Molecular and Cellular Biology, December 1998, p. 6939-6950, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
TAL1 and LIM-Only Proteins Synergistically Induce Retinaldehyde
Dehydrogenase 2 Expression in T-Cell Acute Lymphoblastic Leukemia
by Acting as Cofactors for GATA3
Yuichi
Ono,1
Norio
Fukuhara,1 and
Osamu
Yoshie1,2,*
Shionogi Institute for Medical Science,
Settsu-shi, Osaka 566-0022,1 and
Department of Bacteriology, Kinki University School of
Medicine, Osaka-Sayama, Osaka 589-8511,2 Japan
Received 6 July 1998/Returned for modification 4 August
1998/Accepted 1 September 1998
 |
ABSTRACT |
Previously, we have shown that TAL1 and the LIM-only
protein gene (LMO) are regularly coactivated in T-cell
acute lymphoblastic leukemia (T-ALL). This observation is likely to
relate to the findings that TAL1 and LMO are highly synergistic in
T-cell tumorigenesis in double-transgenic mice. To understand the
molecular mechanisms of functional synergy between TAL1 and LMO in
tumorigenesis and transcriptional regulation, we tried to identify
downstream target genes regulated by TAL1 and LMO by a subtractive PCR
method. One of the isolated genes, that for retinaldehyde
dehydrogenase 2 (RALDH2), was regularly expressed in most of the T-ALL
cell lines that coexpressed TAL1 and LMO.
Exogenously transfected TAL1 and LMO, but not either alone, induced
RALDH2 expression in a T-ALL cell line, HPB-ALL, not
expressing endogeneous TAL1 or LMO. The RALDH2 transcripts in T-ALL
were, however, mostly initiated within the second intron. Promoter
analysis revealed that a GATA site in a cryptic promoter in the second
intron was essential and sufficient for the TAL1- and LMO-dependent
transcriptional activation, and GATA3 binds to this site. In addition,
forced expression of GATA3 potentiated the induction of
RALDH2 by TAL1 and LMO, and these three factors formed
a complex in vivo. Furthermore, a TAL1 mutant not binding to DNA
also activated the transcription of RALDH2 in the
presence of LMO and GATA3. Collectively, we have identified the RALDH2
gene as a first example of direct transcriptional target genes
regulated by TAL1 and LMO in T-ALL. In this case, TAL1 and LMO act as
cofactors for GATA3 to activate the transcription of RALDH2.
 |
INTRODUCTION |
In various types of leukemia,
specific recurrent chromosomal translocations are frequently observed
and potential oncogenic transcription factors have been identified from
the chromosomal breakpoints (46). These transcription
factors are mostly involved in normal hematopoietic cell
differentiation and growth. In T-cell acute lymphoblastic leukemia
(T-ALL), frequent chromosomal abnormalities are found in the
TAL1 (also called SCL or TCL5) locus
(5, 9, 10, 14). Ectopic expression of TAL1, which
is not normally expressed in T cells (44, 57), is observed
in ~60% of T-ALL patients (4). TAL1 encodes at
least two alternative isoforms, full-length TAL1
and N-terminally
truncated TAL1
, having a basic helix-loop-helix (bHLH) motif found
in a number of transcription factors involved in the regulation of cell
differentiation (6). TAL1 dimerizes with ubiquitous bHLH
E-proteins (E47, E12, and HEB) (20, 22), and the
heterodimers bind to the E-box motif (CANNTG), most preferably to
AACAGATGGT (21). However, no
downstream target genes have been identified. It is thus uncertain
whether TAL1-E-protein heterodimers regulate transcription through
binding to this preferred E-box.
LMO1 (RBTN1 or TTG1) and
LMO2 (RBTN2 or TTG2) are also genes
originally identified from recurrent chromosomal breakpoints in T-ALL
(7, 34, 49). Their expression in T-ALL is ectopic, like that
of TAL1 (15, 18, 35, 49). They encode highly related LIM-only class proteins (LMO), which consist of only two tandemly repeated LIM domains. The LIM domain is a cysteine-rich zinc
finger-like motif present in certain homeodomain transcription factors
and some kinases and cytoskeletal proteins, and it appears to
mediate protein-protein interactions (45, 51). LMO are nuclear proteins (35, 61) and are considered to be
involved in transcriptional regulation, even though they do not have
DNA binding activity.
Targeted-disruption experiments revealed that both TAL1 and
LMO2 are essential for embryogenesis, as mutant mice die at
embryonic day 9.5 due to the absence of yolk sac erythropoiesis
(48, 52, 61). Since TAL1 and LMO2 physically associate in
the erythroid cell lineage (56, 59), these transcription
factors are likely to regulate erythroid cell differentiation and
growth by forming a complex.
Previously we have shown that TAL1 is regularly coexpressed
with LMO1 or LMO2 in T-ALL (41).
Furthermore, transgenic mice ectopically expressing TAL1 in T cells did
not efficiently develop tumors (13, 27, 47), whereas
double-transgenic mice expressing TAL1 and LMO rapidly developed
leukemia (2, 30). These results suggest that not only in
the regulation of erythroid cell differentiation but also in the
development of T-ALL, TAL1 and LMO act synergistically, most probably
by forming a complex (30). However, no downstream target
genes regulated by TAL1 and LMO have been identified. Thus, the
molecular mechanism by which these factors regulate transcription in
the erythroid lineage and T-ALL remains mostly unknown.
The fact that chromosomal abnormalities involving TAL1 and
LMO are highly restricted to T-ALL suggests that some other
T-cell-specific cofactor(s) is involved in the oncogenic function of
TAL1 and LMO (41). In the erythroid lineage, LMO2 physically
interacts with GATA1 as well as TAL1 and bridges these factors to form
a larger complex in vivo (42). GATA1 was first identified as
a protein binding to the conserved regulatory elements among many erythroid cell-specific genes (55). Targeted disruption of
GATA1 blocks differentiation of erythroid precursors
(16, 43), implying that TAL1, LMO2, and GATA1 cooperatively
regulate transcription in the erythroid lineage. Although GATA1 is not
expressed in the T-cell lineage, another member of the GATA-binding
protein family, GATA3, is expressed (19, 28, 33). We have
shown that GATA3 physically interacts with LMO in vitro and is a potent
cofactor for TAL1 and LMO in transactivation of an artificial reporter gene in a T-ALL cell line (41).
To understand the mechanism of T-cell tumorigenesis and transcriptional
regulation by TAL1 and LMO, we have been focusing on downstream target
genes of these factors. Previously, we have shown that the gene for a
T-ALL-specific tumor marker, TALLA1 (54), is likely to be
one such gene. TALLA1 is regularly coexpressed with
TAL1 and LMO in T-ALL cell lines (41).
Coexpression of exogeneous TAL1 and LMO1, but not either alone,
strongly induced TALLA1 in a T-ALL cell line, HPB-ALL, not
expressing endogeneous TAL1 or LMO (41). However, the
mechanism of induction of TALLA1 by TAL1 and LMO remains
unknown. In this study, we show that the gene for retinaldehyde
dehydrogenase 2 (RALDH2) (63) is also induced in HPB-ALL
cells by coexpression of exogeneous TAL1 and LMO and that
RALDH2 is regularly expressed in most T-ALL-derived cell
lines ectopically coexpressing TAL1 and LMO. Promoter
analysis revealed that a transcriptional complex containing TAL1, LMO, and GATA3 binds to a GATA site in a cryptic promoter in the second intron of the RALDH2 gene and regulates transcription through this
site. Thus, the RALDH2 gene is a direct target gene regulated by TAL1
and LMO in T-ALL, and in this case TAL1 and LMO act as cofactors
for GATA3.
 |
MATERIALS AND METHODS |
Cell culture.
Hematopoietic cell lines were cultured in RPMI
1640 supplemented with 10% fetal bovine serum. For details of each
T-ALL cell line, see reference 54. HPB-ALL clones
stably expressing TAL1
and/or LMO1 were described previously
(41). 293E and COS cells were cultured in Dulbecco's
modified Eagle's medium supplemented with 10% fetal bovine serum.
PCR-based subtraction.
Suppression-subtractive hybridization
between parental HPB-ALL cells and HPB-ALL cells stably expressing
TAL1
and LMO1 was carried out by using a PCR-Select cDNA subtraction
kit (Clontech) according to the protocol recommended by the
manufacturer. Obtained PCR products were digested with RsaI
and ligated with AD1 adapter. AD1-ligated tester cDNA (300 pg) and
driver cDNA (300 ng) were hybridized and amplified by using AD1S
primer. PCR products were digested with RsaI and ligated
with AD2 adapter. AD2-ligated tester cDNA (10 pg) and driver cDNA (300 ng) were hybridized and amplified by using AD2S primer. Amplified
fragments were cloned into pCRII (Invitrogen). All PCRs were carried
out with Pfu DNA polymerase (Stratagene). Adapter sequences
were as follows: AD1S, 5'-CAGCTCCACAACCTACATCATTCCGT-3'; AD1A, 5'-ACGGAATGATGT-3'; AD2S,
5'-GTCCATCTTCTCTCTGAGACTCTGGT-3'; and AD2A,
5'-ACCAGAGTCTCA-3'. AD1S-AD1A and AD2S-AD2A were
annealed, yielding AD1 and AD2, respectively.
Isolation of RALDH2 cDNA and genomic clones.
A Jurkat cDNA
library (Clontech) was screened by colony hybridization, using as a
probe 32P-radiolabeled cDNA fragments obtained by
subtractive PCR. Four clones were analyzed by DNA sequencing, and then
5' rapid amplification of cDNA ends (RACE) was performed with Molt4 and
K562 poly(A)+ RNAs. Amplified products were cloned into
pCRII (Invitrogen), and several clones were sequenced. Full-length
cDNAs were amplified from Molt4 and K562 poly(A)+ RNAs by
reverse transcription-PCR (RT-PCR) with primers designed from the
sequence of 5'RACE products and the Jurkat cDNA, and several clones
were sequenced.
Genomic clones were obtained by screening a human genomic library by
using the 32P-labeled 5' portion of the Molt4 RALDH2 cDNA
fragment as a probe. The inserts of positive clones were subcloned into
pBluescriptII (Stratagene) and sequenced from both directions.
Northern blotting and RT-PCR.
Total RNA was prepared from
various cell lines by using Trizol reagent (Life Technologies, Inc.).
Poly(A)+ RNA was purified with an mRNA purification kit
(Pharmacia). Two micrograms of each poly(A)+ RNA was
fractionated by electrophoresis on a 1% agarose gel containing formaldehyde and blotted onto a nylon membrane. Filters were hybridized with 32P-labeled probes by using QuikHyb hybridization
solution (Stratagene) and washed at 60°C in 0.1× SSC (1× SSC is
0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate.
RT-PCR was performed essentially as described previously
(41). Amplification was carried out by denaturation at
94°C for 1 min (3 min in the first cycle), annealing at 65°C for 1 min, and extension at 72°C for 1 min (3 min in the last cycle). The number of cycles was 28 for F1-R1, 37 for F2-R1, 30 for F3-R1, and 35 for detection of E2A and RALDH2 in transiently transfected HPB-ALL
cells. Primer sequences were as follows: F1,
5'-AACAACGAGTGGCAGAACTCAGAGAG-3'; F2,
5'-TTCAGTTGTGCCTCTTCCTCTCTAAC-3'; F3,
ACAAAGCAGTGCAGGCAGCC-3'; R1,
ATCGAAAGGTTTTGATGACGCCCTGC-3'; RALDH2 in transiently
transfected HPB-ALL cells, 5'-AGGAGATACTGGATGTGTCTGCTAGC-3'
and 5'-CTCACAGTGTCTTCTGCAATGCAAGC-3'; and E2A,
5'-CAGCAGGGTTTCCAGGCCTGAGGTGC-3' and
5'-GCTGCTGTGCGACTCAGTGAAGTGGG-3'.
Transfection and luciferase assay.
Expression vectors for
TAL1, LMO1, LMO2, and GATA3 were as described previously
(41). The GATA3 KRR mutant (pc-KRR) was kindly provided by
Astar Winoto (53). The EcoRI fragment of pc-KRR
was inserted into pMIKneo, yielding pMIKneoGATA3KRR. The GATA3CFM
mutant was constructed by PCR with mutant primers changing Cys(317) and
Cys(320) to Gly. The TAL1
BM mutant was also constructed by PCR
changing Arg-Glu-Arg(20-22) to Ala-Ala-Ala. To make a series of
RALDH2-T reporter plasmids, each genomic fragment was amplified by PCR
with 5'-GAGGAGCTCCCTTCTCCACACTGAACCAAGAGAG-3' and the
following primers:
1.7-luc,
5'-GAGGGTACCGAGTGTAGGTTTGGAGTGATGTAGG-3';
308-luc, 5'-GAGGGTACCGAGTGTTCCCTGTCTATAATCCAGCC-3';
267-luc,
5'-GAGGGTACCTGTGAAGTTCAAGAAGCAGACAAGG-3';
231-luc,
5'-GAGGGTACCTAGATAAAAGATTTCCTATGAAATAA-3';
228-luc, 5'-GAGGGTACCATAAAAGATTTCCTATGAAATAACTG-3';
207-luc,
5'-GAGGGTACCAACTGCCTTCAAACAGCAGAGCAGCA-3';
181-luc,
5'-GAGGGTACCAACATATGCTCTCAGTACACCACTAC-3'; and
142-luc, 5'-GAGGGTACCACTTTTTTCATGACAGTGGATGGTTC-3'. Amplified
fragments were inserted into the KpnI-SacI site
of the luciferase reporter plasmid pGV-B (TOYO Ink, Tokyo, Japan). To
make tk-luc, the herpes simplex virus (HSV) thymidine kinase
(tk) minimal promoter (36) was amplified by PCR
with 5'-GAGAGATCTCAGTCGGGGCGGCGCGGTCC-3' and
5'-GAGAAGCTTCGGTCGCTCGGTGTTCGAGG-3', digested with
BglII and HindIII, and cloned into the
same site of pGV-B. To make GATA×3-tk-luc, two synthetic
oligonucleotides, 5'-CGTAGATAAAAGTAGATAAAAGTAGATAAAAGAGCT-3' and 5'-CTTTTATCTACTTTTATCTACTTTTATCTACGGTAC-3', were
annealed and cloned into the KpnI-SacI site of
tk-luc. Recipient cells (107) were transfected by
electroporation with various combinations of plasmids together with 0.1 µg of pRL-CMV (Promega). After 24 h, cell lysates were prepared
and assayed by using the Dual-luciferase reporter assay system
(Promega). Luciferase activity was normalized with Renilla
luciferase activity.
Immunoprecipitation.
Two synthetic oligonucleotides,
5'-AATTGCCACCAT GGACTACAAGGACGACGACGACAAGGAATTCCCGGGTCGACA-3' and
5'-CTAGTGTCGACCCGGGAATTCCTTGTCGTCGTCGTCCTTGTAGTCCATGGTGGC-3', were annealed and cloned into the
EcoRI-SpeI site of pMIKneo, yielding pMIKneoFLAG.
Two synthetic oligonucleotides,
5'-AATT GCCACCATGGACTACCCATACGACGTCCCAGACTACGCTGAATTCC CGGGTCGACA-3'
and 5'-CTAGTGTCGACCCGGGAATTCAGCGTAGTCTGGGACGTCGTATGGGTAGTCCATGGTGGC-3', were annealed and cloned into the
EcoRI-SpeI site of pMIKneo, yielding pMIKneoHA.
cDNAs of TAL1
, TAL1
BM, LMO1, LMO2, GATA3, GATA3CFM, and E47S were
amplified by PCR with the following primer sets: TAL1
,
5'-GAGGAATTCATGGAGATTACTGATGGTCC-3' and
5'-GAGGTCGACGGATCCTCACCGAGGGCCGGCTCCATC-3'; TAL1
BM,
5'-GAGGAATTCATGGAGATTACTGATGGTCC-3' and
5'-GAGGAATTCTGATCCTGGTGGCCCAGACCCATCAC-3'; LMO1,
5'-GAGGAATTCATGATGGTGCTGGACAAGGA-3' and
5'-GAGGTCGACGGATCCCGTTACTGAACTTGGGATTC-3'; LMO2,
5'-GAGGAATTCATGTCCTCGGCCATCGAAAG-3' and
5'-GAGGTCGACGGATCCCCTATATCATCCCATTGATC-3'; GATA3 and
GATA3CFM, 5'-GAGGAATTCATGGAGGTGACGGCGGACCAGCCGCG-3' and
5'-GAGGAATTCGTGAGCATCGAGCAGGGCTCTAACCC-3', and E47S,
5'-GAGGAATTCAGTACGGACGAGGTGCTGTC-3' and
5'-GAGGAATTCCTCGTCCCACGGAGGCATAC-3'. TAL1
, LMO1, and LMO2 fragments were digested with EcoRI and SalI and
cloned into the same site of pMIKneoFLAG and pMIKneoHA. TAL1
BM,
GATA3, GATA3CFM, and E47S fragments were digested with EcoRI
and cloned into the same site of pMIKneoFLAG and pMIKneoHA. 293E cells
(2 × 106) were transfected with various combinations
of 5 µg of each plasmid by using Lipofectamine Plus reagent (GIBCO
BRL). After 48 h, cells were lysed in 600 µl of low-stringency
Nonidet P-40 (NP-40) buffer (10 mM HEPES [pH 7.6], 250 mM NaCl, 5 mM
EDTA, 0.1% NP-40) (56) and immunoprecipitated with
anti-FLAG antibody (Kodak). After washing five times with cold
low-stringency NP-40 buffer, immunoprecipitates were analyzed by
immunoblotting with anti-FLAG or antihemagglutinin (anti-HA)
(Boehringer Mannheim).
Electrophoretic mobility shift assay (EMSA).
Cell lysates of
transfected 293E or COS cells were prepared by using low-stringency
NP-40 buffer as described above. Nuclear extracts of HPB-ALL cells were
prepared as described previously (12). Double-stranded
oligonucleotide probes were end labeled by using
[
-32P]ATP and T4 polynucleotide kinase. One
microliter of cell lysates or 5 µg of nuclear extracts was
incubated with or without competitors (100 ng), anti-FLAG monoclonal
antibody (MAb) (2.8 µg), or anti-GATA3 MAb (0.2 µg) (Santa Cruz
Biotechnology, Inc.) for 5 min at room temperature and then with
radiolabeled probes (2 × 104 cpm/ng; 0.5 ng/reaction
mixture) for another 20 min at room temperature in 20 µl of a
solution consisting of 20 mM HEPES (pH 7.5), 50 mM KCl, 1 mM
dithiothreitol, 1 mM EDTA, 5% glycerol, and 0.5 µg (293E and COS
cell lysates) or 2 µg (HPB-ALL nuclear extract) of poly(dI-dC). The
samples were electrophoresed on a 5% polyacrylamide gel with TAE
buffer (7 mM Tris-HCl [pH 7.5], 3 mM sodium acetate, and 1 mM EDTA)
at 120 V for 1.5 h. Gels were dried and subjected to
autoradiography. Oligonucleotide probes were as follows: TAL1CS, 5'-ACCTGAACAGATGGTCGGCT-3' and
5'-AGCCGACCATCTGTTCAGGT-3'; TCR-GATA, 5'-GTTAGAGATAGCATCGCCCC-3' and
5'-GGGGCGATGCTATCTCTAAC-3'; RALDH2-GATA, 5'-GGCCCCTTTTGTAGATAAAAGATTTCCGGG-3' and
5'-CCCGGAAATCTTTTATCTACAAAAGGGGGCC-3'; and RALDH2-GATAM,
5'-GGCCCCTTTTGTTCTAGAAAGATTTCCGGG-3' and
5'-CCCGGAAATCTTTCTAGAACAAAAGGGGCC-3'.
Nucleotide sequence accession numbers.
The nucleotide
sequences of human RALDH2 cDNA are listed in the DDBJ/EMBL/GenBank
database under accession no. AB015226, AB015227, and AB015228. The
sequence in Fig. 3A is listed in the DDBJ/EMBL/GenBank database under
accession no. AB015229.
 |
RESULTS |
RALDH2 is induced by TAL1 and LMO in T-ALL.
To
identify target genes regulated by ectopically coexpressed TAL1 and LMO
in T-ALL, we used a T-ALL-derived cell line, HPB-ALL, not
expressing TAL1 or LMO and its subline stably expressing
transfected TAL1
and LMO1 (41). Using
suppression-subtractive hybridization followed by two cycles of
subtractive PCR (see Materials and Methods), we obtained several
fragments of genes whose expression was strongly upregulated in the
subline coexpressing TAL1
and LMO1 (data not shown). Four of these
fragments were derived from the same gene. Since the encoded amino acid
sequence is 98% identical to mouse RALDH2 (63), this gene
is the human counterpart of the RALDH2 gene (see below).
To examine the roles of TAL1
and LMO1 in the induction of
RALDH2, we analyzed the expression of RALDH2 in
a panel of HPB-ALL clones stably expressing transfected
TAL1
or LMO1 or both (41). As shown in Fig.
1A, the vector control clones and those
expressing either TAL1
or LMO1 alone did not express
RALDH2 at all, whereas those coexpressing both TAL1
and
LMO1 strongly expressed it. To rule out possible clonal variations, we
also examined HPB-ALL cells transiently transfected with TAL1 and LMO
expression vectors (Fig. 1B). Consistent with the results obtained with
stable clones, only HPB-ALL cells cotransfected with TAL1
and LMO1
expressed RALDH2. Furthermore, even the N-terminally
truncated isoform TAL1
induced RALDH2 expression in the
presence of LMO1 or LMO2. These results strongly suggest that
RALDH2 is a transcriptional downstream target gene of TAL1
and LMO and that both TAL1 and LMO are required for induction of
RALDH2.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Induction of RALDH2 by TAL1 and LMO in T-ALL
cell lines. (A) Northern blot analysis for RALDH2 in HPB-ALL
clones. HPB-ALL cells were transfected with the indicated combinations
of expression vectors, and stable transformants were isolated. Two
clones were analyzed for each combination. Poly(A)+
RNA (2 µg each) was electrophoresed, blotted onto a filter, and
hybridized with the 32P-labeled 3' untranslated region of
RALDH2 cDNA obtained by subtractive PCR. The same filter was reprobed
for glyceraldehyde-3-phosphate dehydrogenase (G3PDH) as an internal
control. (B) RT-PCR analysis for RALDH2 in HPB-ALL cells
transiently expressing the indicated combinations of TAL1 and LMO.
HPB-ALL cells were cotransfected with 15 µg each of the indicated
expression vectors and 1 µg of pRC/CMV-luc by electroporation. Total
RNA was prepared 20 h after transfection and subjected to RT-PCR
analysis for RALDH2 and E2A (control). The
amounts of total RNA used were 10, 2, and 0.4 ng from left to right.
Amplification products were electrophoresed on 2% agarose and stained
with ethidium bromide. Transfection efficiency was tested by luciferase
assay and varied within threefold. (C and D) Northern blot analysis for
RALDH2 in T-ALL-derived cell lines (C) and other
hematopoietic cell lines (D). Poly(A)+ RNA (2 µg each)
was examined as described for panel A. BALL-1 and Raji, B-cell lines,
HL60, promyelocytic cell line; U937, monocytoid cell line; K562,
erythroleukemia cell line.
|
|
To examine whether expression of RALDH2 is regularly
associated with ectopic expression of TAL1 and
LMO in T-ALL, we performed Northern blot analysis of 13 T-ALL cell lines (54). As shown in Fig. 1C, HPB-ALL, DND4.1,
and TALL-1 cells, which express neither TAL1 nor
LMO (41), did not express RALDH2
either. In contrast, except for Molt15 and Molt17, all of the T-ALL
cell lines that co-express TAL1 and either LMO1
or LMO2 (41) also expressed RALDH2.
Although Molt15 and Molt17 cells, which were the only T-ALL cell lines
with the CD4
CD8
double-negative phenotype
(54), did not express RALDH2 despite coexpression
of TAL1 and LMO2, these results strongly
support the idea that RALDH2 is indeed induced by
coactivation of TAL1 and LMO in the
majority of T-ALL. Among other hematopoietic cell lines tested, K562,
which is an erythroleukemia-derived cell line endogenously expressing
TAL1 and LMO2, also expressed RALDH2
(Fig. 1D).
Transcription of RALDH2 in T-ALL starts from a T-ALL-specific
promoter.
Full-length cDNA clones of RALDH2 were obtained from
Molt4 and K562 cells. The coding sequence of cDNA obtained from
K562 cells showed a striking homology to the mouse RALDH2 gene, and the
deduced amino acid sequence was 98% identical to that of mouse RALDH2.
In contrast, the 5' portion of cDNA obtained from Molt4 cells was
237 bp shorter than that of K562 cells, and the 5'-terminal 28-bp
sequence was not present in the K562 cDNA. Analysis of the genomic
sequence of RALDH2 revealed that the 28-bp sequence was derived from the second intron. All of the clones obtained from Molt4
cells by the 5'RACE method contained the same short 5' portion, suggesting that transcription was initiated from a cryptic promoter within the second intron of the RALDH2 gene in Molt4 cells (Fig. 2A). This was further confirmed by primer
extension analysis and RNase protection assay (data not shown). These
analyses also revealed that there were several transcriptional
initiation sites within ~30 bp around the boundary between the second
intron and third exon of the RALDH2 gene.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Structures of the RALDH2 gene and mRNA. (A) Schematic
illustration of the RALDH2 gene. Boxes and lines correspond to exons
and introns, respectively. The transcription start sites of the
full-length RALDH2 and the T-ALL-type RALDH2 (RALDH2-T) are marked by
arrows. (B) 5' structure of RALDH2 mRNA in T-ALL cell lines. Two types
of RALDH2 cDNA and the positions of primers used for RT-PCR to
distinguish each type are shown schematically at the top. Total RNA
samples prepared from the indicated cell lines were subjected to
RT-PCR. Amplification products were electrophoresed on 2% agarose and
stained with ethidium bromide. Two clones were analyzed for HPB-ALL
cells stably transfected with TAL1 and LMO1. (C) In vitro
translation from two types of RALDH2 mRNA. Both types of RALDH2 cDNA
were transcribed in vitro and translated in rabbit reticulocyte lysate
in the presence of [35S]methionine. Translation products
were analyzed by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and autoradiography.
|
|
To test which types of message were transcribed in other T-ALL cell
lines, RALDH2 transcription was examined by RT-PCR with primer sets specific for the full-length type (F1-R1), the 5'-truncated type (F2-R1), or both (F3-R1) (Fig. 2B). As expected, K562 cells expressed only the full-length type. In contrast, although some full-length type messages were also detected in Molt4 and SALT12 cells,
the major transcripts in T-ALL-derived cell lines were of the truncated
type. Furthermore, HPB-ALL clones stably expressing transfected TAL1
and LMO1 also expressed only the truncated-type mRNA (Fig. 2B). These
results suggest that ectopic expression of TAL1 and LMO in T-ALL
induces transcription mostly if not exclusively from the intronic
promoter of the RALDH2 gene. Furthermore, this alternatively initiated
type of mRNA was not detected in normal human tissues (data not shown),
suggesting that this type of mRNA is highly specific for T-ALL. The
first AUG codon of T-ALL-specific mRNA is in the same frame of the
full-length RALDH2 mRNA, suggesting that the former encodes an
N-terminally truncated protein. To examine this, we performed in vitro
translation experiments. As shown in Fig. 2C, 56 and 46-kDa proteins
were translated from the full-length mRNA and the T-ALL-specific
mRNA, respectively. This suggests that the N-terminally truncated
46-kDa protein is produced in T-ALL cells. We thus designated this
N-terminally truncated form RALDH2-T (T-ALL type).
A GATA site in the RALDH2-T promoter is required for induction by
TAL1 and LMO.
To understand the mechanism of regulation of the
RALDH2-T promoter by TAL1 and LMO (Fig.
3A), we constructed a luciferase reporter
gene containing the 1.7-kb genomic fragment upstream of the first ATG
codon of RALDH2-T (
1.7-luc [see Fig. 4A]) and transfected it with or without TAL1 and LMO into HPB-ALL cells. As
shown in Fig. 3B, either TAL1 or LMO alone did not induce the transcription from the reporter. However, TAL1 and LMO1 or LMO2 transactivated the reporter 18- and 8-fold, respectively. TAL1
and
TAL1
had similar activities in this assay. These results were in
accordance with the induction of the endogeneous RALDH2-T in
HPB-ALL cells by TAL1 and LMO, suggesting that the 1.7-kb genomic fragment contains a regulatory element(s) responsible for the induction
of RALDH2-T by TAL1 and LMO in T-ALL. As shown in Fig. 3A, a
TATA box-like sequence is not seen in the promoter region, but the
major initiation site matches the consensus initiator (Inr) sequence
(24). There are an E-box (CAGGTG) known to be recognized by
TAL1-E2A heterodimers (60) at position
273 (ATG is +1) and
a consensus GATA site (AGATAA) (29, 37) at position
239.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Induction of the RALDH2-T promoter by TAL1 and LMO. (A)
Nucleotide sequence around the promoter region of RALDH2-T.
Exon sequences are boxed. A consensus GATA site, an optimal E-box, and
the putative initiation codon of RALDH2-T are underlined.
Major transcriptional initiation sites are indicated by arrows. (B)
HPB-ALL cells were cotransfected with 20 µg of a luciferase reporter
plasmid containing the 1.7-kb genomic fragment of the RALDH2-T promoter
( 1.7-luc), 0.1 µg of pRL-CMV for normalization of transfection
efficiency, and 5 µg each of expression plasmids without inserts ( )
or with the indicated inserts. Relative luciferase activity compared to
that of the reporter plasmid alone was determined. Means and standard
deviations for three independent experiments are shown.
|
|
To identify responsive elements in the RALDH2-T promoter, we
constructed a series of 5' deletion mutants and examined activation of
these reporters by TAL1
and LMO1 in HPB-ALL cells (Fig.
4A). Unexpectedly, deletion of the
E-box did not affect the response (compare
308-luc with
267-luc). Mutation of the E-box also had little effect on the
transcription from the reporter (data not shown). In contrast, the
deletion removing 3 bases in the GATA site abrogated the induction
of the reporter by TAL1
and LMO1 (compare
231-luc with
228-luc).
Further deletions to position
142 (~50 bp upstream of transcription
start sites) and the deletion downstream of the start site had little
further effect (Fig. 4A and data not shown). To specifically address
the role of the GATA site at position
239, this element was changed
to a restriction site (
1.7GM-luc [Fig. 4B]). The mutation of the
GATA site effectively abrogated the response. These results clearly
indicate that the GATA site at position
239 in the RALDH2-T promoter
is essential for induction by TAL1 and LMO.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Requirement of a GATA site but not an E-box in the
RALDH2-T promoter for induction by TAL1 and LMO. (A) HPB-ALL cells were
cotransfected with one of the indicated RALDH2-T reporter plasmids and
expression vectors for TAL1 and LMO1. The results show fold
activation in luciferase activity from the reporter alone. Means and
standard deviations for three independent experiments are shown. (B)
Mutations introduced in 1.7GM-luc.
|
|
GATA3 is involved in induction of RALDH2-T by TAL1 and
LMO.
Next, we examined the binding of nuclear proteins to the GATA
site in the RALDH2-T promoter. Nuclear extracts were prepared from
HPB-ALL cells and used for EMSA. As shown in Fig.
5A, binding to the GATA site was
observed. This binding was competed out by a 200-fold excess of the
same cold oligonucleotide but not by the same amount of the mutant
oligonucleotide corresponding to the sequence of the GATA mutant
reporter (
1.7GM-luc [Fig. 4B]), suggesting that the binding was
specific for the GATA site. The binding was also competed out by the
T-cell receptor alpha (TCR
) GATA site, suggesting that the binding
protein is a GATA-binding protein family member. Among six members
identified in the GATA-binding protein family, only GATA3 is known to
be expressed in the T-cell lineage (19, 28, 33). Thus,
we used an anti-GATA3 MAb for supershift experiments. The
anti-GATA3 MAb indeed supershifted the binding complex (Fig. 5A),
indicating that the binding protein is GATA3. The same shift band was
observed even with nuclear extracts from an HPB-ALL clone stably
expressing TAL1
and LMO1, suggesting that TAL1
and LMO1 did not
directly bind to this site and that the binding of GATA3 to this site
was not appreciably enhanced by TAL1
and LMO1 (data not shown).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 5.
Involvement of GATA3 in induction of RALDH2-T
by TAL1 and LMO. (A) GATA3 binds to the GATA site in the RALDH2-T
promoter. EMSA was carried out by using nuclear extracts prepared from
HPB-ALL cells and a labeled oligonucleotide spanning the GATA site in
the RALDH2-T promoter. Cold competitors in 200-fold excess or
anti-GATA3 MAb was added as indicated. (B) The GATA3-CFM mutant does
not bind to DNA. COS cells were transfected with wild-type (WT) or
mutant GATA3 expression vectors. EMSA was carried out by using cell
lysates from transfected COS cells and a labeled oligonucleotide
spanning the GATA site in the TCR enhancer. Cold competitors in
200-fold excess or anti-FLAG MAb was added as indicated. Expression of
GATA3 was confirmed by Western blotting (W) with anti-FLAG MAb
( FLAG). The asterisk indicates nonspecific binding. (C) Interaction
between GATA3 and LMO1 or LMO2 in vivo. Cell lysates from 293E cells
transiently transfected with expression vectors for the indicated
tagged proteins were precipitated with anti-FLAG MAb.
Immunoprecipitates (IP) and cell lysates were immunoblotted with
anti-FLAG or anti-HA MAb as indicated. The asterisk indicates
immunoglobulin H. (D) Complex formation between TAL1, LMO2, and GATA3.
293E cells were transiently transfected with expression vectors for
FLAG-GATA3 and HA-TAL1 with or without that for LMO2, and cell lysates
were immunoprecipitated with anti-FLAG MAb. Immunoprecipitates and cell
lysates were immunoblotted with anti-FLAG or anti-HA MAb as indicated.
The asterisk indicates immunoglobulin H or L. (E and F) Effect of GATA3
on induction of the RALDH2-T promoter by TAL1 and LMO. HPB-ALL (E) and
BALL-1 (F) cells were cotransfected with 15 µg of a luciferase
reporter containing the 1.7-kb genomic fragment of the RALDH2-T
promoter ( 1.7-luc), 0.1 µg of pRL-CMV for normalization of
transfection efficiency, and 5 µg each of expression plasmids without
inserts ( ) or with the indicated inserts. Relative luciferase
activity compared to that of the reporter alone was determined. Means
and standard deviations for three independent experiments are shown.
|
|
Next we examined whether overexpression of GATA3 could affect the
activation of the RALDH2-T promoter by TAL1 and LMO. As shown in Fig.
5E, overexpression of GATA3 alone in HPB-ALL cells did not enhance
1.7-luc reporter expression. However, its induction by TAL1
and
LMO was further upregulated by overexpression of GATA3, especially with
the combination of TAL1
and LMO2. Furthermore, a dominant negative
GATA3 (KRR) (53) effectively suppressed induction of the
reporter by TAL1
and LMO. These results strongly support the idea
that GATA3 is involved in the induction of the RALDH2-T promoter by
TAL1 and LMO. This was further confirmed by the same transfection
assays with a B-ALL-derived cell line, BALL-1 (54) (Fig.
5F). We confirmed by RT-PCR that BALL-1 cells did not express TAL1,
LMO1, LMO2, or GATA3 (data not shown). In this cell line, the
1.7-luc reporter gene was not activated even by cotransfection
of TAL1
and LMO. GATA3 alone had no effect either. However,
cotransfection of GATA3, TAL1
, and LMO activated the reporter by
~20-fold. This further supports the idea that GATA3 is involved in
the transactivation of the RALDH2-T promoter by TAL1 and LMO.
These results led us to examine the physical interactions between TAL1,
LMO, and GATA3. TAL1 had been reported to interact with LMO in vivo
(56, 59). This was also confirmed by our experiments (see
Fig. 6B). FLAG-tagged GATA3 and HA-tagged LMO1 or LMO2 were transiently
expressed in 293E cells. As shown in Fig. 5C, HA-LMO1 as well as
HA-LMO2 was coimmunoprecipitated with FLAG-GATA3 from the cell lysates
by an anti-FLAG MAb, suggesting that both LMO1 and LMO2 were capable of
binding to GATA3 in vivo. On the other hand, direct interaction between
TAL1
and GATA3 was not observed (Fig. 5D). However, in the presence
of LMO2, HA-TAL1
was coimmunoprecipitated with FLAG-GATA3,
suggesting that LMO2 is capable of bridging TAL1 and GATA3 to form a
complex in vivo (Fig. 5D). Collectively, these observations strongly
suggest that a complex consisting of TAL1, LMO, and GATA3 is formed in T-ALL cells and that the complex induces transcription from the RALDH2-T promoter.
DNA binding activity of GATA3 is required for transactivation of
the RALDH2-T promoter.
Thus far, we have shown that a GATA site in
the RALDH2-T promoter is essential for the induction by TAL1 and LMO
and that GATA3 acts in collaboration with TAL1 and LMO. Therefore, we
next tested whether the DNA binding activity of GATA3 was necessary for induction of the RALDH2-T promoter. For this purpose, we
constructed a GATA3 mutant lacking the DNA binding activity. In the
case of GATA1, the C-terminal Zn finger is required for DNA binding
activity, and a mutant with cysteines in this region changed to
glycines could not bind to DNA but still interacted with other
transcription factors, such as SP1 (38). Like this GATA1
mutant, the C-terminal Zn finger of GATA3 was mutated to generate
GATA3-CFM. Whole-cell lysates of COS cells transiently expressing
FLAG-GATA3 or FLAG-GATA3-CFM were used for EMSA to test the DNA binding
activity. As shown in Fig. 5B, FLAG-GATA3 bound to the GATA site of the
TCR
enhancer region (19) and was supershifted by the
anti-FLAG MAb. On the other hand, FLAG-GATA3-CFM could not bind to the
same oligonucleotide even though proteins were detected by Western
blotting. It was also demonstrated that GATA3-CFM interacted with LMO2
in vivo by coprecipitation assays (Fig. 5C). These results confirmed
that GATA3-CFM could form a complex with TAL1 and LMO but could not bind to DNA. After these experiments, we tested whether GATA3-CFM was
capable of activating the RALDH2-T promoter in collaboration with TAL1
and LMO. When GATA3-CFM was transfected with TAL1
and LMO, it did
not enhance the transcription from the reporter
1.7-luc in HPB-ALL
cells or induce the transcription in BALL-1 cells (Fig. 5E and F).
Thus, the DNA binding activity of GATA3 is necessary for the
transactivation of the RALDH2-T promoter by the complex containing
GATA3, TAL1, and LMO.
The DNA binding activity of TAL1 is dispensable for induction of
RALDH2-T.
Next we tested whether the DNA binding activity of TAL1
is required for activation of the RALDH2-T promoter. The basic region of bHLH-type transcription factors is known to be the DNA binding domain (8, 11). Therefore, we mutated three amino acids, in
the basic region, RRR, which are highly conserved in various bHLH
proteins (40), to alanines (AAA) and designated this mutant TAL1
-BM (for basic region mutant). To test whether TAL1
-BM could still interact with E47, a partner of the heterodimer, or with LMO, coprecipitation experiments were performed. As shown in Fig. 6A, HA-tagged E47S was coprecipitated
with FLAG-TAL1
-BM as well as with wild-type FLAG-TAL1
.
HA-tagged LMO2 was also coprecipitated with FLAG-TAL1
-BM,
although the interaction appeared to be weaker than that of LMO2 and
wild-type TAL1
(Fig. 6B). These results confirmed that
TAL1
-BM was still capable of binding to E47 and LMO2. Next
we examined the DNA binding activity of TAL1
-BM. As shown in Fig.
6C, binding to the consensus E-box (21) by the lysate of
293E cells expressing both FLAG-TAL1
and HA-E47S was observed. This
binding was inhibited by addition of anti-FLAG MAb, confirming that the
complex contained FLAG-TAL1
. The binding was competed out by
addition of the cold E-box oligonucleotide but not by the cold GATA
site oligonucleotide, confirming that the TAL1-E47 heterodimer was
capable of binding to the consensus E-box but not to the GATA site in
the RALDH2-T promoter. In contrast, no specific binding by the
lysate of 293E cells expressing FLAG-TAL1
-BM and HA-E47S
was observed, even though the protein expression was confirmed by
Western blotting. These results indicated that TAL1
-BM was capable
of forming a heterodimer with E47S but that the resulting dimer did not
efficiently bind to DNA.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
No requirement of DNA binding activity of TAL1 for
induction of RALDH2-T. (A and B) TAL1 -BM can interact
with E47 and LMO2. Cell lysates from 293E cells transiently transfected
with expression vectors for each tagged proteins were
immunoprecipitated (IP) with anti-FLAG MAb ( FLAG).
Immunoprecipitates and cell lysates were immunoblotted (W) with
anti-FLAG or anti-HA MAb as indicated. The asterisk indicates
immunoglobulin L. WT, wild type. (C) TAL1 -BM does not bind to DNA.
293E cells were transfected with expression vectors for wild-type or
mutant TAL1 and E47S. EMSA was carried out by using cell lysates
from transfected 293E cells and the labeled consensus E-box
oligonucleotide. Cold competitors in 200-fold excess or anti-FLAG MAb
was added as indicated. Expression of TAL1 and E47S was confirmed by
Western blotting with anti-FLAG MAb. Asterisks indicate nonspecific
binding. (D and E) TAL1 -BM induces transcription from the RALDH2-T
reporter in collaboration with LMO and GATA3. HPB-ALL (D) and BALL-1
(E) cells were cotransfected with 20 µg (D) or 15 µg (E) of a
luciferase reporter containing the 1.7-kb genomic fragment of the
RALDH2-T promoter ( 1.7-luc), 0.1 µg of pRL-CMV for normalization of
transfection efficiency, and 5 µg each of expression plasmids without
inserts ( ) or with the indicated inserts. Relative luciferase
activity compared to that of the reporter alone was determined. Means
and standard deviations for three independent experiments are shown.
(F) TAL1 -BM induces endogeneous RALDH2-T expression with
LMO in HPB-ALL cells. HPB-ALL cells were cotransfected with 15 µg
each of indicated expression vectors and 1 µg of pRC/CMV-luc by
electroporation. Total RNA was prepared 20 h after transfection
and subjected to RT-PCR analysis for RALDH2 and
E2A (control). The amounts of total RNA used were 10, 2, and
0.4 ng from left to right. Amplification products were electrophoresed
on 2% agarose and stained with ethidium bromide. Transfection
efficiency was tested by luciferase assay and varied within
threefold.
|
|
After these experiments, we examined whether TAL1
-BM was still
capable of inducing the RALDH2-T promoter in collaboration with
LMO and GATA3. As shown in Fig. 6D, TAL1
-BM induced the transcription from the RALDH2-T reporter
1.7-luc in HPB-ALL cells in
the presence of LMO1 or LMO2, although less efficiently than the
wild-type. Similarly, TAL1
-BM in the presence of LMO and GATA3
activated the transcription by ~10-fold in BALL-1 cells, as TAL1
did (Fig. 6E). Furthermore, transiently expressed TAL1
-BM and LMO
induced the expression of endogeneous RALDH2 in HPB-ALL cells (Fig. 6F). These results clearly demonstrated that the DNA binding activity of TAL1, in contrast to that of GATA3, is not necessary for the activation of the RALDH2-T promoter. Thus, TAL1 acts
as a cofactor for GATA3 in the induction of the RALDH2-T promoter.
TAL1, LMO, and GATA3 activate transcription through the GATA
site.
To further demonstrate that the GATA site in the RALDH2-T
promoter was sufficient for the induction of transcription by the combination of TAL1, LMO, and GATA3, it was tandemly repeated three
times and linked to a heterologous HSV tk minimal promoter (36), making GATA×3-tk-luc. This reporter plasmid was
cotransfected into BALL-1 cells with various combinations of expression
plasmids for TAL1
, LMO1, GATA3, and their mutants. As shown in Fig.
7, although parental tk-luc weakly
responded to the combination of TAL1
, LMO1, and GATA3,
GATA×3-tk-luc was further activated by ~7-fold, indicating that
the combination of TAL1
, LMO1, and GATA3 was indeed capable of
activating the transcription through the GATA site alone. As the case
of
1.7-luc, the transcription from GATA×3-tk-luc was activated even
by TAL1
-BM in collaboration with LMO1 and GATA3 but not by
GATA3-CFM even in the presence of TAL1
and LMO1. These results
further demonstrate that TAL1 and LMO induce the transcription of
the RALDH2-T promoter through the GATA site at position
239 by acting
as cofactors for GATA3.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Transactivation of an artificial reporter consisting of
three tandem repeats of the GATA site by TAL1, LMO, and GATA3. BALL-1
cells were cotransfected with 15 µg of an artificial luciferase
reporter (GATA×3-tk-luc or tk-luc), 0.1 µg of pRL-CMV for
normalization of transfection efficiency, and 5 µg each of expression
plasmids without inserts ( ) or with the indicated inserts. tk-luc
contains only the HSV tk minimal promoter. GATA×3-tk-luc
contains three copies of the GATA site from the RALDH2-T promoter
linked to the minimal HSV tk promoter. Relative luciferase
activity compared to that of the reporter alone was determined. Means
and standard deviations for three independent experiments are shown.
WT, wild type.
|
|
 |
DISCUSSION |
We have identified the RALDH2 gene as a transcriptional
target gene for TAL1 and LMO in T-ALL. RALDH2 was
strongly induced in HPB-ALL cells upon stable as well as transient
coexpression of TAL1 and LMO. Most T-ALL-derived cell
lines that ectopically coexpress TAL1 and
LMO also express RALDH2. A T-ALL-specific
alternative promoter present in the second intron of the RALDH2
gene, termed the RALDH2-T promoter, was transactivated by TAL1
and LMO through binding of a TAL1-LMO-GATA3 complex to a
GATA site in the RALDH2-T promoter. These results strongly suggest
that the RALDH2 gene is a first direct downstream gene for the
abberantly activated transcription factors TAL1 and LMO in T-ALL.
Functional synergy between TAL1 and LMO.
Targeted disruption
of either TAL1 or LMO2 resulted in embryonic
lethality by the absence of yolk sac erythropoiesis (48, 52,
61). In erythroid cells, TAL1 and LMO2 are coexpressed and are
thought to regulate erythropoiesis by forming a oligomeric complex with
GATA1, Ldb1, and E2A (60). TAL1 and LMO are also synergistic
in T-cell tumorigenesis in double-transgenic mice (2, 30).
This suggests that a complex consisting of TAL1 and LMO also plays an
important role in the development of T-cell leukemia. In the present
study, we have shown that both TAL1 and LMO are required for abberant
expression of RALDH2-T in T-ALL (Fig. 1 and 3). Although the
role of RALDH2-T in the development of T-ALL is unknown (see below),
complex formation between TAL1 and LMO is likely to be important in the
regulation of expression of target genes involved in tumorigenesis.
The roles of LMO1 and LMO2 in normal development are thought to be
different, since these genes are expressed in different tissues
(15, 18, 35, 49). In fact, LMO2 but not
LMO1 is coexpressed with TAL1 in the
hematopoietic lineage (56). The structures of LMO1 and LMO2
are, however, very similar, and both are capable of interacting with
TAL1 and GATA proteins in vivo (Fig. 5C) (42, 56, 59). Both
are capable of inducing RALDH2 in collaboration with TAL1
(Fig. 1 and 3). Previously, we have shown that TAL1 is
regularly coexpressed with either LMO1 or LMO2 in
most T-ALL cell lines (41). These results suggest that LMO1 and LMO2 are both capable of playing a similar role in T-ALL oncogenesis.
Since target genes regulated by TAL1 and LMO2 in erythroid cells have
not been identified, their transcriptional activity has not been
clarified. However, by using erythroid precursor-derived cell lines,
TAL1 and LMO2 were both shown to maintain erythroid cells in an
immature state and promote self-renewal (17, 58). Thus, the
complex of TAL1 and LMO may promote expression of genes involved in
cell growth in the erythroid cell lineage. This may relate closely to
their roles in T-cell tumorigenesis.
Mechanism of transcriptional regulation of the RALDH2-T promoter by
TAL1 and LMO.
When we identified RALDH2-T as a target
gene induced by TAL1, we expected that an E-box in the promoter region
of RALDH2-T was an important element (Fig. 3A). However, the
results obtained by transient-transfection experiments using a series
of reporter genes with deletions and point mutations clearly
demonstrated that a GATA site at position
239 but not an E-box at
position
273 was necessary for the induction by TAL1 and LMO (Fig.
4). Our data further showed that GATA3 was capable of binding to the GATA site (Fig. 5A) and was involved in the transactivation by TAL1 and
LMO (Fig. 5E and F). The combination of TAL1, LMO, and GATA3 activated
the transcription even from an artificial reporter gene linked to three
tandem repeats of the GATA site (Fig. 7), suggesting that the GATA site
alone is sufficient for transactivation by TAL1 and LMO in the presence
of GATA3. The observations that the TAL1-E47 heterodimer did not bind
to the GATA site (Fig. 6C) and that TAL1
-BM lacking the DNA binding
activity was still capable of inducing RALDH2-T like the
wild-type TAL1
in the presence of LMO and GATA3 (Fig. 6D to F)
further indicate that the direct binding of TAL1 to the promoter is not
required. Together with the fact that the LMO family proteins are
thought to have no DNA binding activity, this indicates that both TAL1
and LMO appear to act as cofactors for GATA3. As illustrated in Fig.
8, GATA3 is likely to bind to the GATA
site in the RALDH2-T promoter region in normal T cells. Importantly,
however, GATA3 alone does not activate transcription from the RALDH2-T
promoter. Only when TAL1 and LMO are ectopically coexpressed in T-ALL,
a large transcriptional complex containing TAL1, LMO, and GATA3 that is
capable of activating the RALDH2-T promoter is formed. Thus, GATA3 may
act as a DNA-binding platform for LMO and TAL1 (Fig. 8).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 8.
Model of transcriptional activation of the RALDH2-T
promoter by TAL1, LMO, and GATA3. In normal T cells, GATA3 binds to the
GATA site in the RALDH2-T promoter but does not activate transcription.
When TAL1 and LMO are ectopically expressed in T-ALL, a large complex
containing TAL1, LMO, and GATA3 is formed on the GATA site in the
RALDH2-T promoter to activate transcription from a downstream initiator
(Inr) (see Discussion).
|
|
Why are both TAL1 and LMO required for the induction of RALDH2-T
expression in T cells? LMO can interact with GATA3 in the absence of
TAL1 in vivo (Fig. 5C), but expression of LMO alone in HPB-ALL cells
did not induce transcription from the RALDH2-T promoter (Fig. 3). Thus,
although it has been reported that LMO1 and LMO2 contain
transactivation domains in the N termini (32, 50), LMO
itself cannot act as a coactivator for GATA3. The role of LMO in the
induction of RALDH2-T expression may be to bridge TAL1 and GATA3 to
form a complex. Since TAL1 does not interact with GATA3 directly (Fig.
5D), the TAL1-E47 heterodimer may act as a transcriptional coactivator
for GATA3 only in the presence of LMO.
Various transcription factors are known to act synergistically
with GATA family proteins. For example, SP1 and EKLF regulate the
globin gene locus control region with GATA1 (38). In
the regulation of endothelin-1 gene expression in endothelial
cells, GATA2 and AP1 act cooperatively (26). In these cases,
GATA family proteins and other factors are known to cooperate by
binding to respective binding sites in the regulatory regions. However,
when one of these sites is mutated, two factors are still capable of activating transcription through the remaining site. In other words,
one factor which does not bind to DNA is still capable of collaborating
with the other DNA-binding factors by acting as a cofactor. Similar
observations have been reported for bHLH-type transcription factors.
Myogenic factor MyoD and MADS box factor MEF2 cooperatively activate
transcription through each binding site reciprocally (39).
Notably, there is a potential E-box besides the GATA site in the
RALDH2-T promoter (Fig. 3). Deletion or mutation of this E-box,
however, did not affect the induction by TAL1 and LMO (Fig. 4 and data
not shown). Moreover, the existence of the E-box did not complement the
mutation in the GATA site for transcriptional activation by TAL1 and
LMO (Fig. 4). Even in the presence of TAL1 and LMO, GATA3-CFM lacking
DNA binding activity could not transactivate the RALDH2-T promoter
(Fig. 5E and F), whereas a similar mutant, GATA1 disr.Cf, was still
capable of acting as a cofactor for SP1 in the globin gene enhancer
(38). Furthermore, the TAL1-LMO-GATA3 complex could not
activate transcription through the three tandem repeats of the most
preferred E-box element (AACAGATGGT) linked to
tk-luc in BALL-1 cells (data not shown). These results suggest that, in
contrast to the other cases described above, the TAL1-LMO-GATA3 complex
activates transcription from the RALDH2-T promoter only through the
GATA site.
Why does GATA3 activate RALDH2-T transcription only by
forming a complex with TAL1 and LMO? In the experiments using
GATA×3-tk-luc in BALL-1 cells, only sevenfold activation was observed
even though three tandem repeats of the element were used (Fig. 7).
This may suggest that other cis-acting elements in the
RALDH2-T promoter are still involved in full induction by TAL1, LMO,
and GATA3. Preliminary data indeed revealed that the selective deletion
of the 50-bp fragment downstream from the GATA site also decreased the
induction of RALDH2-T as did the GATA site mutation (data not shown). This suggests that there is a downstream
cis-acting element(s) that acts synergistically with the
GATA site in the induction of RALDH2-T by the
TAL1-LMO-GATA3 complex. TAL1 and LMO may mediate synergism
between GATA3 and an unknown factor(s) that binds to the
downstream element(s). The TAL1-LMO-GATA3 complex in T-ALL may
contain Ldb1 (also called NL1 or CLIM2) (1, 3, 25),
like the TAL1-LMO2-GATA1 complex in erythroid cells (60). It
was shown that Ldb1 was required for synergistic activation of the
GSU promoter by P-Lim and P-Otx (3). Thus, Ldb1 may play
a role in cooperation between the TAL1-LMO-GATA3 complex and another
factor(s) binding to the downstream regions of the RALDH2-T promoter in
T-ALL. As shown in Fig. 1C, Molt15 and Molt17 cells, which
express TAL1, LMO2, and GATA3 (41), did not express RALDH2-T. Since these cell lines strongly express
TALLA1 (54), which is also apparently induced by
TAL1 and LMO in T-ALL (41), TAL1 and LMO2 are likely to be
functional in these cell lines. This also suggests that some factor(s)
other than GATA3 and not expressed in Molt15 and Molt17 cells, which
are the only CD4
CD8
double-negative lines
among the T-ALL cell lines examined (54), is involved in the
transactivation of the RALDH2-T promoter. Further studies are needed to
elucidate the exact mechanism of RALDH2-T induction in
T-ALL.
Role of RALDH2-T in T-ALL.
RALDH2 was identified as an
enzyme converting retinal to retinoic acid (63). In
fact, RALDH2 is expressed in the trunk region of the
developing embryo, where retinoic acid is produced (63). It
has been shown that retinoic acid inhibits activation-induced apoptosis
of T cells (23, 62). One possibility is that ectopically expressed RALDH2-T inhibits apoptosis of T cells by generating retinoic
acid. To detect retinoic acid in T-ALL cell lines, we transfected a
luciferase reporter gene containing a retinoic acid response element
(31). Even in the presence of retinal as a substrate,
activation of the reporter was not observed (data not shown). One
possibility is that the N-terminally truncated RALDH2-T protein may not
have the enzymatic activity. Alternatively, RALDH2-T may convert
another substrate or act as a dominant negative factor for other
enzymes. The role of RALDH2-T in the development of T-ALL
thus remains to be determined. Besides its potential role in
T-ALL, RALDH2-T may also provide a useful marker for diagnosis and
monitoring of T-ALL, since this type of RALDH2 transcript could not
be detected in normal tissues even by RT-PCR (data not shown).
Furthermore, the RALDH2-T promoter or its GATA site may be exploited
for driving gene expression specifically in T-ALL for therapeutic purposes.
 |
ACKNOWLEDGMENTS |
We thank K. Maruyama for pMIKneo and pMIKhyg, Astar Winoto
for pc-KRR, Tetsuya Yoshida for helpful discussions, and Yorio Hinuma and Masakazu Hatanaka for constant support and encouragement.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Bacteriology, Kinki University School of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan. Phone and fax: 81-723-67-3606. E-mail: o.yoshie{at}med.kindai.ac.jp.
 |
REFERENCES |
| 1.
|
Agulnick, A. D.,
M. Taira,
J. J. Breen,
T. Tanaka,
I. B. Dawid, and H. Westphal.
1996.
Interactions of the LIM-domain-binding factor Ldb1 with LIM homeodomain proteins.
Nature (London)
384:270-272[Medline].
|
| 2.
|
Aplan, P. D.,
C. A. Jones,
D. S. Chervinsky,
X. Zhao,
M. Ellsworth,
C. Wu,
E. A. McGuire, and K. W. Gross.
1997.
An scl gene product lacking the transactivation domain induces bony abnormalities and cooperates with LMO1 to generate T-cell malignancies in transgenic mice.
EMBO J.
16:2408-2419[Medline].
|
| 3.
|
Bach, I.,
C. Carriere,
H. P. Ostendorff,
B. Andersen, and M. G. Rosenfeld.
1997.
A family of LIM domain-associated cofactors confer transcriptional synergism between LIM and Otx homeodomain proteins.
Genes Dev.
11:1370-1380[Abstract/Free Full Text].
|
| 4.
|
Bash, R. O.,
S. Hall,
C. F. Timmons,
W. M. Crist,
M. Amylon,
R. G. Smith, and R. Baer.
1995.
Does activation of the TAL1 gene occur in a majority of patients with T-cell acute lymphoblastic leukemia? A Pediatric Oncology Group study.
Blood
86:666-676[Abstract/Free Full Text].
|
| 5.
|
Begley, C. G.,
P. D. Aplan,
S. M. Denning,
B. F. Haynes,
T. A. Waldmann, and I. R. Kirsch.
1989.
The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif.
Proc. Natl. Acad. Sci. USA
86:10128-10132[Abstract/Free Full Text].
|
| 6.
|
Bernard, O.,
N. Lecointe,
P. Jonveaux,
M. Souyri,
M. Mauchauffe,
R. Berger,
C. J. Larsen, and D. Mathieu-Mahul.
1991.
Two site-specific deletions and t(1;14) translocation restricted to human T-cell acute leukemias disrupt the 5' part of the tal-1 gene.
Oncogene
6:1477-1488[Medline].
|
| 7.
|
Boehm, T.,
L. Foroni,
Y. Kaneko,
M. F. Perutz, and T. H. Rabbitts.
1991.
The rhombotin family of cysteine-rich LIM-domain oncogenes: distinct members are involved in T-cell translocations to human chromosomes 11p15 and 11p13.
Proc. Natl. Acad. Sci. USA
88:4367-4371[Abstract/Free Full Text].
|
| 8.
|
Brennan, T. J.,
T. Chakraborty, and E. N. Olson.
1991.
Mutagenesis of the myogenin basic region identifies an ancient protein motif critical for activation of myogenesis.
Proc. Natl. Acad. Sci. USA
88:5675-5679[Abstract/Free Full Text].
|
| 9.
|
Carroll, A. J.,
W. M. Crist,
M. P. Link,
M. D. Amylon,
D. J. Pullen,
A. H. Ragab,
G. R. Buchanan,
R. S. Wimmer, and T. J. Vietti.
1990.
The t(1;14)(p34;q11) is nonrandom and restricted to T-cell acute lymphoblastic leukemia: a Pediatric Oncology Group study.
Blood
76:1220-1224[Abstract/Free Full Text].
|
| 10.
|
Chen, Q.,
J. T. Cheng,
L. H. Tasi,
N. Schneider,
G. Buchanan,
A. Carroll,
W. Crist,
B. Ozanne,
M. J. Siciliano, and R. Baer.
1990.
The tal gene undergoes chromosome translocation in T cell leukemia and potentially encodes a helix-loop-helix protein.
EMBO J.
9:415-424[Medline].
|
| 11.
|
Davis, R. L.,
P. F. Cheng,
A. B. Lassar, and H. Weintraub.
1990.
The MyoD DNA binding domain contains a recognition code for muscle-specific gene activation.
Cell
60:733-746[Medline].
|
| 12.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 13.
|
Elwood, N. J., and C. G. Begley.
1995.
Reconstitution of mice with bone marrow cells expressing the SCL gene is insufficient to cause leukemia.
Cell Growth Differ.
6:19-25[Abstract].
|
| 14.
|
Finger, L. R.,
J. Kagan,
G. Christopher,
J. Kurtzberg,
M. S. Hershfield,
P. C. Nowell, and C. M. Croce.
1989.
Involvement of the TCL5 gene on human chromosome 1 in T-cell leukemia and melanoma.
Proc. Natl. Acad. Sci. USA
86:5039-5043[Abstract/Free Full Text].
|
| 15.
|
Foroni, L.,
T. Boehm,
L. White,
A. Forster,
P. Sherrington,
X. B. Liao,
C. I. Brannan,
N. A. Jenkins,
N. G. Copeland, and T. H. Rabbitts.
1992.
The rhombotin gene family encode related LIM-domain proteins whose differing expression suggests multiple roles in mouse development.
J. Mol. Biol.
226:747-761[Medline].
|
| 16.
|
Fujiwara, Y.,
C. P. Browne,
K. Cunniff,
S. C. Goff, and S. H. Orkin.
1996.
Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1.
Proc. Natl. Acad. Sci. USA
93:12355-12358[Abstract/Free Full Text].
|
| 17.
|
Green, A. R.,
E. DeLuca, and C. G. Begley.
1991.
Antisense SCL suppresses self-renewal and enhances spontaneous erythroid differentiation of the human leukaemic cell line K562.
EMBO J.
10:4153-4158[Medline].
|
| 18.
|
Greenberg, J. M.,
T. Boehm,
M. V. Sofroniew,
R. J. Keynes,
S. C. Barton,
M. L. Norris,
M. A. Surani,
M. G. Spillantini, and T. H. Rabbits.
1990.
Segmental and developmental regulation of a presumptive T-cell oncogene in the central nervous system.
Nature (London)
344:158-160[Medline].
|
| 19.
|
Ho, I. C.,
P. Vorhees,
N. Marin,
B. K. Oakley,
S. F. Tsai,
S. H. Orkin, and J. M. Leiden.
1991.
Human GATA-3: a lineage-restricted transcription factor that regulates the expression of the T cell receptor alpha gene.
EMBO J.
10:1187-1192[Medline].
|
| 20.
|
Hsu, H. L.,
J. T. Cheng,
Q. Chen, and R. Baer.
1991.
Enhancer-binding activity of the Tal-1 oncoprotein in association with the E47/E12 helix-loop-helix proteins.
Mol. Cell. Biol.
11:3037-3042[Abstract/Free Full Text].
|
| 21.
|
Hsu, H. L.,
L. Huang,
J. T. Tsan,
W. Funk,
W. E. Wright,
J. S. Hu,
R. E. Kingston, and R. Baer.
1994.
Preferred sequences for DNA recognition by the TAL1 helix-loop-helix proteins.
Mol. Cell. Biol.
14:1256-1265[Abstract/Free Full Text].
|
| 22.
|
Hsu, H. L.,
I. Wadman, and R. Baer.
1994.
Formation of in vivo complexes between the TAL1 and E2A polypeptides of leukemic T cells.
Proc. Natl. Acad. Sci. USA
91:3181-3185[Abstract/Free Full Text].
|
| 23.
|
Iwata, M.,
M. Mukai,
Y. Nakai, and R. Iseki.
1992.
Retinoic acids inhibit activation-induced apoptosis in T cell hybridomas and thymocytes.
J. Immunol.
149:3302-3308[Abstract].
|
| 24.
|
Javahery, R.,
A. Khachi,
K. Lo,
B. Zenzie-Gregory, and S. T. Smale.
1994.
DNA sequence requirements for transcriptional initiator activity in mammalian cells.
Mol. Cell. Biol.
14:116-127[Abstract/Free Full Text].
|
| 25.
|
Jurata, L. W.,
D. A. Kenny, and G. N. Gill.
1996.
Nuclear LIM interactor, a rhombotin and LIM homeodomain interacting protein, is expressed early in neuronal development.
Proc. Natl. Acad. Sci. USA
93:11693-11698[Abstract/Free Full Text].
|
| 26.
|
Kawana, M.,
M. E. Lee,
E. E. Quertermous, and T. Quertermous.
1995.
Cooperative interaction of GATA-2 and AP1 regulates transcription of the endothelin-1 gene.
Mol. Cell. Biol.
15:4225-4231[Abstract].
|
| 27.
|
Kelliher, M. A.,
D. C. Seldin, and P. Leder.
1996.
Tal-1 induces T cell acute lymphoblastic leukemia accelerated by casein kinase II .
EMBO J.
15:5160-5166[Medline].
|
| 28.
|
Ko, L. J.,
M. Yamamoto,
M. W. Leonard,
K. M. George,
P. Ting, and J. D. Engel.
1991.
Murine and human T-lymphocyte GATA-3 factors mediate transcription through a cis-regulatory element within the human T-cell receptor delta gene enhancer.
Mol. Cell. Biol.
11:2778-2784[Abstract/Free Full Text].
|
| 29.
|
Ko, L. J., and J. D. Engel.
1993.
DNA-binding specificities of the GATA transcription factor family.
Mol. Cell. Biol.
13:4011-4022[Abstract/Free Full Text].
|
| 30.
|
Larson, R. C.,
I. Lavenir,
T. A. Larson,
R. Baer,
A. J. Warren,
I. Wadman,
K. Nottage, and T. H. Rabbits.
1996.
Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters thymocyte development and potentiates T cell tumorigenesis in transgenic mice.
EMBO J.
15:1021-1027[Medline].
|
| 31.
|
Lefebvre, P.,
M. P. Gaub,
A. Tahayato,
C. Rochette-Egly, and P. Formstecher.
1995.
Protein phosphatases 1 and 2A regulate the transcriptional and DNA binding activities of retinoic acid receptors.
J. Biol. Chem.
270:10806-10816[Abstract/Free Full Text].
|
| 32.
|
Mao, S.,
G. A. Neale, and R. M. Goorha.
1997.
T-cell proto-oncogene rhombotin-2 is a complex transcription regulator containing multiple activation and repression domains.
J. Biol. Chem.
272:5594-5599[Abstract/Free Full Text].
|
| 33.
|
Marine, J., and A. Winoto.
1991.
The human enhancer-binding protein Gata3 binds to several T-cell receptor regulatory elements.
Proc. Natl. Acad. Sci. USA
88:7284-7288[Abstract/Free Full Text].
|
| 34.
|
McGuire, E. A.,
R. D. Hockett,
K. M. Pollock,
M. F. Bartholdi,
S. J. O'Brien, and S. J. Korsmeyer.
1989.
The t(11;14)(p15;q11) in a T-cell acute lymphoblastic leukemia cell line activates multiple transcripts, including ttg-1, a gene encoding a potential zinc finger protein.
Mol. Cell. Biol.
9:2124-2132[Abstract/Free Full Text].
|
| 35.
|
McGuire, E. A.,
A. R. Davis, and S. J. Korsmeyer.
1991.
T-cell translocation gene 1 (Ttg-1) encodes a nuclear protein normally expressed in neural lineage cells.
Blood
77:599-606[Abstract/Free Full Text].
|
| 36.
|
McKnight, S. L.,
E. R. Gavis,
R. Kingsbury, and R. Axel.
1981.
Analysis of transcriptional regulatory signals of the HSV thymidine kinase gene: identification of an upstream control region.
Cell
25:385-398[Medline].
|
| 37.
|
Merika, M., and S. H. Orkin.
1993.
DNA-binding specificity of GATA family transcription factors.
Mol. Cell. Biol.
13:3999-4010[Abstract/Free Full Text].
|
| 38.
|
Merika, M., and S. H. Orkin.
1995.
Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Kruppel family proteins Sp1 and EKLF.
Mol. Cell. Biol.
15:2437-2447[Abstract].
|
| 39.
|
Molkentin, J. D.,
B. L. Black,
J. F. Martin, and E. N. Olson.
1995.
Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins.
Cell
83:1125-1136[Medline].
|
| 40.
|
Murre, C.,
P. S. McCaw, and D. Baltimore.
1989.
A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins.
Cell
56:777-783[Medline].
|
| 41.
|
Ono, Y.,
N. Fukuhara, and O. Yoshie.
1997.
Transcriptional activity of TAL1 in T cell acute lymphoblastic leukemia (T-ALL) requires RBTN1 or 2 and induces TALLA1, a highly specific tumor marker of T-ALL.
J. Biol. Chem.
272:4576-4581[Abstract/Free Full T |