Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7030-7037, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The T-Cell Oncogenic Protein HOX11 Activates
Aldh1 Expression in NIH 3T3 Cells but Represses Its
Expression in Mouse Spleen Development
Wayne K.
Greene,
Sabine
Bahn,
Norma
Masson, and
Terence H.
Rabbitts*
Division of Protein and Nucleic Acid
Chemistry, MRC Laboratory of Molecular Biology, Cambridge CB2 2QH,
United Kingdom
Received 11 June 1998/Returned for modification 3 August
1998/Accepted 4 September 1998
 |
ABSTRACT |
Hox11 is a homeobox gene essential for spleen formation
in mice, since atrophy of the anlage of a developing spleen occurs in
early embryonic development in Hox11 null mice. HOX11 is
also expressed in a subset of T-cell acute leukemias after specific chromosomal translocations. Since the protein has a homeodomain and can
activate transcription, it probably exerts at least some of its effects
in vivo by regulation of target genes. Representational difference
analysis has been used to isolate cDNA clones corresponding to mRNA
species activated following stable expression of HOX11 in NIH 3T3
cells. The gene encoding the retinoic acid-synthesizing enzyme aldehyde
dehydrogenase 1 (Aldh1), initially called Hdg-1, was found to be
ectopically activated by HOX11 in this system. Study of
Aldh1 gene expression during spleen development showed that
the presence of Aldh1 mRNA inversely correlated with
Hox11. Hox11 null mouse embryos have elevated
Aldh1 mRNA in spleen primordia prior to atrophy, while
Aldh1 seems to be repressed by Hox11 during organogenesis of the spleens of wild-type mice. This result suggests that expression of Aldh1 protein is negatively regulated by Hox11 and
that abnormal expression of Aldh1 in Hox11 null mice may
cause loss of splenic precursor cells by aberrant retinoic acid metabolism.
 |
INTRODUCTION |
The HOX11 protein is a member of the
family of proteins carrying a DNA-binding homeodomain. HOX11
was discovered by its activation in a subset of T-cell acute leukemias
with t(10;14)(q24;q11) or t(7;10)(q35;q24) (6, 10, 18, 23).
This ectopic expression is a contributary factor in the leukemogenesis
of those T-cell tumors with translocations affecting chromosome 10, band q24. While activation of HOX11 is a feature of some
T-cell tumors, the gene is normally not expressed in T cells. In
developing mouse embryos, Hox11 expression is restricted to
some parts of the brain, the developing branchial arches, and the
developing spleen (3, 35, 36). The last site of expression
seems particularly crucial in mouse development, as creation of null
mutations in Hox11 causes mice to be born without spleens
(36) as a result of atrophy of the spleen anlage around
embryonic days 13 to 14 (E13 to E14) (3).
The primary structure of the HOX11 protein suggested that it may be a
transcription factor, mainly because of the homeodomain (4).
Molecular experiments to dissect functional domains of HOX11 confirmed
its ability to bind to specific DNA sequences via the homeodomain
(4, 43) and to activate transcription (26, 50).
The latter ability was due to the presence of modular transcriptional
activation domains (50), of which an
NH2-terminal module is needed for optimal transcription of
a chromosomal target gene (26). In addition, the ability of
HOX11 to interact with the catalytic subunits of protein phosphatases 1 and 2A has also been implicated in tumorigenesis (26), but
the significance of this interaction for Hox11 function in normal mouse
embryogenesis is unclear.
Thus, both the expression of Hox11 during embryogenesis (particularly
in the developing spleen) and the ectopic expression of HOX11 following
chromosomal translocation in T cells may have varying consequences for
the cell. These consequences include activation and repression of gene
expression mediated by the homeodomain binding to DNA in a
sequence-specific manner and modulation of protein function via
protein-protein interactions. The latter mode of action presumably also
has the effect of modulating gene expression indirectly. In the light
of these considerations, it was pertinent to assess the effect on gene
expression after ectopic activation of HOX11 expression. As a model
system, NIH 3T3 cells, which stably express HOX11, were made, and mRNAs
expressed as a result of this were cloned as cDNA fragments. In this
system, we have cloned and characterized two genes, class 1 aldehyde
dehydrogenase (Aldh1) and Slim1. Aldh1 gene
expression seems crucial for mouse spleen development since it shows an
inverse relationship to Hox11 expression in this developing organ.
 |
MATERIALS AND METHODS |
Cell lines.
NIH 3T3 fibroblasts stably expressing HOX11 or
H3-HOX11 (the latter carries a deletion of the third helix of the
HOX11 homeodomain) from the pEF-BOS vector (28) have been
previously described (26) and were grown in Dulbecco
modified Eagle medium supplemented with 10% fetal calf serum.
cDNA synthesis.
Total cytoplasmic RNA was isolated from NIH
3T3 cell lines by Nonidet P-40 lysis, phenol extraction, and ethanol
precipitation. Polyadenylated [poly(A)+] RNA was purified
from total RNA by oligo(dT) cellulose chromatography. In preparing
cDNA, we followed a protocol kindly supplied by Hubank and Schatz
(15). Poly(A)+ RNA (5 µg) and
oligo(dT)12-18 (2 µg) were heated to 70°C for 10 min
in a total volume of 20 µl and then incubated with 1× first-strand
buffer (Gibco BRL), 10 mM dithiothreitol, 0.5 mM each deoxynucleotide
triphosphate, 20 U of RNasin (Promega), and 600 U of Superscript II
reverse transcriptase (Gibco BRL) in a total volume of 40 µl at
37°C for 1 h. Second-strand synthesis was achieved by adding 40 µl of 5× second-strand synthesis buffer [100 mM Tris-HCl (pH 7.5),
500 mM KCl, 25 mM MgCl2, 50 mM
(NH4)2SO4, 50 mM dithiothreitol,
0.25 mg of bovine serum albumin per ml], 2 µl of 15 mM
-NAD, 2 U
of Escherichia coli DNA ligase (New England Biolabs
[NEB]), 2.8 U of RNase H (Pharmacia), and 40 U of E. coli DNA polymerase I (Boehringer Mannheim) in a final volume of 200 µl
and incubating the mixture at 15°C for 2 h and then at 22°C for 1 h. Double-stranded cDNA was phenol-chloroform extracted, ethanol precipitated in the presence of 2 µg of glycogen carrier, and
resuspended in 30 µl of 10 mM Tris-HCl (pH 7.5)-1 mM EDTA (TE).
RDA oligonucleotides.
Oligonucleotides used for
representational difference analysis (RDA) (15) were as
follows: RBgl12, GATCTGCGGTGA; RBgl24, AGCACTCTCCAGCCTCTCACCGCA; JBgl12, GATCTGTTCATG;
JBgl24, ACCGACGTCGACTATCCATGAACA; NBgl12,
GATCTTCCCTCG; and NBgl24, AGGCAACTGTGCTATCCGAGGGAA.
RDA.
RDA was carried out as described previously
(15). Double-stranded cDNA (approximately 2 µg) was
digested with DpnII (NEB), extracted with phenol-chloroform,
and ethanol precipitated. After resuspension, half of the restricted
cDNA was ligated to the RBgl12 (4 µg) and RBgl24 (8 µg)
oligonucleotides overnight at 16°C with 1,200 U of T4 DNA ligase
(NEB) in a 60-µl reaction mixture. Prior to addition of DNA ligase,
the partially complementary RBgl oligonucleotides were annealed by
heating the ligation mixture to 50°C for 1 min and slowly cooling it
to 10°C. The ligations were diluted to 200 µl with TE and amplified
by PCR with the RBgl24 oligonucleotide as the primer and 5 U of
Amplitaq (Perkin-Elmer Cetus) in a 200-µl volume. Twenty identical
reaction mixtures were prepared, with each receiving 2 µl of the
diluted ligation mixture. PCR samples were incubated at 72°C for 3 min to melt the RBgl12 oligomer before addition of the polymerase.
After a further 5 min at 72°C to fill in the ends, the samples were
subjected to 20 cycles of PCR (95°C for 1 min and 72°C for 3 min)
and then combined, extracted with phenol-chloroform, precipitated with
isopropanol, and resuspended in 600 µl of water.
Driver DNA was prepared by digesting the cDNA representations (600 µl) with DpnII, followed by phenol-chloroform extraction and isopropanol precipitation. Tester DNA was prepared by gel purifying
1/10 of the driver DNA with the Qiaex II system (Qiagen) and ligating
it to the JBgl12 and JBgl24 adapters as described above. The first
hybridization was performed by combining 0.4 µg of the NIH 3T3 HOX11
tester DNA with 40 µg of NIH 3T3 driver DNA (a ratio of 1:100). The
mixture was ethanol precipitated and resuspended in 4 µl of EE × 3 buffer, i.e., 30 mM
N-(2-hydroxyethyl)piperazine-N-(3-propanesulfonic acid) (pH 8.0)-3 mM EDTA, and covered with mineral oil. After heating
the resuspension to 98°C for 5 min, 1 µl of 5 M NaCl was added and
the solution was incubated at 67°C for 20 h. Following hybridization, the mixture was diluted to 400 µl with TE along with
40 µg of yeast RNA as the carrier.
Amplification of the reannealed tester was performed by adding 20 µl
of the diluted hybridization mix to a 200-µl PCR mixture,
with the
JBgl24 oligonucleotide as the primer as described above.
After 10 cycles of PCR, the reaction mixtures were phenol-chloroform
extracted,
isopropanol precipitated, and resuspended in 40 µl
of 0.2× TE. To
remove single-stranded amplification products,
half of the initial PCR
products were incubated with 20 U of mung
bean nuclease in a 40-µl
volume at 30°C for 35 min. The reaction
was stopped by adding 160 µl of 50 mM Tris-HCl (pH 8.9) and incubating
the mixture at 98°C
for 5 min. PCR amplification was continued
by adding 20 µl of the
mung bean nuclease-digested products to
a 200-µl PCR mixture as
described above. After a further 18 cycles
of PCR, the products were
extracted with phenol-chloroform, precipitated
with isopropanol, and
resuspended in 100 µl of TE as the first
difference product
(DP1).
DP1s were digested with
DpnII and ligated to new adapters
(NBgl12 and -24), and the RDA procedure was repeated as described
above
with tester-driver ratios of approximately 1:800, 1:400,000,
and
1:8,000,000 for the second, third, and fourth rounds, respectively.
J
adapters were ligated to the tester for the third round, and
N adapters
were ligated for the fourth round. At the end of the
procedure, DPs
were cut with
DpnII, gel purified, and cloned into
the
BamHI site of pBluescript KS(+) (Stratagene). Transformed
TG1 bacterial colonies were screened by colony hybridization with
the
NIH 3T3 and NIH 3T3 HOX11 cDNA representations as
probes.
Filter hybridization analysis.
Total RNA was isolated from
cultured NIH 3T3 cells by Nonidet P-40 lysis. For Northern
hybridizations, RNA samples (10 µg) were denatured with glyoxal
(50°C for 1 h), electrophoresed on 1.4% agarose gels, and
transferred to nylon membranes (45). 32P-labelled probes were prepared by random priming
(7), and the filters were hybridized in hybridization buffer
containing 3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate), 10× Denhardt's solution, 0.1% sodium dodecyl sulfate, and
250 mg of salmon sperm DNA per ml at 65°C for 16 h
(5). The filters were washed in 0.1× SSC-0.1% sodium
dodecyl sulfate at 65°C and subjected to autoradiography at
70°C.
DNA filter hybridization (
5,
41) was carried out essentially
as described previously (
21). The
HOX11 probe
used was
a 1,025-bp coding region cDNA fragment. The

-actin probe
was
a 500-bp cDNA fragment generated by reverse transcription (RT)-PCR.
The
Slim1 (483 bp),
Aldh1 (517 bp), and
ATP
synthase (250 bp)
probes were
DpnII cDNA fragments
obtained from the RDA procedure.
The T-cell receptor

chain
(
TCR
) probe was a 750-bp cDNA isolated
from pM131B10BB1
(
39). The
Hox2.9 probe was an 876-bp cDNA
fragment.
Western blotting.
Western blotting was carried out as
described previously with rabbit polyclonal antiserum raised against a
bacterially expressed HOX11 protein (26).
In situ RNA hybridization.
Cryosections (14 µm) of mouse
embryos, either from Hox11 homozygous mutant (
/
) (3) or
wild-type (C57BL.6) embryos at E12.5 and E13.5, were fixed in 4%
paraformaldehyde and pretreated with 0.25% acetic anhydride in 0.1 M
triethanolamine for 10 min. Hybridization was performed overnight with
probes 3' end labelled with 35S-dATP as previously
described (47, 48).
Antisense oligonucleotides used were as follows: for
Hox11,
GTGAACCTGTCCTTTGTGTATCTGCGGTTACTCTCCATCC and
AGTGTAGGCGCCTCCAACCAAACAGCCAAGGCCATAGTCT,
which correspond
to mRNA positions 536 to 575 and 129 to 168,
respectively; for
Aldh1, ACAGCTAAGGGCAGGGCCTATCTTCCAAATGAACATGAGC
and CTGAGGGACAGAGCTTAAGTCACAACTAGTCCTCCTCACC, which
correspond
to mRNA positions 519 to 558 and 1805 to 1844, respectively; for
Aldh2,
GGTTGCCAGGGCTGGGCCCAGTTTCCATGCTTGCATCAGG and
GCACATCTGGACGCGTGATCGGTCTGCACTGAGCTTCATC,
which correspond
to mRNA positions 573 to 612 and 1742 to 1781,
respectively; and for
Tal1 (or
Scl),
CAACCCAGGGGCCTAAAGGCCCCTGCCTGCTGGCCCTGGGCAGCC,
which
corresponds to mRNA positions 1000 to 1044. All numbering
is
relative to the start site of the ATG initiation
codon.
 |
RESULTS |
RDA cloning of HOX11-activated genes in NIH 3T3 cells.
Differential cDNA cloning methods, such as RDA (15, 22),
provide the means to compare different mRNA expression profiles. We
used cDNA RDA to compare levels of gene expression between NIH 3T3
cells and NIH 3T3 cells ectopically expressing HOX11 (3T3-HOX11) following stable transfection. RDA was performed with NIH 3T3 or
3T3-HOX11 cDNA representations as either the driver or the tester
(15). Only when we used 3T3-HOX11 as the tester could consistent bands be detected (by DP2) after agarose gel electrophoresis (Fig. 1A, 3T3 HOX11 lanes DP2 to DP4), and one of these, a 267-bp band,
hybridized strongly with a HOX11 probe (Fig. 1B). Thus, HOX11 was rapidly enriched by the RDA procedure, reaching a
maximal level by the DP3 round (Fig. 1B). Conversely, hybridization
with a
-actin probe showed depletion of this sequence, which is
common to the driver and tester, from the DP3 and DP4 rounds of
subtracted cDNA when RDA subtraction was carried out with cDNA of
either polarity (Fig.
1B).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Enrichment of 3T3-HOX11 DPs by cDNA RDA. (A)
Ethidium-stained agarose gel electrophoresis of starting cDNA
DpnII fragment representations and various RDA enriched
populations obtained by mutual subtraction of NIH 3T3 cells (3T3) with
3T3-HOX11 (left lanes show products obtained with NIH 3T3 cells as the
tester and right lanes show products obtained with 3T3-HOX11 cells as
the tester). Tester representation (R; unselected cDNA) and DP1, DP2,
DP3, and DP4 are shown. The arrow indicates an enriched HOX11
DpnII fragment identified by Southern filter hybridization with a
HOX11-specific probe. (B) Southern filter hybridizations
(with Slim1, Aldh1, HOX11, and
-actin probes as indicated) of the agarose
gel-fractionated RDA DPs shown in panel A. Fragment sizes are
indicated. (C) Northern filter hybridization of 10 µg of total RNA
prepared from untransfected NIH 3T3 cells and three independent
3T3-HOX11 clones and hybridized with HOX11,
Slim1, Aldh1, and ATP synthase probes
(as indicated). 3T3-HOX11 clones 5 and 18 were found to express HOX11
protein, while clone 11 did not (data not shown). Hybridization of the
filter with ATP synthase was used to assess the quality of
the RNA transferred.
|
|
cDNA sequences enriched when 3T3-HOX11 cDNA was used as the tester were
identified by cloning gel-purified DPs, followed by
sequential
hybridization with NIH 3T3 and 3T3-HOX11 cDNA representations
as
probes. After we screened 264 recombinant colonies, we identified
126 differentially expressed clones, of which 77% represented
HOX11. DNA sequencing revealed that the other clones fell
into
two main groups. One group, 10% of the clones, corresponded to
the human and mouse
SLIM1 and
Slim1 genes, which
encode a novel
LIM-only protein with four and a half LIM domains
(
29), also
called Kyo-T1 (
44), and another group,
7% of the clones, corresponded
to the mouse
Ahd-2 gene,
which encodes class 1 (cytosolic) aldehyde
dehydrogenase
(
37). This gene was provisionally called
Hdg-1 when it was first isolated (
26).
The characteristics of enrichment of
Slim1 and
Aldh1 cDNAs were assayed by hybridization of
appropriate probes to filters
with aliquots of cDNA from each selected
round (DP1 to DP4) and
either untransfected NIH 3T3 or the 3T3-HOX11
clone as the tester
mRNA population (Fig.
1B). This hybridization
analysis revealed
that both
Slim1 and
Aldh1 cDNAs
were enriched in the 3T3-HOX11
tester in a manner which paralleled that
of the
HOX11 cDNA. The
consistent ability of HOX11 to
stimulate both
Slim1 and
Aldh1 mRNA production
was assayed by Northern hybridization of RNAs
from three different NIH
3T3 clones stably transfected with the
HOX11 expression
vector, two of which expressed
HOX11 mRNA (Fig.
1C, clones 5 and 18) and one of which did not (Fig.
1C, clone
11). These assays
demonstrated that HOX11-positive clones 5 and
18 express both
Slim1 and
Aldh1 mRNAs but that untransfected NIH
3T3 cells or transfected, nonexpressing clone 11 does not. However,
in
a wider analysis we observed that while
Aldh1 was always
activated
in HOX11-expressing NIH 3T3 clones,
Slim1 was
activated only in
a proportion (about 50%; data not shown). The reason
for this
difference is obscure at present but may reflect clonal
variation
in responsiveness in the NIH 3T3 population, perhaps with
respect
to expression of a cofactor. Nonetheless, the data indicate a
clear relationship between
Aldh1 activation and HOX11
protein
in this
system.
ALDH1 expression in human lymphoid cell lines.
The
HOX11 gene was first discovered through its activation by
the chromosomal translocation t(10;14) or t(7;10) in some T-cell acute
leukemias. Possible effects of HOX11 expression on both ALDH1 and SLIM1 mRNA levels in human lymphoid
cell lines were assayed by Northern filter hybridization (Fig.
2). Each lane of RNA was assessed for
integrity and loading by hybridization with an ATP synthase
probe (Fig. 2, bottom section) and with a TCR
or
HOX11 probe for the T-cell lines. ALDH1 mRNA
expression was surprisingly restricted and was detectable only in HEL
cells (a cell line derived from a human erythroleukemia) and a small
cell lung carcinoma line (LUDLU). Low levels of ALDH1 mRNA
were found in HepG2. It is noteworthy that none of the T-ALL lines
(including two derived from T-ALL tumors with translocations of
chromosome 10, band q24, involving the HOX11 gene) express
sufficient ALDH1 mRNA to be detected in this Northern blot
assay. Conversely, SLIM1 mRNA was found in most of the T-ALL
lines (Fig. 2) as well as in one pre-B-ALL line (ACVA-1) and a
neuroblastoma line (N417). High levels of SLIM1 mRNA were
also found in the HepG2 liver cell line. The expression of
SLIM1 in these cancer cell lines is noteworthy, as previous
studies of normal tissues have shown that levels of expression of
SLIM1, as judged by Northern blot analysis, were high in
skeletal and heart muscles but were barely detectable in lymphoid
tissues and completely absent in liver (29, 30, 44).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of ALDH1 and SLIM1
mRNAs in T- and B-lymphoid cell lines. Results of Northern filter
hybridization of total RNAs from the indicated cell lines with
Slim1, Aldh1, HOX11,
TCR , and ATP synthase probes are shown. RNAs
were extracted from the T-cell lines (T) KOPT-K1, RPMI 8402, ALL-SIL,
PER-255 (the last two carrying 10q24 translocations involving
HOX11), SUP-T1, SUP-T13, CCRF-CEM (CEM), NALM, HBP-ALL,
PER-117, and Jurkat or from the B-cell lines. (B) 38B9, WEHI-231, RAJI,
and ACVA-1. N417 is a neuroblastoma line; LUDLU is a small cell lung
carcinoma line; HEL, K562, and 707 are erythroid lines, and HepG2 is a
hepatoma line.
|
|
Specificity of Aldh1 and Slim1 induction in
3T3-HOX11 cells.
The specificity of Aldh1 gene
activation was analyzed by distinct transfection experiments involving
NIH 3T3 cells expressing various HOX11 constructs as well as
an unrelated Hox gene, Hox2.9 (8, 31). First, the
effect of inactivating the HOX11 homeodomain was tested by stably
transfecting NIH 3T3 cells with either a mutant of HOX11
lacking the third helix of the homeodomain,
H3-HOX11 (26), complete HOX11, or the vector only (Fig.
3A). RNAs were isolated from three
independent cell clones from each transfection, and Northern blot
analysis was carried out. While HOX11 mRNA was detected in
HOX11 and
H3-HOX11 transfected clones (but not in the vector-only
control clones) (Fig. 3A, BOS lanes), only the HOX11 clones showed
transcriptional activation of the Aldh1 gene. Little or no
Aldh1 mRNA was found in the mutant HOX11 clones
despite both Hox11 mRNA (Fig. 3A) and protein being
detectable in the clones (in Fig. 3A, the bottom section shows a
Western blot developed with anti-HOX11 antiserum).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Specificity of Aldh1 induction by ectopic
expression of HOX11 RNA, extracted from NIH 3T3 cell clones stably
transfected with various HOX11 or Hox2.9
expression constructs, was analyzed by Northern filter hybridization
with Aldh1, HOX11, Hox2.9, and
ATP synthase probe as indicated. (A) Induction of
Aldh1 mRNA by ectopic expression of HOX11 protein. RNAs were
isolated from three independent NIH 3T3 clones stably transfected with
either a HOX11 expression construct (HOX11 controlled by the pEF-BOS
expression cassette [HOX11]), a HOX11 expression construct
encoding a mutant HOX11 protein lacking the third helix of the
homeodomain ( H3-HOX11), or the expression vector only (BOS).
Aliquots were fractionated and transferred to nylon membranes prior to
hybridization with an Aldh1, a HOX11, or an
ATP synthase probe. Protein extracts were also prepared from
these NIH 3T3 clones and analyzed by Western blotting. The presence of
HOX11 protein was assayed (bottom section) with anti-HOX11 antiserum
(26). (B) Stimulation of Aldh1 mRNA expression by
HOX11 via the MT promoter. NIH 3T3 clones expressing
HOX11 were incubated in the presence or absence of 50 µM
zinc for 36 h. RNAs were prepared, fractionated, and transferred
to nylon membranes. These were hybridized to Aldh1 and
ATP synthase probes. Clone 1 is a control not expressing
HOX11 protein (as shown by the Western blot developed with anti-HOX11
antiserum [bottom section]), and clone 2 is a HOX11-expressing line
(see bottom section). (C) Aldh1 gene expression in response
to HOX11 protein expression. We obtained NIH 3T3 clones which were
stably transfected with pEF-BOS-HOX11 or pEF-BOS-Hox2.9. Two clones
were selected for their expression of HOX11 or
Hox2.9 mRNA. RNA was prepared, electrophoresed, and
transferred to nylon filters. These filters were hybridized with
Aldh1, HOX11, Hox2.9, and ATP
synthase probes as indicated.
|
|
A similar dependence of
Aldh1 induction on the ectopic
expression of HOX11 in NIH 3T3 cells was found when HOX11 expression
was controlled by the metallothionein (MT) promoter. Proteins
extracted
from NIH 3T3 clones isolated after transfection with
the MT-HOX11
expression vector or the vector only were analyzed
by Western blotting
with anti-HOX11 antiserum following induction
with zinc. A moderate
induction of HOX11 protein production was
found in this system (three-
to fourfold) (Fig.
3B, lower section),
and HOX11 protein was found only
in the MT-HOX11 clones. In Northern
(RNA) blot analysis, when the
control
ATP synthase mRNA levels
were compared to those of
Aldh1, it was found that
Aldh1 gene
expression is
confined to the MT-HOX11 clones. However, only a
slight difference was
seen in the
Aldh1 levels in uninduced and
induced cells
(Fig.
3B, top section), indicating that HOX11 protein
levels in
uninduced cells, due to leakiness of the MT promoter,
are sufficient
for its role in activating
Aldh1 expression in
the NIH 3T3
cells.
The effect of the Hox2.9 protein (an unrelated homeodomain protein)
(
8,
31) on
Aldh1 mRNA synthesis was analyzed to
assess
the specificity of the HOX11 protein effect. NIH 3T3 clones were
obtained following transfection with expression vectors bearing
genes
coding for either
HOX11 or
Hox2.9, and RNA was
isolated.
Figure
3C shows the results of Northern hybridization
analysis
with two independent clones from each transfection. Using an
ATP synthase probe to control RNA integrity, we confirmed
the presence
of
HOX11 or
Hox2.9 mRNA in the
appropriate clones.
Aldh1 mRNA
was found only in the NIH 3T3
clones expressing
HOX11 (Fig.
3C),
confirming the
specificity of
HOX11 for
Aldh1 mRNA
induction.
The Aldh1 gene is repressed in the spleen primordium in
the presence of Hox11.
During mouse embryogenesis, while
Hox11 is expressed in a variety of locations (3, 35,
36), the sole defect which can be observed in mice lacking
functional Hox11 genes is the absence of spleens at birth
(3, 36). During early development at around E12 to E13,
mesoderm forms the developing-spleen anlage but the organ involutes and
disappears by the E14 stage in Hox11 null mice. The
Hox11 null mutation, however, does not affect viability or
vigor in any other observable way, and true breeding
Hox11
/
mice can be obtained (3,
36). The genes which we have identified by ectopic expression of
HOX11 in NIH 3T3 cells may therefore play a role in spleen development,
and the absence of Hox11 protein in the null mice might result in the
absence of Aldh1 and/or Slim1. This possibility
was investigated by in situ RNA hybridization analysis of wild-type
mouse embryos and Hox11 null mutant embryos at E12.5 and
E13.5.
This analysis failed to demonstrate any difference between levels of
Slim1 expression in the wild type and
Hox11 null
embryos
(data not shown). However, a surprising inverse relationship
was
found between
Hox11 and
Aldh1 mRNA levels in
the developing spleen
(Fig.
4). At E12.5
and E13.5
Hox11 mRNA can be observed in wild-type
embryos in
the developing hindbrain and the spleen anlage (Fig.
4) whereas
Aldh1 mRNA is not detectable. As a control, the related
mRNA
for
Aldh2 was analyzed and, unlike mRNA for
Aldh1, showed
widespread expression. As the spleen anlage
contains rather few
cells at E12.5, it may be possible to miss this
developing organ
as the sagittal sections are made. Accordingly, we
prepared serial
parasagittal sections of an E13.5 wild-type embryo and
hybridized
one section with the
Hox11 oligonucleotide,
thereby detecting
the spleen anlage, the next section with the
Aldh1 oligonucleotide,
and the next with the
Hox11 oligonucleotide (Fig.
4, bottom section,
left-hand
embryo panels).
Hox11 mRNA was detectable in both flanking
sections of the spleen anlage, but no
Aldh1 mRNA was
detectable
in the intermediate section.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 4.
Aldh1 expression in embryonic mouse spleen is
inversely correlated with Hox11. Wild-type (+/+) or Hox11
homozygous mutant ( / ) mouse embryos were taken at E12.5 or E13.5,
and parasagittal cryosections were hybridized in situ with
oligonucleotide probes specific for Hox11, Aldh1,
Aldh2, or Tal1/Scl mRNA. The upper section shows
E12.5 embryos. Consecutive sections of +/+ or / embryos were
hybridized with Hox11, Aldh1, and
Aldh2 probes. The lower section shows E13.5 embryos.
Consecutive sections of +/+ or / embryos were hybridized with
Hox11 and Aldh1 probes in the order shown. For
comparison, we hybridized Tal1/Scl, which showed its
specific location within the hindbrain and fetal liver. Nissl-stained
embryo sections are shown for comparison. SP, spleen; HB, hind brain;
L, fetal liver.
|
|
The data with wild-type mouse embryos show that
Aldh1 mRNA
expression is undetectable in the spleen anlage of E13.5 embryos.
We
next examined in situ hybridization patterns in parasagittal
sections
of E12.5 and E13.5 null
Hox11 embryos. As previously
shown
(
3,
36),
Hox11 mRNA is undetectable in
Hox11 null embryos
at stage E12.5, although a transient
spleen anlage does form (
3).
Aldh2, related to
Aldh1, is expressed in a broad spectrum of developing
tissues of
Hox11 null embryos with a profile which closely
approximates
that of wild-type mice. However, unlike wild-type embryos,
Aldh1 mRNA expression was clearly detectable in the spleen
anlage in
the
Hox11 null embryos, suggesting negative
regulation of
Aldh1 expression by Hox11 in embryogenesis,
rather than positive regulation
as determined by the ectopic
HOX11 expression in NIH 3T3 cells
(Fig.
4). To confirm the
significance of this finding, an unrelated
gene but one which is also
activated by chromosomal translocation
in some human T-cell acute
leukemias, viz.,
Tal1/Scl (
2), was
examined in
the
Hox11 null embryos to assess whether altered
Aldh1 mRNA levels reflected a generalized alteration of gene
expression.
As with
Aldh2 expression,
Tal1 mRNA
levels at the E13.5 stage
did not vary between wild-type and
Hox11 null embryos (Fig.
4),
the main sites of expression
being the fetal liver and specific
regions of the hindbrain. We
conclude, therefore, that the effects
observed in the
Hox11
null embryos reflect a specific negative
regulatory role of Hox11
protein on the
Aldh1 gene in mouse spleen
development.
 |
DISCUSSION |
HOX11 causes gene activation in NIH 3T3 cells.
HOX11 appears
to function as an important regulator of cell growth and survival.
Evidence for this comes from its normal role in the development of
splenic precursor cells as well as from its tumorigenic role, implied
by its association with the breakpoints of chromosomal translocations
in T-ALL and its ability to immortalize murine hematopoietic
progenitors in vitro (11, 12). HOX11 has been postulated to
promote oncogenesis by disrupting a G2/M checkpoint by
binding to protein phosphatase 2A (17). However, it seems
likely that HOX11 can also function by activation or repression of
genes crucial for cell proliferation and/or differentiation in
organogenesis of the spleen.
We have used cDNA RDA (
15,
22) to search for potential
target genes of HOX11, a T-cell oncogenic homeodomain transcription
factor. Using this technique, we have identified
Aldh1, a
gene
encoding an enzyme involved in retinoic acid synthesis, as a gene
which can be transcriptionally upregulated by HOX11 in NIH 3T3
cells.
Slim1, a novel LIM-only gene, may also be a target for
regulation by HOX11 in NIH 3T3 cells, but factors other than simple
intracellular expression of HOX11 appear to be involved. SLIM1
belongs
to a new family of LIM proteins, which include SLIM2 and
DRAL (
9,
29,
44), that contain four and a half LIM domains
in which the
N-terminal domain consists only of the second half
of the LIM
consensus. Two other LIM-only proteins have been identified
via their
association with chromosomal translocations, viz., LMO1
and LMO2
(
38). This finding suggests an interesting possible
link to
HOX11, also activated by chromosomal translocations in
T-ALL,
especially in view of the observed expression of
SLIM1 mRNA
in most T-ALL cell lines examined. However, the possible
significance
for development of T-ALL will need to be addressed
by functional
studies, particularly since not all the 3T3-HOX11
clones display
Slim1 activation.
The activation of
Aldh1 gene transcription following HOX11
expression in NIH 3T3 cells was found in all NIH 3T3 clones tested,
and
mutations of
HOX11 which affect DNA binding and
transcriptional
activation (
26) affect
Aldh1
expression. At present it is not
known whether this relationship is a
direct effect of HOX11 on
the
Aldh1 promoter. Although the
HOX11 homeodomain is required
for
Aldh1 expression, it is
possible that HOX11 may bind to other
intermediate genes whose protein
products themselves bind and
activate the
Aldh1 gene.
Alternatively, protein-protein interaction,
which must be mediated
through the homeodomain, may be responsible
for the molecular effect on
Aldh1 gene
transcription.
A possible Hox11-Aldh1 control system for developing mouse
spleen.
In the activation experiments described in this paper, we
show that HOX11 ectopically expressed in NIH 3T3 cells results, directly or indirectly, in positive regulation of the Aldh1
gene. Conversely, we present evidence that Aldh1 is
negatively regulated by Hox11 in the spleen anlagen of mouse embryos.
This paradox is possibly explained by the physiological status of the
Aldh1 gene in the two different situations. There is
evidence of other homeodomain transcription factors that can act as
both positive and negative regulators in differing situations. Two
notable examples are the Drosophila homeodomain proteins
Antennapaedia and Ultrabithorax, which have been shown to regulate the
centrosomin gene. Antennapaedia negatively regulates
centrosomin in the visceral mesoderm and positively
regulates it in the central nervous system. For Ultrabithorax, the
centrosomin regulatory role was found to be reversed in
these tissues (13). A mechanism to account for these
observations has emerged from a recent study suggesting that HOX
protein interactions with cofactors such as PBX1 can determine whether
target gene activation or repression will occur (34).
A major function of Aldh1 appears to be the biosynthesis of retinoic
acid by conversion of vitamin A (retinol) to its biologically
active
form, retinoic acid, a local regulator of cellular proliferation,
differentiation, and death. During retinoid signalling, retinol
is
converted to retinoic acid via two oxidative reactions in target
cells
(
19). The irreversible second step in which retinoic acid
is
generated from retinal is catalyzed mainly in the adult and
exclusively
in the early embryonic mouse by NAD-dependent Aldh
enzymes
(
27). The class 1 or cytosolic form (Aldh1) and the
closely
related V1 and V2 or Raldh-2 retinal dehydrogenases are
the only Aldh
isoenzymes known to have this catalytic capacity
(
49,
51).
It is noteworthy that aldehyde oxidase, an enzyme
which also has the
capacity to synthesize retinoic acid in vertebrates
(
32,
46), has recently been proposed to be downstream of
Drosophila homeoproteins (
20). Retinoic acid acts
as a ligand for two families
of nuclear receptors, the retinoic acid
and retinoid X receptors.
This diffusable morphogen is crucial to
vertebrate embryogenesis,
where it is distributed in patterns that are
highly regulated,
both temporally and spatially, by the localized
expression of
retinoic acid-synthesizing enzymes, including Aldh1
(
1,
25,
33). As a developmental signal, retinoic acid is
involved in
numerous processes ranging from anteroposterior patterning,
both
along the main body axis and in developing limb buds, to
whole-organ
formation. The need for vigilant control to be maintained
over
retinoic acid biosynthesis is emphasized by the highly teratogenic
effect of a deficiency or excess of retinoic acid during development
(
14,
40). Our results are compatible with a role for Hox11
in regulating retinoic acid availability in an organ-specific
manner by
suppressing
Aldh1 expression in the developing spleen.
Aberrant expression of
Aldh1 in spleen primordia of
Hox11 null
mice provides a plausible molecular mechanism to
account for splenic
involution, since it is known that retinoids can
regulate apoptosis.
This has been demonstrated in vitro as well as in
whole organs
in vivo (
16,
24,
42). Very little is known
about the endogenous
levels of retinoic acid or its biosynthetic
enzymes in the developing
spleen; however, at least in the adult art,
the spleen does not
normally demonstrate detectable retinoic
acid-synthesizing activity
(
32). Therefore, an aberrant
increase in retinoic acid synthesis
in the spleen anlage at that
particular stage of development may
lead to the observed asplenic
phenotype of
Hox11 null mutant
mice.
 |
ACKNOWLEDGMENTS |
We thank M. Hubank and D. Schatz for providing a detailed cDNA
RDA protocol; L. Drynan, A. Forster, and I. Lavenir for technical help
with this work; U. Kees for PER-117 and PER-255 cells; P. H. Rabbitts for LUDLU cells; and R. Hill for a Hox2.9 clone.
W.K.G. was the recipient of a C. J. Martin fellowship from the
Australian National Health and Medical Research Council. N.M. was
supported by the Leukaemia Research Fund.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Protein and Nucleic Acid Chemistry, MRC Laboratory of Molecular
Biology, Hills Rd., Cambridge CB2 2QH, United Kingdom. Phone: 01223 402286. Fax: 01223 412178. E-mail:
thr{at}mrc-lmb.cam.ac.uk.
Present address: TVW Telethon Institute for Child Health Research,
Subiaco, Western Australia 6008, Australia.
Present address: Dept. of Psychiatry, Addenbrooke's Hospital,
Cambridge CB2 2QQ, United Kingdom.
 |
REFERENCES |
| 1.
|
Ang, H. L., and G. Duester.
1997.
Initiation of retinoid signalling in primitive streak mouse embryos: spatiotemporal expression patterns of receptors and metabolic enzymes for ligand synthesis.
Dev. Dyn.
208:536-543[Medline].
|
| 2.
|
Baer, R.
1993.
TAL1, TAL2 and LYL1: a family of basic helix-loop-helix proteins implicated in T cell acute leukaemia.
Semin. Cancer Biol.
4:341-347[Medline].
|
| 3.
|
Dear, T. N.,
W. H. Colledge,
M. B. L. Carlton,
I. Lavenir,
T. Larson,
A. J. H. Smith,
A. J. Warren,
M. J. Evans,
M. V. Sofroniew, and T. H. Rabbitts.
1995.
The Hox11 gene is essential for cell survival during spleen development.
Development
121:2909-2915[Abstract].
|
| 4.
|
Dear, T. N.,
I. Sanchez-Garcia, and T. H. Rabbitts.
1993.
The HOX11 gene encodes a DNA-binding nuclear transcription factor belonging to a distinct family of homeobox genes.
Proc. Natl. Acad. Sci. USA
90:4431-4435[Abstract/Free Full Text].
|
| 5.
|
Denhardt, D. T.
1966.
A membrane-filter technique for the detection of complementary DNA.
Biochem. Biophys. Res. Commun.
23:641-646[Medline].
|
| 6.
|
Dube, I. D.,
S. Kamel-Reid,
C. C. Yuan,
M. Lu,
X. Wu,
G. Corpus,
S. C. Raimondi,
W. M. Crist,
A. J. Carroll,
J. Minowanda, and J. B. Baker.
1991.
A novel human homeobox gene lies at the chromosome 10 breakpoint in lymphoid neoplasias with chromosomal translocation t(10;14).
Blood
78:2996-3003[Abstract/Free Full Text].
|
| 7.
|
Feinberg, A. P., and B. A. Vogelstein.
1983.
A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:6-13[Medline].
|
| 8.
|
Frohman, M. A.,
M. Boyle, and G. R. Martin.
1990.
Isolation of the mouse Hox-2.9 gene; analysis of embryonic expression suggests that positional information along the anterior-posterior axis is specified by mesoderm.
Development
110:589-607[Abstract/Free Full Text].
|
| 9.
|
Genini, M.,
P. Schwalbe,
F. A. Scholl,
A. Remppis,
M. G. Mattei, and B. W. Schafer.
1997.
Subtractive cloning and characterisation of DRAL, a novel LIM-domain protein down-regulated in rhabdomyosarcoma.
DNA Cell Biol.
16:433-442[Medline].
|
| 10.
|
Hatano, M.,
C. W. M. Roberts,
M. Minden,
W. M. Crist, and S. J. Korsmeyer.
1991.
Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukaemia.
Science
253:79-82[Abstract/Free Full Text].
|
| 11.
|
Hawley, R. G.,
A. Z. Fong,
M. D. Reis,
N. Zhang,
M. Lu, and T. S. Hawley.
1997.
Transforming function of the HOX11/TCL3 homeobox gene.
Cancer Res.
57:337-345[Abstract/Free Full Text].
|
| 12.
|
Hawley, R. G.,
A. Z. C. Fong,
M. Lu, and T. S. Hawley.
1994.
The HOX11 homeobox-containing gene of human leukemia immortalizes murine hematopoietic precursors.
Oncogene
9:1-12[Medline].
|
| 13.
|
Heuer, J. G.,
K. Li, and T. C. Kaufman.
1995.
The Drosophila homeotic target gene centrosomin (cmm) encodes a novel centrosomal protein with leucine zippers and maps to a genomic region required for midgut morphogenesis.
Development
121:3861-3876[Abstract].
|
| 14.
|
Horton, C., and M. Maden.
1995.
Endogenous distribution of retinoids during normal development and teratogenesis in the mouse embryo.
Dev. Dyn.
202:312-323[Medline].
|
| 15.
|
Hubank, M., and D. G. Schatz.
1994.
Identifying differences in mRNA expression by representational difference analysis of cDNA.
Nucleic Acids Res.
22:5640-5648[Abstract/Free Full Text].
|
| 16.
|
Iwata, M.,
M. Mukai,
Y. Nakai, and R. Iseki.
1992.
Retinoic acids inhibit activation-induced apoptosis in T cell hybridomas and thymocytes.
J. Immunol.
149:3302-3308[Abstract].
|
| 17.
|
Kawabe, T.,
A. J. Muslin, and S. J. Korsmeyer.
1997.
HOX11 interacts with protein phosphatases PP2A and PP1 and disrupts a G2/M cell-cycle checkpoint.
Nature
385:454-458[Medline].
|
| 18.
|
Kennedy, M. A.,
R. Gonzalez-Sarmiento,
U. R. Kees,
F. Lampert,
N. Dear,
T. Boehm, and T. H. Rabbitts.
1991.
HOX11, a homeobox-containing T-cell oncogene on human chromosome 10q24.
Proc. Natl. Acad. Sci. USA
88:8900-8904[Abstract/Free Full Text].
|
| 19.
|
Kim, C. I.,
M. A. Leo, and C. S. Lieder.
1992.
Retinol forms retinoic acid via retinal.
Arch. Biochem. Biophys.
294:388-393[Medline].
|
| 20.
|
Kuhn, D. T., and G. N. Cunningham.
1997.
Aldehyde oxidase distribution in haltere discs of homeotic bithorax mutants in Drosophila melanogaster.
Mol. Gen. Genet.
150:37-42.
|
| 21.
|
LeFranc, M.-P.,
A. Forster,
R. Baer,
M. A. Stinson, and T. H. Rabbitts.
1986.
Diversity and rearrangement of the human T cell rearranging genes: nine germ-line variable genes belonging to two subgroups.
Cell
45:237-246[Medline].
|
| 22.
|
Lisitsyn, N.,
N. Lisitsyn, and M. Wigler.
1993.
Cloning the differences between two complex genomes.
Science
259:946-951[Abstract].
|
| 23.
|
Lu, M.,
Z. Gong,
W. Shen, and A. D. Ho.
1991.
The tcl-3 proto-oncogene altered by chromosomal translocation in T-cell leukaemia codes for a homeobox protein.
EMBO J.
10:2905-2910[Medline].
|
| 24.
|
Lu, X.-P.,
A. Fanjul,
N. Picard,
M. Pfahl,
D. Rungta,
K. Nared-Hood,
B. Cater,
J. Piedrafita,
S. Tang,
E. Fabbrizio, and M. Pfahl.
1997.
Novel retinoid-related molecules as apoptosis inducers and effective inhibitors of human lung cancer cells in vivo.
Nat. Med.
3:686-690[Medline].
|
| 25.
|
Marsh-Armstrong, N.,
P. McCafferty,
W. Gilbert,
J. E. Dowling, and U. C. Drager.
1994.
Retinoic acid is necessary for development of the ventral retina in zebrafish.
Proc. Natl. Acad. Sci. USA
91:7286-7290[Abstract/Free Full Text].
|
| 26.
|
Masson, N.,
W. K. Greene, and T. H. Rabbitts.
1998.
Optimal activation of an endogenous gene by HOX11 requires the NH2-terminal 50 amino acids.
Mol. Cell. Biol.
18:3502-3508[Abstract/Free Full Text].
|
| 27.
|
McCafferty, P., and U. C. Drager.
1995.
Retinoic acid synthesizing enzymes in the embryonic and adult vertebrates.
Adv. Exp. Med. Biol.
372:173-183[Medline].
|
| 28.
|
Mizushima, S., and S. Nagata.
1990.
pEF-BOS, a powerful mammalian expression vector.
Nucleic Acids Res.
18:5322[Free Full Text].
|
| 29.
|
Morgan, M. J., and A. J. A. Madgwick.
1996.
Slim defines a novel family of LIM-proteins expressed in skeletal muscle.
Biochem. Biophys. Res. Commun.
225:632-638[Medline].
|
| 30.
|
Morgan, M. J.,
A. J. Madgwick,
B. Charleston,
J. M. Pell, and P. T. Loughnan.
1995.
The developmental regulation of a novel muscle LIM-protein.
Biochem. Biophys. Res. Commun.
212:840-846[Medline].
|
| 31.
|
Murphy, P., and R. E. Hill.
1991.
Expression of the mouse labial-like homeobox genes, Hox2.9 and Hox1.6, during segmentation of the hindbrain.
Development
111:61-74[Abstract].
|
| 32.
|
Napoli, J. L., and K. R. Race.
1987.
The biosynthesis of retinoic acid from retinol by rat tissues in vitro.
Arch. Biochem. Biophys.
255:95-101[Medline].
|
| 33.
|
Niederreither, K.,
P. McCafferty,
U. C. Drager,
P. Chambon, and P. Dolle.
1997.
Restricted expression and retinoic acid-induced downregulation of the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse development.
Mech. Dev.
62:67-78[Medline].
|
| 34.
|
Pinsonneault, J.,
B. Florence,
H. Vaessin, and W. McGinnis.
1997.
A model for extradenticle function as a switch that changes HOX protein from repressors to activators.
EMBO J.
16:2032-2042[Medline].
|
| 35.
|
Roberts, C. W.,
A. M. Sonder,
A. Lumsden, and S. J. Korsmeyer.
1995.
Developmental expression of Hox11 and specification of splenic cell fate.
Am. J. Pathol.
146:1089-1101[Abstract].
|
| 36.
|
Roberts, C. W. M.,
J. R. Shutter, and S. J. Korsmeyer.
1994.
Hox11 controls the genesis of the spleen.
Nature
368:747-749[Medline].
|
| 37.
|
Rongnoparut, P., and S. Weaver.
1991.
Isolation and characterisation of cytosolic aldehyde dehydrogenase-encoding cDNA from mouse liver.
Gene
101:261-265[Medline].
|
| 38.
|
Sanchez-Garcia, I., and T. H. Rabbitts.
1993.
LIM domain proteins in leukaemia and development.
Semin. Cancer Biol.
4:349-358[Medline].
|
| 39.
|
Sims, J. E.,
A. Tunnacliffe,
W. J. Smith, and T. H. Rabbitts.
1984.
Complexity of human T-cell antigen receptor -chain constant and variable-region genes.
Nature
312:541-545[Medline].
|
| 40.
|
Soprano, D. R., and K. J. Soprano.
1995.
Retinoids as teratogens.
Annu. Rev. Nutr.
15:111-132[Medline].
|
| 41.
|
Southern, E. M.
1975.
Detection of specific sequences among DNA fragments separated by gel electrophoresis.
J. Mol. Biol.
98:503-517[Medline].
|
| 42.
|
Szondy, Z.,
U. Reichert,
J.-M. Bernardon,
S. Michel,
R. Tóth,
P. Ancian,
E. Ajzner, and L. Fesus.
1997.
Induction of apoptosis by retinoids and retinoic acid receptor -selective compounds in mouse thymocytes through a novel apoptosis pathway.
Mol. Pharmacol.
51:972-982[Abstract/Free Full Text].
|
| 43.
|
Tang, S., and M. L. Breitman.
1995.
The optimal binding sequence of the Hox11 protein contains a predicted recognition core motif.
Nucleic Acids Res.
3:1928-1935.
|
| 44.
|
Taniguchi, Y.,
T. Furukawa,
T. Tun,
H. Han, and T. Honjo.
1998.
LIM protein KyoT2 negatively regulates transcription by association with the RBP-J DNA binding protein.
Mol. Cell. Biol.
18:644-654[Abstract/Free Full Text].
|
| 45.
|
Thomas, P. S.
1980.
Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose.
Proc. Natl. Acad. Sci. USA
77:5201-5205[Abstract/Free Full Text].
|
| 46.
|
Tomita, S.,
M. Tsujita, and Y. Ichikawa.
1993.
Retinal oxidase is identical to aldehyde oxidase.
FEBS Lett.
336:272-274[Medline].
|
| 47.
|
Wisden, W., and B. J. Morris (ed.).
1994.
In situ hybridization protocols for the brain.
Academic Press, New York, N.Y.
|
| 48.
|
Wisden, W.,
B. J. Morris, and S. P. Hunt.
1991.
In situ hybridization with synthetic DNA probes, p. 205-225.
In
J. Chad, and H. Wheal (ed.), Molecular neurobiology: a practical approach. IRL Press, Oxford, United Kingdom.
|
| 49.
|
Yoshida, A.,
L. C. Hsu, and V. Dave.
1992.
Retinal oxidation activity and biological role of human cytosolic aldehyde dehydrogenase.
Enzyme
46:239-244[Medline].
|
| 50.
|
Zhang, N.,
W. Shen,
A. D. Ho, and M. Lu.
1996.
Three distinct domains in the HOX-11 homeobox oncoprotein are required for optimal transactivation.
Oncogene
13:1781-1787[Medline].
|
| 51.
|
Zhao, D.,
P. McCafferty,
K. J. Ivins,
R. L. Neve,
P. Hogan,
W. W. Chin, and U. C. Drager.
1996.
Molecular identification of a major retinoic acid-synthesizing enzyme, a retinaldehyde-specific dehydrogenase.
Eur. J. Biochem.
240:15-22[Medline].
|
Molecular and Cellular Biology, December 1998, p. 7030-7037, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kondo, T., Sheets, P. L., Zopf, D. A., Aloor, H. L., Cummins, T. R., Chan, R. J., Hashino, E.
(2008). Tlx3 exerts context-dependent transcriptional regulation and promotes neuronal differentiation from embryonic stem cells. Proc. Natl. Acad. Sci. USA
105: 5780-5785
[Abstract]
[Full Text]
-
Zhou, X., Mao, K. Z.
(2005). LS Bound based gene selection for DNA microarray data. Bioinformatics
21: 1559-1564
[Abstract]
[Full Text]
-
Owens, B. M., Zhu, Y.-X., Suen, T.-C., Wang, P.-X., Greenblatt, J. F., Goss, P. E., Hawley, R. G.
(2003). Specific homeodomain-DNA interactions are required for HOX11-mediated transformation. Blood
101: 4966-4974
[Abstract]
[Full Text]
-
Owens, B. M., Hawley, R. G.
(2002). HOX and Non-HOX Homeobox Genes in Leukemic Hematopoiesis. Stem Cells
20: 364-379
[Abstract]
[Full Text]