Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7075-7085, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Homology-Dependent Maternal Inhibition of
Developmental Excision of Internal Eliminated Sequences in
Paramecium tetraurelia
Sandra
Duharcourt,1
Anne-Marie
Keller,2 and
Eric
Meyer1,*
Laboratoire de Génétique
Moléculaire, Ecole Normale Supérieure,
Paris,1 and
Centre de
Génétique Moléculaire, CNRS,
Gif-sur-Yvette,2 France
Received 9 March 1998/Returned for modification 6 May 1998/Accepted 1 September 1998
 |
ABSTRACT |
Thousands of single-copy internal eliminated sequences (IESs) are
excised from the germ line genome of ciliates during development of the
polygenomic somatic macronucleus, following sexual events. Paramecium IESs are short, noncoding elements that
frequently interrupt coding sequences. No absolutely conserved sequence
element, other than flanking 5'-TA-3' direct repeats, has been
identified among sequenced IESs; the mechanisms of their specific
recognition and precise elimination are unknown. Previous work has
revealed the existence of an epigenetic control of excision. It was
shown that the presence of one IES in the vegetative macronucleus
results in a specific inhibition of the excision of the same element
during the development of a new macronucleus, in the following sexual generation. We have assessed the generality and sequence specificity of
this transnuclear maternal control by studying the effects of
macronuclear transformation with 13 different IESs. We show that at
least five of them can be maintained in the new macronuclear genome;
sequence specificity is complete both between genes and between
different IESs in the same gene. In all cases, the degree of excision
inhibition correlates with the copy number of the maternal IES, but
each IES shows a characteristic inhibition efficiency. Short internal
IES-like segments were found to be excised from two of the IESs when
excision between normal boundaries was inhibited. Available data
suggest that the sequence specificity of these maternal effects is
mediated by pairing interactions between homologous nucleic acids.
 |
INTRODUCTION |
Ciliates are unicellular eukaryotes
in which germ line and somatic functions are assumed by two kinds of
nuclei coexisting in the same cytoplasm. The diploid micronuclei are
transcriptionally silent during vegetative growth; their main function
is to provide gametic nuclei upon meiosis. Vegetative transcription
takes place in the polygenomic, somatic macronuclei that divide
amitotically and are lost soon after meiosis. Following fertilization,
both kinds of nuclei differentiate from copies of the diploid zygotic nucleus. Macronuclear development involves extensive rearrangements of
the germ line genome: chromosomes are fragmented into shorter, acentric
molecules, and tens of thousands of internally eliminated sequences
(IESs) are removed from coding and noncoding sequences, in a
reproducible and often highly precise manner. In addition, the genome
is amplified to the final ploidy level, ~1,000n in Paramecium
aurelia complex species (for general reviews, see references 5 and 34; for a review of IESs,
see reference 19).
All known Paramecium IESs are short (26 to 882 bp), AT-rich,
single-copy elements flanked by 5'-TA-3' direct repeats in the germ
line sequence. Excision invariably leaves one of the TA repeats in the
rearranged macronuclear sequence, suggesting that the same basic
mechanism is used for all IESs. Although the excision mechanism is
currently unknown, reaction products and intermediates have been
identified in other ciliate species. In Euplotes crassus, the structure of free circles generated by the excision of IESs with
very similar characteristics (TA IESs) is best explained by a mechanism
involving staggered double-strand breaks at both ends (17).
In the more closely related Tetrahymena thermophila, the
mapping of transient DNA breaks suggests a transposition-like mechanism, in which a staggered double-strand break at one end of the
element is followed by a transesterification step that joins the
flanking sequences together, releasing the IES as a linear molecule
(37). Tetrahymena IESs, however, differ from those of Paramecium and Euplotes in that they
lack invariant TA boundaries.
The analysis of some 44 kb of Paramecium germ line sequences
has revealed a high density of IESs, one every 1,300 bp on average, with no significant difference between coding and noncoding sequences (7, 22, 38, 41-43). Although most of the sequences analyzed (35 kb) belong to one multigene family encoding alternative surface antigens, the density of IESs is higher in the remainder of the sequence sample. Thus, the total number of different IESs in the haploid genome is likely to be greater than 50,000. One of the most
puzzling questions raised by this massive excision program is how such
a large number of different elements can be specifically recognized and
excised during macronuclear development. Indeed, no absolutely
conserved sequence motif, other than the TA repeats, has been
identified within or outside IESs.
A partial answer came from a statistical analysis of the sequence of
IES ends, which showed that base composition is not random over at
least six nucleotides immediately internal to each of the TA repeats.
The sequence of preferred bases forms a degenerate inverted repeat
consensus with striking similarity to the ends of the inverted repeats
of Tc1/mariner transposons (18). Several large,
multicopy elements present in the germ line genome of E. crassus are clearly members of this transposon family; like IESs, they are precisely excised between TA direct repeats during
macronuclear development and generate free circles with a similar
structure (14). These similarities have led to the
hypothesis that present-day IESs are mutated and internally deleted
remnants of ancient transposon insertions; the observed consensus could
reflect the conservation of minimal cis-acting determinants
required to direct excision (19).
The functional significance of the Paramecium IES consensus
is supported by the fact that mutations in the TA repeats or at other
positions can abolish excision (6, 24, 25). However, the
comparison of natural allelic variants of IESs located in noncoding
sequences shows that excision boundaries can be displaced over
evolutionary time, implying that mutations can also result in the
recruitment of novel TA boundaries in adjacent sequences (6). The degenerate consensus may therefore reflect a
process of convergent evolution adapting IES ends to mechanistic
constraints of the excision machinery. It should be emphasized that
only a small fraction of IES ends conform exactly to the consensus,
while many perfect matches are found in sequences that are not excised during development. Thus, it is likely that other, unidentified determinants are involved in IES recognition.
Recent evidence suggests that some of these determinants are epigenetic
in nature, i.e., that the excision pattern is not entirely determined
by the germ line sequence itself (reviews in references
27 and 28). Sequence-specific
maternal effects were first revealed by the selective transformation of
the vegetative macronucleus with a plasmid containing a 222-bp IES
located in the gene for surface antigen G. Following the induction of
autogamy (a self-fertilization sexual process), the maternal
macronucleus progressively stops replicating its DNA and is eventually
lost when vegetative growth resumes; its genetic material, including the transforming plasmid, is not transmitted to sexual progeny. Surprisingly, the presence of the IES in the maternal macronucleus was
shown to inhibit specifically the excision of the homologous IES from
the germ line genome in the developing macronucleus (8). The
efficiency of this transnuclear effect, as measured by the fraction
of G-gene copies retaining the IES in the new macronucleus, was further shown to increase with the copy number of the IES in the
maternal macronucleus and with the length of IES flanking sequences
present on the plasmid. The retention of the IES on the endogenous
macronuclear chromosomes has an even stronger effect during the
following sexual cycle, resulting in an ever-increasing fraction of
IES-retaining copies in subsequent sexual generations. Thus, it is
possible to establish stable cell lines in which this particular IES is
never excised, although the germ line genome remains entirely wild type.
A similar parental control of developmental IES excision has also been
reported in T. thermophila for two different elements (2), raising the prospect that the study of epigenetic
regulation will bring valuable insight into basic mechanisms of
recognition and excision of ciliate germ line-specific elements in
general. We have tested the generality and sequence specificity of the maternal inhibition of excision by analyzing the effects of
macronuclear transformation with 13 different Paramecium
IESs. We show that five of them can be maintained in the zygotic
macronucleus in response to maternal transformation. The effect is
completely sequence specific, and each IES appears to inhibit its own
excision with a different efficiency relative to maternal copy number.
 |
MATERIALS AND METHODS |
Cell lines and cultivation.
Paramecium tetraurelia 51 and d4.2 are well-characterized homozygous stocks carrying the
A51 and A29 alleles of
the gene for surface antigen A, respectively (40). Strain
d4.2 was obtained by repeated back-crosses with strain 51 and is
therefore largely isogenic; this study confirmed that it carries the
same allele of the gene for surface antigen G
(G51) by restriction mapping analysis and the
sequencing of over 2,800 bp from both strains, including the central
and most variable region of the coding sequence. Cells were grown in a
wheat grass powder (Pines International Co., Lawrence, Kans.) infusion
medium bacterized the day before use with Klebsiella
pneumoniae and supplemented with 0.8 mg of
-sitosterol (Merck,
Darmstadt, Germany) per liter, at 27°C. Basic methods of cell culture
have been described previously (39).
Recombinant
phages and plasmids.
The
51Gmic and
51Amic phages, containing the micronuclear
G51 and A51 genes, were
isolated from the library of micronuclear DNA from strain 51 constructed by C. J. Steele et al. (41) in the
GEM11 vector, by using IES 51G4404 (29) and a 210-bp
ScaI fragment from the central part of the coding sequence
(31) as probes, respectively. The
51Gmic insert was
entirely sequenced (12,326 bp). The G51 coding
sequence was identified by comparison with known alleles of the
G gene from Paramecium primaurelia
(33); it is 88% identical with G156.
IES excision boundaries were confirmed by sequencing the relevant parts
of the macronuclear version from the macronuclear phage
51Gmac,
which was cloned from a library of total DNA from strain d4.2 in the
EMBL3 vector (29). Plasmids p51A-712mic and p51A-712mac are SalI-SpeI fragments of
51Amic and the
macronuclear clone
SA1 (9), respectively, subcloned into
vector pUC18. Plasmid p29A6649mic was obtained by PCR amplification of
micronuclear DNA from strain d4.2 with primers 6435A and 6649-3' (see below).
Microinjections.
Young cells (less than eight divisions
after autogamy) were injected in mineral water (Volvic Co., Volvic,
France) containing 0.2% bovine serum albumin, under an oil film
(Nujol), while being visualized with a phase-contrast inverted
microscope (Axiovert 35M; Zeiss). CsCl-purified
phage DNA was cut
within the vector arms with SmaI, leaving 3,380 and 728 bp
of
sequences on either side of the insert for
51Gmic and
51Amic and 3,362 and 728 bp for
51Gmac. Column-purified (Qiagen)
plasmid DNA was cut within the vector sequence with XmnI.
Restriction digests were extracted with phenol, filtered on a
0.22-µm-pore-size Ultrafree-MC filter (Millipore), and precipitated
with ethanol. Approximately 5 pl of a 5-mg/ml solution in water was
delivered into the macronucleus. Injected DNA molecules replicate
autonomously at stable copy numbers in the vegetative macronucleus,
forming linear monomers and multimers to which telomeres are added
(11, 12, 15, 16).
Dot blot analyses.
For each sample, 100 cells were pipetted
from depression slide cultures and transferred to 400 µl of 0.4 N
NaOH-50 mM EDTA. The lysates were incubated for 30 min at 68°C and
loaded on a Hybond N+ membrane (Amersham, Little Chalfont,
United Kingdom) with a dot blot apparatus. Genomic DNA samples were
treated in the same way. The membrane was kept wet with 0.4 N NaOH for
15 min, washed in 2× SSC (1× SSC is 150 mM NaCl-15 mM sodium
citrate), and subsequently treated as a Southern blot.
Copy number quantification.
The copy numbers of phage
inserts in transformed clones were determined after hybridization of
dot blots with a 3,359-bp SmaI-SacI fragment from
the small arm of phage
GEM11, which is linked to the inserts in all
SmaI-digested phage DNAs, with a Fuji Bas 1000 imager.
Measured signals were normalized by rehybridizing the same dot blots
with an oligonucleotide specific for macronuclear telomeric repeats, as
previously described (8). Probes specific for IESs 51A2591
and 51G4404 were used to check relative variations of IES copy numbers.
The normalized
probe signals were then translated for all clones
into copy numbers per haploid genome (phg), by using a
G-gene probe to compare the signals obtained for clones
transformed with G-gene phages to those obtained for reference samples (genomic DNA from clones transformed with
G-gene plasmids) loaded on the same dot blots, for which
copy numbers had previously been determined (8). The
reference value of one copy phg was arbitrarily defined as the average
copy number of the G gene in uninjected clones. Plasmid copy
numbers were determined on Southern blots of preautogamous DNA samples
digested with PvuII after hybridization with a 322-bp
PvuII fragment from pUC18, by using the same reference samples.
Autogamy.
Autogamy was induced by starving the cells after
they had reached the appropriate clonal age (30 vegetative divisions)
and assessed by staining with a 15:1 (vol/vol) mix of carmine red (0.5% in 45% acetic acid) and fast green (1% in ethanol). For karyonidal analyses, cells were isolated from depressions showing 100%
autogamous cells. After the first cellular division, one of the two
karyonides was isolated and cultivated. For mass autogamies, about 20 autogamous cells (i.e., 40 karyonidal clones) were transferred to
bacterized medium and grown collectively.
Genomic DNA extraction.
Cultures of exponentially growing
cells (400 ml) at 103 cells/ml were centrifuged. After
being washed in 10 mM Tris (pH 7.0), the cell pellets were resuspended
in 0.5 volume of the same buffer and quickly added to 3 volumes of
lysis solution (0.44 M EDTA [pH 9.0]-1% sodium dodecyl sulfate
[SDS]-0.5% N-laurylsarcosine [Sigma]-1 mg of
proteinase K [Merck] per ml) at 55°C. The lysates were incubated at
55°C overnight, gently extracted once with phenol, and dialyzed twice
against TE (10 mM Tris-HCl-1 mM EDTA, pH 8.0) containing 25% ethanol
and once against TE.
Southern blotting.
DNA restriction and electrophoresis were
carried out according to standard procedures (36). DNA was
transferred from agarose gels to Hybond N+ membranes
(Amersham) in 0.4 N NaOH after depurination in 0.25 N HCl.
Hybridization was carried out according to the procedure described in
reference 3 in 7% SDS-0.5 M sodium phosphate-1% bovine serum albumin-1 mM EDTA (pH 7.2) at 63°C. Probes were labeled with a random priming kit (Boehringer, Mannheim, Germany) to a specific
activity of 3 × 109 cpm/µg. Membranes were washed
for 30 min in 0.2× SSC-0.5% SDS at 60°C prior to autoradiography
or image plate quantification.
PCR amplification and sequencing.
Macronuclear DNA was
amplified with primers located about 25 bp away from each deletion
junction, from total genomic DNA of caryonidal clones, or from
phage DNA. PCRs were carried out in capped 0.5-ml Sigma polypropylene
tubes with reaction mixtures (25 µl) containing 100 ng of total
genomic DNA or 1 ng of cloned DNA, 1× PCR buffer (Promega), 80 µM
(each) deoxynucleoside triphosphate, 2 µM (each) oligonucleotide, and
0.8 U of Tfl polymerase. Amplifications were run for 20 cycles (92°C, 1 min; 63°C, 1 min 15 s; 74°C, 30 s) in a
Perkin-Elmer Cetus thermocycler. Micronuclear DNA was amplified from
total genomic DNA with one primer located within an IES and the other
in the macronuclear sequence. PCRs were run for 30 cycles under the
same conditions as for macronuclear amplification, except that the
annealing temperature was 55°C and the extension time was increased
to 1 min. PCR products were cloned into plasmid pCRScript (Stratagene)
and sequenced with the Sequenase sequencing kit (U.S. Biochemical
Corp.). At least two clones arising from PCR products of two different
karyonidal clones were sequenced to check for PCR-induced
substitutions. The sequenced portions of the micronuclear
A29 allele were amplified with primer pairs
1835A/2591-3' and 6435A/6649-3'. The same primer pairs were used to
check the micronuclear sequence in some postautogamous karyonidal clones.
Sequences of primers (all sequences are written 5' to 3'; the numbers
in parentheses indicate the positions of the 5' end of the primers in
the A51 or G51
micronuclear sequence [accession no. L26124 and AJ010441, respectively]) are as follows: 51A-712-5', (57)
GTCATTTGTTTATGAAAAAATTTCATCAAACTAAG; 51A-712-3', (416)
GGTTTCCAAACAAGAAATTTTCCAT; 51A2591-5', (3747) ACACCAAGCGAAACATGCACAGTCG; 51A2591-3', (4222)
TTTTATGGCATTAAGCTTGTGTCAT; 51A6649-5', (9156)
AAATGGTACTGTTTGTGCTTGGGATAGTGC; 51A6649-3', (9644)
CAGCAGTACATCCAGCTCTCTAAGTTTAGC; 51A1835A, (3016)
ATAGATGGATTGTTTTCCAAGTATCTATATC; 51A6435A, (8971)
GTATCGATAATATTGTTATTAATATATTATAC; 156G2835-5', (5524)
AAACAGGATCAGGTTTGACATTTGCAGATTG; 51G2832-3',
(5948) GTCACACAAGTAGAAGAACCATTTAATGCGC; 51G4404-5', (7325)
CAACATGTGCTGCATATAATGTAGG; 51G4404-3', (7678) ATGAAAGGGAACCAGTTGATTATGCAGAGC. The underlined T in primer
156G2835-5', which is based on the G156 allele,
is an A in G51.
Nucleotide sequence accession number.
The complete sequence
of the
51Gmic insert was submitted to the EMBL database (AJ010441).
 |
RESULTS |
Experimental design.
We chose to test IESs from two surface
antigen genes, one of which contains the previously studied 222-bp IES
(8). The A and G genes are related,
nonessential members of a family of at least 11 genes showing mutually
exclusive expression, so that selection against macronuclear genomes
containing nonfunctional forms of these genes is not expected to bias
the results. Recombinant
phages containing the germ line versions
of these genes were isolated from a library of micronuclear DNA from
strain 51 (Fig. 1). The 12.4-kb insert
from
51Amic contains all but the last 500 bp of the
A-gene coding sequence, as well as about 2.9 kb of 5'
flanking sequences. Nine IESs (51A-712 through 51A6649) have previously
been identified, seven of them located within the coding sequence and
two in the upstream region (41). Sequencing of the 12.3-kb
insert from
51Gmic showed that it contains the complete micronuclear
G gene and revealed the presence of six IESs, four of which
are studied here (51G1413, 51G1832, 51G2832, and 51G4404, the
previously studied 222-bp IES; IESs are named according to the
positions of their insertion sites in the macronuclear sequence,
relative to the translation start).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Maps of the macronuclear A51 gene
(51Amac) and of the inserts of phages 51Amic, 51Gmic, and
51Gmac. Coding sequences are represented by thick arrows in the
macronuclear sequences. IESs are shown as black boxes in the
micronuclear sequences. Double-headed arrows indicate paralogous IES
pairs (IESs occurring at homologous positions in the two genes). Open
boxes at the ends of the phage inserts symbolize the vector arms. The
positions and lengths of probes a, b, c, d, and e are shown.
Restriction sites: M, MnlI; P, PstI (only sites
relevant to Fig. 2 and 3 are shown).
|
|
The transformation of the macronucleus of vegetative cells with the

51Gmic insert is expected to inhibit the excision of
IES 51G4404
during development of a new macronucleus, after induction
of autogamy
in transformed clones. Previous quantitative analyses
(
8)
predict that inhibition will be observed even at low copy
numbers of
the transforming molecule (~1 copy phg, i.e., about
1,000 copies per
macronucleus), providing a positive control for
the experiment. The
retention of other IESs can be examined in
the same postautogamous
samples. Because all
G-gene IESs will
be present in the
maternal macronucleus at the same copy number,
the efficiencies of
inhibition can be directly compared by measuring
the fraction of new
macronuclear copies of the gene retaining
each IES. As a negative
control for the effect of IES sequences,
a

phage containing the
complete macronuclear
G gene was used
(

51Gmac [Fig.
1]).
Similarly, the excision of each
A-gene IES can be examined
in the sexual progeny of clones transformed with

51Amic. Should
any
of them be maintained in the new macronuclear genome,

51Amic
and

51Gmic will serve as specificity controls for each other.
The
A and
G coding sequences are very similar and can
be aligned
with no ambiguity (78% identity at the DNA level, 80% at
the protein
level). An additional point of interest is that some of the
IESs
occur at exactly the same positions in the two genes. In contrast
to their flanking sequences, however, paralogous IESs (51A-10/51G-11,
51A1416/51G1413, 51A1835/51G1832, 51A4404/51G4404, and
51A6435/51G6447)
show no significant sequence similarity and
have different lengths.
IESs 51A-712, 51A2591, 51A4578, 51A6649, and
51G2832 are gene
specific, having no paralogous
counterparts.
Gene-specific maternal effects of A- and
G-gene micronuclear sequences.
DNA from each of the
phages was microinjected into the macronucleus of vegetative cells
from strain 51. Injected cells were cultured separately, and the copy
numbers of phage inserts were precisely measured after about 20 divisions by a dot blot procedure (see Materials and Methods). Selected
clones maintaining between 0.1 and 10 copies phg were then allowed to
undergo autogamy. To examine the new macronuclear genome of sexual
progeny, about 20 autogamous cells for each clone were refed and grown
collectively for DNA extraction. Postautogamous DNA samples were
analyzed on a Southern blot after restriction with MnlI.
There are many sites for this enzyme in the A- and
G-gene coding sequences but none within IESs; the retention
of any IES can thus be detected by a size increase of the corresponding
MnlI fragment.
In the top panel of Fig.
2, the Southern
blot was hybridized with a probe specific for the
MnlI
fragment containing 51A2591,
a 370-bp
A-gene IES (probe a
[Fig.
1]). Lane W1 is a control sample
from uninjected cells and
shows only the 501-bp macronuclear fragment.
In lane W2, the same
control DNA was mixed with a small amount
of phage

51Amic DNA prior
to digestion with
MnlI, to show the
position of the
corresponding 871-bp micronuclear fragment. The
sexual progeny of
clones transformed with

51Gmac (lanes g1 to
g3) or

51Gmic (lanes
G1 to G6) show only the 501-bp fragment,
indicating that IES 51A2591
was correctly excised during macronuclear
development. In contrast, the
sexual progeny of clones transformed
with

51Amic (lanes A1 to A5)
show mostly the IES-retaining fragment,
except for A1, a postautogamous
sample derived from a clone maintaining
only 0.1 copies phg.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot analysis of the macronuclear genome of
sexual progeny of clones transformed with 51Gmac, 51Gmic, and
51Amic. Total DNA from mass-autogamy samples was digested with
MnlI. Because the mic/mac ploidy ratio is ~1/250, only
macronuclear DNA is visible. For each sample, the copy number of the
phage insert in the maternal macronucleus is indicated by a vertical
bar above the lane. Lane W1 is control DNA from uninjected cells. Lanes
W2 and W3 contain the same DNA as in lane W1, mixed with a small amount
of 51Amic and 51Gmic DNA, respectively, prior to digestion with
MnlI. Symbols on the right indicate the positions of
IES-retaining and wild-type macronuclear fragments. The same blot was
hybridized successively with probes a, b, c, and d (Fig. 1).
|
|
The blot was then stripped and rehybridized successively with probe b,
which is specific for the
MnlI fragment containing
IES
51A6649, and probe c, specific for the
MnlI fragment
containing
IES 51A-712 (Fig.
2, second and third panels from top). As
with
IES 51A2591, the excision of these IESs was affected in the sexual
progeny of clones transformed with

51Amic, in which both the
micronuclear and the macronuclear fragments are observed, but
not in
the progeny of clones transformed with
G-gene phages. In
all
three cases, the fraction of IES-retaining copies increases
with the
copy number of

51Amic in the maternal macronucleus.
However, for a
given copy number, this fraction differs for each
IES (see quantitative
analysis below). The blot was also hybridized
with probes specific for
the
MnlI fragments containing each of
the other six
A-gene IESs (51A-10, 51A1416, 51A1835, 51A4404,
51A4578, and
51A6435), one after the other. These IESs were fully
excised in all
samples (data not
shown).
Rehybridization of the same blot with a
G-gene probe gives a
different picture. Probe d is specific for an
MnlI fragment
containing
two IESs, 51G2832 and 51G4404 (Fig.
1). In the
postautogamous
progeny of clones transformed with

51Gmic (lanes G1
to G6), two
different fragments are revealed in addition to the
macronuclear
fragment (Fig.
2, fourth panel from top). The largest has
the
same size as the micronuclear fragment visible in control lane
W3,
which contains W1 DNA mixed with a small amount of

51Gmic
phage DNA,
indicating that both IESs can be maintained in the
new macronuclear
genome. The intermediate fragment suggests that
some
G-gene
copies retain only one of the two IESs. Excision of
these IESs was not
affected in the sexual progeny of clones transformed
with

51Gmac or

51Amic, even at high copy numbers. Thus, the
effect depends on the
presence of the IESs themselves in the maternal
macronucleus and is
strictly gene specific. Hybridization with
probes specific for the
fragments containing IESs 51G1413 and
51G1832 showed that these IESs
were always fully excised (data
not
shown).
To look at each of the maintained IESs separately, the postautogamous
samples derived from

51Gmic-transformed clones were
also analyzed on
a different Southern blot after digestion with
PstI, which
cuts the coding sequence in between the two IESs (Fig.
1). In Fig.
3, this blot was hybridized successively
with probe
d, which reveals a
PstI fragment containing only
51G4404, and
probe e, which reveals a fragment containing only 51G2832.
If
one considers only the mass-autogamy samples G1 to G6, it can
be
seen that for both IESs the average fraction of IES-retaining
copies
increases with the copy number of the

51Gmic phage insert
in the
maternal macronucleus. It is also very clear that, for
a given copy
number, the excision of 51G4404 is inhibited more
efficiently than that
of 51G2832.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Southern blot analysis of the excision of IESs 51G4404
and 51G2832 in sexual progeny of clones transformed with 51Gmic.
Samples G1 to G6 and W1 to W3 are the same as in Fig. 2. Each of the
mass-autogamy samples G2 to G6 is followed by a series of karyonidal
samples representing individual clones isolated from the same mass
autogamy. Vertical bars above the lanes indicate the copy numbers of
phage inserts in maternal macronuclei. W0 is a control mass autogamy
from an uninjected cell; 0a and 0b are karyonidal clones from this mass
autogamy. All samples were digested with PstI. The same blot
was hybridized successively with probes d and e (see Fig. 1). In
addition to the PstI fragment containing IES 51G2832, probe
e cross-hybridizes with the central PstI fragment from the
G gene (upper band in lower panel), due to the repeated
structure of this region of the coding sequence.
|
|
Karyonidal variability of maternal inhibition of excision.
Many of the postautogamous DNA samples, which were prepared from mass
autogamies of transformed clones, contained both rearranged and
IES-retaining molecules. This heterogeneity could mean that IES
excision was inhibited only on a fraction of the ~1,000 copies of the
genome in each new macronucleus or that only a fraction of the ~40
new macronuclei analyzed in each sample were affected. To address this
question, a number of autogamous cells were isolated from the same
populations that were used for the mass-autogamy samples. In each
autogamous cell, two new macronuclei develop independently from mitotic
products of the zygotic nucleus; during the first vegetative division,
they segregate without dividing to the two daughter cells, which are
called karyonides. To prepare postautogamous DNA samples corresponding
to single events of macronuclear development, only one of the two
karyonides from each isolated cell was cultured.
Karyonidal samples from mass autogamies G2 to G6 are shown in Fig.
3.
When the mass-autogamy sample contains both forms, striking
differences
in the relative amounts of these forms can be observed
in individual
karyonidal clones. This is most clearly seen with
the G4 mass-autogamy
sample, in which IES 51G2832 is excised on
about 60% of molecules
(lane G4, probe e). Of five karyonidal
clones analyzed (lanes 4a to
4e), one shows only IES-retaining
copies, a second one shows a small
fraction of rearranged copies,
and the other three contain only the
rearranged form. Most of
the karyonidal clones analyzed for G2 and G3,
which showed only
a small fraction of IES-retaining copies, appear to
be pure for
the rearranged form. Intranuclear heterogeneity is also
observed:
karyonidal clones 5a and 5b contain roughly equal copy
numbers
of the two forms, like the G5 mass-autogamy from which they
were
isolated. A similar analysis of the progeny of clones transformed
with

51Amic also revealed a high karyonidal variability in the
inhibition of excision of
A-gene IESs (data not shown).
Thus,
excision inhibition appears to be a stochastic process in single
developing macronuclei, occurring with a probability that depends
on
the copy number of micronuclear sequences in the maternal
macronucleus.
Sequence specificity of the maternal effects of single IESs.
To test the specificity of the effect among the three A-gene
IESs showing inhibition, plasmids containing only one of them were
constructed. IESs 51A-712 and 51A6649 were chosen to make the test
stringent, as the absence of any effect on 51A2591, which was the most
readily maintained IES in the
51Amic experiment, would be more
conclusive. Plasmid p51A-712mic contains a 1.5-kb segment of the germ
line sequence upstream of the A gene, including IES 51A-712
but not IES 51A-10; a negative control is provided by plasmid
p51A-712mac, which contains the homologous segment from the rearranged
macronuclear sequence (see map in Fig. 4). To study IES 51A6649, we
used plasmid p29A6649mic, which contains a segment of the micronuclear
A29 allele including the IES as well as 301 bp
of flanking sequences (242 bp upstream, which also includes IES
51A6435, and 59 bp downstream; see map in Fig. 5). Within this segment,
the A29 allele differs from
A51 by only a single substitution within the IES
(see below). The maternal effects of these plasmids were tested as in
the
phage experiment, except that plasmid copy numbers in the
macronucleus of transformed clones were determined by Southern blotting
of preautogamous DNA samples (see Materials and Methods).
The new macronuclear genome of sexual progeny was probed on a Southern
blot of mass-autogamy samples digested with
MnlI and
BstBI. The top panel of Fig.
4
shows hybridization of the blot
with probe f, revealing the
BstBI-
MnlI fragment containing 51A-712.
The
retention of this IES is observed only in the postautogamous
progeny of
the clone transformed with the highest copy number
of p51A-712mic (9.9 copies phg, lane 10; the weak signals in lanes
7 and 10 are due to a
different effect of high-copy-number transformation
with cloned
macronuclear or micronuclear sequences, which causes
imprecise
deletions of the homologous regions of the germ line
genome during
development of a new macronucleus [
8,
26,
30]).
Retention of 51A-712 is not observed in the progeny of clones
transformed with p51A-712mac, even at 15.6 copies phg, or with
p29A6649mic. Hybridization of the same blot with probe b reveals
the
MnlI fragment containing IES 51A6649. The excision of this
IES is inhibited in the progeny of the clone transformed with
p29A6649mic (2.1 copies phg) but not in any other sample. It can
be
noticed that the IES-retaining fragment in this sample migrates
slightly faster than the control micronuclear fragment in lane
W2; this
difference will be discussed below. In all of these samples,
the
more readily blocked 51A2591 is fully excised, as shown by
hybridization with probe a.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4.
Southern blot analysis of the excision of IESs 51A-712,
51A6649, and 51A2591 in sexual progeny of clones transformed with
plasmids p51A-712mac, p51A-712mic, and p29A6649mic (see map in Fig. 5).
Plasmid copy numbers in the maternal macronucleus are indicated by the
vertical bars above the lanes. Mass-autogamy samples were digested with
MnlI and BstBI. The same blot was successively
hybridized with probes a, b (Fig. 1), and f (see map; M,
MnlI; B, BstBI).
|
|
We took advantage of a previous experiment to examine the sequence
specificity of the effect among
G-gene IESs. A plasmid
containing only IES 51G4404 (p51G4404mic; see map in Fig.
5) had
previously been shown to inhibit the excision of this IES
(
8).
Hybridization of a Southern blot of
PstI-digested postautogamous
samples with probe e showed
that the presence of p51G4404mic in
the maternal macronucleus had no
effect on the excision of 51G2832,
even at a copy number 30-fold higher
than that necessary to completely
abolish excision of 51G4404 (data not
shown). Thus, maternal inhibition
of excision appears to be completely
sequence specific, both between
genes and between IESs in the same
gene. These results are summarized
in Fig.
5.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Summary of the results showing the sequence specificity
of the inhibition of IES excision by maternal sequences. The maps show
the phage and plasmid inserts used. IESs are shown as black boxes.
Paralogous IES pairs are indicated by double-headed arrows. The names
of the five IESs showing inhibition are boxed. In the lower panel, the
plus sign indicates that excision inhibition was observed. nd, not
determined.
|
|
Quantitative analysis of excision inhibition.
As noted above,
the efficiency of excision inhibition, relative to the copy number of
phage insert in the maternal macronucleus, differs for each IES. To
quantify these differences, the relative intensities of the rearranged
and IES-retaining versions of each fragment were determined, by using
only mass-autogamy samples to average the karyonidal variability. Since
the probes used contain only macronuclear sequences, relative
intensities give an exact measure of the fraction of rearranged copies
in new macronuclei. This fraction was then plotted as a function of the
copy number of phage insert in the maternal macronucleus. The fairly
regular aspect of the plots obtained for the two G-gene IESs
(Fig. 6A) indicates that karyonidal
variability is reasonably well averaged in pools of ~40 karyonidal
clones and illustrates clearly the quantitative difference in the
effects of the
51Gmic insert on the two IESs. Excision of 51G4404 is
reduced by 50% with only 0.4 copies phg in the maternal macronucleus,
while about 2 copies phg are necessary to achieve a similar inhibition
of the excision of 51G2832. The plots obtained for the three
A-gene IESs also show significant differences in the
efficiency of inhibition by the
51Amic insert (Fig. 6B). Maternal
copy numbers of
51Gmic and
51Amic can be directly compared
because they were both measured by probing with a
vector sequence
which remains linked to the inserts in injected phage DNA. The blocking
of 51A2591 is slightly less efficient than that of 51G4404, while
blocking efficiencies of 51A6649 and 51G2832 are comparable. Only a
weak effect is observed for 51A-712 (~30% inhibition at the highest
copy number tested, 5.9 copies phg).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Quantitative analysis of the excision of different IESs
as a function of the copy number of specific sequences in the maternal
macronucleus. "% excision in new macronucleus" is the fraction of
rearranged copies in the new macronuclear genome, as measured in
mass-autogamy samples. (A) Excision of IESs 51G4404 and 51G2832 after
transformation of the maternal macronucleus with 51Gmac or
51Gmic. (B) Excision of IESs 51A2591, 51A6649, and 51A-712 after
transformation of the maternal macronucleus with 51Amic. (C and D)
Filled symbols show the quantification of the maternal effects of IESs
present on the endogenous macronuclear chromosomes and are superimposed
on the same graphs as in panels A and B, respectively, to compare the
inhibition efficiencies of IES-retaining chromosomes with those of the
phage inserts.
|
|
It was previously shown that the inhibition of 51G4404 is much more
efficient when the maternal IES is present on endogenous
macronuclear
chromosomes (50% inhibition with ~0.3 copies phg)
than when it is
present on a plasmid with 629 bp of flanking sequences
(50% inhibition
with ~3 copies phg) (
8). These copy numbers
can be
directly compared to those given in the present study because
the same
reference samples were used for quantification. It can
thus be
concluded that the efficiency of the IES in the context
of the

51Gmic insert (12.3 kb) is very close to that of the IES-retaining
macronuclear chromosome. To determine whether the weaker effects
of
other IESs can be enhanced when they are present on endogenous
macronuclear chromosomes, postautogamous karyonidal clones
retaining
various copy numbers of each IES were allowed to undergo a
second
autogamy. The new macronuclear genome was analyzed on Southern
blots of mass-autogamy samples (data not shown), and the fraction
of
rearranged copies was plotted as a function of the copy number
of
chromosome-borne IES in the maternal macronucleus, which cannot
exceed
1 copy phg (Fig.
6C and D). Most of the points indicate
that endogenous
IESs indeed have slightly higher efficiencies
than phage inserts;
however, their effects also appear to be much
more variable. To
establish a stable cell line which never excises
a given IES, the
minimal efficiency required is 100% inhibition
with

1 copy phg.
Although a couple of second-generation samples
still showed little or
no rearranged copies for 51A2591, such
an efficiency appears to be
reproducibly attained only for
51G4404.
Macronuclear maintained IESs are not copied from maternal
sequences.
To test whether the maintenance of IESs in the
macronuclear genome could be due to the repair of a gap left in the
genomic sequence after constitutive excision of the IES, by a mechanism involving the copying of a homologous template from the maternal macronucleus, advantage was taken of the fact that two different alleles of the A gene, A51 and
A29, can be distinguished by a number of
substitutions. Partial sequencing of the micronuclear
A29 gene from strain d4.2 (see Materials and
Methods) showed that the two alleles are ~99% identical in the
regions around IESs 51A2591 and 51A6649. The macronucleus of vegetative
cells from strain d4.2 was transformed with
51Amic DNA. After
induction of autogamy, the new macronuclear genome was analyzed as
described for the experiment with strain 51. IES 29A2591 was
maintained, with an efficiency similar to that of 51A2591 (data not
shown). The macronuclear maintained IES was PCR amplified and cloned
(see Materials and Methods). Its sequence was shown to be identical with the A29 germ line sequence, which differs
from the A51 germ line sequence by one
substitution and a 12-bp insertion (Fig.
7A). Thus, it can be concluded that the
maintained IES originated from the d4.2 germ line genome and had not
been converted by the
51Amic sequence which had caused its
retention. This extends an earlier result obtained for 51G4404, showing
that the engineering of a novel restriction site within the injected
IES does not alter the sequence of the IES recovered from the
macronucleus of postautogamous progeny (8).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Internal IES-like segments excised from the macronuclear
maintained copies of 51A2591 (A) and 51A6649 (B). Only the sequences of
internal segments are shown. Boldface TAs are the excision boundaries
of internal segments. Boxed TAs are the excision boundaries of the
whole IESs. The sequences of homologous segments of the
A29 allele are also shown; differences with the
A51 allele are underlined. The 40-bp segment in
29A2591 is not excised in the macronuclear maintained version.
|
|
Short IES-like segments are excised from some of the maintained
IESs.
Macronuclear maintained copies of IES 51A2591 were also
cloned and sequenced after PCR amplification, by using postautogamous samples from the first experiment (progeny of strain 51 cells transformed with
51Amic). Quite unexpectedly, the maintained sequence proved to differ from the germ line sequence by the deletion of an internal 28-bp segment (Fig. 7A). The same size difference could be detected in postautogamous DNA samples by comparison with
51Amic DNA on appropriate Southern blots, showing that all macronuclear maintained copies of IES 51A2591 carry the 28-bp deletion
(data not shown). To check that the particular stock of strain 51 used
did not carry the deletion in its germ line genome, micronuclear DNA
was PCR amplified from total DNA samples of karyonidal clones
containing the shortened version in their macronuclear genome, by using
micronuclear sequence-specific primers located in other IESs. The
micronuclear sequence was found to be identical with the published
sequence present in
51Amic. Since micronuclei and macronuclei
develop from mitotic products of the same zygotic nucleus, the 28-bp
deletion must occur during macronuclear development. We also checked
that the 28-bp segment was not deleted in the
51Amic molecules
replicating in the maternal macronucleus, by using preautogamous DNA
samples from transformed clones.
The 28-bp internal segment has all the characteristics of a
Paramecium IES. It is bounded by two TA direct repeats, one
of
which is left in the macronuclear maintained sequence, and its
ends
show a reasonable match to the IES end consensus (51A28 in
Fig.
8). Thus, it can be viewed as a short IES
within the larger
51A2591, which is excised during macronuclear
development when
the excision of 51A2591 is inhibited by the

51Amic
sequence in
the maternal macronucleus. Remarkably, both of the
mutations that
distinguish 29A2591 from 51A2591 are located within the
IES-like
segment (Fig.
7A). The 12-bp insertion in the
A29 allele is located immediately internal to
the downstream TA boundary,
disrupting the adjacent consensus; this may
be related to the
fact that no internal deletion occurs in IES 29A2591
when excision
of the latter is inhibited by

51Amic.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
Sequences of the ends of tested IESs. The left (L) and
right (R) end sequences of each IES are aligned with the degenerate
consensus established from the general IES sample (18, 19).
All sequences are written 5' to 3'. Subscripts in the general consensus
indicate the fraction of sequences in the general sample showing the
preferred nucleotide at each position. Sequences marked with asterisks
are the ends of internal IES-like segments within 51A2591 (51A28) and
51A6649 (51A29).
|
|
The macronuclear maintained versions of the other four regulatable IESs
were sequenced in the same way. The maintained 51A6649
sequence also
lacked a 29-bp internal segment present in the micronuclear
sequence
(Fig.
7A), explaining the size difference already noticeable
in Fig.
4.
Like the 28-bp segment of 51A2591, the 29-bp segment
has all the
characteristics of an IES (51A29 in Fig.
8). PCR amplification
and
sequencing were again used to check that the segment was present
in the
micronuclei of clones maintaining the shortened version
in their
macronuclei. The only difference between allelic IESs
29A6649 and
51A6649 is a substitution located in the IES-like
segment. To determine
whether the 29-bp segment can also be independently
excised in the
A29 allele, the excision of 29A6649 was
inhibited by transforming
d4.2 cells with plasmid p29A6649mic, at a
copy number which did
not cause copy number reduction in the new
macronucleus. Restriction
mapping of the PCR-amplified maintained
version of 29A6649 showed
that it was about 29 bp shorter than the
micronuclear sequence,
consistent with the idea that the same segment
as that in 51A6649
had been excised (data not shown). The deletion of
short internal
segments, however, is not a general feature of
maintained IESs:
the macronuclear versions of 51A-712, 51G4404, and
51G2832 were
shown to be identical with the corresponding germ line
sequences.
Characteristics of IESs showing inhibition.
Only five of the
tested IESs could be maintained in the new macronucleus, following
maternal transformation with micronuclear sequences. They share no
obvious feature that could clearly distinguish them from the other
eight. Four of them are among the largest (222 to 370 bp), while none
of the short ones (28 to 52 bp), including the short IES-like segments
located within 51A2591 and 51A6649, could be blocked. However, maternal
inhibition is not determined only by size, because only one of several
77-bp IESs shows the effect, and the largest IES in the sample
(51A4578, 882 bp) does not. There appears to be nothing special about
the location of IESs showing inhibition, as they are interspersed with
other IESs in coding sequences; one of them (51A-712) is located in
noncoding sequences. Since the only significant sequence feature
identified in IESs is the degenerate consensus of end sequences, the
ends of tested IESs were examined (Fig. 8). Internal IES-like segments, which were always excised from the maintained versions of 51A2591 and
51A6649, were included in the analysis. In IESs not showing inhibition,
the degree of conservation of each of the eight positions of the
consensus is similar to that observed in the whole sample of IESs from
which the consensus was established. In IESs showing inhibition, the
fourth position shows a T in 8 sequences of 10, whereas an A is
preferred in 70% of sequences in the general sample. Although the
number of sequences is limited, this deviation is interesting because
all known IESs beginning with the sequence 5'-TATT-3' on both sides
have now been shown to be subject to maternal inhibition. However, this
sequence feature is not necessary for the effect, since both ends of
51A6649 show the more standard sequence 5'-TACA-3'.
 |
DISCUSSION |
This study has shown that the developmental excision of five
different Paramecium IESs can be inhibited by transformation of the maternal macronucleus with specific micronuclear sequences. Although 12 of the 13 IESs tested belong to the A and
G genes, one of those showing inhibition (51A-712) is
located ~700 bp upstream of the A-gene transcription start
site. This region is apparently noncoding and is clearly upstream of
the A-gene promoter, since normal transcription regulation
does not require more than ~270 bp of upstream sequences (21,
23). Thus, the effect is not limited to IESs located within
surface antigen genes and may concern a sizeable fraction of the
estimated ~50,000 different IESs in the genome. The case of
paralogous IESs 51G4404 and 51A4404 is interesting because only the
former could be inhibited. IESs that have a common ancestor are
unlikely to use radically different excision mechanisms, suggesting
that the same mechanism can be differently affected depending on the
particular sequence. Paralogous IESs often show limited sequence
conservation at their very ends (22, 38); the fact that one
of the TATT ends of 51G4404 is changed to TATG in 51A4404 can be viewed
as supporting the significance of the deviation from the consensus
noted above. However, this single criterion is not sufficient to
explain the different behaviors of all tested IESs.
The search for possible mechanisms should take into account all basic
features of this transnuclear epigenetic phenomenon. The first and most
important is sequence specificity. The micronuclear A gene
can inhibit the excision of A-gene IESs in the developing macronucleus but has no effect on G-gene IESs and vice
versa. Maternal inhibition is caused by the IESs themselves, as shown by macronuclear controls and the effect of 51G4404 without flanking sequences (8). Complete IES specificity was here
demonstrated for the effects of 51A-712, 29A6649, and 51G4404; in an
independent study, transformation with 51A2591 alone was shown to block
the homologous IES (24). Taken together, these results
strongly suggest that each IES inhibits the excision of its germ line
copy independently from the others. The homology requirement can
nevertheless tolerate small differences between the sequence present in
the maternal macronucleus and the germ line sequence, such as the introduction of a restriction site within 51G4404 (8), or
the allelic differences between A51 and
A29 (one substitution and a 12-bp insertion at
the most, in 29A2591). This allowed us to show that macronuclear
maintained IESs originate from the germ line genome and are not copied
from maternal sequences. Short internal deletions in the maintained
versions of IESs 51A2591 and 51A6649 (28 and 29 bp of 370) do not seem
to impair the effect either, as these shortened copies were themselves
able to inhibit excision of the germ line copies in the following
sexual generation. In contrast, removing a 147-bp internal segment from
the 222-bp IES 51G4404 has been shown to abolish the effect
(8).
A second important feature is copy number dependence. Because of the
large variability observed among individual karyonidal clones derived
from a single transformed clone, the quantitative relationship is most
clearly evidenced by the analysis of mass-autogamy samples, which
measures the average effect in ~40 different karyonidal clones for
each point. Karyonidal variability could in principle reflect the
unequal distribution of IES copies during amitotic divisions of the
transformed macronucleus, leading to variable copy numbers at the time
of induction of autogamy. However, this is unlikely to account for the
extreme variability observed in some cases. For instance, the absence
of any effect on 51G2832 in some karyonidal clones from the G4
population cannot be explained by the absence of the
51Gmic insert
in the maternal macronuclei of these particular cells during autogamy,
because 51G4404 was fully maintained in these clones. Similarly, one
karyonide derived from a clone transformed with
51Amic was found to
retain 51A6649 but not 51A2591, although the latter is retained on a
higher fraction of copies in the mass-autogamy sample (data not shown).
Thus, excision inhibition appears to be a stochastic process in single developing macronuclei; the mass-autogamy correlation indicates that
its probability is determined by the copy number of the IES in the
maternal macronucleus.
Thirdly, for a given maternal copy number, the probability of
inhibition varies greatly between different IESs. It should be noted
that when the effect is weak (low maternal copy numbers or unefficient
IESs), karyonidal variability may not be correctly averaged in pools of
~40 karyonidal clones, which adds to measurement errors inherent in
the quantification of faint hybridization signals. Despite these
technical limitations, the consistency of the mass-autogamy plots shows
that each IES is inhibited with a characteristic efficiency, which does
not correlate with any obvious feature such as IES size, position
within the gene, or end sequence. The efficiency of 51G4404 was
previously shown to increase with the length of flanking sequences
present on the maternal molecule (8). It was here shown to
be eightfold higher in the context of the
51Gmic insert than on the
largest plasmid tested (851 bp) and very close to that of the
chromosome-borne IES (50% inhibition with ~0.3 copies phg). This
suggests that the efficiencies determined for other IESs, all present
on phage inserts of similar sizes (12.3 to 12.4 kb), are also close to
their maximum values. Our attempt to determine directly the
efficiencies of chromosome-borne IESs after a second autogamy revealed
that their effects are more variable than those of phage inserts, and
on average only slightly stronger. In spite of this greater
variability, the results confirm the relative efficiencies of the
different IESs, indicating that they reflect intrinsic properties of
the elements. Since the least efficient IES was only partially
inhibited at the highest copy number tested, transformation with higher
copy numbers might have resulted in the inhibition of more IESs. Thus,
it may be misleading to classify IESs into two categories according to
whether inhibition was observed.
Finally, the observation that internal IES-like segments are
excised from the macronuclear maintained versions of 51A2591 and 51A6649 reveals that at least parts of the inhibited IESs are
still accessible to the excision machinery. Internal excision events
are not linked to the process of maternal inhibition, as they do not
occur in the A29 allele of 51A2591, nor in the
other three IESs showing inhibition. Moreover, a point mutation at the
left end of 51A2591 has been reported to impair excision, allowing
Mayer et al. (24) to show that, in the absence of any
maternal inhibition, the internal 28-bp segment is still deleted in the
macronuclear version of the IES. Similarly, a point mutation in one of
the TA boundaries of 51A6649 reveals that the excision of the internal
29-bp segment occurs independently from the maternal inhibition
(25). It has been suggested that the 51A2591 28-bp segment
could have originated from the secondary insertion of some mobile
element into a preexisting IES or ancestral transposon (24).
Our observation that allelic differences between 51A2591 and 29A2591
are all located within this segment does not support a more recent
origin. Since the homologous segment from the
A29 allele does not appear to be capable of
independent excision, the data are perhaps more consistent with the
idea that functional IES consensus sequences were created by random
mutations in the A51 allele. However, it remains
intriguing that the only allelic difference between 51A6649 and
29A6649 is also located within the 29-bp IES-like segment.
Two different types of models have been proposed to account for the
sequence specificity of maternal inhibition of IES excision in
Paramecium and Tetrahymena spp. (2,
8). In the first type, IES copies in the maternal macronucleus
sequester a sequence-specific protein factor that is required for
excision in the developing macronucleus. Although formally a
possibility, the model would require an unreasonably large number of
different factors if, as suggested by the present work, a significant
fraction of IESs in the genome can inhibit their own excision with a
high specificity. Furthermore, the factor would have to bind the IES
itself, since flanking macronuclear sequences have no inhibitory
effect; this is difficult to reconcile with the higher efficiency of
molecules containing longer flanking sequences.
The second type of model proposes that IES copies are exported from the
maternal macronucleus to the developing macronucleus, where they would
affect excision by pairing with homologous sequences of the germ line
genome. The model easily accounts for the observed sequence
specificity; furthermore, the dependence of inhibition efficiency on
the length of IES flanking sequences could be explained by differences
in pairing efficiency. Although there is no direct evidence, a transfer
of nucleic acids between the two nuclei is also likely to be involved
in another type of homology-dependent maternal effects on macronuclear
development in Paramecium spp., affecting the level of
amplification of macronucleus-destined sequences (27, 28,
30). RNA would seem to be a better candidate than DNA for a
messenger molecule able to leave one nucleus and enter another. That
IES-containing plasmids and phage inserts can be transcribed without
the need for a polymerase II promoter is suggested by a recent study of
homology-dependent gene silencing in vegetative cells, in which
aberrantly sized transcripts could be detected following transformation
of the macronucleus with plasmids containing promoterless coding
sequences (35). Furthermore, the maternal macronucleus is
known to remain fully active in transcription throughout the
development of the new macronucleus (1).
In the simplest version of this model, pairing of a maternal transcript
with the germ line sequence could directly inhibit IES excision by
steric hindrance. This is unlikely because excision of the internal
IES-like segments in 51A2591 and 51A6649 would then be expected to be
inhibited in the same way. Alternatively, a transient pairing
interaction could induce some epigenetic modification of the germ line
IES, which in turn would block excision. A highly localized
modification, such as the methylation or other chemical modification of
specific nucleotides or dinucleotides, could affect the excision of
each IES to a different extent, depending on the location of modified
sites relative to IES boundaries. This could explain the absence of any
inhibitory effect for some IESs and for internal IES-like segments. For
a given IES, the efficiency of inhibition would also depend on the
concentration of effective transcripts, determined by the copy number
of the maternal IES. The fact that
51Amic can occasionally inhibit
51A6649 without affecting the more sensitive 51A2591 suggests that
effective transcripts do not necessarily cover the whole phage insert.
Maternal transcription level and RNA stability might thus be additional
factors that determine the characteristic inhibition efficiency of each IES.
The targeting of epigenetic modifications to specific genomic sequences
through pairing interactions has been implicated in many
homology-dependent gene silencing phenomena. These effects have been
revealed by transformation in a wide range of eukaryotes (13,
20), including P. tetraurelia (35). Both
transcriptional and posttranscriptional cases of silencing are
frequently associated with epigenetic modifications of the genes; it
has recently been proposed that all types of homology-dependent gene
silencing in plants are triggered by a common RNA-based mechanism
(44). The transnuclear nature of the Paramecium
maternal effect is not unique. A dominant silencing effect has been
observed in multinucleated cells of Neurospora crassa
(4); in several multicellular organisms, the
propagation of homology-dependent silencing signals is thought to involve the transfer of RNA molecules across cellular
boundaries (10, 32). The novel aspect of the
homology-dependent epigenetic effect described here is that it affects
developmental genome rearrangements rather than gene expression.
 |
ACKNOWLEDGMENTS |
We thank J. R. Preer, Jr., for the gift of the
library
of micronuclear DNA and J. D. Forney for the gift of phage
SA1.
This work was supported by grant no. 22/95 from the Groupement de
Recherches et d'Etudes sur les Génomes, BP25, 91193 Gif-sur-Yvette Cedex, France; grant no. 1374 from the Association pour
la Recherche sur le Cancer, 94800 Villejuif, France; and grant no.
97N63/0016 from the Centre National de la Recherche Scientifique. S. Duharcourt was the recipient of doctoral fellowships from the
Association pour la Recherche sur le Cancer and from the Fondation pour
la Recherche Médicale.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Génétique Moléculaire, ENS, 46 rue d'Ulm, 75005 Paris, France. Phone: 33 (1) 44 32 39 49. Fax: 33 (1) 44 32 39 41. E-mail: emeyer{at}wotan.ens.fr.
 |
REFERENCES |
| 1.
|
Berger, J. D.
1973.
Nuclear differentiation and nucleic acid synthesis in well-fed exconjugants of Paramecium aurelia.
Chromosoma
42:247-268[Medline].
|
| 2.
|
Chalker, D. L., and M.-C. Yao.
1996.
Non-Mendelian, heritable blocks to DNA rearrangement are induced by loading the somatic nucleus of Tetrahymena with germ line-limited DNA.
Mol. Cell. Biol.
16:3658-3667[Abstract].
|
| 3.
|
Church, G. M., and W. Gilbert.
1984.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:1991-1995[Abstract/Free Full Text].
|
| 4.
|
Cogoni, C.,
J. T. Irelan,
M. Schumacher,
E. U. Selker, and G. Macino.
1996.
Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation.
EMBO J.
15:3153-3163[Medline].
|
| 5.
|
Coyne, R. S.,
D. L. Chalker, and M.-C. Yao.
1996.
Genome downsizing during ciliate development: nuclear division of labor through chromosome restructuring.
Annu. Rev. Genet.
30:557-578[Medline].
|
| 6.
|
Dubrana, K.,
A. Le Mouël, and L. Amar.
1997.
Deletion endpoint allele specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.
Nucleic Acids Res.
25:2448-2454[Abstract/Free Full Text].
|
| 7.
| Dubrana, K., and L. Amar. 1998. Personal
communication.
|
| 8.
|
Duharcourt, S.,
A. Butler, and E. Meyer.
1995.
Epigenetic self-regulation of the excision of an internal eliminated sequence in Paramecium tetraurelia.
Genes Dev.
9:2065-2077[Abstract/Free Full Text].
|
| 9.
|
Epstein, L. M., and J. D. Forney.
1984.
Mendelian and non-Mendelian mutations affecting surface antigen expression in Paramecium tetraurelia.
Mol. Cell. Biol.
4:1583-1590[Abstract/Free Full Text].
|
| 10.
|
Fire, A.,
S. Xu,
M. K. Montgomery,
S. A. Kostas,
S. E. Driver, and C. C. Mello.
1998.
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature
391:806-811[Medline].
|
| 11.
|
Gilley, D.,
J. R. Preer, Jr.,
K. J. Aufderheide, and B. Polisky.
1988.
Autonomous replication and addition of telomerelike sequences to DNA microinjected into Paramecium tetraurelia macronuclei.
Mol. Cell. Biol.
8:4765-4772[Abstract/Free Full Text].
|
| 12.
|
Godiska, R. D.,
K. J. Aufderheide,
D. Gilley,
P. Hendrie,
T. Fitzwater,
L. B. Preer,
B. Polisky, and J. R. Preer, Jr.
1987.
Transformation of Paramecium by microinjection of a cloned serotype gene.
Proc. Natl. Acad. Sci. USA
84:7590-7594[Abstract/Free Full Text].
|
| 13.
|
Henikoff, S., and M. A. Matzke.
1997.
Exploring and explaining epigenetics effects.
Trends Genet.
13:293-295[Medline].
|
| 14.
|
Jaraczewski, J. W., and C. L. Jahn.
1993.
Elimination of Tec elements involves a novel excision process.
Genes Dev.
7:95-105[Abstract/Free Full Text].
|
| 15.
|
Katinka, M. D., and F. M. Bourgain.
1992.
Interstitial telomeres are hotspots for illegitimate recombination with DNA molecules injected into the macronucleus of Paramecium primaurelia.
EMBO J.
11:725-732[Medline].
|
| 16.
|
Kim, C. S.,
J. R. Preer, Jr., and B. Polisky.
1992.
Bacteriophage lambda fragments replicate in the Paramecium macronucleus: absence of active copy number control.
Dev. Genet.
13:97-102[Medline].
|
| 17.
|
Klobutcher, L. A.,
L. R. Turner, and J. LaPlante.
1993.
Circular forms of developmentally excised DNA in Euplotes crassus have a heteroduplex junction.
Genes Dev.
7:84-94[Abstract/Free Full Text].
|
| 18.
|
Klobutcher, L. A., and G. Herrick.
1995.
Consensus inverted terminal repeat sequence of Paramecium IESs: resemblance to termini of Tc1-related and Euplotes Tec transposons.
Nucleic Acids Res.
23:2006-2013[Abstract/Free Full Text].
|
| 19.
|
Klobutcher, L. A., and G. Herrick.
1997.
Developmental genome reorganization in ciliated protozoa: the transposon link.
Prog. Nucleic Acids Res. Mol. Biol.
56:1-62[Medline].
|
| 20.
|
Kumpatla, S. P.,
M. B. Chandrasekharan,
L. M. Iyer,
G. Li, and T. C. Hall.
1998.
Genome intruder scanning and modulation systems and transgene silencing.
Trends Plant Sci.
3:97-104.
|
| 21.
|
Leeck, C. L., and J. D. Forney.
1994.
The upstream region is required but not sufficient to control mutually exclusive expression of Paramecium surface antigen genes.
J. Biol. Chem.
269:31283-31288[Abstract/Free Full Text].
|
| 22.
|
Ling, K.-Y.,
B. Vaillant,
W. J. Haynes,
Y. Saimi, and C. Kung.
1998.
A comparison of internal eliminated sequences in the genes that encode two K(+)-channel isoforms in Paramecium tetraurelia.
J. Eukaryot. Microbiol.
45:459-465[Medline].
|
| 23.
|
Martin, L. D.,
S. Pollack,
J. R. Preer, Jr., and B. Polisky.
1994.
DNA sequence requirements for the regulation of immobilization antigen A expression in Paramecium tetraurelia.
Dev. Genet.
15:443-451[Medline].
|
| 24.
|
Mayer, K. M.,
K. Mikami, and J. D. Forney.
1998.
A mutation in Paramecium tetraurelia reveals functional and structural features of developmentally excised DNA elements.
Genetics
148:139-149[Abstract/Free Full Text].
|
| 25.
| Mayer, K. M., and J. D. Forney. 1998. Personal communication.
|
| 26.
|
Meyer, E.
1992.
Induction of specific macronuclear developmental mutations by microinjection of a cloned telomeric gene in Paramecium primaurelia.
Genes Dev.
6:211-222[Abstract/Free Full Text].
|
| 27.
|
Meyer, E., and S. Duharcourt.
1996.
Epigenetic programming of developmental genome rearrangements in ciliates.
Cell
87:9-12[Medline].
|
| 28.
|
Meyer, E., and S. Duharcourt.
1996.
Epigenetic regulation of programmed genomic rearrangements in Paramecium aurelia.
J. Eukaryot. Microbiol.
43:453-461[Medline].
|
| 29.
|
Meyer, E., and A.-M. Keller.
1996.
A Mendelian mutation affecting mating-type determination also affects developmental genomic rearrangements in Paramecium tetraurelia.
Genetics
143:191-202[Abstract].
|
| 30.
|
Meyer, E.,
A. Butler,
K. Dubrana,
S. Duharcourt, and F. Caron.
1997.
Sequence-specific epigenetic effects of the maternal somatic genome on developmental rearrangements of the zygotic genome in Paramecium primaurelia.
Mol. Cell. Biol.
17:3589-3599[Abstract].
|
| 31.
|
Nielsen, E.,
Y. You, and J. Forney.
1991.
Cysteine residue periodicity is a conserved structural feature of variable surface proteins from Paramecium tetraurelia.
J. Mol. Biol.
222:835-841[Medline].
|
| 32.
|
Palauqui, J.-C.,
T. Elmayan,
J.-M. Pollien, and H. Vaucheret.
1997.
Systemic acquired silencing: transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocks to non-silenced scions.
EMBO J.
16:4738-4745[Medline].
|
| 33.
|
Prat, A.
1990.
Conserved sequences flank variable tandem repeats in two alleles of the G surface protein of Paramecium primaurelia.
J. Mol. Biol.
211:521-535[Medline].
|
| 34.
|
Prescott, D. M.
1994.
The DNA of ciliated protozoa.
Microbiol. Rev.
58:233-267[Abstract/Free Full Text].
|
| 35.
|
Ruiz, F.,
L. Vayssié,
C. Klotz,
L. Sperling, and L. Madeddu.
1998.
Homology-dependent gene silencing in Paramecium.
Mol. Biol. Cell
9:931-943[Abstract/Free Full Text].
|
| 36.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Saveliev, S. V., and M. M. Cox.
1996.
Developmentally programmed DNA deletion in Tetrahymena thermophila by a transposition-like mechanism.
EMBO J.
15:2858-2869[Medline].
|
| 38.
|
Scott, J.,
C. Leeck, and J. Forney.
1994.
Analysis of the micronuclear B type surface protein gene in Paramecium tetraurelia.
Nucleic Acids Res.
22:5079-5084[Abstract/Free Full Text].
|
| 39.
|
Sonneborn, T. M.
1970.
Methods in Paramecium research.
Methods Cell Physiol.
4:241-339.
|
| 40.
|
Sonneborn, T. M.
1974.
Paramecium aurelia, p. 469-594.
In
R. C. King (ed.), Handbook of genetics: plants, plant viruses and protists, vol. 2. Plenum Press, New York, N.Y.
|
| 41.
|
Steele, C. J.,
G. A. Barkocy-Gallagher,
L. B. Preer, and J. R. Preer, Jr.
1994.
Developmentally excised sequences in micronuclear DNA of Paramecium.
Proc. Natl. Acad. Sci. USA
91:2255-2259[Abstract/Free Full Text].
|
| 42.
|
Vayssié, L.,
L. Sperling, and L. Madeddu.
1997.
Characterization of multigene families in the micronuclear genome of Paramecium tetraurelia reveals a germline specific sequence in an intron of a centrin gene.
Nucleic Acids Res.
25:1036-1041[Abstract/Free Full Text].
|
| 43.
| Vayssié, L., and L. Madeddu. 1998. Personal
communication.
|
| 44.
|
Wassenegger, M., and T. Pélissier.
1998.
A model for RNA-mediated gene silencing in higher plants.
Plant Mol. Biol.
37:349-362[Medline].
|
Molecular and Cellular Biology, December 1998, p. 7075-7085, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nowacki, M., Higgins, B. P., Maquilan, G. M., Swart, E. C., Doak, T. G., Landweber, L. F.
(2009). A Functional Role for Transposases in a Large Eukaryotic Genome. Science
324: 935-938
[Abstract]
[Full Text]
-
Lepere, G., Nowacki, M., Serrano, V., Gout, J.-F., Guglielmi, G., Duharcourt, S., Meyer, E.
(2009). Silencing-associated and meiosis-specific small RNA pathways in Paramecium tetraurelia. Nucleic Acids Res
37: 903-915
[Abstract]
[Full Text]
-
Gratias, A., Lepere, G., Garnier, O., Rosa, S., Duharcourt, S., Malinsky, S., Meyer, E., Betermier, M.
(2008). Developmentally programmed DNA splicing in Paramecium reveals short-distance crosstalk between DNA cleavage sites. Nucleic Acids Res
36: 3244-3251
[Abstract]
[Full Text]
-
Lepere, G., Betermier, M., Meyer, E., Duharcourt, S.
(2008). Maternal noncoding transcripts antagonize the targeting of DNA elimination by scanRNAs in Paramecium tetraurelia. Genes Dev.
22: 1501-1512
[Abstract]
[Full Text]
-
Duret, L., Cohen, J., Jubin, C., Dessen, P., Gout, J.-F., Mousset, S., Aury, J.-M., Jaillon, O., Noel, B., Arnaiz, O., Betermier, M., Wincker, P., Meyer, E., Sperling, L.
(2008). Analysis of sequence variability in the macronuclear DNA of Paramecium tetraurelia: A somatic view of the germline. Genome Res
18: 585-596
[Abstract]
[Full Text]
-
Robinson, T., Katz, L. A.
(2007). Non-Mendelian Inheritance of Paralogs of 2 Cytoskeletal Genes in the Ciliate Chilodonella uncinata. Mol Biol Evol
24: 2495-2503
[Abstract]
[Full Text]
-
Kowalczyk, C. A., Anderson, A. M., Arce-Larreta, M., Chalker, D. L.
(2006). The germ line limited M element of Tetrahymena is targeted for elimination from the somatic genome by a homology-dependent mechanism. Nucleic Acids Res
34: 5778-5789
[Abstract]
[Full Text]
-
Zufall, R. A., McGrath, C. L., Muse, S. V., Katz, L. A.
(2006). Genome Architecture Drives Protein Evolution in Ciliates. Mol Biol Evol
23: 1681-1687
[Abstract]
[Full Text]
-
Matsuda, A., Forney, J. D.
(2006). The SUMO Pathway Is Developmentally Regulated and Required for Programmed DNA Elimination in Paramecium tetraurelia. Eukaryot Cell
5: 806-815
[Abstract]
[Full Text]
-
Malone, C. D., Anderson, A. M., Motl, J. A., Rexer, C. H., Chalker, D. L.
(2005). Germ Line Transcripts Are Processed by a Dicer-Like Protein That Is Essential for Developmentally Programmed Genome Rearrangements of Tetrahymena thermophila. Mol. Cell. Biol.
25: 9151-9164
[Abstract]
[Full Text]
-
Matsuda, A., Forney, J. D.
(2005). Analysis of Paramecium tetraurelia A-51 Surface Antigen Gene Mutants Reveals Positive-Feedback Mechanisms for Maintenance of Expression and Temperature-Induced Activation. Eukaryot Cell
4: 1613-1619
[Abstract]
[Full Text]
-
Matsuda, A., Takahashi, M.
(2005). Non-Mendelian Inheritance Induced by Gene Amplification in the Germ Nucleus of Paramecium tetraurelia. Genetics
169: 137-147
[Abstract]
[Full Text]
-
Chalker, D. L., Fuller, P., Yao, M.-C.
(2005). Communication Between Parental and Developing Genomes During Tetrahymena Nuclear Differentiation Is Likely Mediated by Homologous RNAs. Genetics
169: 149-160
[Abstract]
[Full Text]
-
Garnier, O., Serrano, V., Duharcourt, S., Meyer, E.
(2004). RNA-Mediated Programming of Developmental Genome Rearrangements in Paramecium tetraurelia. Mol. Cell. Biol.
24: 7370-7379
[Abstract]
[Full Text]
-
Fillingham, J. S., Pearlman, R. E.
(2004). Role of Micronucleus-Limited DNA in Programmed Deletion of mse2.9 during Macronuclear Development of Tetrahymena thermophila. Eukaryot Cell
3: 288-301
[Abstract]
[Full Text]
-
Ardell, D. H., Lozupone, C. A., Landweber, L. F.
(2003). Polymorphism, Recombination and Alternative Unscrambling in the DNA Polymerase {alpha} Gene of the Ciliate Stylonychia lemnae (Alveolata; class Spirotrichea). Genetics
165: 1761-1777
[Abstract]
[Full Text]
-
Gratias, A., Betermier, M.
(2003). Processing of Double-Strand Breaks Is Involved in the Precise Excision of Paramecium Internal Eliminated Sequences. Mol. Cell. Biol.
23: 7152-7162
[Abstract]
[Full Text]
-
Yao, M.-C., Fuller, P., Xi, X.
(2003). Programmed DNA Deletion As an RNA-Guided System of Genome Defense. Science
300: 1581-1584
[Abstract]
[Full Text]
-
Sperling, L., Dessen, P., Zagulski, M., Pearlman, R. E., Migdalski, A., Gromadka, R., Froissard, M., Keller, A.-M., Cohen, J.
(2002). Random Sequencing of Paramecium Somatic DNA. Eukaryot Cell
1: 341-352
[Abstract]
[Full Text]
-
Dubrana, K., Amar, L.
(2001). Control of DNA excision efficiency in Paramecium. Nucleic Acids Res
29: 4654-4662
[Abstract]
[Full Text]
-
Ku, M., Mayer, K., Forney, J. D.
(2000). Developmentally Regulated Excision of a 28-Base-Pair Sequence from the Paramecium Genome Requires Flanking DNA. Mol. Cell. Biol.
20: 8390-8396
[Abstract]
[Full Text]
-
Haynes, W. J., Ling, K.-Y., Preston, R. R., Saimi, Y., Kung, C.
(2000). The Cloning and Molecular Analysis of pawn-B in Paramecium tetraurelia. Genetics
155: 1105-1117
[Abstract]
[Full Text]
-
Bétermier, M., Duharcourt, S., Seitz, H., Meyer, E.
(2000). Timing of Developmentally Programmed Excision and Circularization of Paramecium Internal Eliminated Sequences. Mol. Cell. Biol.
20: 1553-1561
[Abstract]
[Full Text]
-
Nikiforov, M. A., Smothers, J. F., Gorovsky, M. A., Allis, C. D.
(1999). Excision of micronuclear-specific DNA requires parental expression of Pdd2p andoccursindependentlyfromDNA replication in Tetrahymena thermophila. Genes Dev.
13: 2852-2862
[Abstract]
[Full Text]
-
Mayer, K. M., Forney, J. D.
(1999). A Mutation in the Flanking 5'-TA-3' Dinucleotide Prevents Excision of an Internal Eliminated Sequence From the Paramecium tetraurelia Genome. Genetics
151: 597-604
[Abstract]
[Full Text]