Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7294-7303, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Multiple Orientation-Dependent, Synergistically
Interacting, Similar Domains in the Ribosomal DNA Replication
Origin of the Fission Yeast, Schizosaccharomyces
pombe
Soo-Mi
Kim and
Joel A.
Huberman*
Department of Genetics, Roswell Park Cancer
Institute, Buffalo, New York 14263
Received 3 June 1998/Returned for modification 3 August
1998/Accepted 19 August 1998
 |
ABSTRACT |
Previous investigations have shown that the fission yeast,
Schizosaccharomyces pombe, has DNA replication origins (500 to 1500 bp) that are larger than those in the budding yeast,
Saccharomyces cerevisiae (100 to 150 bp). Deletion and
linker substitution analyses of two fission yeast origins revealed that
they contain multiple important regions with AT-rich asymmetric
(abundant A residues in one strand and T residues in the complementary
strand) sequence motifs. In this work we present the characterization
of a third fission yeast replication origin, ars3001, which
is relatively small (~570 bp) and responsible for replication of
ribosomal DNA. Like previously studied fission yeast origins,
ars3001 contains multiple important regions. The three most
important of these regions resemble each other in several ways: each
region is essential for origin function and is at least partially
orientation dependent, each region contains similar clusters of
A+T-rich asymmetric sequences, and the regions can partially substitute
for each other. These observations suggest that ars3001
function requires synergistic interactions between domains binding
similar proteins. It is likely that this requirement extends to other
fission yeast origins, explaining why such origins are larger than
those of budding yeast.
 |
INTRODUCTION |
To understand the molecular
mechanisms of initiation and regulation of eukaryotic DNA replication,
it is helpful to study the cis-acting sequences
(replicators) essential for origin function. Identification and
characterization of replicators in the budding yeast,
Saccharomyces cerevisiae, were facilitated by the discovery that DNA sequences serving as replicators in chromosomes also serve as
replicators in plasmids (reviewed in reference 30). These origin sequences are called autonomously replicating sequence (ARS) elements, because they permit plasmids to replicate autonomously in yeast cells.
Plasmids bearing ARS elements and selectable markers can transform
S. cerevisiae cells at a high frequency (15, 38),
permitting a plasmid transformation assay that has been used to
characterize the sequence requirements for origin function. ARS
elements have two essential components: a short A domain of about 20 bp, which contains a
9-of-11 match to the 11-bp ARS consensus
sequence (ACS) (4, 30), and a broad (~100-bp) flanking
region, called the B domain, 3' to the consensus T-rich strand. The B
domain consists of two or three additional important sequence motifs (16, 23, 31, 39). One of the important sequences in the B
domain, called B1, cooperates with the A domain to form a binding site
for the origin recognition complex (ORC), the putative initiator protein (2, 32, 33). Other possible functions for the B domain include serving as a DNA unwinding element (28, 41), enhancing origin activity by serving as a binding site for
transcription factors (23, 42), and interacting with a
single-stranded DNA binding protein (24).
Replication origins in most other eukaryotes are poorly understood,
mainly due to lack of unambiguous techniques for characterizing them.
However, in the fission yeast, Schizosaccharomyces pombe, which is evolutionarily distant from S. cerevisiae
(3), chromosomal DNA sequences with properties similar to
ARS elements of budding yeast have been identified (25, 26, 34,
40, 44), and some of them have been shown to correspond to
chromosomal replication origins (8, 35, 43). Because
S. pombe is in some respects more similar to other
eukaryotic organisms than is S. cerevisiae (reviewed in
reference 45), it is possible that further study of
ARS elements in S. pombe will provide information useful in understanding replication origins in many other eukaryotic organisms.
S. pombe ARS elements are AT rich, like those of S. cerevisiae, but are generally bigger (500 to 1500 bp). Two
S. pombe ARS elements, ars1 (5) and
ars3002 (7), have been studied in some detail.
Deletion and linker substitution analyses indicate that these ARS
elements contain at least one (for ars1) or two (for
ars3002) essential modules and some additional important modules, and each of the essential modules contains critical sequence elements extending for 20 to 30 bp. The critical sequences are all AT
rich and asymmetric, in the sense that A residues are clustered on one
strand while T residues are clustered on the complementary strand.
To test whether these features are common to other S. pombe
ARS elements, we chose to study the ribosomal DNA (rDNA) ARS element, which we have previously mapped to the nontranscribed spacer in the
rDNA repeats (35). Because there are 100 to 150 copies of the rDNA repeat in the S. pombe genome, the rDNA ARS element
is by far the most abundant ARS element in the genome.
We have previously shown that a 2.3-kbp
BamHI-KpnI restriction fragment within the rDNA
repeat (see Fig. 1) exhibits as much ARS activity as a restriction
fragment containing the entire rDNA repeat and that the 2.3-kbp
fragment contains all detectable rDNA initiation sites (see the gray
box in Fig. 1 and reference 35). The ARS element
within this 2.3-kbp fragment was designated ars3001 according to the four-digit S. pombe ARS-naming convention
(8), because it was the first ARS element to be discovered
in chromosome III (9, 40).
In this report, we describe the results of systematic mutagenesis of
ars3001. These results identify three domains that are essential for function. Each of these domains contains important sequences which share similarities with those detected in the two
earlier studies but are not equivalent to the ACS of S. cerevisiae ARS elements. Domain substitution experiments indicate
that the three domains are largely orientation dependent and can
partially substitute for each other.
 |
MATERIALS AND METHODS |
Strains and media.
Escherichia coli DH5
cells (Life
Technologies) were used for cloning plasmids containing mutated
ars3001 DNA. The S. pombe strain
ura4-D18 (ura4-D18 leu1-32 end1
h
) (12) was used as the recipient strain
for transformation assays. Cells were grown in EMM (27)
supplemented with 150 mg (each) of uracil and leucine per liter when
not under selection or 150 mg of leucine per liter when under selection
for uracil prototrophy.
Generation of progressive deletions and determination of
nucleotide sequence of the 2.3-kbp BamHI-KpnI
restriction fragment.
Plasmid pRS306 (or 406):rDNA-2.3k was
constructed by ligating the 2.3-kbp
BamHI-blunt-ended-KpnI fragment (see Fig. 1)
between the BamHI and SmaI sites in the multiple
cloning site of the vector pRS306 or pRS406 (37).
Unidirectional sequential deletions from both ends of the insert were
generated with exonuclease III as described previously (13)
with modifications suggested by Stratagene (protocol for the
pBluescriptII exonuclease III-mung bean DNA sequencing system;
Stratagene). For deletions starting at the BamHI site,
plasmid pRS406:rDNA-2.3k was digested with BamHI, to
generate recessed 3' ends susceptible to exonuclease III attack, and
also with SacI, to generate exonuclease III-resistant
protruding 3' ends. For deletions in the opposite orientation, plasmid
pRS306:rDNA-2.3k was digested with EcoRI to generate
susceptible ends. To generate resistant ends, treatment with
HindIII was followed by treatment with Klenow polymerase
and
-thio-deoxynucleoside triphosphates. Subsequent incubation with
exonuclease III for increasing times resulted in progressive resection
of the insert while leaving the SacI or
-thio-HindIII end intact. Mung bean nuclease was then
used to generate flush ends. The plasmids were recircularized by
blunt-end ligation and then used to transform DH5
cells. Minipreps of individual plasmid clones from each time point were used to select
clones with deletions of increasing sizes in increments of 100 to 250 bp. These clones were then used, in combination with vector-specific
primers, to determine the nucleotide sequence of both strands of the
2.3-kbp BamHI-KpnI fragment.
Plasmid construction.
To obtain the plasmid
pura4script:rDNA-573, the exonuclease III deletion construct, K4 (see
Fig. 2A), was cut with FokI and treated with Klenow
polymerase. The resulting rDNA-containing 1.86-kbp fragment was gel
purified and cut with ClaI to generate a 583-bp fragment
(the desired 573-bp fragment plus 10 extra bp of vector sequence). The
gel-purified 583-bp fragment was ligated between the ClaI
and SmaI sites in the multiple cloning site of the vector
pura4script (8), which contains the S. pombe ura4 gene, thus permitting selection in the ura4-D18 strain.
Generation of ~60-bp internal deletions.
All the ~60-bp
deletion constructs except
3 (see Fig. 3A) were made according to
the protocol for the MORPH Site-Specific Plasmid DNA Mutagenesis Kit (5 Prime-3 Prime, Inc.). The primers have 13- to 18-bp flanking sequences
at both sides of the region to be deleted and replaced by the
EcoRI-BglII linker, GGAATTCCGAAGATCTTC, at the position of the deletion. They were annealed to the
template plasmid, pura4script:rDNA-573, prepared from E. coli (methylated). Subsequent incubation with T4 DNA polymerase
and T4 DNA ligase resulted in a mixture of nonmutagenized template
(both strands methylated) and mutagenized (methylated template strand
and nonmethylated replacement strand) plasmids. The nonmutagenized
template plasmids were then fragmented by DpnI, and the
mutagenized plasmids were transformed into an E. coli mutS
strain, in which the methylation-specific repair system is inactive.
The desired constructs were identified by susceptibility to digestion
with EcoRI or BglII. For
3, the two-step PCR
method described by Dubey et al. (7) was used (see below).
The external primers, rightward-pointing (forward) and
leftward-pointing (reverse), correspond to sequences within the
multiple cloning site outside the 573-bp insert. The internal (forward
and reverse) primers flanking the region to be deleted (region 3) had
the EcoRI-BglII linker and the EcoRI
linker, respectively, at their 5' ends. All primer sequences are
available upon request.
Generation of 10-bp linker substitutions.
The procedure
employed was similar to that of Dubey et al. (7). All
internal (forward and reverse) primers were designed with stretches of
17 to 24 nucleotides (depending on requirements for specific PCR)
corresponding to the flanking sequences of the regions to be
substituted (indicated by horizontal lines in Fig. 5). In addition, the
primers had linkers containing AvaI restriction sites
(CCCCCGGGGG) at their 5' ends. External primers were based on sequences in the vector multiple cloning site and were designed so
that the XbaI and XhoI sites within the multiple
cloning site would be included in the final PCR products. The forward
external primer was the same as that described above (previous
paragraph), and the reverse external primer was designed to delete the
AvaI site located within the multiple cloning site. To
generate linker substitutions, internal primers flanking regions to be
substituted were amplified in combination with appropriate external
primers. The resulting PCR products were digested with AvaI
and then ligated together. Then, the ligation products were further
amplified with the paired external primers, digested with
XbaI and XhoI, and cloned between the
XbaI and XhoI sites of pura4script. The
consequence of these manipulations was replacement of 10 bp of S. pombe sequence by the 10-bp AvaI linker. All primer
sequences are available on request.
Generation of domain substitutions and inversions.
To
facilitate constructing substitutions or inversions, each of the three
domains was first deleted and replaced by the
EcoRI-BglII linker (see Fig. 6), according to the
same two-step PCR and cloning strategy used for the constructions of
3 and the 10-bp linker substitutions. Then, the desired domain (as a
PCR product flanked by an EcoRI site at one side and a
BglII site on the other side, depending on the intended
orientation) was simply ligated between the EcoRI and
BglII sites in the appropriate deletion mutant. Thus, each
mutant contains the desired substitution or inversion flanked by two
linkers. All primer sequences are available on request.
Transformation of S. pombe cells.
S. pombe
D18 (12) cells lacking the ura4 gene were
transformed (10) with equal amounts of DNA from the plasmids
under test and then grown under selection for uracil prototrophy. After 5 to 6 days, plates were scanned, and the number and mean size of
colonies were calculated by using an image-processing program that
permitted objective discrimination between the larger colonies and the
smaller background colonies produced by vector alone.
Analysis of DNA sequences.
To calculate free energies of
unwinding, we employed the Thermodyn program (28) with a
sliding 100-bp window. MacVector software (Oxford Molecular Group) was
employed to search for the following consensus sequences (in which W
stands for A/T, R stands for A/G, and Y stands for T/C): M, WRTTTATTTAW
(1 mismatch allowed) (25); Z, WWTTWTWTTWTT (1 mismatch
allowed) (46); C, TTGTATTTTAATTTGTATTTTTTGTAATTT (10 mismatches allowed) (5); and D,
WTWTWTTTYTTTTTWTTTTA (3 mismatches allowed). Consensus sequence D has
not previously been published. It is based on the 20-bp critical
sequence in
10 of ars3002 (7). Using MacVector
software, we first searched the database consisting of all known
S. pombe ARS element sequences for
12-of-20 matches to the
ars3002 critical sequence. Then, we used the Consensus
program of the Genetics Computer Group software package to develop a
consensus from the matches that we found. The resulting consensus is
shown above as sequence D.
Nucleotide sequence accession number.
The sequence of the
2.3-kbp BamHI-KpnI fragment described in this
work has been deposited in GenBank under accession no. AF040270.
 |
RESULTS |
Improved localization and characterization of ars3001.
Our previous studies (35) indicated that all S. pombe rDNA ARS activity is localized within a 2.3-kbp
BamHI-KpnI fragment (Fig.
1). To better localize ars3001
activity within this fragment, we employed progressive exonuclease III
deletion from both ends of the fragment. The results of assays for ARS
activity in selected deletions from each set are shown in Fig.
2A. The left and right boundaries for
ars3001 defined by the data in Fig. 2A are sharp compared to
those of most other S. pombe ARS elements studied so far
(e.g., ars3002, ars3003, and the right boundary
of ars1, all of which show a gradual decrease of ARS
activity as the size of the deletion increases [5, 7,
46]). However, the left boundary of ars1 is
similarly sharp (5). Even though the boundaries of
ars3001 appear sharp, the tested deletions were all
unidirectional, leaving open the possibility that a defect generated by
a deletion in the left side of the ARS element could be compensated by
a region preserved on the right side of the ARS element and vice versa.
To test this possibility and to obtain a small fragment with full ARS
activity for further analyses, we subcloned several fragments (Fig. 2B)
encompassing the boundaries defined in Fig. 2A, and we tested these
small fragments for ARS activity. As shown in Fig. 2B, all the tested
clones showed ARS activity comparable to that of the full 2.3-kbp
fragment. Since the smallest fragment (573 bp) includes the essential
region defined in Fig. 2A (gray box), we used this fragment for further
studies.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Summary of previous studies localizing ARS activity in
the rDNA repeat. (Top) The rDNA repeat (10.9 kbp) consists of the
3.46-kbp nontranscribed spacer (NTS) and the transcribed region
containing the external transcribed spacer (ETS); the 17S, 5.8S, and
25S rRNA genes; and the internal transcribed spacers (ITS1 and
ITS2, not labeled on the figure) which flank the 5.8S gene.
Restriction enzyme sites are mapped based on the data from references
1, 19, 21 (GenBank accession no. Y09256) and
36 and this work (GenBank accession no. AF040270).
The gray box shows the replication initiation zone where bubble arcs
were detected by two-dimensional gel analysis (35).
Abbreviations: A, AluI; B, BamHI; Bg,
BglII; E, EcoRI; H, HindIII; K,
KpnI; S, SalI. (Bottom) Restriction fragments in
the rDNA repeat previously shown to have ARS activity. The presence of
ARS activity is indicated by a plus symbol. The 2.3-kbp
BamHI-KpnI fragment (thick line) is the smallest
tested fragment with full ARS activity.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Localization of ARS activity within the 2.3-kbp
fragment. (A) The map shows sets of nested deletions either from the
BamHI site (B1 to B10) or from the KpnI site (K2
to K10). Thin lines represent the portion deleted from the 2.3-kbp
fragment (black bar at the top of the map). Transformation frequencies
(Rel. Trans. Freq.) of the deletion constructs (means ± standard
deviations) are represented relative to that of the 2.3-kbp wild-type
fragment. The gray box represents the minimal region showing
significant ARS activity, as defined by external deletions. (B) The
lines show the tested smaller fragments encompassing the minimal region
defined in panel A. The thick line represents the smallest fragment
(573 bp) showing a transformation frequency comparable to that of the
complete 2.3-kbp fragment.
|
|
Compared to previously studied strong (ars2-2 and
ars2-1 [43]) and weak (ars3002
and ars3003 [17]) S. pombe ARS
elements, the 573-bp fragment showed moderately strong ARS activity
(18), which is consistent with our observation that the
chromosomal rDNA origin is moderately efficient (35). In
addition, a plasmid containing the 573-bp fragment segregated stably as
an unrearranged monomer for at least 20 cell generations
(18).
Effects of ~60-bp internal deletions.
The set of exonuclease
III deletion clones that we had constructed permitted us to obtain the
nucleotide sequence of the 2.3-kbp restriction fragment. Availability
of the nucleotide sequence allowed us to conduct a higher-resolution
mutational analysis of the ARS-containing 573-bp fragment.
As the first step toward characterization of the sequence elements
important for ARS activity within the 573-bp fragment, we introduced
relatively large deletions (52 to 66 bp) (Fig.
3A) throughout the fragment and then
tested the deletion constructs for transformation frequency. As shown
in Fig. 3B, deletion of region 3 or 9 essentially eliminated ARS
activity and deletion of region 2 or 6 significantly reduced it.
Deletion of region 4, 5, or 7 moderately affected ARS activity.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of ~60-bp internal deletions on the ARS
activity of the 573-bp version of ars3001. (A) The
nucleotide sequence of the 573-bp version of ars3001 is
shown with the positions of each deletion region ( 1 to 9). The
left endpoint is a FokI cut site (see Materials and Methods)
and the right endpoint is the K4 deletion point (Fig. 2). Over- and
underlines are used to distinguish the boundaries of neighboring
deletion regions. The size of each deletion is within the range 52 to
66 bp. The leftmost 28 nucleotides and the rightmost 19 nucleotides of
the 573-bp fragment were not included in a deletion region. Instead,
these sequences served as templates for primer design. The leftmost
sequences are located beyond the left boundary defined by nested
deletions (Fig. 2) and are thus not expected to be important for
activity of the 573-bp fragment. The importance of the rightmost 19 nucleotides remains uncertain. (B) At the top are shown the
transformation frequency and colony area relative to those of the
573-bp wild-type ars3001. Black bars and stippled bars
represent values calculated for four independent experiments. Error
bars show standard deviations. The vector alone (pura4script
[7]) was transferred into S. pombe cells as
a negative control. wt, wild type. In the middle is shown a map of the
deletion regions, indicated by brackets. 1 to 9 correspond to
deletion regions 1 to 9. At the bottom, pictured at the same
magnification, are portions of petri plates from one of the experiments
summarized in the chart at 6 days after transformation.
|
|
Figure 3B presents measurements of both transformation frequency and
average colony size. When cells are grown on selective medium, as they
are during ARS activity assays, cell growth rate can be limited by
plasmid replication rate. Plasmids bearing efficient ARS elements can
replicate rapidly, and the cells containing them can produce large
colonies. Consistent with these expectations, we found that the mean
areas of colonies calculated by computer image analysis were roughly
proportional to transformation frequency values (Fig. 3B). In a
separate study on the ARS elements of the ura4 origin region
(17), we have shown that relative transformation frequencies
and colony sizes of isolated ARS elements in plasmids correlate with
origin function in the chromosome, as measured by the ratio of
replication intermediates resulting from de novo initiation to those
resulting from passive replication.
Since DNA unwinding can, in some cases, be a rate-limiting step in
origin function (28, 41), we compared the results of our
functional analysis (Fig. 3B) with the free energy of unwinding calculated for each position in the nucleotide sequence by using the
Thermodyn program (28) employing a window size of 100 bp (thin black line in the ars3001 diagram in Fig.
4). Interestingly, the two regions with
the lowest free energy of unwinding correspond to the two regions (3 and 9) which were most affected by the ~60-bp deletion (Fig. 3B; Fig.
4).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of the three characterized S. pombe ARS elements. The three ARS elements (thick horizontal
lines) ars1 (5), ars3002
(7), and ars3001 were compared at the same scale
in terms of effects of internal deletions on transformation frequency
(Rel. Transf. Freq.), free energy of unwinding ( G) (28),
and locations of consensus matches. Regions whose deletions had
significant effects ( 1, 2, etc.) are given. , , and along with the underlines mark the locations of the three 50-bp domains
for ars3001. The positions of consensus matches are marked
by vertical black lines with horizontal tails below the thick lines. M
corresponds to the 11-bp consensus WRTTTATTTAW of Maundrell et al.
(25), Z corresponds to the 12-bp consensus WWTTWTWTTWTT of
Zhu et al. (46), C corresponds to the rightmost 30 bp
(TTGTATTTTAATTTGTATTTTTTGTAATTT) in segment 1 of Clyne and
Kelly (5), and D corresponds to a 20-bp consensus
(WTWTWTTTYTTTTTWTTTTA; see Materials and Methods) based
on the critical sequence in 10 of ars3002 (7)
(in the aforementioned sequences, W stands for A/T, R stands for A/G,
and Y stands for T/C). In each case, the direction of the horizontal
tail indicates the orientation of the T-rich form of the consensus (see
text and Fig. 5 legend for details).
|
|
We also took advantage of the nucleotide sequence to search within the
573-bp fragment for sequence motifs previously detected by our
laboratory (7, 46) and others (5, 25) as
relatively abundant in S. pombe ARS elements. We shall refer
to these as S. pombe ACSs, but it is important to realize
that they are not equivalent to the ACS of S. cerevisiae.
Prior to this investigation, it was known only that they are relatively
abundant in S. pombe ARS elements and that two of them
(5, 7) are found in particular sequences critical for ARS
activity. Whether any of them has general significance for ARS function
was unknown. It is striking, therefore, that all of the consensus
sequence matches in ars3001 (marked Z, D, M, and C in the
ars3001 diagram in Fig. 4) are localized in regions 2, 3, 6, and 9, the regions whose deletions most reduced ARS activity.
Effects of 10-bp linker substitutions.
To obtain a
higher-resolution picture of the nucleotide sequences important for ARS
function in regions 2, 3, 6, and 9, we employed linker
substitution with a 10-bp GC-rich linker
(C5G5). The linker was substituted for each of
the overlined or underlined 10-bp nucleotide sequences (Fig.
5), and the effect of the substitution on
transformation was measured. Note that the results are displayed on a logarithmic scale.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of 10-bp linker substitution mutations within
deletion regions 2 to 3 (A), 6 (B), and 9 (C) on ars3001
activity. The nucleotides indicated by the horizontal lines were
replaced by the 10-bp linker, CCCCCGGGGG, which contains the
AvaI restriction site. Each number (2-3 to 9-6) marked above
the sequence corresponds to the position of a linker substitution;
e.g., 2-3 corresponds to the third linker substitution from the left
end of deletion region 2, etc. Note that average transformation
frequencies of four to six independent experiments relative to those of
the 573-bp wild type are indicated on a logarithmic scale (Log RTF).
Error bars show the standard deviations. At the bottom of each
nucleotide sequence are shown the positions of matches to the Z
(46), M (25), C (5), and D (see
Materials and Methods) S. pombe ARS consensus motifs (see
also Fig. 4). In each case, the distinguishing letter is at the 3' end
of the T-rich strand of the consensus motif. The boundaries of 50-bp
domains , , and are indicated by striped, dotted, and open
boxes, respectively.
|
|
In regions 2 and 3 (Fig. 5A), the linker substitutions at positions 2-6 and 3-3 decreased ARS activity about fourfold, and approximately
twofold effects were created by the two intervening substitutions (3-1 and 3-2). However, none of the 10-bp substitutions in regions 2 and 3 inhibited ARS activity to the same extent as the ~60-bp deletion of
region 2 or 3 (Fig. 3B). Thus, the stimulatory effects of regions 2 and
3 on ARS function may be due to redundant function of several short
sequence stretches within these regions. This result is similar to but
less extreme than that obtained in a study of ars1
(5), where a 50-bp deletion of the region at the extreme
left end of ars1 decreased activity nearly 200-fold, yet
none of the 10-bp linker substitutions in this region significantly affected ARS activity. Five of the six consensus sequence matches in
regions 2 and 3 (lower portion of Fig. 5A) are located in the area most
affected by linker substitution mutations (3-1 to 3-3), suggesting the
importance of these consensus sequences for the stimulatory effect of
region 3.
Surprisingly, linker substitution at position 6-4 reduced
transformation frequency ~15-fold (Fig. 5B), even though
deletion of the entire 54 bp of region 6 caused only an ~5-fold
reduction in transformation frequency (Fig. 3B). The more extreme
effect of the smaller linker substitution suggests that malfunction of region 6 may interfere with ARS activity to a greater extent than complete loss of region 6. In addition to linker substitution at
position 6-4, that at 6-3 also has a significant effect (about threefold). The substitutions of 6-3 and 6-4 colocalize with several consensus sequences, lending further support to the hypothesis that
these sequences have biological importance.
One linker substitution in region 9, that at 9-5, reduces ARS
activity ~30-fold (Fig. 5C) and thus accounts for the effect (~30-fold) of deleting all 66 bp of region 9 (Fig. 3B). Two
other linker substitutions (9-1 and 9-2) also have pronounced effects (about 10-fold) and colocalize with a cluster of consensus sequence motifs, adding to the evidence from regions 3 and 6 that
clustered consensus sequences contribute to ARS function.
Effects of domain deletion, inversion, and substitution.
The
fact that clustered consensus sequences appear to be important for ARS
activity in regions 3, 6, and 9 (Fig. 3B, 4, and 5) raises the question
of what the function(s) of these sequences might be. The consensus
sequence of S. cerevisiae ARS elements (the ACS) is an
important part of the ORC binding site (2, 6). It is known
that inversion of the S. cerevisiae ACS inactivates ARS
activity (14). We wondered, therefore, what might be the effects of inverting the important
clustered-consensus-sequence-containing regions in ars3001.
We also wondered whether the contributions to ARS activity by regions
2, 3, 6, and 9 are unique or redundant, and we thought we might be able
to distinguish between these possibilities by testing the effects of
substituting the important sequences for each other.
To facilitate inversion and substitution experiments, we defined three
domains covering the sequences identified as most important by linker
substitution in regions 2, 3, 6, and 9 (Fig. 5). Since we do not know
the role of the spacing between the domains, we set the domain sizes to
be of equal length (50 bp), sufficient to include all of the 10-bp
stretches identified as most important by linker substitution, even in
region 9. We have arbitrarily called these domains
,
, and
in
order from left to right in ars3001 (Fig. 4 to 7).
The first step in constructing the inversion and substitution mutations
was the creation, by PCR mutagenesis, of precise deletions of each of
the three domains, leaving a 20-bp linker pair (consisting of a 10-bp
EcoRI linker plus a 10-bp BglII linker) in each
of their places. To construct other mutations, we then simply
inserted the desired domain, in the intended
orientation, between the EcoRI and BglII sites in
the appropriate deletion mutant. Thus, each mutant we constructed
contains the desired substitution or inversion flanked by two linkers.
Since we had not previously tested the combined effects of two linkers
harboring different restriction enzyme sites and these linkers were
different from those used in the previous 10-bp linker substitution
analysis (Fig. 5), we measured the effects of the new linkers in two
ways. First, we confirmed that the linkers did not have ARS activities
of their own. The constructs in which domains
,
, and
were
deleted and replaced by the 20-bp linker pair lacked significant ARS
activity (Fig. 7 [d
, d
, and
d
]), as anticipated. Second, we tested the effects of
substituting each domain by itself, thus generating constructs which
differed from the wild-type ars3001 only in having two
linkers flanking domain
,
, or
(Fig.
6). As is evident from Fig. 6, the
two linkers did not decrease transformation frequency, but they did
decrease colony size, especially when they flanked domain
or
.
We used these results as controls for further inversion and
substitution experiments.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Linker substitution at both ends of domains , ,
and reduces colony size but not transformation frequency. The
combined effects on ARS activity of the two different linkers flanking
each domain were measured as controls for further experiments
(Fig. 7). On the left are diagrams of the constructs,
s (in which domain is replaced by itself),
s ( by ), s ( by ), and
the 573-bp wild-type (wt) and vector controls. Average transformation
frequencies and colony sizes from two independent experiments, relative
to those of the wild type, are indicated (with experimental ranges
[error bars]) on the right.
|
|
Each domain was then replaced by other domains in normal or inverted
orientation. All measurements were relative to the controls in Fig. 6
(data redisplayed in Fig. 7 as
s
,
s
, and
s
). The
results (Fig. 7) show that orientation is critical for the operation of
domains
and
(i
,
si
,
si
, i
,
si
,
si
) but less important for domain
(i
,
si
,
si
). In its
normal orientation, domain
can substitute for domain
or
(
s
,
s
), but neither domain
nor
domain
(
s
,
s
) can efficiently
replace domain
. Domain
can replace domain
(
s
), but domain
cannot efficiently replace domain
(
s
). Thus, these observations suggest an order of
domain functional capability for replacing other domains (from most to least capable: domain
, domain
, domain
). The fact that some domains can substitute for others indicates that the functions of all
three domains are, at least in some part, similar, in spite of any
limitations imposed by our rather arbitrary definitions of the domains.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of deletions, substitutions, and inversions of
the three domains on ARS activity. The transformation frequency
(Transf. Frequ.) and colony size of each mutation were compared to
those of the proper control construct ( s for all
domain mutations, s for domain , and
s for domain [Fig. 6]). Average values of two
independent experiments are shown with data ranges (error bars).
Abbreviations: XsY, domain X replaced by domain Y;
dX, deletion of X; iX, inversion of X;
XsiY, domain X replaced by inverted orientation of domain
Y.
|
|
 |
DISCUSSION |
The experiments described in this paper provide the first
high-resolution genetic analysis of ars3001, the ARS element
in S. pombe rDNA. Because the ribosomal genes are repeated
100- to 150-fold in the haploid genome (22) and because
initiation sites for rDNA replication colocalize with
ars3001 (35), it is likely that
ars3001 contains the cis-acting sequences for the
most abundant replication origins in S. pombe chromosomes.
We found that full ars3001 activity is contained within a
573-bp stretch (Fig. 2), making ars3001 the shortest of the
well-characterized S. pombe ARS elements (Fig. 4). Internal
deletion scanning and linker substitution mutagenesis revealed three
regions within ars3001 that are especially important for its
activity (Fig. 3 to 5). Based on linker substitution mutagenesis within
these three regions (Fig. 5), 50-bp domains
,
, and
were
defined to include the most important sequences in each region (Fig. 4
to 7). Each of the domains is essential for ARS activity (Fig. 7).
Domains
and
(and to a lesser extent domain
) are sensitive
to orientation (Fig. 7). Domain
can substitute for domains
and
, and domain
can replace domain
(Fig. 7). Thus, neither
domain
nor domain
performs a unique role.
What is the significance of these observations for our understanding of
replication origin function in S. pombe? In attempting to
answer this question, it is important to consider what has been learned
from earlier studies of ars1 (5) and
ars3002 (7) as well as from the present study of
ars3001. Results from all three investigations are
summarized in Fig. 4. In the next several paragraphs we discuss the
major conclusions that can be drawn from these investigations.
Internal redundancy in S. pombe ARS elements.
In
Fig. 4, the thick black bars show (all on the same scale) the minimal
ARS elements as defined by external deletion studies. Above the black
bars are light gray bar charts showing the results of deleting the
indicated 50- to 60-bp segments of each ARS element. In each series,
the individual deletions are numbered consecutively from left to right
across the ARS element (
1,
2, etc.), but Fig. 4 displays labels
only for those deletions having the most serious effects. Some
deletions have very serious consequences for ARS activity, while others
have negligible impact. How should the different effects of these
deletions be interpreted?
We and others (5, 7, 46) have pointed out that S. pombe ARS elements frequently contain redundant regions important for their activity. For example, although individual deletion of none
of the rightmost three 50-bp segments of ars1 reduces transformation frequency more than 2-fold, deletion of all three together reduces transformation frequency ~50-fold (5).
Thus, the sequences important for ARS function within the rightmost 150 bp of ars1 are redundant; only by deleting enough of them is
their importance revealed. The lesson for interpretation of the 50- to
60-bp deletion results summarized in Fig. 4 is clear. Segments whose
individual deletion seriously impairs ARS activity probably play unique
roles in ARS function; segments whose deletions do not seriously
inhibit ARS activity may also make important contributions; however,
these contributions may be redundant with contributions made by other segments.
The fact that ars3001 is the shortest of the
well-characterized S. pombe ARS elements suggests that it is
less internally redundant. Perhaps that is why we could detect three
important 50-bp domains,
,
, and
(Fig. 4 to 7), each of which
proved essential when replaced by a 20-bp linker pair (Fig. 7). This hypothetical reduced redundancy might also explain why 10-bp linker substitution mutations within domains
,
, and
had measurable effects (Fig. 5) while linker substitutions as short as 10 bp had no
significant effect even within the essential segment 1 of
ars1 (5).
Because deletion scanning of ars1 detected only one
essential segment (
1 [Fig. 4]), Clyne and Kelly (5)
proposed that ars1 is organized similarly to S. cerevisiae ARS elements, with one domain containing the essential
ACS and an essential flanking domain within which internal deletion and
linker substitution mutations have reduced effects. The results
subsequently obtained for ars3001 (this study) and
ars3002 (7) suggest that such a close parallel
between S. pombe and S. cerevisiae ARS element organization does not generally hold true. Both ars3001 and
ars3002 contain multiple segments whose deletion seriously
impairs ARS activity, and ars3002 contains two noncontiguous
segments (8 and 10) whose deletion eliminates activity (summarized in
Fig. 4). Nevertheless, despite this multiplicity of essential or
important segments in some S. pombe ARS elements, the
inference of Clyne and Kelly (5) may be partially valid. It
is possible that, for each ARS element, one essential or important
segment may be more important than others. For example, domain
,
which can replace but cannot be replaced by domains
and
in
ars3001, may be ultimately more important for ARS activity
than domain
or 
even though all three domains are essential in
certain tests (Fig. 3B and 4, 5, and 7).
The segments most important for ARS activity are usually abundant
in matches to AT-rich asymmetric consensus sequence motifs.
Several previous investigators have identified sequence motifs common
to S. pombe ARS elements. These sequence motifs share the
properties of being highly AT rich and asymmetric (mostly A residues in
one strand and T residues in the other strand). We have searched for
these consensus motifs in the sequences of the three ARS elements shown
in Fig. 4. The positions of the matches we have found to these motifs
are shown in Fig. 4 by markers consisting of vertical black lines with
horizontal tails. Each marker is labeled to identify the sequence motif
matched at that position. The exact locations of matching sequences in
ars3001 are shown in Fig. 5. In Fig. 4 and 5, M signifies
the 11-bp consensus of Maundrell et al. (25), Z stands for
the 12-bp consensus of Zhu et al. (46), C indicates the
rightmost 30-bp in segment 1 of Clyne and Kelly (5), and D
represents a 20-bp consensus, previously unpublished, that we
identified based on the critical sequence in segment 10 of
ars3002 (7). In each case in Fig. 4, the
direction of the horizontal tail indicates whether the match to the
T-rich form of the consensus is found in the upper strand (tail to the right) or lower strand (tail to the left).
It is striking that all clusters consisting of three or more consensus
matches are located in DNA segments whose deletion leads to serious
loss of ARS activity (Fig. 4). In fact, for the three ARS elements in
Fig. 4, each of the 50- to 60-bp segments most important for ARS
activity is associated with a cluster of consensus matches, and
higher-resolution linker substitution experiments within the important
segments reveal that 10- or 20-bp linker substitutions targeting the
consensus matches frequently inhibit ARS activity to a greater extent
than do linker substitutions in other portions of the important
segments (5, 7) (Fig. 5). Thus, although these and earlier
observations indicate that there is no S. pombe ARS
consensus sequence with the properties of the ACS in S. cerevisiae (these properties include [i] the existence of a
single essential match in each ARS element and [ii] the fact that
certain point mutations within the consensus destroy ARS activity), the
array of S. pombe ARS consensus motifs tested in Fig. 4
appears to provide a tool with which biologists will be able to predict
the important portions of previously uncharacterized S. pombe ARS elements. It seems that a cluster of three or more close
matches to these motifs indicates a high probability of importance for
ARS function. The increased certainty stems from the addition of
ars3001 to the database of relatively well characterized S. pombe ARS elements and from the combined use of all four
previously proposed S. pombe ARS consensus motifs. In the
future, detailed analyses of additional S. pombe ARS
elements will provide even greater certainty.
Although clusters of these four consensus motifs correlate with
importance for ARS activity within ARS elements, such clusters cannot
be used to predict the locations of ARS elements in S. pombe
genomic DNA. For example, between residues 1830 and 1925 of the
S. pombe rDNA sequence flanking ars3001 (GenBank
accession no. AF040270), the density of matches to the Z consensus
sequence is much higher than that in ars3001, but this
stretch of sequence is not part of an ARS element (35).
Similarly, despite our relatively advanced understanding of S. cerevisiae ARS elements, it is not yet possible to predict their
locations in chromosomal DNA.
ars1 contains only a single cluster of three or more
consensus motifs (Fig. 4). Presumably the functions carried out by the additional segments containing consensus clusters in ars3001
and ars3002 are handled in ars1 by (probably
redundant) segments lacking consensus clusters.
Orientation of consensus matches may be important for ARS
activity.
Both ars3001 and ars3002 have
three separate regions containing clusters of three or more consensus
matches. It is interesting that, in both ARS elements, all three
clusters have the same orientation (T-rich strand on bottom). The
possible importance of this common orientation is suggested by the
observation that inversion of domains
and
(and to a lesser
extent domain
) inhibits ARS function (Fig. 7). The probability that
such common internal orientation would occur by chance in both ARS
elements is relatively high, 1 in 16, so additional S. pombe
ARS elements with multiple consensus clusters need to be analyzed
before the significance of this observation can be fully evaluated.
Role of DNA unwindability in ARS function?
Considerable
evidence (reviewed in reference 20) suggests that a
stretch of easily unwound DNA is frequently an important component of
an S. cerevisiae ARS element. In addition, an earlier low-resolution study suggested a correlation between ARS elements and
easily unwound DNA in S. pombe (46). To help
determine whether stretches of easily unwound DNA correlate with
sequences important for ARS function in S. pombe, we used
the Thermodyn program (28) to calculate the free energy of
unwinding (thin black line) in sliding 100-bp windows across each ARS
element in Fig. 4.
In S. cerevisiae, a free energy of unwinding of <98
kcal/mol is sufficient for normal ARS function (29). For
each of the S. pombe ARS elements surveyed in Fig. 4, the
free energy of unwinding is <98 kcal/mol across most of the ARS
element, probably as a partial consequence of the AT richness of most
of the ARS element. By comparison to this S. cerevisiae
standard, then, DNA unwindability should not be limiting for ARS
function in most portions of these S. pombe ARS elements,
and one would not expect a correlation between local minima in free
energy of unwinding and importance for ARS function. Indeed, no
correlation is observed. It is interesting, though, that in
ars3001, which has the highest average free energy of
unwinding of the three studied ARS elements, local minima do fall
within two of the three regions most important for ARS activity. Thus,
the data in Fig. 4 are partially consistent with an important role for
DNA unwindability in ARS function but do not prove or disprove it.
Important regions of S. pombe ARS elements.
The
most important regions of ars1, ars3001, and
ars3002 all contain clustered consensus sequences (Fig. 4).
At least one of these consensus-rich regions, domain
of
ars3001, can functionally replace two other consensus-rich
regions (domains
and
) (Fig. 7). These observations suggest that
all of these important consensus-rich regions may bind a common
protein(s) and perform a common function(s).
The fact that, within ars3001 and ars3002, all
the consensus-rich important regions have the same orientation
indicates the possibility of interactions between them. That these
interactions are synergistic, not additive, is suggested by the
observation that deletion of any one of the consensus-rich important
regions in ars3001 (domain
,
, or
) destroys ARS
activity (Fig. 7).
Because initiation of DNA replication in S. pombe requires
ORC function (11) as in S. cerevisiae, it is
possible that some of the proteins binding to these important
consensus-rich regions are components of S. pombe ORC. If
so, then some S. pombe ARS elements, if not all, may contain
more than one ORC binding site. Experiments designed to test this
possibility are under way in our laboratory.
 |
ACKNOWLEDGMENTS |
We are grateful to J. Aquiles Sanchez for pioneering the study of
S. pombe rDNA replication in our laboratory; to William Burhans and David Kowalski for comments on the manuscript; and to
Debbie Mahoney, Karuna Sharma, and Martin Weinberger for constructive criticism throughout this study.
This research was supported by Public Health Service grant GM49294 from
the National Institute of General Medical Sciences and by a grant from
the Buffalo Foundation, with additional support from shared resources
of the Roswell Park Cancer Center Support, grant P30 CA16056.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics, Roswell Park Cancer Institute, Elm & Carlton Streets,
Buffalo, NY 14263-0001. Phone: (716) 845-3047. Fax: (716) 845-8126. E-mail: huberman{at}acsu.buffalo.edu.
 |
REFERENCES |
| 1.
|
Balzi, E.,
A. Di Pietro,
A. Goffeau,
H. van Heerikhuizen, and J. Klootwijk.
1985.
The RNA polymerase I initiation site and the external transcribed spacer of the fission yeast Schizosaccharomyces pombe ribosomal RNA genes.
Gene
39:165-172[Medline].
|
| 2.
|
Bell, S. P., and B. Stillman.
1992.
ATP dependent recognition of eukaryotic origins of DNA replication by a multi-protein complex.
Nature
357:128-134[Medline].
|
| 3.
|
Berbee, M. L., and J. W. Taylor.
1993.
Dating the evolutionary radiations of the true fungi.
Can. J. Bot.
71:1114-1127.
|
| 4.
|
Broach, J. R.,
Y.-Y. Li,
J. Feldman,
M. Jayaram,
J. Abraham,
K. A. Nasmyth, and J. B. Hicks.
1983.
Localization and sequence analysis of yeast origins of DNA replication.
Cold Spring Harbor Symp. Qual. Biol.
47:1165-1173.
|
| 5.
|
Clyne, R. K., and T. J. Kelly.
1995.
Genetic analysis of an ARS element from the fission yeast Schizosaccharomyces pombe.
EMBO J.
14:6348-6357[Medline].
|
| 6.
|
Diffley, J. F. X., and J. H. Cocker.
1992.
Protein-DNA interactions at a yeast replication origin.
Nature
357:169-172[Medline].
|
| 7.
|
Dubey, D. D.,
S.-M. Kim,
I. T. Todorov, and J. A. Huberman.
1996.
Large, complex modular structure of a fission yeast DNA replication origin.
Curr. Biol.
6:467-473[Medline].
|
| 8.
|
Dubey, D. D.,
J. Zhu,
D. L. Carlson,
K. Sharma, and J. A. Huberman.
1994.
Three ARS elements contribute to the ura4 replication origin region in the fission yeast, Schizosaccharomyces cerevisiae.
EMBO J.
13:3638-3647[Medline].
|
| 9.
|
Fournier, P.,
C. Gaillardin,
L. de Louvencourt,
H. Heslot,
B. F. Lang, and F. Kaudewitz.
1982.
r-DNA plasmid from Schizosaccharomyces pombe: cloning and use in yeast transformation.
Curr. Genet.
6:31-38.
|
| 10.
|
Gietz, D.,
A. St. John,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 11.
|
Grallert, B., and P. Nurse.
1996.
The ORC1 homolog orp1 in fission yeast plays a key role in regulating onset of S phase.
Genes Dev.
10:2644-2654[Abstract/Free Full Text].
|
| 12.
|
Grimm, C.,
J. Kohli,
J. Murray, and K. Maundrell.
1988.
Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker.
Mol. Gen. Genet.
215:81-86[Medline].
|
| 13.
|
Henikoff, S.
1984.
Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing.
Gene
28:351-359[Medline].
|
| 14.
|
Holmes, S. G., and M. M. Smith.
1989.
Interaction of the H4 autonomously replicating sequence core consensus sequence and its 3'-flanking domain.
Mol. Cell. Biol.
9:5464-5472[Abstract/Free Full Text].
|
| 15.
|
Hsiao, C.-L., and J. Carbon.
1979.
High-frequency transformation of yeast by plasmids containing the cloned yeast ARG4 gene.
Proc. Natl. Acad. Sci. USA
76:3829-3833[Abstract/Free Full Text].
|
| 16.
|
Huang, R.-Y., and D. Kowalski.
1996.
Multiple DNA elements in ARS305 determine replication origin activity in a yeast chromosome.
Nucleic Acids Res.
24:816-823[Abstract/Free Full Text].
|
| 17.
| Kim, S.-M., and J. A. Huberman.
Unpublished data.
|
| 18.
| Kim, S.-M., and J. A. Huberman.
Unpublished data.
|
| 19.
| Lapeyre, B., and J. Feliu. 1993. GenBank accession
no. Z19578.
|
| 20.
|
Lin, S., and D. Kowalski.
1997.
Functional equivalency and diversity of cis-acting elements among yeast replication origins.
Mol. Cell. Biol.
17:5473-5484[Abstract].
|
| 21.
|
Liu, Z.,
A. Zhao,
L. Chen, and L. Pape.
1997.
Activated levels of rRNA synthesis in fission yeast are driven by an intergenic rDNA region positioned over 2500 nucleotides upstream of the initiation site.
Nucleic Acids Res.
25:659-668[Abstract/Free Full Text].
|
| 22.
|
Maleszka, R., and G. D. Clark-Walker.
1993.
Yeasts have a four-fold variation in ribosomal DNA copy number.
Yeast
9:53-58[Medline].
|
| 23.
|
Marahrens, Y., and B. Stillman.
1992.
A yeast chromosomal origin of DNA replication defined by multiple functional elements.
Science
255:817-823[Abstract/Free Full Text].
|
| 24.
|
Matsumoto, K., and Y. Ishimi.
1994.
Single-stranded-DNA-binding protein-dependent DNA unwinding of the yeast ARS1 region.
Mol. Cell. Biol.
14:4624-4632[Abstract/Free Full Text].
|
| 25.
|
Maundrell, K.,
A. Hutchison, and S. Shall.
1988.
Sequence analysis of ARS elements in fission yeast.
EMBO J.
7:2203-2209[Medline].
|
| 26.
|
Maundrell, K.,
A. P. H. Wright,
M. Piper, and S. Shall.
1985.
Evaluation of heterologous ARS activity in S. cerevisiae using cloned DNA from S. pombe.
Nucleic Acids Res.
13:3711-3722[Abstract/Free Full Text].
|
| 27.
|
Moreno, S.,
A. Klar, and P. Nurse.
1991.
Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.
Methods Enzymol.
194:795-823[Medline].
|
| 28.
|
Natale, D. A.,
A. E. Schubert, and D. Kowalski.
1992.
DNA helical stability accounts for mutational defects in a yeast replication origin.
Proc. Natl. Acad. Sci. USA
89:2654-2658[Abstract/Free Full Text].
|
| 29.
|
Natale, D. A.,
R. M. Umek, and D. Kowalski.
1993.
Ease of DNA unwinding is a conserved property of yeast replication origins.
Nucleic Acids Res.
21:555-560[Abstract/Free Full Text].
|
| 30.
|
Newlon, C. S.
1996.
DNA replication in yeast, p. 873-914.
In
M. L. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 31.
|
Rao, H.,
Y. Marahrens, and B. Stillman.
1994.
Functional conservation of multiple elements in yeast chromosomal replicators.
Mol. Cell. Biol.
14:7643-7651[Abstract/Free Full Text].
|
| 32.
|
Rao, H., and B. Stillman.
1995.
The origin recognition complex interacts with a bipartite DNA binding site within yeast replicators.
Proc. Natl. Acad. Sci. USA
92:2224-2228[Abstract/Free Full Text].
|
| 33.
|
Rowley, A.,
J. H. Cocker,
J. Harwood, and J. F. X. Diffley.
1995.
Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC.
EMBO J.
14:2631-2641[Medline].
|
| 34.
|
Sakaguchi, J., and M. Yamamoto.
1982.
Cloned ura1 locus of Schizosaccharomyces pombe propagates autonomously in this yeast assuming a polymeric form.
Proc. Natl. Acad. Sci. USA
79:7819-7823[Abstract/Free Full Text].
|
| 35.
|
Sanchez, J. A.,
S.-M. Kim, and J. A. Huberman.
1998.
Ribosomal DNA replication in the fission yeast, Schizosaccharomyces pombe.
Exp. Cell. Res.
238:220-230[Medline].
|
| 36.
|
Schaak, J.,
J. Mao, and D. Soll.
1982.
The 5.8S RNA gene sequence and the ribosomal repeat of Schizosaccharomyces pombe.
Nucleic Acids Res.
10:2851-2864[Abstract/Free Full Text].
|
| 37.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 38.
|
Struhl, K.,
D. T. Stinchcomb,
S. Scherer, and R. W. Davis.
1979.
High-frequency transformation of yeast: autonomous replication of hybrid DNA molecules.
Proc. Natl. Acad. Sci. USA
76:1035-1039[Abstract/Free Full Text].
|
| 39.
|
Theis, J. F., and C. S. Newlon.
1994.
Domain B of ARS307 contains two functional elements and contributes to chromosomal replication origin function.
Mol. Cell. Biol.
14:7652-7659[Abstract/Free Full Text].
|
| 40.
|
Toda, T.,
Y. Nakaseko,
O. Niwa, and M. Yanagida.
1984.
Mapping of rRNA genes by integration of hybrid plasmids in Schizosaccharomyces pombe.
Curr. Genet.
8:93-97.
|
| 41.
|
Umek, R. M., and D. Kowalski.
1988.
The ease of DNA unwinding as a determinant of initiation at yeast replication origins.
Cell
52:559-567[Medline].
|
| 42.
|
Walker, S. S.,
S. C. Francesconi, and S. Eisenberg.
1990.
A DNA replication enhancer in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
87:4665-4669[Abstract/Free Full Text].
|
| 43.
|
Wohlgemuth, J. G.,
G. H. Bulboaca,
M. Moghadam,
M. S. Caddle, and M. P. Calos.
1994.
Physical mapping of origins of replication in the fission yeast Schizosaccharomyces pombe.
Mol. Biol. Cell
5:839-849[Abstract].
|
| 44.
|
Wright, A. P. H.,
K. Maundrell, and S. Shall.
1986.
Transformation of Schizosaccharomyces pombe by non-homologous, unstable integration of plasmids in the genome.
Curr. Genet.
10:503-508[Medline].
|
| 45.
|
Zhao, Y., and H. B. Lieberman.
1995.
Schizosaccharomyces pombe: a model for molecular studies of eukaryotic genes.
DNA Cell Biol.
14:359-371[Medline].
|
| 46.
|
Zhu, J.,
D. L. Carlson,
D. D. Dubey,
K. Sharma, and J. A. Huberman.
1994.
Comparison of the two major ARS elements of the ura4 replication origin region with other ARS elements in the fission yeast, Schizosaccharomyces pombe.
Chromosoma
103:414-422[Medline].
|
Molecular and Cellular Biology, December 1998, p. 7294-7303, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fersht, N., Hermand, D., Hayles, J., Nurse, P.
(2007). Cdc18/CDC6 activates the Rad3-dependent checkpoint in the fission yeast. Nucleic Acids Res
35: 5323-5337
[Abstract]
[Full Text]
-
Balasov, M., Huijbregts, R. P. H., Chesnokov, I.
(2007). Role of the Orc6 Protein in Origin Recognition Complex-Dependent DNA Binding and Replication in Drosophila melanogaster. Mol. Cell. Biol.
27: 3143-3153
[Abstract]
[Full Text]
-
Dai, J., Chuang, R.-Y., Kelly, T. J.
(2005). DNA replication origins in the Schizosaccharomyces pombe genome. Proc. Natl. Acad. Sci. USA
102: 337-342
[Abstract]
[Full Text]
-
Yompakdee, C., Huberman, J. A.
(2004). Enforcement of Late Replication Origin Firing by Clusters of Short G-rich DNA Sequences. J. Biol. Chem.
279: 42337-42344
[Abstract]
[Full Text]
-
Altman, A. L., Fanning, E.
(2004). Defined Sequence Modules and an Architectural Element Cooperate To Promote Initiation at an Ectopic Mammalian Chromosomal Replication Origin. Mol. Cell. Biol.
24: 4138-4150
[Abstract]
[Full Text]
-
Wang, L., Lin, C.-M., Brooks, S., Cimbora, D., Groudine, M., Aladjem, M. I.
(2004). The Human {beta}-Globin Replication Initiation Region Consists of Two Modular Independent Replicators. Mol. Cell. Biol.
24: 3373-3386
[Abstract]
[Full Text]
-
Hodson, J. A., Bailis, J. M., Forsburg, S. L.
(2003). Efficient labeling of fission yeast Schizosaccharomyces pombe with thymidine and BUdR. Nucleic Acids Res
31: e134-e134
[Abstract]
[Full Text]
-
Vashee, S., Cvetic, C., Lu, W., Simancek, P., Kelly, T. J., Walter, J. C.
(2003). Sequence-independent DNA binding and replication initiation by the human origin recognition complex. Genes Dev.
17: 1894-1908
[Abstract]
[Full Text]
-
Ghosh, S., Satish, S., Tyagi, S., Bhattacharya, A., Bhattacharya, S.
(2003). Differential use of multiple replication origins in the ribosomal DNA episome of the protozoan parasite Entamoeba histolytica. Nucleic Acids Res
31: 2035-2044
[Abstract]
[Full Text]
-
Liu, G., Malott, M., Leffak, M.
(2003). Multiple Functional Elements Comprise a Mammalian Chromosomal Replicator. Mol. Cell. Biol.
23: 1832-1842
[Abstract]
[Full Text]
-
Chuang, R.-Y., Chretien, L., Dai, J., Kelly, T. J.
(2002). Purification and Characterization of the Schizosaccharomyces pombe Origin Recognition Complex. INTERACTION WITH ORIGIN DNA AND Cdc18 PROTEIN. J. Biol. Chem.
277: 16920-16927