Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 6962-6970, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
p21WAF1/CIP1 Is Upregulated
by the Geranylgeranyltransferase I Inhibitor GGTI-298 through a
Transforming Growth Factor
- and Sp1-Responsive Element:
Involvement of the Small GTPase RhoA
Jalila
Adnane,1
Francisco A.
Bizouarn,1
Yimin
Qian,2
Andrew D.
Hamilton,2 and
Saïd M.
Sebti1,*
Drug Discovery Program, H. Lee Moffitt Cancer
Center, and Department of Biochemistry and Molecular Biology,
University of South Florida, Tampa, Florida
33612,1 and
Department of Chemistry,
Yale University, New Haven, Connecticut2
Received 23 February 1998/Returned for modification 15 May
1998/Accepted 26 August 1998
 |
ABSTRACT |
We have recently reported that the geranylgeranyltransferase I
inhibitor GGTI-298 arrests human tumor cells at the G1
phase of the cell cycle and increases the protein and RNA levels of the
cyclin-dependent kinase inhibitor p21WAF1/CIP1.
Here, we show that GGTI-298 acts at the transcriptional level to induce
p21WAF1/CIP1 in a human pancreatic carcinoma
cell line, Panc-1. This upregulation of
p21WAF1/CIP1 promoter was selective, since
GGTI-298 inhibited serum responsive element- and E2F-mediated
transcription. A functional analysis of the
p21WAF1/CIP1 promoter showed that a GC-rich
region located between positions
83 and
74, which contains a
transforming growth factor
-responsive element and one Sp1-binding
site, is sufficient for the upregulation of
p21WAF1/CIP1 promoter by GGTI-298.
Electrophoretic mobility shift assays showed a small increase in the
amount of DNA-bound Sp1-Sp3 complexes. Furthermore, the analysis of Sp1
transcriptional activity in GGTI-298-treated cells by using GAL4-Sp1
chimera or Sp1-chloramphenicol acetyltransferase reporter revealed a
significant increase in Sp1-mediated transcription. Moreover, GGTI-298
treatment also resulted in increased Sp1 and Sp3 phosphorylation. These
results suggest that GGTI-298-mediated upregulation of
p21WAF1/CIP1 involves both an increase in the
amount of DNA-bound Sp1-Sp3 and enhancement of Sp1 transcriptional
activity. To identify the geranylgeranylated protein(s) involved in
p21WAF1/CIP1 transcriptional activation, we
analyzed the effects of the small GTPases Rac1 and RhoA on
p21WAF1/CIP1 promoter activity. The dominant
negative mutant of RhoA, but not Rac1, was able to activate
p21WAF1/CIP1. In contrast, constitutively
active RhoA repressed p21WAF1/CIP1.
Accordingly, the ADP-ribosyl transferase C3, which specifically inhibits Rho proteins, enhanced the activity of
p21WAF1/CIP1. Taken together, these results
suggest that one mechanism by which GGTI-298 upregulates
p21WAF1/CIP1 transcription is by preventing the
small GTPase RhoA from repressing p21WAF1/CIP1 induction.
 |
INTRODUCTION |
Small G proteins such as Ras, Rho,
and Rac are intimately involved in signaling pathways that
regulate mitogenesis (14, 25, 33). The role of Ras as a
transducer of mitogenic signals from receptor tyrosine kinases to the
nucleus is well established (14, 25, 33). Similarly,
RhoA and Rac1 have been shown to be required for the
G1-to-S-phase transition of the cell cycle during
mitogenesis (29). It is therefore not surprising that these
small G proteins are implicated in pathological conditions, such as
cancer and certain cardiovascular diseases, where aberrant proliferation is involved. Indeed, oncogenic Ras mutations are found in
30% of all human tumors (2, 3). Furthermore, GTP-locked forms of Ras, RhoA, and Rac1 all cause uncontrolled proliferation and
tumor growth (16, 32). Finally, elimination of oncogenic Ras
by homologous recombination in human tumors with multiple genetic
alternations inhibits their ability to grow in nude mice (37). Thus, elimination of oncogenic ras function
alone is sufficient to reverse malignant transformation, and therefore
pharmacological inhibition of small G-protein function would
potentially be an excellent strategy for preventing or curing diseases
in which aberrant proliferation is implicated. One approach that we
have taken is to make pharmacological agents that inhibit prenylation of small G proteins, which is a lipid posttranslational modification required for their function (36).
Protein prenylation is catalyzed by three prenyl transferases that
attach to carboxyl terminal cysteines either a farnesyl, by
farnesyltransferase (FTase), or a geranylgeranyl, by
geranylgeranyltransferase (GGTase) I and II (47). Whereas
FTase and GGTase I recognize proteins that end with carboxyl-terminal
CAAX (where C is cysteine, A is an aliphatic amino acid, and X is any
amino acid) sequences, GGTase II catalyzes geranylgeranylation of
proteins that end with CXC, XXCC, and CCXX sequences. FTase prefers
CAAX sequences where X is methionine, serine, cysteine, or glutamine,
whereas GGTase I prefers leucine or isoleucine at the X position.
Among farnesylated proteins are H-Ras, K-Ras, N-Ras, and lamin B, and
among geranylgeranylated proteins are Rac1, RhoA, and Rap1a
(47). Although the X position of CAAX sequences determines
whether a protein will be a substrate for FTase or GGTase I, there is
some degree of cross-specificity between the two enzymes
(47). For example, a member of the Rho family of small G
proteins, RhoB, is known to be both farnesylated and geranylgeranylated
under normal conditions (18). Furthermore, in human tumor
cells that are treated with FTase inhibitors, K-Ras and N-Ras become
geranylgeranylated (21, 34, 45).
We and others have made CAAX peptidomimetics that are potent inhibitors
of FTase that are selective of FTase over GGTase I (9, 36).
These agents are potent antagonists of oncogenic Ras processing and
signaling and inhibit the growth of murine and human tumors in various
animal models (9, 36). Furthermore, we have recently made
CAAX peptidomimetics that are potent and selective for GGTase I over
FTase and found these also to inhibit human tumor growth in nude mice
(20, 26, 38, 42). Although the mechanisms by which FTase
inhibitors and GGTase I inhibitors inhibit tumor growth are not known,
there are several intriguing differences in their mechanisms of action.
While FTase inhibitors induce apoptosis only when the cells are
prevented from attaching to the substratum (19), GGTase I
inhibitors induce apoptosis of attached cells (27).
Furthermore, GGTase I inhibitors induce a G1 block in a
large number of human tumor cell lines, whereas FTase inhibitors can
either induce a G1 block or a G2/M enrichment or have no effect on cell cycle distribution (41). Finally, GGTase I, but not FTase, inhibitors block platelet-derived growth factor-dependent tyrosine phosphorylation of its receptors
(26).
One possible mechanism by which cells arrest in G1 phase is
mediated by cyclin-dependent kinase (CDK) inhibitors such as
p21WAF1/CIP1.
p21WAF1/CIP1 could mediate G1-phase
arrest through inhibition of CDKs and possibly through inhibition of
DNA replication (43, 46). The fact that inhibition of
protein geranylgeranylation resulted in a G1-phase block in
all cells we have evaluated prompted us to investigate the effects of
GGTase I inhibitors on the cell cycle machinery. Recently, we have
found that treatment of several human tumors with GGTI-298, a GGTase I
inhibitor, induced an accumulation of
p21WAF1/CIP1 (41). Here we show that
the activation of p21WAF1/CIP1 by GGTI-298
occurs at the transcriptional level and that the promoter region
involved contains a Sp1- and transforming growth factor
(TGF-
)-responsive element (T
RE). Furthermore, we have demonstrated that GGTI-298 increased the amount of Sp1 and Sp3 DNA
binding and enhanced Sp1 transcriptional activity. Moreover, we show
that the small GTPase RhoA, but not Rac1, represses
p21WAF1/CIP1 transcription. Thus, our
results suggest that one mechanism by which GGTI-298 upregulates
p21WAF1/CIP1 transcription is by preventing the
small GTPase RhoA from repressing p21WAF1/CIP1 induction.
 |
MATERIALS AND METHODS |
Plasmid constructs.
The p21WAF promoter deletion and mutant
constructs were kindly provided by Xiao-Fan Wang (6).
pSG4+Sp1N, pSG4+Sp1Q, pSG4+Sp1
, and pSG4+Sp1B-C express the GAL4-DNA
binding domain (amino acids 1 to 147) fused to Sp1 transactivation
domain (10). GAL4-VP16 expresses GAL4-DNA binding domain
fused to the acidic activation domain (amino acids 411 to 454) of
herpes simplex virus type 1 VP16 transcription factor. G5BCAT is a
chloramphenicol acetyltransferase (CAT) reporter, which carries five
GAL4-DNA binding sites upstream of E1B minimal promoter and the TATA
box. pCMV-
gal and pSRE plasmids were provided by R. Jove, and
4XE2F-CAT was provided by W. D. Cress (Moffitt Cancer Research
Center, University of South Florida). 6XSp1-CAT was previously
described (1). The pcDNA3 expression vectors encoding for
Rac1 wild type (Rac1-wt), Rac1-115I (activated), Rac1-17N (dominant
negative), RhoA-wt, RhoA-63L (activated), and RhoA-19N (dominant
negative) were constructed by inserting Rac1 and RhoA BamHI
cDNA fragments from pzipNeo (16) into pcDNA3 (Invitrogen) at
the BamHI site.
Tissue culture and transfection.
Panc-1 cells were grown in
Dulbecco's modified Eagle medium (DMEM) (GIBCO/BRL) supplemented with
10% fetal bovine serum (FBS). Panc-1 cells were transfected at 40%
confluence with 6 µg of p21WAF1/CIP1, 4 µg
of Rac1 or RhoA, and 0.5 µg of pCMV-
gal by the calcium phosphate
precipitation method as described previously (1). DNA
precipitates were removed 15 h after transfection, and the cells
were replenished with fresh medium. Cells were harvested 30 h
later and lysed in 200 µl of passive lysis buffer (Promega). Cell
extracts were used for
-galactosidase, luciferase, and CAT assays.
The thin-layer chromatography plates were scanned with a
PhosphorImager, and the percentages of acetylated and nonacetylated forms of chloramphenicol were determined. All transfections were repeated a minimum of three times, and the standard deviations were calculated.
Electrophoretic mobility shift assay (EMSA).
Oligonucleotides corresponding to the wt p21WAF promoter sequences from
86 to
71 (GGTCCCGCCTCCTTG) and from
93 to
62
(GAGCGCGGGTCCCGCCTCCTTGAGGCGGGCCC) and their complementary
sequences were synthesized and annealed. The sequence of the mutant
competitor is GGTTATCTAGAACTG. Two picomoles of annealed wt
oligonucleotides was end labeled with T4 kinase (Gibco BRL) and 50 µCi of [
-32P]ATP. Nuclear extracts were prepared
from both GGTI-298-treated and untreated Panc-1 cells. After two 24-h
treatments with GGTI-298, cells in a 100-mm-diameter plate were washed
three times with 4 ml of cold phosphate-buffered saline (PBS) and then
harvested in 1 ml of TEN solution (40 mM Tris [pH 7.5], 1 mM EDTA
[pH 8.0], 150 mM NaCl). Cells from two plates were combined into one
conical tube and spun 10 min at 4,000 × g. The cell
pellet was resuspended in 60 µl of hypotonic buffer A (10 mM HEPES
[pH 7.9], 1.5 mM MgCl2, 10 mM KCl, 1 µg of
leupeptin/ml, 1 µg of pepstatin/ml, 1 mM dithiothreitol [DTT], 1 mM
phenylmethylsulfonyl fluoride [PMSF]) and transferred to a microfuge
tube. Three cycles of freezing-thawing were performed in dry
ice/ethanol at 37°C. The nuclei (pellet) were recovered by
centrifugation for 1 min at 14,000 × g. The nuclei were
resuspended in 20 µl of buffer C (0.2 mM EDTA [pH 8.0], 20 mM HEPES
[pH 7.9], 1.5 mM MgCl2, 420 mM KCl, 25% glycerol, 1 µg
of leupeptin/ml, 1 µg of pepstatin/ml, 1 mM DTT, 1 mM PMSF) and
incubated 30 min at 4°C. Supernatants were clarified (nuclear
extracts were obtained), and protein concentrations were determined.
Binding reactions were performed at room temperature (RT). The final
volume of the binding reaction mixtures was 20 µl, in which 6 µg of
nuclear extract, 1 µg of poly(dI-dC)/ml, unlabeled specific
competitor, and 2 µl of 10× binding buffer (100 mM Tris [pH 7.5],
50 mM EDTA [pH 8.0], 10 mM MgCl2, 10 mM DTT, 50%
glycerol, 250 mM NaCl) were combined and incubated 10 min at RT.
Radiolabeled probe (40,000 counts per minute) was added, and incubation
was resumed for 20 min at RT. For supershift assays with Sp1 and Sp3, 1 µl of Sp1- or Sp3-specific polyclonal antibody (Santa Cruz
Biotechnology) was added to the binding reaction mixture, and
incubation was resumed for 30 min at RT. Binding reaction products were
resolved on 0.5× Tris-borate-EDTA buffer and 5.0% acrylamide gel at
100 V for 4 h at RT. The gels were subsequently dried and exposed for autoradiography.
ADP-ribosylation by Clostridium botulinum C3
exoenzyme.
C3 exoenzyme (Sigma) was introduced into cells by using
Lipofectamine (Gibco BRL). Briefly, 10 µg of lyophilized C3 exoenzyme was resuspended in 2 ml of buffer (10 mM Tris-HCl [pH 7.5], 114 mM
KCl, 15 mM NaCl, 5.5 mM MgCl2). C3 exoenzyme (2.5 µg, or
500 µl) was mixed with 500 µl of Opti-MEM (Gibco BRL) and 16 µl
of PLUS reagent (Gibco BRL) for 15 min at RT. Meanwhile, in a separate tube, 12 µl of Lipofectamine was mixed with 1 ml of Opti-MEM. Next,
the C3 exoenzyme and Lipofectamine mixtures were combined, and
incubation was resumed for 15 min at RT. Next, cells were washed twice
with 2 ml of Opti-MEM and then incubated with C3 exoenzyme mixture for
15 h at 37°C in 5% CO2. The medium was replaced by
DMEM supplemented with 15% FBS and the incubation was resumed for
24 h. Cells were harvested and lysed in 200 µl of passive lysis
buffer (Promega). Aliquots (20 µl each) of cell lysate were used for
-galactosidase and luciferase assays.
In vivo phosphorylation of Sp1 and Sp3.
Panc-1 cells
(106) were treated with GGTI-298 (15 µM) for 30 h
prior to incubation with ortho[32P]phosphate. Cells were
washed twice with DMEM without phosphate (Gibco BRL) and then incubated
in 2.5 ml of the same medium supplemented with 10% dialyzed FBS (Gibco
BRL) for 1 h. After 2.5 mCi of phosphorus-32 (NEN Life Science
Products) was added to each plate (1 mCi/ml), the incubation was
resumed for 3 h. Afterward, cells were washed twice with ice-cold
PBS and then lysed in 0.5 ml of immunoprecipitation (IP) buffer (30 mM
HEPES [pH 7.5], 10 mM NaCl, 5 mM MgCl2, 25 mM NaF, 1 mM
EGTA, 1% Triton X-100, 10% glycerol, 2 mM sodium orthovanadate, 10 mg
of aprotinin/ml, 10 mg of soybean trypsin inhibitor/ml, 25 mg of
leupeptin/ml, 2 mM PMSF, 6.4 mg of phosphatase substrate/ml). Following
centrifugation to remove cellular debris, 5-µl aliquots of cell
lysate were used to determine protein concentration, and equal amounts
of proteins were used for IP with Sp1 (1:200) and Sp3 (1:100)
polyclonal antibodies (Santa Cruz Biotechnology). The IP was performed
overnight at 4°C. Sp1 and Sp3 immunocomplexes were isolated using
protein A-agarose beads (Santa Cruz Biotechnology). The beads were
washed five times with IP buffer and finally were resuspended in 1×
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
loading buffer, followed by separation on SDS-8% polyacrylamide gel.
Next, the gel was fixed in water-methanol-acetic acid (60%:30%:10%) for 1 h, dried, and exposed for autoradiography.
 |
RESULTS |
GGTI-298 upregulates p21WAF1/CIP1 promoter
activity in human pancreatic tumor cells (Panc-1 cells).
We have
previously shown that GGTI-298 was able to arrest human tumor cells in
the G1 phase of the cell cycle and induce the accumulation
of p21WAF1/CIP1 (41). To evaluate
whether p21WAF1/CIP1 was transcriptionally
activated by GGTI-298 we analyzed the activity of its promoter in
response to GGTI-298. We transiently transfected human pancreatic
carcinoma cells, Panc-1 cells, with a luciferase reporter containing a
full-length p21WAF1/CIP1 promoter and incubated
cells with increasing doses of a GGTase I inhibitor (GGTI-298) for
36 h. The comparison of the relative luciferase activity of
GGTI-298-treated cells with that of the untreated control cells showed
an upregulation of the full-length promoter in a dose-dependent manner
(Fig. 1). p21p
p53, which contains the
p21WAF1/CIP1 promoter lacking the p53 consensus
site, was also upregulated by GGTI-298. The transcriptional activation
of p21 was greater in the absence of the p53-binding site than in its
presence (Fig. 1). These results demonstrate that the activation of
p21WAF1/CIP1 promoter by GGTI-298 is mediated
through a p53-independent pathway.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
GGTI-298 upregulates p21WAF1/CIP1
promoter activity in human pancreatic tumor cells, Panc-1 cells, in a
p53-independent manner. Panc-1 cells were transfected with 4 µg of
p21P, which contains the full-length sequence of p21 promoter, or
p21P p53, which is lacking the p53 consensus site and 0.5 µg of
pCMV- gal as described in Materials and Methods. At 15 h
posttransfection, cells were incubated with increasing doses of
GGTI-298 for 36 h. The fold induction was calculated by dividing
the luciferase activity values of samples treated with GGTI-298 by the
activity of untreated control samples. The samples were normalized for
transfection efficiency against -galactosidase activity. Bars
represent standard deviations. The data are representative of three
independent experiments.
|
|
GGTI-298 upregulates p21WAF1/CIP1 promoter
through a region that contains a TGF-
-responsive element and
Sp1-binding sites.
To pinpoint the region of the
p21WAF1/CIP1 promoter that is upregulated by
GGTI-298, we analyzed deletion mutants truncated in the 5-prime end of
the promoter. As shown in Fig. 2,
GGTI-298 activated by 2.4-fold the full-length promoter (p21P) and by
4.9-fold the promoter lacking the p53 consensus site (p21P
p53). The
constructs with deletions of 1.1 kb (p21P
1.1), 2.1 kb (p21P
2.1),
and 2.3 kb (p21P
2.3) were activated 4-, 7.5-, and 6.7-fold,
respectively. The construct p21PSma, which contains the sequences from
111 through the transcription initiation site, was activated
4.3-fold, suggesting that this region was sufficient for
GGTI-298-mediated p21WAF1/CIP1 promoter
upregulation. Deletion of the sequences between
111 and
62
(p21Sma
1) resulted in a decrease of the promoter basal activity and
GGTI-298-mediated upregulation. Similarly, deletion of the sequences
between
111 and
62 from the full-length promoter (p21PSma
2)
resulted in the loss of the promoter basal activity and the induction
by GGTI-298. Thus, the sequences between
111 and
62, which contain
a TGF-
-responsive element and two Sp1-binding sites, represent the
minimal region for p21WAF1/CIP1 promoter basal
activity and GGTI-298-mediated upregulation. In order to determine
whether the upregulation by GGTI-298 was specific, we transiently
transfected Panc-1 cells with a luciferase reporter that contains the
serum responsive element (SRE) from the c-fos gene promoter.
In contrast to the effects on p21WAF1/CIP1
promoter, GGTI-298 inhibited SRE-mediated transcription by threefold (Fig. 2).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Upregulation of p21WAF1/CIP1
promoter by GGTI-298 is mediated through a region that contains a
T RE and Sp1-binding sites. Panc-1 cells were transfected with the
indicated p21P deletion constructs. At 15 h posttransfection,
cells were incubated in either medium alone or medium containing
GGTI-298 (15 µM) for 36 h as described in Materials and Methods.
The fold induction was calculated by dividing the luciferase activity
values of samples treated with GGTI-298 by the activity of untreated
control samples. The samples were normalized for transfection
efficiency against -galactosidase activity. Panc-1 cells were also
transfected with pSRE to determine specificity of GGTI-298. Each error
bar represents the average deviation for three independent experiments.
The construct map was adapted from Datto et al. (6).
|
|
TGF-
/Sp1-responsive element between
83 and
74 is essential
for p21WAF1/CIP1 promoter activity and
upregulation by GGTI-298.
As described above, the analysis of
p21WAF1/CIP1 promoter deletion mutants allowed
us to identify the region between
111 and
62 as the minimal region
for the upregulation by GGTI-298. This region of the promoter contains
two Sp1-binding sites. The first Sp1 has previously been shown to be
part of a T
RE. To further characterize the nucleotide sequence that
is essential for GGTI-298-mediated upregulation, we analyzed a set of
p21WAF1/CIP1 mutant constructs. p21P93-S, which
contains the wt sequence from
93 to the transcription initiation
site, was upregulated by 3.1-fold (Fig.
3). p21P 93-S 1, which is mutated in the
sequences between
93 and
84, upstream of Sp1 and T
RE, was
activated by fourfold. Similarly, constructs with mutations in
Sp1-binding sites, sequences between
73 and
64 (p21P 93-S 3) and
sequences between
63 and
54 (p21P 93-S 4), were activated 2.9- and
2.7-fold, respectively. In contrast, mutation of the Sp1 and T
RE
sequences between
83 and
74 (p21P 93-S 2) resulted in a significant
decrease of the promoter activity and GGTI-298-mediated upregulation
(0.8-fold activation). Specifically, a two-nucleotide change, CC
GA,
at positions
79 and
78 (p21P 93-S 2.2), which results in the
alteration of Sp1 and T
RE, also abolished GGTI-298-mediated
upregulation (1.1-fold activation). Furthermore, changing the
nucleotides at position
77 and
76, TC
GG, which is the T
RE
region that does not contain the Sp1-binding site, also reduced, from
3.1- to 2.1-fold, GGTI-298 activation (p21P 93-S 2.3) (Fig. 3). Thus,
the region of Sp1 and T
RE between
83 and
74 is essential for the
full response to GGTI-298.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Sp1- and TGF- -responsive element at positions 83 to
78 is essential for GGTI-298-mediated upregulation of p21 promoter
activity. Panc-1 cells were transfected with the indicated p21P mutant
constructs. Starting at 15 h posttransfection, cells were
incubated with GGTI-298 (15 µM) for 36 h. The fold induction was
calculated by dividing the luciferase activity values of samples
treated with GGTI-298 by the activity of untreated control samples. The
samples were normalized for transfection efficiency against
-galactosidase activity. Each error bar represents the average
deviation for three independent experiments. The construct map was
adapted from Datto et al. (6). mut, mutation.
|
|
GGTI-298 increases Sp1- and Sp3-DNA binding to the sequence between
85 and
73 of the p21WAF1/CIP1
promoter.
The analysis of p21WAF1/CIP1
promoter mutants showed that Sp1 and T
RE sequences, from
83 to
74, were required for the upregulation mediated by GGTI-298. To
determine the mechanism through which p21WAF1/CIP1 induction occurs, we performed EMSA
using as a probe the sequence between
85 and
73 of
p21WAF1/CIP1 promoter. The EMSA performed with
nuclear extracts from both GGTI-298-treated Panc-1 cells and untreated
Panc-1 cells and 32P-end-labeled Sp1 and T
RE (
85 to
73) probe revealed four specific bands (Fig.
4). The binding of these nuclear proteins
could be competed by an excess of unlabeled wt
85 to
73
oligonucleotide. However, the mutant competitor, corresponding to the
sequence from
85 to
73 of p21P 93-S 2, which was not upregulated by
GGTI-298 (Fig. 3), was unable to compete for the binding of the
retarded proteins (Fig. 4). Furthermore, the patterns of the retarded
bands were similar whether nuclear extract from GGTI-298-treated
samples or that from control samples was used. In contrast, the
intensity of the retarded bands was increased in GGTI-298-treated
samples (Fig. 4). The sequence from
85 to
73 that encompasses a
T
RE was shown previously to bind to both Sp1 and Sp3. Supershift
experiments in the presence of specific antibodies for Sp1 and Sp3 show
shift of the top band with Sp1 antibody, whereas the second and third bands from the top were both shifted with Sp3 antibody. The pattern of
the fourth band was unchanged by either Sp1 or Sp3 antibodies. None of
the four bands shifted with normal rabbit immunoglobulin G. These
results show the ability of GGTI-298 to enhance Sp1 and Sp3 DNA binding
to the sequences from
85 to
73 of
p21WAF1/CIP1 promoter (Fig. 4).

View larger version (111K):
[in this window]
[in a new window]
|
FIG. 4.
Sp1 and Sp3 interact with GGTI-298-responsive region.
Nuclear extracts from GGTI-298-treated or untreated Panc-1 cells were
incubated with a 32P-labeled probe corresponding to the
sequence from 86 to 71 of the wt p21 promoter. Unlabeled wt or
mutant competitors corresponding to the sequence from 86 to 71 of
the wt p21 promoter and p21P93-S mut 2, respectively, were used.
Polyclonal antibodies to either Sp1, Sp-3, or normal rabbit
immunoglobulin G were included for supershift. Data are representative
of two independent experiments.
|
|
GGTI-298 upregulates Sp1 transcriptional activity.
As we have
shown above, GGTI-298 induces p21WAF1/CIP1
through a region that contains Sp1 and T
RE. To determine the effect
of GGTI-298 on Sp1 transcriptional activity, we used chimeras which
express GAL4-Sp1 fusions consisting of GAL4 DNA binding domain (amino acids 1 to 147) and Sp1 transactivation domain. The use of GAL4-Sp1 fusion proteins, containing different transactivation domains of Sp1,
allows for analysis of the effect of GGTI-298 on Sp1-mediated transcription specifically, independent of Sp1 DNA binding activity. Panc-1 cells were transiently cotransfected with GAL4-Sp1 deletion constructs, G5BCAT reporters, which contain five GAL4-binding sites
upstream of the E1B TATA box, and pCMV-
gal as an internal control
for transfection efficiency. Cells were subsequently incubated with
GGTI-298 (15 µM) for 36 h. After normalization for transfection efficiency, the samples were assayed for CAT activity. As shown in Fig.
5, the transcription mediated by
GAL4-Sp1N (amino acids 83 to 621), GAL4-Sp
(amino acids 262 to 500),
GAL4-Sp1Q (amino acids 339 to 500), and GAL4-Sp1B-C (amino acids 422 to
542) was stimulated in response to GGTI-298. Thus, a region between
amino acids 422 and 500 of Sp1 protein, shown to interact with
TAFII110 (10), is sufficient to confer the
stimulation by GGTI-298. However, these results do not rule out the
possibility that regions outside the 422 to 500 region may contribute
to the observed stimulation by GGTI-298. To determine the specificity
of GGTI-298-mediated stimulation of Sp1 transcriptional activity, we
cotransfected Panc-1 cells with GAL4-VP16, which expresses GAL4-DNA
binding domain fused to the acidic activation domain (amino acids 411 to 454) of herpes simplex virus VP16 transcription factor. The effect
on Sp1 was specific in that no effect of GGTI-298 on transcription mediated by GAL4-VP16 was observed (Fig. 5). This specificity was
further demonstrated by showing that GGTI-298 downregulates E2F-mediated transcription in Panc-1 cells (Fig. 5). Furthermore, transcription mediated by Sp1-CAT reporter, which contains a repeat of
six Sp1-binding sites, was also enhanced by GGTI-298. Taken together,
these results show the ability of GGTI-298 to stimulate selectively
Sp1-mediated transcription and suggest a model in which GGTI-298
upregulates p21WAF1/CIP1 by enhancing both Sp1
transcriptional activity and DNA binding.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
GGTI-298 upregulates Sp1-transcriptional activity.
Panc-1 cells were cotransfected with 1 µg of GAL4-Sp1 constructs, 4 µg of G5BCAT, 2 µg of Sp1-CAT or E2F-CAT, and 0.5 µg of
pCMV- gal. At 15 h posttransfection, cells were incubated with
GGTI-298 (15 µM) for 36 h as described in Materials and Methods.
Samples were normalized for transfection efficiency against
-galactosidase activity and then assayed for CAT activity.
Thin-layer chromatography plates were scanned with a PhosphorImager,
and the percentages of acetylated and nonacetylated forms of
chloramphenicol were determined. The fold induction was calculated by
dividing the CAT activity values of samples treated with GGTI-298 by
the activity of untreated control samples. Data are representative of
three independent experiments.
|
|
GGTI-298 mediates an increase in Sp1 and Sp3 phosphorylation.
As shown in Fig. 5, the transcriptional activity of GAL4-Sp1 fusion was
specifically enhanced by GGTI-298. This result suggested that GGTI-298
might affect Sp1 posttranscriptional modification(s), such as
phosphorylation. To determine whether GGTI-298 could affect the
phosphorylation state of Sp1 and Sp3, GGTI-298-treated and -untreated
cells were labeled with ortho[32P]phosphate as described
in Materials and Methods. Cells were first treated with GGTI-298 (15 µM) for 30 h prior to labeling with
ortho[32P]phosphate. Equal amounts of proteins were
used for immunoprecipitation with Sp1 or Sp3 antibodies, followed by
analysis of the immunocomplexes by SDS-PAGE. GGTI-298 treatment
resulted in increased phosphorylation of both Sp1 and Sp3 (Fig.
6). The phosphorylation state of Sp1 in
GGTI-298-treated cells was markedly higher than that of Sp3. Thus,
phosphorylation of Sp1 and Sp3 could be one of the mechanisms leading
to the enhancement of Sp1-transcriptional activity.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
GGTI-298 mediates an increase in Sp1 and Sp3
phosphorylation. GGTI-298-treated and untreated Panc-1 cells were
labeled with ortho[32P]phosphate as described in
Materials and Methods. Equal amounts of proteins were used for IP with
Sp1 (1:200) and Sp3 (1:100) polyclonal antibodies, followed by analysis
of the immunocomplexes by SDS-8% PAGE. The gel was fixed, dried, and
exposed for autoradiography. Data are representative of two independent
experiments.
|
|
The small GTPase RhoA, but not Rac1, represses
p21WAF1/CIP1 transcription.
The
upregulation of p21WAF1/CIP1 promoter by
GGTI-298 suggested a role of geranylgeranylated proteins in
p21WAF1/CIP1 regulation. Substrates for GGTase
I, such as small GTPases RhoA and Rac1, play important roles in signal
transduction and cell cycle regulation. To determine whether RhoA and
Rac1 are involved in p21WAF1/CIP1 regulation, we
cotransfected Panc-1 cells with p21WAF1/CIP1
promoter and Rac1 or RhoA expression vectors (Fig.
7). At 15 h posttransfection, cells
were incubated in DMEM supplemented with 0.5% FBS for 24 h.
Subsequently, cells were incubated with DMEM supplemented with 15%
FBS, and the incubation was resumed for 24 h. Aliquots of cell lysate
were assayed for
-galactosidase and luciferase assays. As shown in
Fig. 7A, expression of the constitutively active RhoA (63L) resulted in
a threefold repression of p21WAF1/CIP1 promoter
activity. In contrast, the dominant negative mutant of RhoA (19N) had
an opposite effect, in that its expression activated p21WAF1/CIP1 promoter by 2.5-fold. Neither the
dominant negative mutant (Rac1-17N) nor the constitutively active Rac1
(Rac1-115I) had an effect on p21WAF1/CIP1
promoter. These results show the ability of RhoA to repress
p21WAF1/CIP1 transcription.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 7.
The small GTPase RhoA is an upstream effector of
p21WAF1/CIP1. (A) Panc-1 cells were
cotransfected with 6 µg of p21WAF1/CIP1
promoter, 4 µg of Rac1 or RhoA, and 0.5 µg of pCMV -gal
expression vectors. Rac1-115I and RhoA-63L vectors express
constitutively active GTPases. Rac1-17N and RhoA-19N vectors express
dominant negative mutants. Aliquots of cell lysate were subjected to
-galactosidase and luciferase assays. (B) Panc-1 cells were
transfected with p21WAF1/CIP1 promoter, and at
15 h posttransfection cells were incubated in DMEM supplemented
with 0.5% FBS for 24 h. Subsequently, cells were treated with C3
exoenzyme as described in Materials and Methods. Aliquots of cell
lysate were analyzed for -galactosidase and luciferase activities.
Data are representative of at least three independent experiments.
|
|
To further demonstrate the involvement of RhoA in regulating
p21
WAF1/CIP1, we analyzed the activity of
p21
WAF1/CIP1 promoter in cells treated with
C. botulinum C3 exoenzyme. C3
exoenzyme specifically
ADP-ribosylates Rho proteins, which results
in their inactivation.
Panc-1 cells were transfected with p21
WAF1/CIP1
promoter, and at 15 h posttransfection cells were incubated in
DMEM supplemented with 0.5% FBS for 24 h. Subsequently, cells
were treated with C3 exoenzyme as described in Materials and Methods.
Aliquots of cell lysate were analyzed for

-galactosidase and
luciferase activities. As shown in Fig.
7B, C3 exoenzyme mediated
the activation of p21
WAF1/CIP1 promoter.
In contrast, SRE, which was shown to be positively
regulated by Rho
GTPases in response to serum, was downregulated
by C3 exoenzyme. Taken
together, these results demonstrate the
involvement of Rho proteins in
p21
WAF1/CIP1 regulation.
 |
DISCUSSION |
Mutations in the ras oncogene and p53 tumor suppressor
gene are the most frequently identified genetic alterations responsible for human cancers (for reviews see references 5,
2-4, and 22). Thus, recent drug discovery
efforts have focused on developing pharmacological approaches to
suppress ras oncogenic ability and/or to restore p53
function. One mechanism by which p53 keeps cells in check and prevents
aberrant malignant growth involves induction of a G1 arrest
that allows cells to repair DNA damage, initiate programmed cell death,
or differentiate (7, 31). Often, the G1 arrest
is mediated by p53-dependent transcriptional activation of the CDK
inhibitor p21WAF1/CIP1 (8). It is
believed that in about half of human cancers, this important
p53-dependent induction of p21WAF1/CIP1 is
not operational, due to the lack of functional p53. Thus, a desirable
characteristic of novel anticancer agents is restoration of
p21WAF1/CIP1 induction in the absence of
functional p53 in human cancers.
Recently, we made a potent and selective GGTase I inhibitor, GGTI-298,
that blocks human tumors in G1, induces apoptosis, and
inhibits tumor growth in nude mouse xenografts (38, 41). Evaluation of the mechanism by which GGTase I inhibitors arrest cells
in the G1 phase of the cell cycle revealed that GGTI-298 strongly induces p21WAF1/CIP1 accumulation in
human tumors that lack both alleles of the p53 gene (41). In
this study we used a human pancreatic carcinoma cell line,
Panc-1, to demonstrate that GGTI-298 upregulates
p21WAF1/CIP1 at the transcriptional level.
Since p53 protein is one of the major transactivators of p21 promoter,
we tested the effect of GGTI-298 on a p21 promoter that is lacking the
p53-binding site. We found the p53 site to be dispensable for
GGTI-298-mediated upregulation, suggesting a p53-independent mechanism.
In contrast, a small region of the promoter (
84 to
74) comprising a
T
RE that contains an Sp1-binding site was sufficient for
upregulation by GGTI-298. A similar region (
93 to
44) that contains
this T
RE was also shown to be the minimal region for TGF-
-,
butyrate-, phorbol ester-, and okadaic acid-mediated upregulation of
p21WAF1/CIP1 promoter (6, 28, 48).
Sp1-binding sites similar to the one contained in the
GGTI-298-responsive element are bound to a common set of ubiquitously
expressed nuclear proteins which regulate the expression of a variety
of genes, including those encoding p15INK4B, CYP11A, mdr1,
2(I)
collagen, ornithine decarboxylase, pyruvate kinase M, and acetyl
coenzyme A carboxylase (5, 17, 23, 39).
We found Sp1 and Sp3 DNA binding to the sequence from
84 to
74 of
p21WAF1/CIP1 promoter to be enhanced by
GGTI-298. Furthermore, GGTI-298 is capable of activating transcription
from a CAT reporter plasmid that contains six Sp1-binding sites.
Moreover, using chimera that express GAL4-DNA binding domain fused to
Sp1 transactivation domain, we have shown that GGTI-298 is capable of
activating specifically Sp1 transcriptional activity. In contrast, E2F-
and SRE-mediated transcription were repressed. Taken together, these
results show that two different mechanisms could lead to
GGTI-298-mediated p21WAF1/CIP1 induction, one
through the increase of Sp1 affinity for its binding site and the
second through the stimulation of Sp1 transcriptional activity. Sp1 is
a phosphoprotein that has been shown to be phosphorylated by
DNA-dependent protein kinase (see reference 13 for a
review). Interestingly, okadaic acid, a selective inhibitor
of the serine-threonine phosphatase PP2A, was shown to induce
p21WAF1/CIP1 (48), mediate
hyperphosphorylation of Sp1 (35), and increase the
transcriptional activity of Sp1 with a concomitant hyperphosphorylation of Sp1 (24). We have analyzed the phosphorylation states of Sp1 and Sp3 in response to GGTI-298 and found Sp1 and Sp3 to be highly
phosphorylated in GGTI-298-treated cells compared to untreated cells.
Interestingly, the increase in phosphorylation was observed only with
the 106-kDa isoforms of Sp1 and Sp3, suggesting that specific isoforms
may have different functions. Taken together, our results suggest that
GGTI-298-mediated Sp1 phosphorylation may lead to the increase of both
DNA-binding and transcriptional activity of Sp1.
The characterization of the signal transduction pathways that are
involved in GGTI-298-mediated p21WAF1/CIP1
induction may lead to the identification of the proteins involved in
p21WAF1/CIP1 regulation. First of all, GGTI-298
may affect cellular pathways that are used by TGF-
to trigger its
growth-inhibiting effect. Indeed, TGF-
also upregulates p21 promoter
activity through the same region as does GGTI-298 (
84 to
74)
(6). It is interesting that the common
subunit of GGTase
I and FTase has been shown by three independent groups to bind to and
to be phosphorylated by TGF-
receptor (15, 40, 44).
Furthermore, it has been suggested that GGTase I or FTase may be
involved in mediating TGF-
signaling. Clues about the nature of the
signal transduction pathways that are affected by GGTI-298 may also be
obtained from the study of the GGTase I substrates that are involved in
p21 regulation. Several small GTPases involved in signal transduction, such as the Rho family of proteins (i.e., RhoA, RhoB, CDC42Hs, and
Rac1), are prenylated by GGTase I. Research at a number of laboratories
over the past few years has revealed that the Rho GTPases play crucial
roles in the G1/S transition of the cell cycle. For
instance, injection of the constitutively active Cdc42, Rac1, and RhoA
proteins in Swiss 3T3 fibroblasts was shown to stimulate cell cycle
progression through the G1 phase and subsequent DNA
synthesis, whereas injection of dominant negative forms of these
GTPases blocked stimulation of DNA synthesis in response to serum
(29). Rho proteins facilitate the progression from G1 to S phase in growth-stimulated cells by promoting the
degradation of the CDK inhibitor p27Kip1 (12). Furthermore,
the Rho family of GTPases has also been suggested to regulate cell
proliferation by modulating transcription of specific genes, such as
c-fos (11). We found the constitutively active
small GTPase RhoA (63L) to downregulate
p21WAF1/CIP1 promoter. In contrast, the dominant
negative form of RhoA (19N) had an opposite effect in that it activated
p21WAF1/CIP1 promoter. Neither the dominant
negative mutant (Rac1-17N) nor the constitutively active Rac1
(Rac1-115I) had an effect on p21WAF1/CIP1
promoter, suggesting that Rac1 and RhoA may function through different
pathways to control cell cycle progression. We further demonstrated the
involvement of Rho proteins in regulating
p21WAF1/CIP1 by showing the activation of
p21WAF1/CIP1 by C. botulinum C3
exoenzyme, which specifically ADP-ribosylates and inactivates Rho
proteins. These results show the ability of RhoA to regulate
p21WAF1/CIP1, which could be one of the
mechanisms by which RhoA controls cell growth. While this article was
in revision, Olson and coworkers (30) reported that signals
from Ras and Rho GTPases interact to regulate expression of
p21WAF1/CIP1. The authors showed that induction
of DNA synthesis by constitutively active Ras requires Rho signaling
for the suppression of p21WAF1/CIP1 induction.
These results are consistent with our findings and give further support
to the idea that RhoA is the target for GGTI-298. Thus, the present
study suggests that GGTI-298, which inhibits Rho proteins by preventing
their geranylgeranylation, induces p21WAF1/CIP1
and a subsequent arrest in the G1 phase of the cell cycle.
Furthermore, results from this study, coupled with our previous work
(27, 41), also suggest that pharmacological agents capable
of inhibiting protein geranylgeranylation restore cell growth arrest
and apoptosis in cancer cells with a nonfunctional p53.
 |
ACKNOWLEDGMENTS |
We are grateful to X.-F. Wang (Duke University Medical Center)
for supplying the p21WAF1/CIP1 constructs, C. Der (University of North Carolina at Chapel Hill) for RhoA and Rac1
pzip constructs, G. Gill (University of California, Berkeley) for GAL4
constructs, and P. D. Robbins (University of Pittsburgh) for Sp1 constructs.
This work was supported in part by Public Health Service Award CA-67771
from the National Cancer Institute. (S.M.S. and A.D.H.) and by ACS-IRG
from the American Cancer Society (J.A.). The work was also supported in
part by the Molecular Biology Facility at the H. Lee Moffitt Cancer
Center and Research Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Drug Discovery
Program, H. Lee Moffitt Cancer Center, 12902 Magnolia Dr., Tampa, FL 33612. Phone: (813) 979-6734. Fax: (813) 979-6748. E-mail:
sebti{at}moffitt.usf.edu.
 |
REFERENCES |
| 1.
|
Adnane, J.,
Z. Shao, and P. D. Robbins.
1995.
The retinoblastoma susceptibility gene product represses transcription when directly bound to the promoter.
J. Biol. Chem.
270:8837-8843[Abstract/Free Full Text].
|
| 2.
|
Barbacid, M.
1987.
ras genes.
Annu. Rev. Biochem.
56:779-827[Medline].
|
| 3.
|
Bos, J. L.
1989.
ras oncogenes in human cancer: a review.
Cancer Res.
49:4682-4689[Abstract/Free Full Text].
|
| 4.
|
Collins, K.,
T. Jacks, and N. P. Pavletich.
1997.
The cell cycle and cancer.
Proc. Natl. Acad. Sci. USA
94:2776-2778[Free Full Text].
|
| 5.
|
Cornwell, M. M., and D. E. Smith.
1993.
SP1 activates the MDR1 promoter through one of two distinct G-rich regions that modulate promoter activity.
J. Biol. Chem.
268:19505-19511[Abstract/Free Full Text].
|
| 6.
|
Datto, M. B.,
Y. Yu, and X. F. Wang.
1995.
Functional analysis of the transforming growth factor beta responsive elements in the WAF1/Cip1/p21 promoter.
J. Biol. Chem.
270:28623-28628[Abstract/Free Full Text].
|
| 7.
|
Dulic, V.,
W. K. Kaufmann,
S. J. Wilson,
T. D. Tlsty,
E. Lees,
J. W. Harper,
S. J. Elledge, and S. I. Reed.
1994.
p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest.
Cell
76:1013-1023[Medline].
|
| 8.
|
el-Deiry, W. S.,
J. W. Harper,
P. M. O'Connor,
V. E. Velculescu,
C. E. Canman,
J. Jackman,
J. A. Pietenpol,
M. Burrell,
D. E. Hill,
Y. Wang, et al.
1994.
WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis.
Cancer Res.
54:1169-1174[Abstract/Free Full Text].
|
| 9.
|
Gibbs, J. B., and A. Oliff.
1997.
The potential of farnesyltransferase inhibitors as cancer chemotherapeutics.
Annu. Rev. Pharmacol. Toxicol.
37:143-166[Medline].
|
| 10.
|
Gill, G.,
E. Pascal,
Z. H. Tseng, and R. Tjian.
1994.
A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation.
Proc. Natl. Acad. Sci. USA
91:192-196[Abstract/Free Full Text].
|
| 11.
|
Hill, C. S.,
J. Wynne, and R. Treisman.
1995.
The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF.
Cell
81:1159-1170[Medline].
|
| 12.
|
Hirai, A.,
S. Nakamura,
Y. Noguchi,
T. Yasuda,
M. Kitagawa,
I. Tatsuno,
T. Oeda,
K. Tahara,
T. Terano,
S. Narumiya,
L. D. Kohn, and Y. Saito.
1997.
Geranylgeranylated rho small GTPase(s) are essential for the degradation of p27Kip1 and facilitate the progression from G1 to S phase in growth-stimulated rat FRTL-5 cells.
J. Biol. Chem.
272:13-16[Abstract/Free Full Text].
|
| 13.
|
Jackson, S.,
T. Gottlieb, and K. Hartley.
1993.
Phosphorylation of transcription factor Sp1 by the DNA-dependent protein kinase.
Adv. Second Messenger Phosphoprotein Res.
28:279-286[Medline].
|
| 14.
|
Katz, M. E., and F. McCormick.
1997.
Signal transduction from multiple Ras effectors.
Curr. Opin. Genet. Dev.
7:75-79[Medline].
|
| 15.
|
Kawabata, M.,
T. Imamura,
K. Miyazono,
M. E. Engel, and H. L. Moses.
1995.
Interaction of the transforming growth factor-beta type I receptor with farnesyl-protein transferase-alpha.
J. Biol. Chem.
270:29628-29631[Abstract/Free Full Text].
|
| 16.
|
Khosravi-Far, R.,
P. A. Solski,
G. J. Clark,
M. S. Kinch, and C. J. Der.
1995.
Activation of Rac1, RhoA, and mitogen-activated protein kinases is required for Ras transformation.
Mol. Cell. Biol.
15:6443-6453[Abstract].
|
| 17.
|
Kumar, A. P.,
P. K. Mar,
B. Zhao,
R. L. Montgomery,
D. C. Kang, and A. P. Butler.
1995.
Regulation of rat ornithine decarboxylase promoter activity by binding of transcription factor Sp1.
J. Biol. Chem.
270:4341-4348[Abstract/Free Full Text].
|
| 18.
|
Lebowitz, P. F.,
J. P. Casey,
G. C. Prendergast, and J. A. Thissen.
1997.
Farnesyltransferase inhibitors alter the prenylation and growth-stimulating function of RhoB.
J. Biol. Chem.
272:15591-15594[Abstract/Free Full Text].
|
| 19.
|
Lebowitz, P. F.,
D. Sakamuro, and G. C. Prendergast.
1997.
Farnesyl transferase inhibitors induce apoptosis of Ras-transformed cells denied substratum attachment.
Cancer Res.
57:708-713[Abstract/Free Full Text].
|
| 20.
|
Lerner, E. C.,
Y. Qian,
A. D. Hamilton, and S. M. Sebti.
1995.
Disruption of oncogenic K-Ras4B processing and signaling by a potent geranylgeranyltransferase I inhibitor.
J. Biol. Chem.
270:26770-26773[Abstract/Free Full Text].
|
| 21.
|
Lerner, E. C.,
T. Zhang,
D. B. Knowles,
Y. Qian,
A. D. Hamilton, and S. M. Sebti.
1997.
Inhibition of the prenylation of K-Ras, but not H- or N-Ras, is highly resistant to CAAX peptidomimetics and requires both a farnesyltransferase and a geranylgeranyltransferase I inhibitor in human tumor cell lines.
Oncogene
15:1283-1288[Medline].
|
| 22.
|
Levine, A. J.,
M. E. Perry,
A. Chang,
A. Silver,
D. Dittmer,
M. Wu, and D. Welsh.
1994.
The role of the p53 tumour-suppressor gene in tumorigenesis.
Br. J. Cancer
69:409-416[Medline].
|
| 23.
|
Li, J. M.,
M. A. Nichols,
S. Chandrasekharan,
Y. Xiong, and X. F. Wang.
1995.
Transforming growth factor beta activates the promoter of cyclin-dependent kinase inhibitor p15INK4B through an Sp1 consensus site.
J. Biol. Chem.
270:26750-26753[Abstract/Free Full Text].
|
| 24.
|
Lin, M. C.,
F. Almus-Jacobs,
H. H. Chen,
G. C. Parry,
N. Mackman,
J. Y. Shyy, and S. Chien.
1997.
Shear stress induction of the tissue factor gene.
J. Clin. Investig.
99:737-744[Medline].
|
| 25.
|
McCormick, F.
1995.
Ras-related proteins in signal transduction and growth control.
Mol. Reprod. Dev.
42:500-506[Medline].
|
| 26.
|
McGuire, T. F.,
Y. Qian,
A. Vogt,
A. D. Hamilton, and S. M. Sebti.
1996.
Platelet-derived growth factor receptor tyrosine phosphorylation requires protein geranylgeranylation but not farnesylation.
J. Biol. Chem.
271:27402-27407[Abstract/Free Full Text].
|
| 27.
|
Miquel, K.,
A. Pradines,
J. Sun,
Y. Qian,
A. D. Hamilton,
S. M. Sebti, and G. Favre.
1997.
GGTI-298 induces G0-G1 block and apoptosis whereas FTI-277 causes G2-M enrichment in A549 cells.
Cancer Res.
57:1846-1850[Abstract/Free Full Text].
|
| 28.
|
Nakano, K.,
T. Mizuno,
Y. Sowa,
T. Orita,
T. Yoshino,
Y. Okuyama,
T. Fujita,
N. Ohtani-Fujita,
Y. Matsukawa,
T. Tokino,
H. Yamagishi,
T. Oka,
H. Nomura, and T. Sakai.
1997.
Butyrate activates the WAF1/Cip1 gene promoter through Sp1 sites in a p53-negative human colon cancer cell line.
J. Biol. Chem.
272:22199-22206[Abstract/Free Full Text].
|
| 29.
|
Olson, M. F.,
A. Ashworth, and A. Hall.
1995.
An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1.
Science
269:1270-1272[Abstract/Free Full Text].
|
| 30.
|
Olson, M. F.,
H. F. Paterson, and C. J. Marshall.
1998.
Signals from Ras and Rho GTPases interact to regulate expression of p21Waf1/Cip1.
Nature
394:295-299[Medline].
|
| 31.
|
Polyak, K.,
Y. Xia,
J. L. Zweier,
K. W. Kinzler, and B. Vogelstein.
1997.
A model for p53-induced apoptosis.
Nature
389:300-305[Medline].
|
| 32.
|
Qiu, R. G.,
J. Chen,
F. McCormick, and M. Symons.
1995.
A role for Rho in Ras transformation.
Proc. Natl. Acad. Sci. USA
92:11781-11785[Abstract/Free Full Text].
|
| 33.
|
Quilliam, L. A.,
R. Khosravi-Far,
S. Y. Huff, and C. J. Der.
1995.
Guanine nucleotide exchange factors: activators of the Ras superfamily of proteins.
Bioessays
17:395-404[Medline].
|
| 34.
|
Rowell, C. A.,
J. J. Kowalczyk,
M. D. Lewis, and A. M. Garcia.
1997.
Direct demonstration of geranylgeranylation and farnesylation of Ki-Ras in vivo.
J. Biol. Chem.
272:14093-14097[Abstract/Free Full Text].
|
| 35.
|
Sanceau, J.,
T. Kaisho,
T. Hirano, and J. Wietzerbin.
1995.
Triggering of the human interleukin-6 gene by interferon-gamma and tumor necrosis factor-alpha in monocytic cells involves cooperation between interferon regulatory factor-1, NF kappa B, and Sp1 transcription factors.
J. Biol. Chem.
270:27920-27931[Abstract/Free Full Text].
|
| 36.
|
Sebti, S. M., and A. D. Hamilton.
1997.
Inhibition of Ras prenylation: a novel approach to cancer chemotherapy.
Pharmacol. Ther.
74:103-114[Medline].
|
| 37.
|
Shirasawa, S.,
M. Furuse,
N. Yokoyama, and T. Sasazuki.
1993.
Altered growth of human colon cancer cell lines disrupted at activated Ki-ras.
Science
260:85-88[Abstract/Free Full Text].
|
| 38.
|
Sun, J.,
Y. Qian,
A. D. Hamilton, and S. M. Sebti.
1997.
Both farnesyltransferase and geranylgeranyltransferase I inhibitors are required for inhibition of oncogenic K-ras prenylation but each alone is sufficient to suppress human tumor growth in nude mouse xenografts.
Oncogene
16:1467-1473.
|
| 39.
|
Venepally, P., and M. R. Waterman.
1995.
Two Sp1-binding sites mediate cAMP-induced transcription of the bovine CYP11A gene through the protein kinase A signaling pathway.
J. Biol. Chem.
270:25402-25410[Abstract/Free Full Text].
|
| 40.
|
Ventura, F.,
F. Liu,
J. Doody, and J. Massague.
1996.
Interaction of transforming growth factor-beta receptor I with farnesyl-protein transferase-alpha in yeast and mammalian cells.
J. Biol. Chem.
271:13931-13934[Abstract/Free Full Text].
|
| 41.
|
Vogt, A.,
J. Sun,
Y. Qian,
A. D. Hamilton, and S. M. Sebti.
1997.
The geranylgeranyltransferase-I inhibitor GGTI-298 arrests human tumor cells in G0/G1 and induces p21WAF1/CIP1/SDI1 in a p53-independent manner.
J. Biol. Chem.
272:27224-27229[Abstract/Free Full Text].
|
| 42.
|
Vogt, A.,
Y. Qian,
T. F. McGuire,
A. D. Hamilton, and S. M. Sebti.
1996.
Protein geranylgeranylation, not farnesylation, is required for the G1 to S phase transition in mouse fibroblasts.
Oncogene
13:1991-1999[Medline].
|
| 43.
|
Waga, S.,
G. J. Hannon,
D. Beach, and B. Stillman.
1994.
The p21 inhibitor of cyclin-dependent kinases controls DNA replication by interaction with PCNA.
Nature
369:574-578[Medline].
|
| 44.
|
Wang, T.,
P. D. Danielson,
B. Y. Li,
P. C. Shah,
S. D. Kim, and P. K. Donahoe.
1996.
The p21(Ras) farnesyltransferase alpha subunit in TGF-beta and activin signaling.
Science
271:1120-1122[Abstract].
|
| 45.
|
Whyte, D. B.,
P. Kirschmeier,
T. N. Hokenberry,
I. Nunez-Oliva,
L. James,
J. J. Catino,
W. R. Bishop, and J. K. Pai.
1997.
K- and N-Ras are geranylgeranylated in cells treated with farnesyl protein transferase inhibitors.
J. Biol. Chem.
272:14459-14464[Abstract/Free Full Text].
|
| 46.
|
Xiong, Y.,
G. J. Hannon,
H. Zhang,
D. Casso,
R. Kobayashi, and D. Beach.
1993.
p21 is a universal inhibitor of cyclin kinases.
Nature
366:701-704[Medline].
|
| 47.
|
Zhang, F. L., and P. J. Casey.
1996.
Protein prenylation: molecular mechanisms and functional consequences.
Annu. Rev. Biochem.
65:241-269[Medline].
|
| 48.
|
Zhang, W.,
L. Grasso,
C. D. McClain,
A. M. Gambel,
Y. Cha,
S. Travali,
A. B. Deisseroth, and W. E. Mercer.
1995.
p53-independent induction of WAF1/CIP1 in human leukemia cells is correlated with growth arrest accompanying monocyte/macrophage differentiation.
Cancer Res.
55:668-674[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1998, p. 6962-6970, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kazi, A., Carie, A., Blaskovich, M. A., Bucher, C., Thai, V., Moulder, S., Peng, H., Carrico, D., Pusateri, E., Pledger, W. J., Berndt, N., Hamilton, A., Sebti, S. M.
(2009). Blockade of Protein Geranylgeranylation Inhibits Cdk2-Dependent p27Kip1 Phosphorylation on Thr187 and Accumulates p27Kip1 in the Nucleus: Implications for Breast Cancer Therapy. Mol. Cell. Biol.
29: 2254-2263
[Abstract]
[Full Text]
-
Watanabe, M., Fiji, H. D. G., Guo, L., Chan, L., Kinderman, S. S., Slamon, D. J., Kwon, O., Tamanoi, F.
(2008). Inhibitors of Protein Geranylgeranyltransferase I and Rab Geranylgeranyltransferase Identified from a Library of Allenoate-derived Compounds. J. Biol. Chem.
283: 9571-9579
[Abstract]
[Full Text]
-
Leupold, J. H., Asangani, I., Maurer, G. D., Lengyel, E., Post, S., Allgayer, H.
(2007). Src Induces Urokinase Receptor Gene Expression and Invasion/Intravasation via Activator Protein-1/p-c-Jun in Colorectal Cancer. Mol Cancer Res
5: 485-496
[Abstract]
[Full Text]
-
Walker, J. L., Castagnino, P., Chung, B. M., Kazanietz, M. G., Assoian, R. K.
(2006). Post-transcriptional Destabilization of p21cip1 by Protein Kinase C in Fibroblasts. J. Biol. Chem.
281: 38127-38132
[Abstract]
[Full Text]
-
Zeng, Y., Zhuang, S., Gloddek, J., Tseng, C.-C., Boss, G. R., Pilz, R. B.
(2006). Regulation of cGMP-dependent Protein Kinase Expression by Rho and Kruppel-like Transcription Factor-4. J. Biol. Chem.
281: 16951-16961
[Abstract]
[Full Text]
-
Croft, D. R., Olson, M. F.
(2006). The Rho GTPase Effector ROCK Regulates Cyclin A, Cyclin D1, and p27Kip1 Levels by Distinct Mechanisms. Mol. Cell. Biol.
26: 4612-4627
[Abstract]
[Full Text]
-
Wang, D.-A., Sebti, S. M.
(2005). Palmitoylated Cysteine 192 Is Required for RhoB Tumor-suppressive and Apoptotic Activities. J. Biol. Chem.
280: 19243-19249
[Abstract]
[Full Text]
-
Patil, S., Bunderson, M., Wilham, J., Black, S. M.
(2004). Important role for Rac1 in regulating reactive oxygen species generation and pulmonary arterial smooth muscle cell growth. Am. J. Physiol. Lung Cell. Mol. Physiol.
287: L1314-L1322
[Abstract]
[Full Text]
-
Saika, S., Muragaki, Y., Okada, Y., Miyamoto, T., Ohnishi, Y., Ooshima, A., Kao, W. W.-Y.
(2004). Sonic Hedgehog Expression and Role in Healing Corneal Epithelium. IOVS
45: 2577-2585
[Abstract]
[Full Text]
-
Lee, J. Y., Elmer, H. L., Ross, K. R., Kelley, T. J.
(2004). Isoprenoid-Mediated Control of SMAD3 Expression in a Cultured Model of Cystic Fibrosis Epithelial Cells. Am. J. Respir. Cell Mol. Bio.
31: 234-240
[Abstract]
[Full Text]
-
Ray, A., Shakya, A., Kumar, D., Ray, B. K.
(2004). Overexpression of Serum Amyloid A-Activating Factor 1 Inhibits Cell Proliferation by the Induction of Cyclin-Dependent Protein Kinase Inhibitor p21WAF-1/Cip-1/Sdi-1 Expression. J. Immunol.
172: 5006-5015
[Abstract]
[Full Text]
-
Sun, J., Ohkanda, J., Coppola, D., Yin, H., Kothare, M., Busciglio, B., Hamilton, A. D., Sebti, S. M.
(2003). Geranylgeranyltransferase I Inhibitor GGTI-2154 Induces Breast Carcinoma Apoptosis and Tumor Regression in H-Ras Transgenic Mice. Cancer Res.
63: 8922-8929
[Abstract]
[Full Text]
-
Sebti, S. M.
(2003). Blocked Pathways: FTIs Shut Down Oncogene Signals. The Oncologist
8: 30-38
[Abstract]
[Full Text]
-
Joyce, P. L., Cox, A. D.
(2003). Rac1 and Rac3 Are Targets for Geranylgeranyltransferase I Inhibitor-Mediated Inhibition of Signaling, Transformation, and Membrane Ruffling. Cancer Res.
63: 7959-7967
[Abstract]
[Full Text]
-
Roovers, K., Assoian, R. K.
(2003). Effects of Rho Kinase and Actin Stress Fibers on Sustained Extracellular Signal-Regulated Kinase Activity and Activation of G1 Phase Cyclin-Dependent Kinases. Mol. Cell. Biol.
23: 4283-4294
[Abstract]
[Full Text]
-
Doisneau-Sixou, S. F., Cestac, P., Chouini, S., Carroll, J. S., Hamilton, A. D., Sebti, S. M., Poirot, M., Balaguer, P., Faye, J.-C., Sutherland, R. L., Favre, G.
(2003). Contrasting Effects of Prenyltransferase Inhibitors on Estrogen-Dependent Cell Cycle Progression and Estrogen Receptor-Mediated Transcriptional Activity in MCF-7 Cells. Endocrinology
144: 989-998
[Abstract]
[Full Text]
-
Chen, J. C., Zhuang, S., Nguyen, T. H., Boss, G. R., Pilz, R. B.
(2003). Oncogenic Ras Leads to Rho Activation by Activating the Mitogen-activated Protein Kinase Pathway and Decreasing Rho-GTPase-activating Protein Activity. J. Biol. Chem.
278: 2807-2818
[Abstract]
[Full Text]
-
Sharpe, C. C., Hendry, B. M.
(2003). Signaling: Focus on Rho in Renal Disease. J. Am. Soc. Nephrol.
14: 261-264
[Full Text]
-
Lobell, R. B., Liu, D., Buser, C. A., Davide, J. P., DePuy, E., Hamilton, K., Koblan, K. S., Lee, Y., Mosser, S., Motzel, S. L., Abbruzzese, J. L., Fuchs, C. S., Rowinsky, E. K., Rubin, E. H., Sharma, S., Deutsch, P. J., Mazina, K. E., Morrison, B. W., Wildonger, L., Yao, S.-L., Kohl, N. E.
(2002). Preclinical and Clinical Pharmacodynamic Assessment of L-778,123, a Dual Inhibitor of Farnesyl:Protein Transferase and Geranylgeranyl:Protein Transferase Type-I. Molecular Cancer Therapeutics
1: 747-758
[Abstract]
[Full Text]
-
Schwartz, M. A., Assoian, R. K.
(2002). Integrins and cell proliferation: regulation of cyclin-dependent kinases via cytoplasmic signaling pathways. J. Cell Sci.
114: 2553-2560
[Abstract]
[Full Text]
-
Adnane, J., Seijo, E., Chen, Z., Bizouarn, F., Leal, M., Sebti, S. M., Munoz-Antonia, T.
(2002). RhoB, Not RhoA, Represses the Transcription of the Transforming Growth Factor beta Type II Receptor by a Mechanism Involving Activator Protein 1. J. Biol. Chem.
277: 8500-8507
[Abstract]
[Full Text]
-
Wei, L., Imanaka-Yoshida, K., Wang, L., Zhan, S., Schneider, M. D., DeMayo, F. J., Schwartz, R. J.
(2002). Inhibition of Rho family GTPases by Rho GDP dissociation inhibitor disrupts cardiac morphogenesis and inhibits cardiomyocyte proliferation. Development
129: 1705-1714
[Abstract]
[Full Text]
-
Shi, W., Gould, M. N.
(2002). Induction of cytostasis in mammary carcinoma cells treated with the anticancer agent perillyl alcohol. Carcinogenesis
23: 131-142
[Abstract]
[Full Text]
-
Lobell, R. B., Omer, C. A., Abrams, M. T., Bhimnathwala, H. G., Brucker, M. J., Buser, C. A., Davide, J. P., deSolms, S. J., Dinsmore, C. J., Ellis-Hutchings, M. S., Kral, A. M., Liu, D., Lumma, W. C., Machotka, S. V., Rands, E., Williams, T. M., Graham, S. L., Hartman, G. D., Oliff, A. I., Heimbrook, D. C., Kohl, N. E.
(2001). Evaluation of Farnesyl:Protein Transferase and Geranylgeranyl:Protein Transferase Inhibitor Combinations in Preclinical Models. Cancer Res.
61: 8758-8768
[Abstract]
[Full Text]
-
Han, J.-W., Ahn, S. H., Kim, Y. K., Bae, G.-U., Yoon, J. W., Hong, S., Lee, H. Y., Lee, Y.-W., Lee, H.-W.
(2001). Activation of p21WAF1/Cip1 Transcription through Sp1 Sites by Histone Deacetylase Inhibitor Apicidin. INVOLVEMENT OF PROTEIN KINASE C. J. Biol. Chem.
276: 42084-42090
[Abstract]
[Full Text]
-
Adjei, A. A.
(2001). Blocking Oncogenic Ras Signaling for Cancer Therapy. JNCI J Natl Cancer Inst
93: 1062-1074
[Abstract]
[Full Text]
-
Reszka, A. A., Halasy-Nagy, J., Rodan, G. A.
(2001). Nitrogen-Bisphosphonates Block Retinoblastoma Phosphorylation and Cell Growth by Inhibiting the Cholesterol Biosynthetic Pathway in a Keratinocyte Model for Esophageal Irritation. Mol. Pharmacol.
59: 193-202
[Abstract]
[Full Text]
-
Danen, E. H.J., Sonneveld, P., Sonnenberg, A., Yamada, K. M.
(2000). Dual Stimulation of Ras/Mitogen-activated Protein Kinase and RhoA by Cell Adhesion to Fibronectin Supports Growth Factor-stimulated Cell Cycle Progression. JCB
151: 1413-1422
[Abstract]
[Full Text]
-
de Caestecker, M. P., Piek, E., Roberts, A. B.
(2000). Role of Transforming Growth Factor-{beta} Signaling in Cancer. JNCI J Natl Cancer Inst
92: 1388-1402
[Abstract]
[Full Text]
-
Park, J.-S., Qiao, L., Gilfor, D., Yang, M. Y., Hylemon, P. B., Benz, C., Darlington, G., Firestone, G., Fisher, P. B., Dent, P.
(2000). A Role for Both Ets and C/EBP Transcription Factors and mRNA Stabilization in the MAPK-dependent Increase in p21 Cip-1/WAF1/mda6 Protein Levels in Primary Hepatocytes. Mol. Biol. Cell
11: 2915-2932
[Abstract]
[Full Text]
-
Hu, P. P.-c., Shen, X., Huang, D., Liu, Y., Counter, C., Wang, X.-F.
(1999). The MEK Pathway Is Required for Stimulation of p21WAF1/CIP1 by Transforming Growth Factor-beta. J. Biol. Chem.
274: 35381-35387
[Abstract]
[Full Text]
-
Park, J.-S., Carter, S., Reardon, D. B., Schmidt-Ullrich, R., Dent, P., Fisher, P. B.
(1999). Roles for Basal and Stimulated p21Cip-1/WAF1/MDA6 Expression and Mitogen-activated Protein Kinase Signaling in Radiation-induced Cell Cycle Checkpoint Control in Carcinoma Cells. Mol. Biol. Cell
10: 4231-4246
[Abstract]
[Full Text]
-
Park, H.-J., Galper, J. B.
(1999). 3-Hydroxy-3-methylglutaryl CoA reductase inhibitors up-regulate transforming growth factor-beta signaling in cultured heart cells via inhibition of geranylgeranylation of RhoA GTPase. Proc. Natl. Acad. Sci. USA
96: 11525-11530
[Abstract]
[Full Text]
-
Sowa, Y., Orita, T., Minamikawa-Hiranabe, S., Mizuno, T., Nomura, H., Sakai, T.
(1999). Sp3, but not Sp1, Mediates the Transcriptional Activation of the p21/WAF1/Cip1 Gene Promoter by Histone Deacetylase Inhibitor. Cancer Res.
59: 4266-4270
[Abstract]
[Full Text]
-
Sun, J., Qian, Y., Chen, Z., Marfurt, J., Hamilton, A. D., Sebti, S. M.
(1999). The Geranylgeranyltransferase I Inhibitor GGTI-298 Induces Hypophosphorylation of Retinoblastoma and Partner Switching of Cyclin-dependent Kinase Inhibitors. A POTENTIAL MECHANISM FOR GGTI-298 ANTITUMOR ACTIVITY. J. Biol. Chem.
274: 6930-6934
[Abstract]
[Full Text]
-
Zhang, W., Geiman, D. E., Shields, J. M., Dang, D. T., Mahatan, C. S., Kaestner, K. H., Biggs, J. R., Kraft, A. S., Yang, V. W.
(2000). The Gut-enriched Kruppel-like Factor (Kruppel-like Factor 4) Mediates the Transactivating Effect of p53 on the p21WAF1/Cip1 Promoter. J. Biol. Chem.
275: 18391-18398
[Abstract]
[Full Text]
-
Allal, C., Favre, G., Couderc, B., Salicio, S., Sixou, S., Hamilton, A. D., Sebti, S. M., Lajoie-Mazenc, I., Pradines, A.
(2000). RhoA Prenylation Is Required for Promotion of Cell Growth and Transformation and Cytoskeleton Organization but Not for Induction of Serum Response Element Transcription. J. Biol. Chem.
275: 31001-31008
[Abstract]
[Full Text]
-
Huber, H. E., Robinson, R. G., Watkins, A., Nahas, D. D., Abrams, M. T., Buser, C. A., Lobell, R. B., Patrick, D., Anthony, N. J., Dinsmore, C. J., Graham, S. L., Hartman, G. D., Lumma, W. C., Williams, T. M., Heimbrook, D. C.
(2001). Anions Modulate the Potency of Geranylgeranyl-Protein Transferase I Inhibitors. J. Biol. Chem.
276: 24457-24465
[Abstract]
[Full Text]