INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

To understand the molecular mechanisms of initiation and regulation of eukaryotic DNA replication, it is helpful to study the cis-acting sequences (replicators) essential for origin function. Identification and characterization of replicators in the budding yeast, Saccharomyces cerevisiae, were facilitated by the discovery that DNA sequences serving as replicators in chromosomes also serve as replicators in plasmids (reviewed in reference 30). These origin sequences are called autonomously replicating sequence (ARS) elements, because they permit plasmids to replicate autonomously in yeast cells.

Plasmids bearing ARS elements and selectable markers can transform S. cerevisiae cells at a high frequency (15, 38), permitting a plasmid transformation assay that has been used to characterize the sequence requirements for origin function. ARS elements have two essential components: a short A domain of about 20 bp, which contains a 9-of-11 match to the 11-bp ARS consensus sequence (ACS) (4, 30), and a broad (~100-bp) flanking region, called the B domain, 3' to the consensus T-rich strand. The B domain consists of two or three additional important sequence motifs (16, 23, 31, 39). One of the important sequences in the B domain, called B1, cooperates with the A domain to form a binding site for the origin recognition complex (ORC), the putative initiator protein (2, 32, 33). Other possible functions for the B domain include serving as a DNA unwinding element (28, 41), enhancing origin activity by serving as a binding site for transcription factors (23, 42), and interacting with a single-stranded DNA binding protein (24).

Replication origins in most other eukaryotes are poorly understood, mainly due to lack of unambiguous techniques for characterizing them. However, in the fission yeast, Schizosaccharomyces pombe, which is evolutionarily distant from S. cerevisiae (3), chromosomal DNA sequences with properties similar to ARS elements of budding yeast have been identified (25, 26, 34, 40, 44), and some of them have been shown to correspond to chromosomal replication origins (8, 35, 43). Because S. pombe is in some respects more similar to other eukaryotic organisms than is S. cerevisiae (reviewed in reference 45), it is possible that further study of ARS elements in S. pombe will provide information useful in understanding replication origins in many other eukaryotic organisms.

S. pombe ARS elements are AT rich, like those of S. cerevisiae, but are generally bigger (500 to 1500 bp). Two S. pombe ARS elements, ars1 (5) and ars3002 (7), have been studied in some detail. Deletion and linker substitution analyses indicate that these ARS elements contain at least one (for ars1) or two (for ars3002) essential modules and some additional important modules, and each of the essential modules contains critical sequence elements extending for 20 to 30 bp. The critical sequences are all AT rich and asymmetric, in the sense that A residues are clustered on one strand while T residues are clustered on the complementary strand.

To test whether these features are common to other S. pombe ARS elements, we chose to study the ribosomal DNA (rDNA) ARS element, which we have previously mapped to the nontranscribed spacer in the rDNA repeats (35). Because there are 100 to 150 copies of the rDNA repeat in the S. pombe genome, the rDNA ARS element is by far the most abundant ARS element in the genome.

We have previously shown that a 2.3-kbp BamHI-KpnI restriction fragment within the rDNA repeat (see Fig. 1) exhibits as much ARS activity as a restriction fragment containing the entire rDNA repeat and that the 2.3-kbp fragment contains all detectable rDNA initiation sites (see the gray box in Fig. 1 and reference 35). The ARS element within this 2.3-kbp fragment was designated ars3001 according to the four-digit S. pombe ARS-naming convention (8), because it was the first ARS element to be discovered in chromosome III (9, 40).

In this report, we describe the results of systematic mutagenesis of ars3001. These results identify three domains that are essential for function. Each of these domains contains important sequences which share similarities with those detected in the two earlier studies but are not equivalent to the ACS of S. cerevisiae ARS elements. Domain substitution experiments indicate that the three domains are largely orientation dependent and can partially substitute for each other.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Strains and media. Escherichia coli DH5 cells (Life Technologies) were used for cloning plasmids containing mutated ars3001 DNA. The S. pombe strain ura4-D18 (ura4-D18 leu1-32 end1 h) (12) was used as the recipient strain for transformation assays. Cells were grown in EMM (27) supplemented with 150 mg (each) of uracil and leucine per liter when not under selection or 150 mg of leucine per liter when under selection for uracil prototrophy.

Generation of progressive deletions and determination of nucleotide sequence of the 2.3-kbp BamHI-KpnI restriction fragment. Plasmid pRS306 (or 406):rDNA-2.3k was constructed by ligating the 2.3-kbp BamHI-blunt-ended-KpnI fragment (see Fig. 1) between the BamHI and SmaI sites in the multiple cloning site of the vector pRS306 or pRS406 (37). Unidirectional sequential deletions from both ends of the insert were generated with exonuclease III as described previously (13) with modifications suggested by Stratagene (protocol for the pBluescriptII exonuclease III-mung bean DNA sequencing system; Stratagene). For deletions starting at the BamHI site, plasmid pRS406:rDNA-2.3k was digested with BamHI, to generate recessed 3' ends susceptible to exonuclease III attack, and also with SacI, to generate exonuclease III-resistant protruding 3' ends. For deletions in the opposite orientation, plasmid pRS306:rDNA-2.3k was digested with EcoRI to generate susceptible ends. To generate resistant ends, treatment with HindIII was followed by treatment with Klenow polymerase and -thio-deoxynucleoside triphosphates. Subsequent incubation with exonuclease III for increasing times resulted in progressive resection of the insert while leaving the SacI or -thio-HindIII end intact. Mung bean nuclease was then used to generate flush ends. The plasmids were recircularized by blunt-end ligation and then used to transform DH5 cells. Minipreps of individual plasmid clones from each time point were used to select clones with deletions of increasing sizes in increments of 100 to 250 bp. These clones were then used, in combination with vector-specific primers, to determine the nucleotide sequence of both strands of the 2.3-kbp BamHI-KpnI fragment.

Plasmid construction. To obtain the plasmid pura4script:rDNA-573, the exonuclease III deletion construct, K4 (see Fig. 2A), was cut with FokI and treated with Klenow polymerase. The resulting rDNA-containing 1.86-kbp fragment was gel purified and cut with ClaI to generate a 583-bp fragment (the desired 573-bp fragment plus 10 extra bp of vector sequence). The gel-purified 583-bp fragment was ligated between the ClaI and SmaI sites in the multiple cloning site of the vector pura4script (8), which contains the S. pombe ura4 gene, thus permitting selection in the ura4-D18 strain.

Generation of ~60-bp internal deletions. All the ~60-bp deletion constructs except 3 (see Fig. 3A) were made according to the protocol for the MORPH Site-Specific Plasmid DNA Mutagenesis Kit (5 Prime-3 Prime, Inc.). The primers have 13- to 18-bp flanking sequences at both sides of the region to be deleted and replaced by the EcoRI-BglII linker, GGAATTCCGAAGATCTTC, at the position of the deletion. They were annealed to the template plasmid, pura4script:rDNA-573, prepared from E. coli (methylated). Subsequent incubation with T4 DNA polymerase and T4 DNA ligase resulted in a mixture of nonmutagenized template (both strands methylated) and mutagenized (methylated template strand and nonmethylated replacement strand) plasmids. The nonmutagenized template plasmids were then fragmented by DpnI, and the mutagenized plasmids were transformed into an E. coli mutS strain, in which the methylation-specific repair system is inactive. The desired constructs were identified by susceptibility to digestion with EcoRI or BglII. For 3, the two-step PCR method described by Dubey et al. (7) was used (see below). The external primers, rightward-pointing (forward) and leftward-pointing (reverse), correspond to sequences within the multiple cloning site outside the 573-bp insert. The internal (forward and reverse) primers flanking the region to be deleted (region 3) had the EcoRI-BglII linker and the EcoRI linker, respectively, at their 5' ends. All primer sequences are available upon request.

Generation of 10-bp linker substitutions. The procedure employed was similar to that of Dubey et al. (7). All internal (forward and reverse) primers were designed with stretches of 17 to 24 nucleotides (depending on requirements for specific PCR) corresponding to the flanking sequences of the regions to be substituted (indicated by horizontal lines in Fig. 5). In addition, the primers had linkers containing AvaI restriction sites (CCCCCGGGGG) at their 5' ends. External primers were based on sequences in the vector multiple cloning site and were designed so that the XbaI and XhoI sites within the multiple cloning site would be included in the final PCR products. The forward external primer was the same as that described above (previous paragraph), and the reverse external primer was designed to delete the AvaI site located within the multiple cloning site. To generate linker substitutions, internal primers flanking regions to be substituted were amplified in combination with appropriate external primers. The resulting PCR products were digested with AvaI and then ligated together. Then, the ligation products were further amplified with the paired external primers, digested with XbaI and XhoI, and cloned between the XbaI and XhoI sites of pura4script. The consequence of these manipulations was replacement of 10 bp of S. pombe sequence by the 10-bp AvaI linker. All primer sequences are available on request.

Generation of domain substitutions and inversions. To facilitate constructing substitutions or inversions, each of the three domains was first deleted and replaced by the EcoRI-BglII linker (see Fig. 6), according to the same two-step PCR and cloning strategy used for the constructions of 3 and the 10-bp linker substitutions. Then, the desired domain (as a PCR product flanked by an EcoRI site at one side and a BglII site on the other side, depending on the intended orientation) was simply ligated between the EcoRI and BglII sites in the appropriate deletion mutant. Thus, each mutant contains the desired substitution or inversion flanked by two linkers. All primer sequences are available on request.

Transformation of S. pombe cells. S. pombe D18 (12) cells lacking the ura4 gene were transformed (10) with equal amounts of DNA from the plasmids under test and then grown under selection for uracil prototrophy. After 5 to 6 days, plates were scanned, and the number and mean size of colonies were calculated by using an image-processing program that permitted objective discrimination between the larger colonies and the smaller background colonies produced by vector alone.

Analysis of DNA sequences. To calculate free energies of unwinding, we employed the Thermodyn program (28) with a sliding 100-bp window. MacVector software (Oxford Molecular Group) was employed to search for the following consensus sequences (in which W stands for A/T, R stands for A/G, and Y stands for T/C): M, WRTTTATTTAW (1 mismatch allowed) (25); Z, WWTTWTWTTWTT (1 mismatch allowed) (46); C, TTGTATTTTAATTTGTATTTTTTGTAATTT (10 mismatches allowed) (5); and D, WTWTWTTTYTTTTTWTTTTA (3 mismatches allowed). Consensus sequence D has not previously been published. It is based on the 20-bp critical sequence in 10 of ars3002 (7). Using MacVector software, we first searched the database consisting of all known S. pombe ARS element sequences for 12-of-20 matches to the ars3002 critical sequence. Then, we used the Consensus program of the Genetics Computer Group software package to develop a consensus from the matches that we found. The resulting consensus is shown above as sequence D.

Nucleotide sequence accession number. The sequence of the 2.3-kbp BamHI-KpnI fragment described in this work has been deposited in GenBank under accession no. AF040270.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Improved localization and characterization of ars3001. Our previous studies (35) indicated that all S. pombe rDNA ARS activity is localized within a 2.3-kbp BamHI-KpnI fragment (Fig. 1). To better localize ars3001 activity within this fragment, we employed progressive exonuclease III deletion from both ends of the fragment. The results of assays for ARS activity in selected deletions from each set are shown in Fig. 2A. The left and right boundaries for ars3001 defined by the data in Fig. 2A are sharp compared to those of most other S. pombe ARS elements studied so far (e.g., ars3002, ars3003, and the right boundary of ars1, all of which show a gradual decrease of ARS activity as the size of the deletion increases [5, 7, 46]). However, the left boundary of ars1 is similarly sharp (5). Even though the boundaries of ars3001 appear sharp, the tested deletions were all unidirectional, leaving open the possibility that a defect generated by a deletion in the left side of the ARS element could be compensated by a region preserved on the right side of the ARS element and vice versa. To test this possibility and to obtain a small fragment with full ARS activity for further analyses, we subcloned several fragments (Fig. 2B) encompassing the boundaries defined in Fig. 2A, and we tested these small fragments for ARS activity. As shown in Fig. 2B, all the tested clones showed ARS activity comparable to that of the full 2.3-kbp fragment. Since the smallest fragment (573 bp) includes the essential region defined in Fig. 2A (gray box), we used this fragment for further studies.

View larger version (12K): [in this window] [in a new window]   FIG. 1.   Summary of previous studies localizing ARS activity in the rDNA repeat. (Top) The rDNA repeat (10.9 kbp) consists of the 3.46-kbp nontranscribed spacer (NTS) and the transcribed region containing the external transcribed spacer (ETS); the 17S, 5.8S, and 25S rRNA genes; and the internal transcribed spacers (ITS1 and ITS2, not labeled on the figure) which flank the 5.8S gene. Restriction enzyme sites are mapped based on the data from references 1, 19, 21 (GenBank accession no. Y09256) and 36 and this work (GenBank accession no. AF040270). The gray box shows the replication initiation zone where bubble arcs were detected by two-dimensional gel analysis (35). Abbreviations: A, AluI; B, BamHI; Bg, BglII; E, EcoRI; H, HindIII; K, KpnI; S, SalI. (Bottom) Restriction fragments in the rDNA repeat previously shown to have ARS activity. The presence of ARS activity is indicated by a plus symbol. The 2.3-kbp BamHI-KpnI fragment (thick line) is the smallest tested fragment with full ARS activity.

View larger version (52K): [in this window] [in a new window]   FIG. 2.   Localization of ARS activity within the 2.3-kbp fragment. (A) The map shows sets of nested deletions either from the BamHI site (B1 to B10) or from the KpnI site (K2 to K10). Thin lines represent the portion deleted from the 2.3-kbp fragment (black bar at the top of the map). Transformation frequencies (Rel. Trans. Freq.) of the deletion constructs (means ± standard deviations) are represented relative to that of the 2.3-kbp wild-type fragment. The gray box represents the minimal region showing significant ARS activity, as defined by external deletions. (B) The lines show the tested smaller fragments encompassing the minimal region defined in panel A. The thick line represents the smallest fragment (573 bp) showing a transformation frequency comparable to that of the complete 2.3-kbp fragment.

Effects of ~60-bp internal deletions. The set of exonuclease III deletion clones that we had constructed permitted us to obtain the nucleotide sequence of the 2.3-kbp restriction fragment. Availability of the nucleotide sequence allowed us to conduct a higher-resolution mutational analysis of the ARS-containing 573-bp fragment.

View larger version (53K): [in this window] [in a new window]   FIG. 3.   Effects of ~60-bp internal deletions on the ARS activity of the 573-bp version of ars3001. (A) The nucleotide sequence of the 573-bp version of ars3001 is shown with the positions of each deletion region (1 to 9). The left endpoint is a FokI cut site (see Materials and Methods) and the right endpoint is the K4 deletion point (Fig. 2). Over- and underlines are used to distinguish the boundaries of neighboring deletion regions. The size of each deletion is within the range 52 to 66 bp. The leftmost 28 nucleotides and the rightmost 19 nucleotides of the 573-bp fragment were not included in a deletion region. Instead, these sequences served as templates for primer design. The leftmost sequences are located beyond the left boundary defined by nested deletions (Fig. 2) and are thus not expected to be important for activity of the 573-bp fragment. The importance of the rightmost 19 nucleotides remains uncertain. (B) At the top are shown the transformation frequency and colony area relative to those of the 573-bp wild-type ars3001. Black bars and stippled bars represent values calculated for four independent experiments. Error bars show standard deviations. The vector alone (pura4script [7]) was transferred into S. pombe cells as a negative control. wt, wild type. In the middle is shown a map of the deletion regions, indicated by brackets. 1 to 9 correspond to deletion regions 1 to 9. At the bottom, pictured at the same magnification, are portions of petri plates from one of the experiments summarized in the chart at 6 days after transformation.

View larger version (41K): [in this window] [in a new window]   FIG. 4.   Comparison of the three characterized S. pombe ARS elements. The three ARS elements (thick horizontal lines)ars1 (5), ars3002 (7), and ars3001were compared at the same scale in terms of effects of internal deletions on transformation frequency (Rel. Transf. Freq.), free energy of unwinding (G) (28), and locations of consensus matches. Regions whose deletions had significant effects (1, 2, etc.) are given. , , and  along with the underlines mark the locations of the three 50-bp domains for ars3001. The positions of consensus matches are marked by vertical black lines with horizontal tails below the thick lines. M corresponds to the 11-bp consensus WRTTTATTTAW of Maundrell et al. (25), Z corresponds to the 12-bp consensus WWTTWTWTTWTT of Zhu et al. (46), C corresponds to the rightmost 30 bp (TTGTATTTTAATTTGTATTTTTTGTAATTT) in segment 1 of Clyne and Kelly (5), and D corresponds to a 20-bp consensus (WTWTWTTTYTTTTTWTTTTA; see Materials and Methods) based on the critical sequence in 10 of ars3002 (7) (in the aforementioned sequences, W stands for A/T, R stands for A/G, and Y stands for T/C). In each case, the direction of the horizontal tail indicates the orientation of the T-rich form of the consensus (see text and Fig. 5 legend for details).

Effects of 10-bp linker substitutions. To obtain a higher-resolution picture of the nucleotide sequences important for ARS function in regions 2, 3, 6, and 9, we employed linker substitution with a 10-bp GC-rich linker (C₅G₅). The linker was substituted for each of the overlined or underlined 10-bp nucleotide sequences (Fig. 5), and the effect of the substitution on transformation was measured. Note that the results are displayed on a logarithmic scale.

View larger version (26K): [in this window] [in a new window]   FIG. 5.   Effects of 10-bp linker substitution mutations within deletion regions 2 to 3 (A), 6 (B), and 9 (C) on ars3001 activity. The nucleotides indicated by the horizontal lines were replaced by the 10-bp linker, CCCCCGGGGG, which contains the AvaI restriction site. Each number (2-3 to 9-6) marked above the sequence corresponds to the position of a linker substitution; e.g., 2-3 corresponds to the third linker substitution from the left end of deletion region 2, etc. Note that average transformation frequencies of four to six independent experiments relative to those of the 573-bp wild type are indicated on a logarithmic scale (Log RTF). Error bars show the standard deviations. At the bottom of each nucleotide sequence are shown the positions of matches to the Z (46), M (25), C (5), and D (see Materials and Methods) S. pombe ARS consensus motifs (see also Fig. 4). In each case, the distinguishing letter is at the 3' end of the T-rich strand of the consensus motif. The boundaries of 50-bp domains , , and  are indicated by striped, dotted, and open boxes, respectively.

Effects of domain deletion, inversion, and substitution. The fact that clustered consensus sequences appear to be important for ARS activity in regions 3, 6, and 9 (Fig. 3B, 4, and 5) raises the question of what the function(s) of these sequences might be. The consensus sequence of S. cerevisiae ARS elements (the ACS) is an important part of the ORC binding site (2, 6). It is known that inversion of the S. cerevisiae ACS inactivates ARS activity (14). We wondered, therefore, what might be the effects of inverting the important clustered-consensus-sequence-containing regions in ars3001. We also wondered whether the contributions to ARS activity by regions 2, 3, 6, and 9 are unique or redundant, and we thought we might be able to distinguish between these possibilities by testing the effects of substituting the important sequences for each other.

View larger version (22K): [in this window] [in a new window]   FIG. 6.   Linker substitution at both ends of domains , , and  reduces colony size but not transformation frequency. The combined effects on ARS activity of the two different linkers flanking each domain were measured as controls for further experiments (Fig. 7). On the left are diagrams of the constructs, s (in which domain  is replaced by  itself), s ( by ), s ( by ), and the 573-bp wild-type (wt) and vector controls. Average transformation frequencies and colony sizes from two independent experiments, relative to those of the wild type, are indicated (with experimental ranges [error bars]) on the right.

View larger version (29K): [in this window] [in a new window]   FIG. 7.   Effects of deletions, substitutions, and inversions of the three domains on ARS activity. The transformation frequency (Transf. Frequ.) and colony size of each mutation were compared to those of the proper control construct (s for all domain  mutations, s for domain , and s for domain  [Fig. 6]). Average values of two independent experiments are shown with data ranges (error bars). Abbreviations: XsY, domain X replaced by domain Y; dX, deletion of X; iX, inversion of X; XsiY, domain X replaced by inverted orientation of domain Y.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The experiments described in this paper provide the first high-resolution genetic analysis of ars3001, the ARS element in S. pombe rDNA. Because the ribosomal genes are repeated 100- to 150-fold in the haploid genome (22) and because initiation sites for rDNA replication colocalize with ars3001 (35), it is likely that ars3001 contains the cis-acting sequences for the most abundant replication origins in S. pombe chromosomes.

We found that full ars3001 activity is contained within a 573-bp stretch (Fig. 2), making ars3001 the shortest of the well-characterized S. pombe ARS elements (Fig. 4). Internal deletion scanning and linker substitution mutagenesis revealed three regions within ars3001 that are especially important for its activity (Fig. 3 to 5). Based on linker substitution mutagenesis within these three regions (Fig. 5), 50-bp domains , , and  were defined to include the most important sequences in each region (Fig. 4 to 7). Each of the domains is essential for ARS activity (Fig. 7). Domains  and  (and to a lesser extent domain ) are sensitive to orientation (Fig. 7). Domain  can substitute for domains  and , and domain  can replace domain  (Fig. 7). Thus, neither domain  nor domain  performs a unique role.

What is the significance of these observations for our understanding of replication origin function in S. pombe? In attempting to answer this question, it is important to consider what has been learned from earlier studies of ars1 (5) and ars3002 (7) as well as from the present study of ars3001. Results from all three investigations are summarized in Fig. 4. In the next several paragraphs we discuss the major conclusions that can be drawn from these investigations.

Internal redundancy in S. pombe ARS elements. In Fig. 4, the thick black bars show (all on the same scale) the minimal ARS elements as defined by external deletion studies. Above the black bars are light gray bar charts showing the results of deleting the indicated 50- to 60-bp segments of each ARS element. In each series, the individual deletions are numbered consecutively from left to right across the ARS element (1, 2, etc.), but Fig. 4 displays labels only for those deletions having the most serious effects. Some deletions have very serious consequences for ARS activity, while others have negligible impact. How should the different effects of these deletions be interpreted?

The segments most important for ARS activity are usually abundant in matches to AT-rich asymmetric consensus sequence motifs. Several previous investigators have identified sequence motifs common to S. pombe ARS elements. These sequence motifs share the properties of being highly AT rich and asymmetric (mostly A residues in one strand and T residues in the other strand). We have searched for these consensus motifs in the sequences of the three ARS elements shown in Fig. 4. The positions of the matches we have found to these motifs are shown in Fig. 4 by markers consisting of vertical black lines with horizontal tails. Each marker is labeled to identify the sequence motif matched at that position. The exact locations of matching sequences in ars3001 are shown in Fig. 5. In Fig. 4 and 5, M signifies the 11-bp consensus of Maundrell et al. (25), Z stands for the 12-bp consensus of Zhu et al. (46), C indicates the rightmost 30-bp in segment 1 of Clyne and Kelly (5), and D represents a 20-bp consensus, previously unpublished, that we identified based on the critical sequence in segment 10 of ars3002 (7). In each case in Fig. 4, the direction of the horizontal tail indicates whether the match to the T-rich form of the consensus is found in the upper strand (tail to the right) or lower strand (tail to the left).

Orientation of consensus matches may be important for ARS activity. Both ars3001 and ars3002 have three separate regions containing clusters of three or more consensus matches. It is interesting that, in both ARS elements, all three clusters have the same orientation (T-rich strand on bottom). The possible importance of this common orientation is suggested by the observation that inversion of domains  and  (and to a lesser extent domain ) inhibits ARS function (Fig. 7). The probability that such common internal orientation would occur by chance in both ARS elements is relatively high, 1 in 16, so additional S. pombe ARS elements with multiple consensus clusters need to be analyzed before the significance of this observation can be fully evaluated.

Role of DNA unwindability in ARS function? Considerable evidence (reviewed in reference 20) suggests that a stretch of easily unwound DNA is frequently an important component of an S. cerevisiae ARS element. In addition, an earlier low-resolution study suggested a correlation between ARS elements and easily unwound DNA in S. pombe (46). To help determine whether stretches of easily unwound DNA correlate with sequences important for ARS function in S. pombe, we used the Thermodyn program (28) to calculate the free energy of unwinding (thin black line) in sliding 100-bp windows across each ARS element in Fig. 4.

Important regions of S. pombe ARS elements. The most important regions of ars1, ars3001, and ars3002 all contain clustered consensus sequences (Fig. 4). At least one of these consensus-rich regions, domain  of ars3001, can functionally replace two other consensus-rich regions (domains  and ) (Fig. 7). These observations suggest that all of these important consensus-rich regions may bind a common protein(s) and perform a common function(s).