded (Fig.
5a).
Thus, it appears that
degradation of the
gas5 spliced RNA may
be regulated through
the p70
S6k signal transduction cascade. According to our
model, spliced
gas5 RNA is expected to accumulate in
nondividing cells. Indeed,
an analysis of adult mouse tissues
demonstrated that the
gas5 transcript is present at high
levels in brain, where the majority
of cells are not dividing, and is
present at low levels in liver,
where cells are continuously dividing
(
16). An intriguing question
is whether regulation of the
spliced
gas5 RNA through the p70
S6k signalling
pathway and its accumulation in certain tissues plays
some unknown
cellular role or whether the
gas5 gene merely serves
as a
vehicle for the production of its intron-encoded
snoRNAs.
In contrast to
gas5,
UHG does not accumulate in
density-arrested or serum-starved cells and it is not sensitive to
rapamycin
(Fig.
5a and b). A number of studies have demonstrated that
the
5'TOP sequences, along with adjacent downstream regions, are
required
to shift transcripts into submonosomal particles (
3,
27,
42,
50). Since insertion of a single adenosine residue into
a 5'
oligopyrimidine tract abrogates this shift (
3,
42),
the
UHG transcript may not accumulate during growth arrest
because
its 5'-end sequence contains an adenosine residue at position
+4. However, with exception of this adenosine,
UHG contains
an
oligopyrimidine tract which is conserved between human and mouse.
Interestingly, we observe modest increases in the levels of both
U75
(encoded within
gas5; Fig.
5b) and U22 (encoded within
UHG;
data not shown) when cells are density arrested,
suggesting that
these genes may be transcribed in a similar
growth-dependent manner.
However, we cannot exclude the unlikely
possibility that snoRNAs
are stabilized under these
conditions.
snoRNA host genes possess characteristics of the 5'TOP gene
family.
Strikingly, inspection of known snoRNA host genes reveals
that they all exhibit characteristics of the 5'TOP gene class.
Presented in Table 1 are transcription
start sequences of host genes along with their corresponding
snoRNAs. In contrast to the non-protein-coding host genes
(gas5, UHG, U17HG, and
U19HG), most host genes generate protein products in
addition to their snoRNAs. Many snoRNAs are encoded within
introns of ribosomal protein genes while others are found within
introns of genes specifying translation factors or nucleolar proteins.
The heat shock cognate 70 protein has been reported to localize to the
nucleolus during heat shock (76), and the laminin binding
protein/p40 has been reported to associate with ribosomes (70,
71). A ribosome-related function is not, however, obvious for the
protein products of the ATP synthase
(56) and
Q1Z7F5 genes (88). Despite their variety of
functions, all snoRNA host genes possess at least some of the
distinctive characteristics of 5'TOP genes: a 5' oligopyrimidine tract,
a cytidine transcription start site, and a short 5'UTR. The
hsc70 transcript does not contain a strong oligopyrimidine
tract
yet begins at a cytidine residue
and the eukaryotic initiation
factors and ATP synthase
messages are reported to start with
guanosine and adenosine residues, respectively (56, 60, 69),
but these are located within oligopyrimidine sequences (Table 1).
Two observations suggest that the 5'TOP sequences of snoRNA host genes
play a role in addition to that in translational regulation.
First,
while all snoRNA host genes contain characteristics of
the 5'TOP gene
family (Table
1), they are not all translationally
regulated in a 5'TOP
growth-dependent manner. For example, eIF4A
I and
eIF4A
II have been shown not to shift into mRNPs during
growth
arrest (
28). Second,
UHG possesses an
absolutely conserved pyrimidine-rich
5'-end sequence but does not
appear to be translationally regulated
in the way
gas5 is
regulated. Since all snoRNA host transcripts
release their snoRNAs in
the nucleus, we suspect that a second
role of 5'TOP sequences likely
involves some nuclear process.
One possibility is that 5'
oligopyrimidine tracts participate
in the regulation of transcription
of snoRNA-containing genes,
balancing the synthesis of
translation-associated components with
the machinery that generates the
ribosome. Alternatively, the
pyrimidine-rich transcription start sites
of snoRNA host genes
could function by altering the composition of
transcription initiation
complexes to include factors that later assist
in the splicing
and release of snoRNAs. Examples of such communication
between
the transcription and mRNA processing machineries have been
reported
recently: splicing factors have been found to interact with
the
C-terminal domain of RNA polymerase II (reviewed in references
18 and
79) and the
polyadenylation factor CPSF has been identified
as a component of the
TFIID transcription initiation complex (
19).
Our finding
that all known snoRNA host genes contain 5'TOP sequences
represents an
additional step toward understanding the growth-dependent
regulation of
the protein synthesis machinery in vertebrate
cells.
 |
ACKNOWLEDGMENTS |
We are grateful to Mei-Di Shu, Jahan Moslehi, and Zoe Bellows for
their technical assistance and Timothy McConnell, Leo Otake, and Kazio
Tycowski for their comments on the manuscript. We also thank Lennart
Philipson, Tamas Kiss, and Witold Filipowicz (with Pawel Pelczar) for
sharing unpublished data and Kazio Tycowski for his many helpful insights.
This work was supported by NIH grant GM-26154.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Yale University, 295 Congress Ave., New Haven, CT 06536. Phone: (203)
737-4417. Fax: (203) 624-8213. E-mail: joan.steitz{at}yale.edu.
Present address: Fred Hutchinson Cancer Research Center, Seattle, Wash.
 |
REFERENCES |
| 1.
|
Agrawal, M. G., and L. H. Bowman.
1987.
Transcriptional and translational regulation of ribosomal protein formation during mouse myoblast differentiation.
J. Biol. Chem.
262:4868-4875[Abstract/Free Full Text].
|
| 2.
|
Amaldi, F., and P. Pierandrei-Amaldi.
1997.
TOP genes: a translationaly controlled class of genes including those coding for ribosomal proteins, p. 1-17.
In
P. Jeanteur (ed.), Progress in molecular and subcellular biology, vol. 18. Springer-Verlag, Berlin, Germany.
|
| 3.
|
Avni, D.,
S. Shama,
F. Loreni, and O. Meyuhas.
1994.
Vertebrate mRNAs with a 5'-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element.
Mol. Cell. Biol.
14:3822-3833[Abstract/Free Full Text].
|
| 4.
|
Balakin, A. G.,
L. Smith, and M. J. Fournier.
1996.
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Cell
86:823-834[Medline].
|
| 5.
|
Bally, M.,
J. Hughes, and G. Cesareni.
1988.
SnR30: a new, essential small nuclear RNA from Saccharomyces cerevisiae.
Nucleic Acids Res.
16:5291-5303[Abstract/Free Full Text].
|
| 6.
|
Beltrame, M., and D. Tollervey.
1995.
Base pairing between U3 and the pre-ribosomal RNA is required for 18S rRNA synthesis.
EMBO J.
14:4350-4356[Medline].
|
| 7.
|
Bortolin, M. L., and T. Kiss.
1998.
Human U19 intron-encoded snoRNA is processed from a long primary transcript that possesses little potential for protein coding.
RNA
4:445-454[Abstract].
|
| 8.
|
Bousquet-Antonelli, C.,
Y. Henry,
J.-P. Gelunge,
M. Caizergues-Ferrer, and T. Kiss.
1997.
A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs.
EMBO J.
16:4769-4775.
|
| 9.
|
Caffarelli, E.,
M. Arese,
B. Santoro,
P. Fragapane, and I. Bozzoni.
1994.
In vitro study of processing of the intron-encoded U16 small nucleolar RNA in Xenopus laevis.
Mol. Cell. Biol.
14:2966-2974[Abstract/Free Full Text].
|
| 10.
|
Caffarelli, E.,
A. Fatica,
S. Prislei,
E. DeGregorio,
P. Frangepane, and I. Bozzoni.
1996.
Processing of the intron-encoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing reaction and the stability of the mature snoRNA.
EMBO J.
15:1121-1131[Medline].
|
| 11.
|
Camacho-Vanegas, O.,
F. Weighardt,
C. Ghigna,
F. Amaldi,
S. Riva, and G. Biamonti.
1997.
Growth-dependent and growth-independent translation of messengers for heterogeneous nuclear ribonucleoproteins.
Nucleic Acids Res.
25:3950-3954[Abstract/Free Full Text].
|
| 12.
|
Cavaille, J., and J.-P. Bachellerie.
1996.
Processing of fibrillarin-associated snoRNAs from pre-mRNA introns: an exonucleolytic process exclusively directed by the common stem-box terminal structure.
Biochimie
78:443-456[Medline].
|
| 13.
|
Cavaille, J.,
M. Nicoloso, and J.-P. Bachellerie.
1996.
Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides.
Nature
383:732-735[Medline].
|
| 14.
|
Chu, S.,
R. H. Archer,
J. M. Zengel, and L. Lindahl.
1994.
The RNA of RNase MRP is required for normal processing of the ribosomal RNA.
Proc. Natl. Acad. Sci. USA
91:659-663[Abstract/Free Full Text].
|
| 15.
|
Ciccarelli, C.,
L. Philipson, and V. Sorrentino.
1990.
Regulation of expression of growth arrest-specific genes in mouse fibroblasts.
Mol. Cell. Biol.
10:1525-1529[Abstract/Free Full Text].
|
| 16.
|
Coccia, E. M.,
C. Cicala,
C. Charlesworth,
C. Ciccarelli,
G. B. Rossi,
L. Philipson, and V. Sorrentino.
1992.
Regulation and expression of a growth arrest-specific gene (gas5) during growth, differentiation, and development.
Mol. Cell. Biol.
12:3514-3521[Abstract/Free Full Text].
|
| 17.
|
Colombo, P.,
J. Yon, and M. Fried.
1991.
The organization and expression of the human L7a ribosomal protein gene.
Biochim. Biophys. Acta
1129:93-95[Medline].
|
| 18.
|
Corden, J. L., and M. Patturajan.
1997.
A CTD function linking transcription to splicing.
Trends Biochem. Sci.
22:413-416[Medline].
|
| 19.
|
Dantonel, J.-C.,
K. G. K. Murthy,
J. L. Manley, and L. Tora.
1997.
Transcription factor TFIID recruits factor CPSF for formation of 3' end of mRNA.
Nature
389:399-402[Medline].
|
| 20.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 21.
|
Dworniczak, B., and M. E. Mirault.
1987.
Structure and expression of a human gene coding for a 71 kd heat shock `cognate' protein.
Nucleic Acids Res.
15:5181-5197[Abstract/Free Full Text].
|
| 22.
|
Eichler, D. C., and N. Craig.
1995.
Processing of eukaryotic ribosomal RNA.
Prog. Nucleic Acid Res. Mol. Biol.
49:197-239.
|
| 23.
|
Ganot, P.,
M.-L. Bortolin, and T. Kiss.
1997.
Site-specific pseudouridine formation in pre-ribosomal RNA is guided by small nucleolar RNAs.
Cell
89:799-809[Medline].
|
| 24.
|
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 25.
|
Geyer, P. K.,
O. Meyuhas,
R. P. Perry, and L. F. Johnson.
1982.
Regulation of ribosomal protein mRNA content and translation in growth-stimulated mouse fibroblasts.
Mol. Cell. Biol.
2:685-693[Abstract/Free Full Text].
|
| 26.
|
Hadjiolov, A. A.
1985.
The nucleolus and ribosome biogenesis.
Springer-Verlag, Vienna, Austria.
|
| 27.
|
Hammond, M. L.,
W. Merrick, and L. H. Bowman.
1991.
Sequences mediating the translation of mouse S16 ribosomal protein mRNA during myoblast differentiation and in vitro and possible control points for the in vitro translation.
Genes Dev.
5:1723-1736[Abstract/Free Full Text].
|
| 28.
|
Huang, S., and J. W. B. Hershey.
1989.
Translational initiation factor expression and ribosomal protein gene expression are repressed coordinately but by different mechanisms in murine lymphosarcoma cells treated with glucocorticoids.
Mol. Cell. Biol.
9:3679-3684[Abstract/Free Full Text].
|
| 29.
|
Hughes, J. M. X., and M. J. Ares.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external spacer of yeast pre-ribosomal RNA and prevents formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 30.
|
Jackers, P.,
F. Minoletti,
D. Belotti,
N. Clausse,
G. Sozzi,
M. E. Sobel, and V. Castronovo.
1996.
Isolation from a multigene family of the active human gene of the metastasis-associated multifunctional protein 37LRP/p40 at chromosome 3p21.3.
Oncogene
13:495-503[Medline].
|
| 31.
|
Jaeger, J. A.,
D. H. Turner, and M. Zuker.
1989.
Predicting optimal and suboptimal secondary structure for RNA.
Methods Enzymol.
183:281-306.
|
| 32.
|
Jeffries, H. B. J.,
S. Fumagalli,
P. B. Dennis,
C. Reinhard,
R. B. Pearson, and G. Thomas.
1997.
Rapamycin suppresses 5'TOP mRNA translation through inhibition of p70S6k.
EMBO J.
12:3693-3704[Medline].
|
| 33.
|
Kaspar, R. L. R.,
M. W. White,
R. E. Rhoads, and D. R. Morris.
1990.
Simultaneous cytoplasmic redistribution of ribosomal protein L32 mRNA and phosphorylation of eukaryotic initiation factor 4E after mitogenic stimulation of Swiss 3T3 cells.
J. Biol. Chem.
265:3619-3622[Abstract/Free Full Text].
|
| 34.
|
Kass, S.,
K. Tyc,
J. A. Steitz, and B. Sollner-Webb.
1990.
The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing.
Cell
60:897-908[Medline].
|
| 35.
|
Kato, S.,
S. Sekine,
S.-W. Oh,
N.-S. Kim,
Y. Umezawa,
N. Abe,
M. Yokoyama-Kobayashi, and T. Aoki.
1994.
Construction of a human full-length cDNA bank.
Gene
150:243-250[Medline].
|
| 36.
|
Kenmochi, N.,
N. Maeda, and T. Tanaka.
1992.
The structure and complete sequence of the gene encoding chicken ribosomal protein L5.
Gene
119:215-219[Medline].
|
| 37.
|
Kiss, T.,
M.-L. Bortolin, and W. Filipowicz.
1996.
Characterization of the intron-encoded U19 RNA, a new mammalian small nucleolar RNA that is not associated with fibrillarin.
Mol. Cell. Biol.
16:1391-1400[Abstract].
|
| 38.
|
Kiss, T., and W. Filipowicz.
1995.
Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns.
Genes Dev.
9:1411-1424[Abstract/Free Full Text].
|
| 39.
|
Kiss-Laszlo, Z.,
Y. Henry,
J.-P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of pre-ribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 40.
|
Kozak, M.
1996.
Interpreting cDNA sequences: some insights from studies on translation.
Mamm. Genome
7:563-574[Medline].
|
| 41.
|
Leader, D. J.,
G. P. Clark,
J. Watters,
A. F. Beven,
P. J. Shaw, and J. W. S. Brown.
1997.
Clusters of multiple different small nucleolar RNA genes in plants are expressed as and processed from polycistronic pre-snoRNAs.
EMBO J.
16:5742-5751[Medline].
|
| 42.
|
Levy, S.,
D. Avni,
N. Hariharan,
R. P. Perry, and O. Meyuhas.
1991.
Oligopyrimidine tract at the 5' end of mammalian ribosomal protein mRNAs is required for their translational control.
Proc. Natl. Acad. Sci. USA
88:3319-3323[Abstract/Free Full Text].
|
| 43.
|
Liang, W. Q., and M. J. Fournier.
1995.
U14 base-pairs with 18S rRNA: a novel snoRNA interaction required for rRNA processing.
Genes Dev.
9:2433-2443[Abstract/Free Full Text].
|
| 44.
|
Loreni, F., and F. Amaldi.
1992.
Translational regulation of ribosomal protein synthesis in Xenopus cultured cells: mRNA relocation between polysomes and RNP during nutritional shifts.
Eur. J. Biochem.
205:1027-1032[Medline].
|
| 45.
|
Loreni, F.,
I. Ruberti,
I. Bozzoni,
P. Pierandrei-Amaldi, and F. Amaldi.
1985.
Nucleotide sequence of the L1 ribosomal protein gene of Xenopus laevis: remarkable homology among introns.
EMBO J.
4:3483-3488[Medline].
|
| 46.
|
Maden, B. E.
1997.
Guides to 95 new angles.
Nature
389:129-131[Medline].
|
| 47.
|
Maden, B. E. H.
1990.
The numerous modified nucleotides in eukaryotic ribosomal RNA.
Prog. Nucleic Acids Res.
39:241-303[Medline].
|
| 48.
|
Maden, T.
1996.
Click here for methylation.
Nature
383:675-676[Medline].
|
| 49.
|
Maquat, L.
1995.
When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells.
RNA
1:453-465[Abstract].
|
| 50.
|
Mariottini, P., and F. Amaldi.
1990.
The 5' untranslated region of mRNA for ribosomal protein S19 is involved in its translational regulation during Xenopus development.
Mol. Cell. Biol.
10:816-822[Abstract/Free Full Text].
|
| 51.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
64:897-934[Medline].
|
| 52.
|
Meyuhas, O.,
D. Avni, and S. Shama.
1996.
Translational control of ribosomal protein mRNAs in eukaryotes, p. 363-388.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 53.
|
Meyuhas, O.,
E. A. Thompson, and R. P. Perry.
1987.
Glucocorticoids selectively inhibit translation of ribosomal protein mRNAs in P1798 lymphosarcoma cells.
Mol. Cell. Biol.
7:2691-2699[Abstract/Free Full Text].
|
| 54.
|
Morrissey, J. P., and D. Tollervey.
1993.
Yeast snR30 is a small nucleolar RNA required for 18S rRNA synthesis.
Mol. Cell. Biol.
13:2469-2477[Abstract/Free Full Text].
|
| 55.
|
Nakanishi, T.,
K. Kohno,
M. Ishiura,
H. Ohashi, and T. Uchida.
1988.
Complete nucleotide sequence and characterization of the 5'-flanking region of mammalian elongation factor 2 gene.
J. Biol. Chem.
263:6384-6391[Abstract/Free Full Text].
|
| 56.
|
Neckelmann, N.,
C. K. Warner,
A. Chung,
J. Kudoh,
S. Minosha,
R. Fukuyama,
M. Maekawa,
Y. Shimizu,
N. Shimizu,
J. D. Liu, and D. C. Wallace.
1989.
The human ATP synthase subunit gene: sequence analysis, chromosome assignment, and differential expression.
Genomics
5:829-843[Medline].
|
| 57.
|
Ni, J.,
A. L. Tien, and M. J. Fournier.
1997.
Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal RNA.
Cell
89:565-573[Medline].
|
| 58.
|
Nicoloso, M.,
M. Caizergues-Ferrer,
B. Michot,
M. C. Azum, and J.-P. Bachellerie.
1994.
U20, a novel small nucleolar RNA, is encoded in an intron of the nucleolin gene in mammals.
Mol. Cell. Biol.
14:5766-5776[Abstract/Free Full Text].
|
| 59.
|
Nicoloso, M.,
L.-H. Qu,
B. Michot, and J.-P. Bachellerie.
1996.
Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs.
J. Mol. Biol.
260:178-195[Medline].
|
| 60.
|
Nielsen, P. J., and H. Trachsel.
1988.
The mouse protein synthesis initiation factor 4A gene family includes two related functional genes which are differentially expressed.
EMBO J.
7:2097-2105[Medline].
|
| 61.
|
O'Brien, C. A., and S. L. Wolin.
1994.
A possible role for the 60-kDa Ro autoantigen in a discard pathway for defective 5S rRNA precursors.
Genes Dev.
8:2891-2903[Abstract/Free Full Text].
|
| 62.
|
Peculis, B.
1997.
RNA processing: pocket guides to ribosomal RNA.
Curr. Biol.
7:480-482.
|
| 63.
|
Peculis, B. A., and J. A. Steitz.
1993.
Disruption of U8 nucleolar snRNA inhibits 5.8S and 28S rRNA processing in the Xenopus oocyte.
Cell
73:1233-1245[Medline].
|
| 64.
|
Pelczar, P., and W. Filipowicz.
1998.
The host gene for intronic U17 small nucleolar RNAs in mammals has no protein-coding potential and is a member of the 5'-terminal oligopyrimidine gene family.
Mol. Cell. Biol.
18:4509-4518[Abstract/Free Full Text].
|
| 64a.
| Philipson, L. Personal communication.
|
| 64b.
| Philipson, L. Unpublished results.
|
| 65.
|
Pierandrei-Amaldi, P.,
E. Beccari,
I. Bozzoni, and F. Amaldi.
1985.
Ribosomal protein production in normal and anucleoate Xenopus embryos: regulation at the posttranscriptional and translational levels.
Cell
42:317-323[Medline].
|
| 66.
|
Prislei, S.,
A. Michienzi,
C. Presutti,
P. Fragapane, and I. Bozzoni.
1993.
Two different snoRNAs are encoded in introns of amphibian and human L1 ribosomal protein genes.
Nucleic Acids Res.
21:5824-5830[Abstract/Free Full Text].
|
| 67.
|
Qu, L. H.,
Y. Henry,
M. Nicoloso,
B. Michot,
M. C. Azum,
M. H. Renalier,
F. M. Caizergues, and J.-P. Bachellerie.
1995.
U24, a novel intron-encoded small nucleolar RNA with two 12 nt long, phylogenetically conserved complementarities to 28S rRNA.
Nucleic Acids Res.
23:2669-2676[Abstract/Free Full Text].
|
| 68.
|
Qu, L. H.,
M. Nicoloso,
B. Michot,
M. C. Azum,
F. M. Caizergues,
M. H. Renalier, and J.-P. Bachellerie.
1994.
U21, a novel small nucleolar RNA with a 13 nt complementarity to 28S rRNA, is encoded in an intron of ribosomal protein L5 gene in chicken and mammals.
Nucleic Acids Res.
22:4073-4081[Abstract/Free Full Text].
|
| 69.
|
Reddy, N. S.,
W. W. Roth,
P. W. Bragg, and A. J. Wahba.
1988.
Isolation and mapping of a gene for protein synthesis initiation factor 4A and its expression during differentiation of murine erythroleukemia cells.
Gene
70:231-243[Medline].
|
| 70.
|
Rosenthal, E. T., and L. Wordeman.
1995.
A protein similar to the 67 kDa laminin binding protein and p40 is probably a component of the translation machinery in Urechis caupo oocytes and embryos.
J. Cell Sci.
108:245-256[Abstract].
|
| 71.
|
Satoh, K.,
K. Narumi,
T. Sakai,
T. Abe,
T. Kikuchi,
K. Matsushima,
S. Sindoh, and M. Motomiya.
1992.
Cloning of 67-kDa laminin receptor cDNA and gene expression in normal and malignant cell lines of the human lung.
Cancer Lett.
62:199-203[Medline].
|
| 72.
|
Savino, R., and S. A. Gerbi.
1990.
In vivo disruption of Xenopus U3 snRNA affects ribosomal RNA processing.
EMBO J.
9:2299-2308[Medline].
|
| 73.
|
Schmitt, M. E., and D. A. Clayton.
1993.
Nuclear RNase MRP is required for correct processing of pre-5.8S rRNA in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:7935-7941[Abstract/Free Full Text].
|
| 74.
|
Schneider, C.,
R. M. King, and L. Philipson.
1988.
Genes specifically expressed at growth arrest of mammalian cells.
Cell
54:787-793[Medline].
|
| 75.
|
Smith, C. M., and J. A. Steitz.
1997.
Sno storm in the nucleolus: new roles for myriad small RNPs.
Cell
89:669-672[Medline].
|
| 76.
|
Sollner-Webb, B.
1993.
Novel intron-encoded small nucleolar RNAs.
Cell
75:403-405[Medline].
|
| 77.
|
Sollner-Webb, B.,
K. T. Tycowski, and J. A. Steitz.
1996.
Ribosomal RNA processing in eukaryotes, p. 469-490.
In
R. A. Zimmerman, and A. E. Dahlberg (ed.), Ribosomal RNA: structure, evolution, processing, and function in protein biosynthesis. CRC Press, Boca Raton, Fla.
|
| 78.
|
Srivastava, M.,
O. W. McBride,
P. J. Fleming,
H. B. Pollard, and A. L. Burns.
1990.
Genomic organization and chromosomal localization of the human nucleolin gene.
J. Biol. Chem.
265:14922-14931[Abstract/Free Full Text].
|
| 79.
|
Steinmetz, E. J.
1997.
Pre-mRNA processing and the CTD of RNA polymerase II: the tail that wags the dog?
Cell
89:491-494[Medline].
|
| 80.
|
Tollervey, D.
1987.
A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA.
EMBO J.
6:4169-4175[Medline].
|
| 81.
|
Tollervey, D., and C. Guthrie.
1985.
Deletion of a yeast small nucleolar RNA gene impairs growth.
EMBO J.
4:3873-3878[Medline].
|
| 82.
|
Tollervey, D., and T. Kiss.
1997.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
3:337-342.
|
| 83.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 84.
|
Tycowski, K. T.,
M. Shu, and J. A. Steitz.
1996.
A mammalian gene with introns instead of exons generating stable RNA products.
Nature
379:464-466[Medline].
|
| 85.
|
Tycowski, K. T.,
M.-D. Shu, and J. A. Steitz.
1994.
Requirement for intron-encoded U22 small nucleolar RNA in 18S ribosomal RNA maturation.
Science
266:1558-1561[Abstract/Free Full Text].
|
| 86.
|
Tycowski, K. T.,
M.-D. Shu, and J. A. Steitz.
1993.
A small nucleolar RNA is processed from an intron of the human gene encoding ribosomal protein S3.
Genes Dev.
7:1176-1190[Abstract/Free Full Text].
|
| 87.
|
Tycowski, K. T.,
C. M. Smith,
M. Shu, and J. A. Steitz.
1996.
A small nucleolar RNA required for site-specific ribose methylation of rRNA in Xenopus.
Proc. Natl. Acad. Sci. USA
93:14480-14485[Abstract/Free Full Text].
|
| 88.
|
Van den Ouweland, A. M. W.,
P. Kioschis,
M. Verdijk,
F. Tamanini,
D. Toniolo,
A. Poustka, and B. A. Van Oost.
1992.
Identification and characterization of a new gene in the human Xq28 region.
Hum. Mol. Genet.
1:269-273[Abstract/Free Full Text].
|
| 89.
|
Wyatt, J. R.,
E. J. Sontheimer, and J. A. Steitz.
1992.
Site-specific crosslinking of mammalian snRNPs to the 5' splice site prior to the first step of pre-messenger RNA splicing.
Genes Dev.
6:2542-2553[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1998, p. 6897-6909, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pang, K. C., Dinger, M. E., Mercer, T. R., Malquori, L., Grimmond, S. M., Chen, W., Mattick, J. S.
(2009). Genome-Wide Identification of Long Noncoding RNAs in CD8+ T Cells. J. Immunol.
182: 7738-7748
[Abstract]
[Full Text]
-
Mourtada-Maarabouni, M., Hedge, V. L., Kirkham, L., Farzaneh, F., Williams, G. T.
(2008). Growth arrest in human T-cells is controlled by the non-coding RNA growth-arrest-specific transcript 5 (GAS5). J. Cell Sci.
121: 939-946
[Abstract]
[Full Text]
-
Dong, X.-Y., Rodriguez, C., Guo, P., Sun, X., Talbot, J. T., Zhou, W., Petros, J., Li, Q., Vessella, R. L., Kibel, A. S., Stevens, V. L., Calle, E. E., Dong, J.-T.
(2008). SnoRNA U50 is a candidate tumor-suppressor gene at 6q14.3 with a mutation associated with clinically significant prostate cancer. Hum Mol Genet
17: 1031-1042
[Abstract]
[Full Text]
-
Ideue, T., Sasaki, Y. T.F., Hagiwara, M., Hirose, T.
(2007). Introns play an essential role in splicing-dependent formation of the exon junction complex. Genes Dev.
21: 1993-1998
[Abstract]
[Full Text]
-
Royo, H., Basyuk, E., Marty, V., Marques, M., Bertrand, E., Cavaille, J.
(2007). Bsr, a Nuclear-retained RNA with Monoallelic Expression. Mol. Biol. Cell
18: 2817-2827
[Abstract]
[Full Text]
-
Tanaka-Fujita, R., Soeno, Y., Satoh, H., Nakamura, Y., Mori, S.
(2007). Human and mouse protein-noncoding snoRNA host genes with dissimilar nucleotide sequences show chromosomal synteny. RNA
13: 811-816
[Abstract]
[Full Text]
-
He, H., Cai, L., Skogerbo, G., Deng, W., Liu, T., Zhu, X., Wang, Y., Jia, D., Zhang, Z., Tao, Y., Zeng, H., Aftab, M. N., Cui, Y., Liu, G., Chen, R.
(2006). Profiling Caenorhabditis elegans non-coding RNA expression with a combined microarray. Nucleic Acids Res
34: 2976-2983
[Abstract]
[Full Text]
-
Bek, M. F., Bayer, M., Muller, B., Greiber, S., Lang, D., Schwab, A., August, C., Springer, E., Rohrbach, R., Huber, T. B., Benzing, T., Pavenstadt, H.
(2006). Expression and Function of C/EBP Homology Protein (GADD153) in Podocytes. Am. J. Pathol.
168: 20-32
[Abstract]
[Full Text]
-
Zekri, L., Chebli, K., Tourriere, H., Nielsen, F. C., Hansen, T. V. O., Rami, A., Tazi, J.
(2005). Control of Fetal Growth and Neonatal Survival by the RasGAP-Associated Endoribonuclease G3BP. Mol. Cell. Biol.
25: 8703-8716
[Abstract]
[Full Text]
-
Horisawa, K., Doi, N., Takashima, H., Yanagawa, H.
(2005). Application of Quantitative Real-Time PCR for Monitoring the Process of Enrichment of Clones on In Vitro Protein Selection. J Biochem
137: 121-124
[Abstract]
[Full Text]
-
Intine, R. V., Dundr, M., Vassilev, A., Schwartz, E., Zhao, Y., Zhao, Y., DePamphilis, M. L., Maraia, R. J.
(2004). Nonphosphorylated Human La Antigen Interacts with Nucleolin at Nucleolar Sites Involved in rRNA Biogenesis. Mol. Cell. Biol.
24: 10894-10904
[Abstract]
[Full Text]
-
Schwartz, E. I., Intine, R. V., Maraia, R. J.
(2004). CK2 Is Responsible for Phosphorylation of Human La Protein Serine-366 and Can Modulate rpL37 5'-Terminal Oligopyrimidine mRNA Metabolism. Mol. Cell. Biol.
24: 9580-9591
[Abstract]
[Full Text]
-
SAWATA, M., TAKEUCHI, H., KUBO, T.
(2004). Identification and analysis of the minimal promoter activity of a novel noncoding nuclear RNA gene, AncR-1, from the honeybee (Apis mellifera L.). RNA
10: 1047-1058
[Abstract]
[Full Text]
-
Kiss, A. M., Jady, B. E., Bertrand, E., Kiss, T.
(2004). Human Box H/ACA Pseudouridylation Guide RNA Machinery. Mol. Cell. Biol.
24: 5797-5807
[Abstract]
[Full Text]
-
Vitali, P., Royo, H., Seitz, H., Bachellerie, J.-P., Huttenhofer, A., Cavaille, J.
(2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res
31: 6543-6551
[Abstract]
[Full Text]
-
McCutcheon, J. P., Eddy, S. R.
(2003). Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res
31: 4119-4128
[Abstract]
[Full Text]
-
Numata, K., Kanai, A., Saito, R., Kondo, S., Adachi, J., Wilming, L. G., Hume, D. A., RIKEN GER Group, , GSL Members, , Hayashizaki, Y., Tomita, M.
(2003). Identification of Putative Noncoding RNAs Among the RIKEN Mouse Full-Length cDNA Collection. Genome Res
13: 1301-1306
[Abstract]
[Full Text]
-
Fontanier-Razzaq, N., Harries, D. N., Hay, S. M., Rees, W. D.
(2002). Amino Acid Deficiency Up-regulates Specific mRNAs in Murine Embryonic Cells. J. Nutr.
132: 2137-2142
[Abstract]
[Full Text]
-
Runte, M., Huttenhofer, A., Gro{beta}, S., Kiefmann, M., Horsthemke, B., Buiting, K.
(2001). The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A. Hum Mol Genet
10: 2687-2700
[Abstract]
[Full Text]
-
Hirose, T., Steitz, J. A.
(2001). Position within the host intron is critical for efficient processing of box C/D snoRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA
10.1073/pnas.231490998v1
[Abstract]
[Full Text]
-
Mattick, J. S., Gagen, M. J.
(2001). Review ArticleThe Evolution of Controlled Multitasked Gene Networks: The Role of Introns and Other Noncoding RNAs in the Development of Complex Organisms. Mol Biol Evol
18: 1611-1630
[Abstract]
[Full Text]
-
Dong, G., Loukinova, E., Chen, Z., Gangi, L., Chanturita, T. I., Liu, E. T., Van Waes, C.
(2001). Molecular Profiling of Transformed and Metastatic Murine Squamous Carcinoma Cells by Differential Display and cDNA Microarray Reveals Altered Expression of Multiple Genes Related to Growth, Apoptosis, Angiogenesis, and the NF-{{kappa}}B Signal Pathway. Cancer Res.
61: 4797-4808
[Abstract]
[Full Text]
-
Liang-Hu, Q., Qing, M., Hui, Z., Yue-Qin, C.
(2001). Identification of 10 novel snoRNA gene clusters from Arabidopsis thaliana. Nucleic Acids Res
29: 1623-1630
[Abstract]
[Full Text]
-
Cavaillé, J., Buiting, K., Kiefmann, M., Lalande, M., Brannan, C. I., Horsthemke, B., Bachellerie, J.-P., Brosius, J., Hüttenhofer, A.
(2000). Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. USA
10.1073/pnas.250426397v1
[Abstract]
[Full Text]
-
Dunbar, D. A., Chen, A. A., Wormsley, S., Baserga, S. J.
(2000). The genes for small nucleolar RNAs in Trypanosoma brucei are organized in clusters and are transcribed as a polycistronic RNA. Nucleic Acids Res
28: 2855-2861
[Abstract]
[Full Text]
-
Darzacq, X., Kiss, T.
(2000). Processing of Intron-Encoded Box C/D Small Nucleolar RNAs Lacking a 5',3'-Terminal Stem Structure. Mol. Cell. Biol.
20: 4522-4531
[Abstract]
[Full Text]
-
Kim, S., Mao, P.-L., Gagliardi, M., Bedard, P.-A.
(1999). C/EBPbeta (NF-M) Is Essential for Activation of the p20K Lipocalin Gene in Growth-Arrested Chicken Embryo Fibroblasts. Mol. Cell. Biol.
19: 5718-5731
[Abstract]
[Full Text]
-
Cavaille, J., Vitali, P., Basyuk, E., Huttenhofer, A., Bachellerie, J.-P.
(2001). A Novel Brain-specific Box C/D Small Nucleolar RNA Processed from Tandemly Repeated Introns of a Noncoding RNA Gene in Rats. J. Biol. Chem.
276: 26374-26383
[Abstract]
[Full Text]
-
Hirose, T., Steitz, J. A.
(2001). Position within the host intron is critical for efficient processing of box C/D snoRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA
98: 12914-12919
[Abstract]
[Full Text]
-
Cavaille, J., Buiting, K., Kiefmann, M., Lalande, M., Brannan, C. I., Horsthemke, B., Bachellerie, J.-P., Brosius, J., Huttenhofer, A.
(2000). From the Cover: Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. USA
97: 14311-14316
[Abstract]
[Full Text]