Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7304-7316, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Inhibition of Double-Stranded RNA-Dependent Protein Kinase PKR by
Vaccinia Virus E3: Role of Complex Formation and the E3
N-Terminal Domain
Patrick R.
Romano,1,
Fan
Zhang,1
Seng-Lai
Tan,2
Minerva T.
Garcia-Barrio,1
Michael G.
Katze,2
Thomas E.
Dever,1 and
Alan G.
Hinnebusch1,*
Laboratory of Eukaryotic Gene Regulation,
National Institute of Child Health and Human Development, Bethesda,
Maryland 20892,1 and
Department of
Microbiology, School of Medicine, University of Washington,
Seattle, Washington 981952
Received 3 June 1998/Returned for modification 3 August
1998/Accepted 18 August 1998
 |
ABSTRACT |
The human double-stranded RNA (dsRNA)-dependent protein kinase
PKR inhibits protein synthesis by phosphorylating translation initiation factor 2
(eIF2
). Vaccinia virus E3L
encodes a dsRNA binding protein that inhibits PKR in virus-infected
cells, presumably by sequestering dsRNA activators. Expression of
PKR in Saccharomyces cerevisiae inhibits
protein synthesis by phosphorylation of eIF2
, dependent on its two
dsRNA binding motifs (DRBMs). We found that expression of
E3 in yeast overcomes the lethal effect of PKR in a manner requiring
key residues (Lys-167 and Arg-168) needed for dsRNA binding by
E3 in vitro. Unexpectedly, the N-terminal half of E3, and residue
Trp-66 in particular, also is required for anti-PKR function. Because
the E3 N-terminal region does not contribute to dsRNA binding in
vitro, it appears that sequestering dsRNA is not the sole function of
E3 needed for inhibition of PKR. This conclusion was supported by the
fact that E3 activity was antagonized, not augmented, by overexpressing
the catalytically defective PKR-K296R protein containing functional
DRBMs. Coimmunoprecipitation experiments showed that a majority of PKR
in yeast extracts was in a complex with E3, whose formation was
completely dependent on the dsRNA binding activity of E3 and
enhanced by the N-terminal half of E3. In yeast two-hybrid assays and
in vitro protein binding experiments, segments of E3 and PKR
containing their respective DRBMs interacted in a manner requiring E3
residues Lys-167 and Arg-168. We also detected interactions between PKR
and the N-terminal half of E3 in the yeast two-hybrid and
repressor
dimerization assays. In the latter case, the N-terminal half of E3
interacted with the kinase domain of PKR, dependent on E3 residue
Trp-66. We propose that effective inhibition of PKR in yeast requires
formation of an E3-PKR-dsRNA complex, in which the N-terminal half of
E3 physically interacts with the protein kinase domain of PKR.
 |
INTRODUCTION |
Mammalian PKR is a double-stranded
RNA (dsRNA)-dependent protein kinase that is transcriptionally induced
by interferon and becomes activated in virus-infected cells by dsRNAs
produced during the virus life cycle. PKR interferes with virus
propagation by phosphorylating the
subunit of translation
initiation factor 2 (eIF2
), converting eIF2 from a substrate to an
inhibitor of its guanine nucleotide exchange factor, eIF2B. This leads
to inhibition of viral protein synthesis at the translation initiation
step. PKR is activated by dsRNA in vitro, and the N-terminal half of the protein contains two copies of a dsRNA binding motif (DRBM) also present in other dsRNA binding proteins (reviewed in
references 11 and 33). When
expressed in yeast (Saccharomyces cerevisiae) cells, PKR
inhibits general translation initiation and cell growth due to
hyperphosphorylation of eIF2
. Mutations in the DRBMs which impair
dsRNA binding by PKR in vitro also reduce the ability of PKR to
phosphorylate eIF2
in yeast, consistent with the idea that the DRBMs
mediate the stimulatory effect of dsRNA on PKR kinase activity
(10, 40). The importance of dsRNA binding for kinase
activation in vivo is also shown by the fact that viruses encode
negative regulators of PKR that interfere with the binding of dsRNA
activators to the enzyme. VA RNAI, encoded by adenovirus, binds to the DRBMs but fails to activate the enzyme. The vaccinia virus
E3L product is a dsRNA-binding protein capable of
inhibiting PKR by sequestering dsRNA activators (3, 7, 26,
49).
Vaccinia virus E3 contains one copy of the conserved DRBM
in the C-terminal half of the protein that is necessary and sufficient for dsRNA binding in vitro (8) and also to provide the
host range (9), replication efficiency, and interferon
resistance in cultured cells characteristic of wild-type vaccinia virus
(45). The ability of E3 to inhibit PKR in cell extracts can
be partially reversed by adding large amounts of dsRNA (1, 14,
26), leading to the conclusion that E3 inhibits PKR by
sequestering dsRNA activators. Consistent with this view, an
E3L-deleted virus can be functionally complemented by
expression of heterologous dsRNA binding proteins, including
rotavirus NSP3 (32), reovirus S4 (2), the
cellular human immunodeficiency virus transactivation response (TAR)
RNA binding protein (TRBP) (36), and Escherichia coli RNase III (44). Additionally, E3 was found to
suppress the dsRNA-dependent 2',5'-oligoadenylate
synthetase/RNase L portion of the interferon response
pathway (2).
The C-terminal portion of E3 containing the DRBM exists as a dimer in
solution and appears to bind dsRNA cooperatively; thus, protein-protein interactions contribute to the dsRNA binding
affinity of E3. Removal of the N-terminal half of the protein had
no significant effect on the affinity of E3 for dsRNA; however, it
reduced the formation of higher-order oligomers in solution
(22). Although the N-terminal domain was not required for
replication or interferon sensitivity of vaccinia virus during
infections of cultured cells, it remains possible that it confers a
replication advantage in infected whole animals (45).
There is evidence that PKR acts as a dimer and that the N-terminal
region containing the DRBMs mediates dimerization in addition to dsRNA
binding. PKR activation exhibits second-order kinetics with respect
to protein concentration (28), and the enzyme was purified
as a phosphorylated dimer from L cells (31). In addition, two mutant PKR alleles containing deletions in DRBM-1 or
DRBM-2 functionally complemented when coexpressed in the same
yeast cells (40). It was also shown that an N-terminal
segment of PKR containing both DRBMs was coimmunoprecipitated with
full-length PKR from transfected COS cells (50).
Similarly, N-terminal segments were shown to interact with
themselves and with full-length PKR in various in vivo and in vitro
protein interaction assays (12, 37, 38, 48).
The observation that PKR activation is inhibited by very high
concentrations of dsRNAs (24) suggested that dimer formation is promoted by binding of two PKR molecules to the same dsRNA molecule. Accordingly, high concentrations of dsRNAs would favor dissociation of dimers into monomers bound to different dsRNA molecules
(28). In agreement with this view, binding of
full-length PKR to an N-terminal fragment containing the DRBMs in
vitro was dependent on dsRNA (12). Moreover, chemical
cross-linking and gel filtration experiments indicated that TAR RNA
promotes PKR dimerization (4a). Other studies indicated that
PKR dimerization is relatively unaffected by point mutations in the
DRBMs which impair dsRNA binding in vitro (12, 35, 37, 38,
50), suggesting that dimerization can occur through
protein-protein interactions in the absence of dsRNA binding.
Cooperative binding to dsRNA of PKR N-terminal fragments
(41) confirms that the DRBMs are capable of protein-protein
interactions regardless of whether these are sufficient for
dimerization in the absence of dsRNA binding.
Interestingly, mutations that reduced dsRNA binding in vitro
impaired dimerization in vivo by full-length PKR but not by the isolated N-terminal domain of the protein. To account for these last
observations, it was proposed that the dimerization domain in the
N-terminal region of PKR is masked by interactions between the
N-terminal and C-terminal halves of the protein and that dsRNA binding stimulates a conformational change that exposes the
N-terminal dimerization surface, leading to autophosphorylation and PKR
activation (51). The idea that the N-terminal region
functions negatively was originally prompted by observations that its
removal leads to constitutively active PKR function (50,
54). A recent study using the yeast two-hybrid assay
confirmed that the N-terminal and C-terminal halves of PKR can
physically interact (42).
Previously, we obtained genetic evidence that high-level PKR
activity requires self-interactions between the protein kinase domains in a PKR dimer. Expression of PKR-K296R (and
several other kinase domain point mutants) did not detectably interfere
with wild-type PKR in yeast cells, whereas mutant PKR
alleles with deletions in the kinase domain did interfere with
wild-type PKR function in yeast (40). Since PKR mutants with
point mutations or deletions in the kinase domain were comparably
expressed and were presumed to bind dsRNA equally well, the
dominant interference by the deletion alleles was difficult to explain
by sequestering of dsRNA activators. Accordingly, we proposed that
kinase domain deletion mutants formed heterodimers with wild-type PKR
that were less active than those formed with PKR-K296R because the
deletions eliminated important interactions between the kinase domains
in the dimer (40). In vitro studies with recombinant
PKR have provided independent evidence for self-interactions in
the kinase domain and the relative inactivity of heterodimers formed
between wild-type and kinase domain deletion mutants (37).
In addition, a recent study using in vivo protein interaction assays
confirmed the existence of a second dimerization domain in PKR located
between residues 244 and 296 (48).
The fact that overexpression of PKR-K296R protein did not detectably
interfere with PKR function in yeast (40) suggested that
dsRNA activators may be too abundant in yeast cells to allow inhibition
of PKR by sequestering of dsRNA. Accordingly, we reasoned that if
expression of E3 inhibited PKR in yeast, this might indicate that E3
does not rely exclusively on sequestering dsRNA. In this report, we
show that E3 can indeed inhibit PKR in yeast and that this
inhibition requires the nonconserved N-terminal half of E3 in addition
to its DRBM. In addition, we provide several lines of evidence
indicating that E3 inhibits PKR by forming inactive E3-PKR-dsRNA
complexes. Our results lead us to propose that E3 inhibits PKR by a
novel mechanism in which the inhibitory E3 N-terminal domain is
tethered to PKR by interactions between the DRBMs of the two proteins.
 |
MATERIALS AND METHODS |
Plasmids and yeast strains.
Construction of the plasmids
containing PKR-K296R (p1470) and PKR-
K (p1766)
under the control of the GAL-CYC1 promoter was described
previously (40). Plasmid p1545, from which wild-type PKR was
produced in strains coexpressing various E3 proteins, contains a
2.8-kbp ApaI-PstI fragment from p1420
(15) inserted into the high-copy-number TRP1
yeast plasmid pRS424 (46). p2521 containing
PKR-
K was constructed by inserting a 2.8-kbp
ApaI-BamHI fragment from p1766 into the
high-copy-number LEU2 plasmid pRS425 (46).
Plasmid pHY26, containing the vaccinia virus E3L coding sequence on an EcoRI-BamHI fragment in vector
pSG5, has been previously described (53). An
EcoRI fragment containing E3L was isolated from
pHY26, blunted ended, and further digested with BamHI. The resulting fragment was inserted between the SmaI and
BamHI sites of pEMBLyex4 (6), creating
plasmid pC178.
To facilitate subcloning and mutagenesis of the E3L coding
sequence, an SstI-BamHI fragment from plasmid
pC178 was inserted into SstI-, BamHI-digested
pUC19, creating p2286. A PCR fusion technique (52) was used
to insert the nine codons encoding the hemagglutinin (HA) epitope (TAC
CCA TAC GAC GTA CCA GAC TAT GCA) immediately following the
E3L start codon in plasmid p2286, creating plasmid pR124.
p2245 was created by inserting an SstI-BamHI
fragment from pR124 containing the HA-tagged E3L
coding sequence into pEMBLyex4. p2558 was created by inserting an
SstI-BamHI fragment from p2245 into p2444,
a modified pEMBLyex4 vector in which the URA3 marker is
replaced by TRP1 (39). Silent mutations which
generated ClaI restriction sites within the E3L
coding sequence were introduced by PCR fusion. ClaI sites
were created by altering the codons for Asp-7 (GAC to GAT) and Ile-85
(ATA to ATC) of plasmid p2286 to create pR49. pR49 was digested with
ClaI and religated to produce the E3L
7-86
allele in pR50. The HA epitope was inserted immediately after the
E3L start codon in pR50 as described above, and the sequence containing the HA-tagged version of E3L
7-86
(HA-E3L
7-86) was inserted as an
SstI-BamHI fragment into pEMBLyex4, creating plasmid p2446. PCR fusion was used to introduce a BsrGI site
at the codon for Ser-81 (TCG to TAC) and Asp-82 (GAC to AGC) of pR124 to create pR141. Digestion with BsrGI followed by religation
generated pR144. The HA-E3L
60-82 allele was isolated from
pR144 as an SstI-XbaI fragment and ligated with
SstI-, XbaI-digested pEMBLyex4 to create p2604. A BsrGI site was introduced by PCR fusion at the
Val-15 codon (GTG to GTA) and Cys-16 codon (TGT to CAT) in pR124,
and digestion of pR124 with BsrGI followed by religation
generated pR143 containing HA-E3L
15-56. This tagged
allele was inserted into pEMBLyex4 as an
SstI-BamHI fragment, creating p2602. PCR fusion was used to construct E3L-K167A,R168A by changing
the codon for Lys-167 to GCA and the codon for Arg-168 to GCA in p2245, creating pR187. PCR fusion was used to construct
E3L-W66A,F67A,M68A by changing the three relevant codons
to GCG, GCT, and GCG, respectively, in p2245, creating p2601.
Similarly each codon was individually changed to GCG, GCT, or GCG,
respectively, using the same PCR fusion technique, creating p2603
(W66A), p2638 (F67A), and p2639 (M68A).
The plasmid vectors for yeast two-hybrid analysis, pGBT10 and pGAD425,
and the constructs encoding the fusion proteins containing the GAL4
activation domain (AD) and various PKR segments, pAD-PKR-K296R, pAD-PKR
243-451, pAD-PKR
297-551, pAD-PKR
1-366, and
pAD-PKR
1-243, have been described previously (19).
Plasmids encoding fusion proteins between the GAL4 DNA
binding domain (BD) (pGBT10) and wild-type E3 (pR162),
E3-K167A,R168A (pL194-4), E3-W66A (pL181-10), E3
60-82
(pL182-3), E3
7-86 (pL165-2), E3
7-86,K167A,R168A (PL199-1), E3
105-190,W66A (pL168-3), and E3
105-190 (PL166-4), were
constructed by PCR using as primers oligonucleotides that introduce
NdeI and BamHI sites at the beginning and end,
respectively, of the E3L coding sequence. Where necessary, a
stop codon was included in the 3' oligonucleotide. Following
amplification, the PCR products were digested with NdeI
and BamHI and ligated with NdeI-,
BamHI-digested pGBT10.
Plasmids encoding GST-E3 fusions were constructed by using p2645, a
derivative of vector pGEX-5X-3 (Pharmacia) produced by inserting a pair
of annealed oligonucleotides, RO97 (5' GATCGTCCATATGCTCG) and RO98 (5' GATCCGAGCATATGGAC), which contain an
NdeI site at the BamHI site of pGEX-5X-3. In
p2645, the ATG initiation codon is within the NdeI site, and
a BamHI site was reintroduced downstream. Plasmids encoding
GST-E3 WT (wild type) (pR194), GST-E3-W66A (pR195), GST-E3-
7-86
(pR196), GST-E3-
7-86,K167A,R168A (pL201-2),
GST-E3-
105-190 (pR198), and GST-E3-
105-190,W66A (pR199)
were made by inserting into p2645 the appropriate
NdeI-SalI fragment obtained from the plasmids
described above encoding fusions between the GAL4 BD and various E3 segments.
Plasmids used for in vitro transcription and translation of PKR
mutant proteins, pcDNA1/Neo, pcDNA1/Neo-PKR WT,
pcDNA1/Neo-PKR-K296R, pcDNA1/Neo-PKR-
297-551, and
pcDNA1/Neo-PKR-
1-243, were described previously
(19). pcDNA-PKR-
1-367 was made by synthesizing a HindIII-BamHI fragment by PCR using
primers FZP29 (5'
CCGGAAGCTTGCCGCCACCATGTTCTGTGATAAAGG 3')
and P68-3' (5'
TATCAGAAGCAGGATCCCGGGGATCCCTAACATGTGTGTCGTTCA 3'),
with HindIII and BamHI sites shown in
italics and start and stop codons shown in boldface, and inserting it
between the HindIII and BamHI sites of
pcDNA1/Neo. The inserted fragment contains an ATG codon in the optimum
Kozak sequence context (29) in frame with the PKR-
1-367
coding sequence. The sequence of the inserted fragment was verified by
using a Sequenase version 2.0 DNA sequencing kit from United States
Biochemical/Amersham Life Sciences.
Construction of the isogenic S. cerevisiae strains RY1-1 and
RY1-12 (a ura3-52 leu2-3 leu2-112 gcn2
trp1-
63),
containing two copies and a single copy, respectively, of the wild-type
human PKR coding sequence under control of the GAL-CYC1
promoter integrated at the LEU2 locus, was described
previously (40). S. cerevisiae J82 (a
ura3-52 leu2-3 leu2-112 gcn2
sui2
trp1-
63, p1098 [SUI2-S51A, LEU2]) and H1894 (a ura3-52 leu2-3
leu2-112 gcn2
trp1-63
) (15) are derivatives of
strain H1645 (16). Strain Hf7c (a ura3-52
his3-200 lys2-801 ade2-101 trp1-901 leu2-3,112 gal4-542 gal80-538
LYS2::GAL1-HIS3 URA3::[GAL
17-mers]3-CYC1-lacZ) (18) was
used for yeast two-hybrid analysis. Media used to culture yeast strains
and to conduct growth tests for phenotypic analysis of PKR
alleles were described previously (40).
Immunoblot analysis of E3 and PKR protein expression.
Whole-cell extracts were prepared, proteins were resolved by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
blotted to nitrocellulose membranes, and the membranes were treated
with blocking solution exactly as described previously (40)
except for the addition of complete protease inhibitor (CPI) cocktail
(Boehringer Mannheim) to the lysis buffer and the use of 8 to 16%
gradient gels. Immunodetection of E3 protein was conducted with
monoclonal or polyclonal antibodies against the HA epitope,
HA-12CA5 (Boehringer Mannheim) or HA.11 (BabCo), respectively, used at
a dilution of 1:500 in blocking solution. Immunodetection of PKR was
conducted with a PKR-specific monoclonal antibody (71/10; Ribogene) at
a dilution of 1:1,000 in blocking solution. Visualization of immune
complexes by using the enhanced chemiluminescence (ECL) detection
system (Amersham) was conducted as specified by the manufacturer.
Poly(I-C) binding assays.
Whole-cell extracts were
prepared by breaking cells with glass beads in KR lysis buffer (20 mM
Tris-HCl [pH 8.0], 50 mM KCl, 400 mM NaCl, 20% glycerol, 0.1%
Triton X-100, 0.5 mM EDTA) containing CPI cocktail; 100 µg of
whole-cell extract was incubated with poly(I-C)-agarose in 200 µl of
buffer A (150 mM KCl, 20 mM HEPES, 10% glycerol, 5 mM magnesium
acetate) plus CPI cocktail for 1 h at 4°C. The agarose beads
were collected and washed three times with KR lysis buffer, and the
pellet was resuspended in 30 µl of 2× Laemmli sample buffer
(30). Proteins in the supernatant were precipitated with
trichloroacetic acid, washed once with 80% ethanol, dried, resuspended
in 30 µl of 2× Laemmli sample buffer, and boiled for 5 min. The
proteins were resolved by SDS-PAGE on 8 to 16% polyacrylamide gradient
gels. Immunodetection of E3 proteins was conducted as described above.
Coimmunoprecipitation of PKR and E3.
Whole-cell extracts
were prepared by breaking the cells with glass beads in
immunoprecipitation lysis buffer (20 mM Tris-HCl [pH 8.0], 150 mM
KCl, 1 mM magnesium acetate, 1 mM dithiothreitol) containing CPI
cocktail (Boehringer Mannheim). To immunoprecipitate PKR and E3,
protein samples (500 µg) were diluted to a final volume of 0.05 ml in
nondenaturing binding buffer (20 mM Tris-HCl [pH 8.0], 150 mM
KCl, 1 mM magnesium acetate, 0.1% Triton X-100) containing CPI
cocktail (Boehringer Mannheim). Three microliters of monoclonal antibodies against the HA epitope (HA-12CA5; Boehringer Mannheim) was
added, and samples were incubated at 4°C for 2 h with rocking. Immune complexes were collected using GammaBind Plus protein
G-Sepharose beads and washed three times with 0.10 ml of nondenaturing
binding buffer. The beads were resuspended in 30 µl of 2×
Laemmli sample buffer (30), boiled for 3 min, resolved by
SDS-PAGE on 8 to 16% gradient gels, and subjected to immunoblot
analysis for detection of PKR and E3 proteins as described above. The
efficiencies of immunoprecipitating E3 proteins and PKR were estimated
by video image densitometry of the resulting films, using the NIH Image software (version 1.61).
In vivo protein interaction assays.
For yeast two-hybrid
analysis, GAL4 fusion constructs were introduced into yeast strain Y190
(obtained from S. Elledge, Baylor College of Medicine) by standard
techniques (25). Transformants were selected on synthetic
complete dextrose (SC) medium (43) lacking tryptophan and
leucine. The strength of the protein-protein interactions was measured
by stimulation of the HIS3 reporter present in this strain
as assayed by growth on SC medium lacking histidine, tryptophan, and
leucine and containing 24 or 30 mM 3-aminotriazole. The procedures
followed in performing
repressor dimerization assays and the
N-PKR-
1-243 and
N-PKR-K296R constructs used in these
experiments were described previously (48). Plasmids encoding glutathione S-transferase (GST)-E3 fusions were
described above. PC168-derived plasmids encoding the
repressor
N-terminal DNA-binding domain (
N) fused with the indicated PKR
proteins and p2645-derived plasmids encoding GST alone or GST fused
with the indicated E3 proteins were cotransformed into E. coli AG1688 (obtained from J. C. Hu, Texas A&M University).
Cotransformants were selected on B medium containing 50 µg of
ampicillin and 20 µg of chloramphenicol per ml. Cultures grown
overnight (30°C) in LB supplemented with the antibiotics, 10 mM
MgSO4, and 0.2% maltose were used to create bacterial
lawns containing 100 nM isopropylthio-
-D-galactoside
(IPTG). Lawns were then spotted with 5-µl aliquots of serial
dilutions of a
KH54 phage lysate (109 PFU) at 10-fold
intervals. Infected lawns were incubated overnight at 30°C, and the
inhibition of dimerization mediated by
N-PKR fusions was scored by
appearance of dot plaques on the lawns.
GST binding assays.
Transformants of E. coli
BL21(DE3) bearing plasmids encoding GST or different GST-E3 fusion
proteins were grown to an optical density at 600 nm (OD600)
of 0.6 to 0.7, and IPTG was added to 1 mM to induce expression of the
GST proteins for 2 h. Total proteins were extracted by sonicating
cells in 1× phosphate-buffered saline containing CPI cocktail
(Boehringer Mannheim), followed by centrifugation at 12,000 × g for 30 min at 4°C. 35S-labeled proteins
PKR-K296R, PKR-
243-551, PKR-
297-551, PKR-
1-243, and
PKR-
1-367 were produced by in vitro transcription and
translation using plasmids pcDNA1/Neo-PKR K296R, pcDNA1/Neo-PKR WT
linearized with BanI, pcDNA1/Neo-PKR-
297-551,
pcDNA1/Neo-PKR-
1-234, and pcDNA1/Neo-PKR-
1-367, respectively,
[35S]-Pro Mix (mixture of [35S]methionine
and [35S]cysteine; Amersham), and the TNT T7 coupled
reticulocyte lysate system (Promega) as instructed by the manufacturer.
GST binding assays were conducted essentially as described
previously (19), with the following modifications:
binding buffer (1× phosphate-buffered saline) contained CPI
cocktail (Boehringer Mannheim) as the only source of protease
inhibitors; 15 µl of glutathione-Sepharose beads (50% slurry)
instead of 50 µl was added to each reaction mixture; after washing,
the glutathione-Sepharose beads were resuspended in 15 µl of 2× SDS
sample buffer, boiled, and resolved by SDS-PAGE on 10 to 20%
polyacrylamide gradient gels.
Assays of ribosome binding by E3 and PKR in yeast cell
extracts.
Detection of ribosome association in whole-cell
extracts was conducted essentially as described previously
(54). The distribution of proteins in the gradients was
analyzed by separating 25 µl from each 600-µl fraction by
SDS-PAGE on 10 to 20% gradient gels followed by immunoblot analysis of
PKR and HA-E3 proteins conducted as described above.
 |
RESULTS |
Genetic evidence that E3 inhibits PKR in yeast through
complex formation.
S. cerevisiae contains a protein
kinase known as GCN2 that phosphorylates eIF2
on serine-51
(16), the same reaction catalyzed by PKR in mammalian cells.
To test whether E3 can inhibit PKR activity in yeast, we used a
gcn2
strain (RY1-1) expressing wild-type PKR cDNA under
the control of a galactose-inducible (GAL) promoter from a
plasmid integrated in the genome. When RY1-1 is cultured on medium
containing galactose as the carbon source (SGal medium [10%
galactose, 2% raffinose]), PKR is expressed at levels high enough to cause extensive phosphorylation of eIF2
, with attendant inhibition of protein synthesis and cell growth (15) (Fig.
1A, lane 8). When PKR is expressed at low
levels on medium with glucose as the carbon source (SD medium), the
amount of eIF2
phosphorylation is not great enough to reduce growth
rate (lane 4). A multicopy plasmid containing E3L cDNA under
the control of the same GAL promoter was introduced
into strain RY1-1 and assayed for inhibition of PKR function
in cells grown on SGal medium. In parallel, two PKR alleles
encoding catalytically defective proteins with wild-type DRBMs were
compared with E3L for the ability to inhibit wild-type PKR function: (i) PKR-K296R, which is recessive
to wild-type PKR in yeast, and (ii) PKR-
K,
completely lacking the kinase domain, which is dominant negative
to wild-type PKR (40). When expressed at
high levels, the recessive PKR-K296R allele had no
effect on wild-type PKR function (compare lanes 5 and 8),
whereas the dominant-negative PKR-
K allele inhibited
wild-type PKR and restored growth on SGal medium (lane 7),
as reported previously (40). The E3L construct resembled PKR-
K and reversed the growth inhibition
associated with PKR overexpression (lane 6), indicating that E3
interferes with PKR function in yeast cells.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic evidence that E3 inhibits PKR in yeast through
heterocomplex formation. (A) A plasmid containing the
PKR-K296R (p1470), PKR- K (p1766), or
wild-type E3L (p2245) cDNA, all under the control of the
CYC1-GAL promoter, or empty vector p1079 (none) was
introduced into the gcn2 yeast strain RY1-1 containing
two copies of the wild-type PKR allele (also under
CYC1-GAL control) integrated at the LEU2
locus. Patches of transformants were grown on SD medium, replica
plated to SD or SGal medium, and incubated for 3 to 4 days at 30°C.
(B) Plasmids containing E3L (p2558) and PKR K296R
(p1470) or the corresponding empty vectors (p2444 and p1079) were
introduced into strain RY1-1, and transformants were streaked for
single colonies on SGal medium and incubated for 5 to 6 days at 30°C.
(C) The parental strain of RY1-1 lacking the integrated copies of
PKR, H1894, was transformed with plasmids containing
E3L (p2558), plus either PKR-K296R (p1470) or
empty vector (pEMBLyex4), and grown on SGal medium for ~12
h. Whole-cell extracts were prepared, and 20 µg of total cell protein
was fractionated by SDS-PAGE and subjected to immunoblot analysis using
monoclonal antibodies against PKR and against HA to detect HA-tagged
E3. ECL (Amersham) was used to visualize immune complexes.
Transformants of strain H1894 rather than the RY1-1 transformants
described for panel B were analyzed to eliminate differential effects
of wild-type PKR on expression of E3.
|
|
The fact that E3 inhibited wild-type PKR in yeast
whereas PKR-K296R did not, even though both proteins
contain DRBMs, could be explained by proposing that E3 is
expressed at higher levels and thus can sequester dsRNA activators
more effectively than PKR-K296R. Alternatively, E3 could inhibit PKR by
forming defective heteromeric complexes, in the manner proposed
previously to account for the dominant-negative phenotype of
PKR-
K (40). If the former explanation is
correct, then coexpressing PKR-K296R and E3 in the same cells should
enhance down-regulation of wild-type PKR by increasing the abundance of
functional DRBMs without changing the number of active kinase
domains. Alternatively, if E3 must form complexes with PKR to
inhibit kinase activity, then coexpressing PKR-K296R might
interfere with E3 inhibitory function by displacing it from the
inhibited PKR-E3 complexes and forming PKR-PKR-K296R heterodimers of
relatively higher activity plus inactive PKR-K296R-E3 complexes.
To test these predictions, we introduced the PKR-K296R
construct into RY1-1 transformants containing integrated
wild-type PKR and plasmid-borne E3L. As
described above, cells overexpressing wild-type PKR on
galactose medium failed to grow, whereas coexpressing E3 suppressed the
toxicity of PKR and rescued growth on galactose medium (Fig. 1B,
PKR + Vector versus PKR + E3L).
Coexpressing the inactive PKR-K296R protein together with E3
neutralized the effect of E3 and restored the toxicity of
the wild-type PKR (Fig. 1B, PKR + E3L + PKR-K296R). Immunoblot analysis showed that E3 levels were
unaffected by coexpressing PKR-K296R in the same cells (Fig. 1C);
thus, the ability of PKR-K296R to reverse E3 inhibitory function is
unlikely to result from a reduction in E3 expression. Our results can
be explained by proposing that E3 inactivates PKR by forming a complex
with it and that the defective PKR-K296R protein rescues the
wild-type kinase by sequestering E3 in nonfunctional PKR-K296R-E3 complexes.
Identification of residues in the N-terminal domain of E3 required
for inhibition of PKR.
To determine the importance of dsRNA
binding by E3 for its ability to inhibit PKR in yeast, we
introduced alanine substitutions at Lys-167 and Arg-168 in the E3 DRBM.
These residues are conserved in the DRBMs of other dsRNA binding
proteins (47), and it was shown that alanine substitutions
in the corresponding residues of PKR DRBM-1 abolished or weakened dsRNA
binding in vitro (34, 38). Moreover, a single threonine
substitution in E3 at Lys-167 was shown previously to abolish dsRNA
binding in vitro (8). We also constructed several
deletion and point mutations in the N-terminal half of E3 to determine
whether this uncharacterized part of the protein was required for E3
inhibitory function (Fig. 2A). These mutations
were introduced into a plasmid-borne E3L construct identical
to that described above except that coding sequences for the influenza
virus HA epitope were added to the beginning of the coding
region to facilitate immunodetection of E3 proteins. Addition of
the HA epitope had no effect on E3 function, as judged by growth
assays of the type represented in Fig. 1A (data not shown).

View larger version (21K):
[in this window]
[in a new window]

View larger version (52K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Genetic evidence that the N-terminal domain of E3 is
critically required for inhibition of PKR. (A) Summary of growth
phenotypes on SGal medium conferred by different E3L
alleles in strain RY1-1, indicating their ability to inhibit PKR
function in yeast. The mutant E3 proteins are represented
schematically at the bottom, from amino acids 1 to 190. Transformants of RY1-1 bearing the indicated plasmid-borne
E3L alleles were analyzed for growth as described for Fig. 1
and scored relative to transformants containing wild-type
E3L or vector alone. The E3L alleles were
introduced into RY1-1 on the follow
ing plasmids: E3L (wild type [WT]), p2445;
E3-K167A,R168A, p2612; E3- 15-56, p2602;
E3- 7-86, p2446; E3- 60-82, p2604;
E3-W66A, p2603; E3-F67A, p2638;
E3-M68A, p2639; E3-W66A,F67A,M68A, p2601; NONE,
empty vector p1079. (B) Transformants of RY1-1 bearing the indicated
plasmid-borne alleles or vector alone, described above, were streaked
for single colonies on SGal medium and incubated for 7 to 10 days at
30°C. (C) The gcn2 eIF-2 -S51A yeast strain J82
expressing wild-type PKR from plasmid p1545 was transformed with
plasmids containing the indicated E3L alleles described
above, grown in SD medium at 30°C for ~30 h, and shifted to SGal
medium for ~12 h. Whole-cell extracts were prepared and 20 µg
of total protein was fractionated by SDS-PAGE and subjected to
immunoblot analysis using monoclonal antibodies against the HA epitope
to detect the HA-tagged E3. The ECL system was used to detect the
immune complexes. Transformants of strain J82 rather than the RY1-1
transformants described for panel A were analyzed to eliminate the
differential effects of wild-type PKR on the expression of the
various mutant E3 proteins. The blot was stripped and probed with
antibodies against poly(A) binding protein (PAB1) to verify that equal
amounts of whole-cell protein were loaded in all lanes (data not
shown). Lanes 1 and 2 and lanes 3 to 7 derived from different
experiments.
|
|
The K167A,R168A double substitution in the DRBM abolished E3 function,
restoring the lethal effect of high-level PKR expression on SGal
medium (Fig. 2A and B). To verify that this mutant protein was
incapable of binding dsRNA, we compared it to wild-type E3 for
the ability to bind to poly(I-C)-agarose beads. As shown in Fig.
3, under conditions where ca. 50% of
wild-type E3 in the extract bound to the resin (lanes 6 and 7 versus 2 and 3), none of the E3-K167A,R168A mutant protein was
recovered in the bound fraction (lanes 4 and 5 versus 8 and 9).
Interestingly, the
7-86 and
60-82 deletions and the W66A
substitution also abolished the anti-PKR function of E3 (Fig. 2A and
B), whereas Ala substitutions at Phe-67 and Met-68, flanking Trp-66,
had no effect on E3 function (Fig. 2A). It was shown previously that
the N-terminal half of E3 makes no contribution to the binding
affinity for dsRNA, as purified full-length E3 and the C-terminal
half of E3 containing the DRBM had indistinguishable dissociation
constants (22). Thus, the requirement for the N-terminal
half of E3 for inhibition of PKR cannot be explained by a reduction in
dsRNA binding.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
The K167A and R168A mutations impair dsRNA binding
by E3 in vitro. Transformants of strain J82 containing the indicated
HA-tagged E3L alleles or vector alone (p1079) were
grown in SD medium for ~30 h and then shifted to inducing conditions
(SGal medium) for ~12 h, and whole-cell extracts were prepared.
Aliquots containing 100 µg of total protein were incubated with
poly(I-C)-agarose for 1 h at 4°C. Proteins which bound to
poly(I-C)-agarose were collected by centrifugation and eluted by
boiling in 2× Laemmli sample buffer. Unbound proteins in the
supernatant were trichloroacetic acid precipitated, washed with
ethanol, and resuspended by boiling in 2× Laemmli sample buffer.
Proteins were resolved by SDS-PAGE using 8 to 16% gradient gels and
subjected to immunoblot analysis using monoclonal antibodies
against the HA epitope (HA-12CA5) and ECL to detect
immune complexes. Lanes 1 to 5 contain the fraction of E3 proteins
which bound to poly(I-C)-agarose; lanes 6 to 9 contain the fraction of
E3 proteins which did not bind to poly(I-C)-agarose.
|
|
We conducted immunoblot analysis of mutant and wild-type E3
proteins in whole-cell extracts to determine whether the
impaired functions of the K167A R168A,
15-56,
7-86, and W66A E3L
alleles resulted from instability of the mutant proteins. For this
experiment, the E3L constructs were expressed in a
strain containing a nonphosphorylatable form of eIF2
(eIF2
-S51A) to eliminate the inhibitory effect of PKR
function on protein synthesis in strains containing defective E3
proteins. The results shown in Fig. 2C indicated that all of the mutant
proteins were present in amounts similar or even greater than that of
wild-type E3. Thus, the mutations seem to impair E3 function, not
its expression or stability.
PKR down-regulates its own expression in yeast by a mechanism that
depends on phosphorylation of eIF2
, such that PKR abundance is
inversely proportional to its eIF2
kinase activity (15, 27,
40). Accordingly, the levels of PKR in strains coexpressing E3 proteins should be inversely proportional to the anti-PKR function of the E3 proteins. This expectation was borne out by immunoblot analysis of PKR levels in strains expressing wild-type
eIF2
, where we found that PKR accumulated to higher levels in
transformants expressing wild-type E3 than in those containing the
inactive E3 protein E3-
7-86, E3-W66A, or E3-K167A,R168A (data not shown).
To demonstrate more directly that E3 inhibits PKR function in yeast, we
measured the relative amounts of eIF2
phosphorylated and
unphosphorylated on serine-51 in extracts from yeast strains expressing PKR and various E3 proteins. As shown in Fig.
4, the presence of wild-type E3
decreased the proportion of phosphorylated eIF2
from ca. 70% to ca.
35%. In contrast, the E3-
7-86, E3-W66A, and E3-K167A,R168A
proteins produced little or no reduction in the extent of eIF2
phosphorylation. Taken together, the results in Fig. 2 to 4 indicate
that both the dsRNA binding activity of E3 and residues in its
N-terminal domain between amino acids 60 and 82 are critically required
for the inhibition of PKR function in yeast cells.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of E3 reduces eIF2 phosphorylation by PKR
in yeast cells. Transformants of strain RY1-12 (containing the
single-copy chromosomal PKR construct) bearing the indicated
E3L alleles or vector alone (lanes 2 to 6) and the vector
transformant of strain H1894 lacking the PKR construct (lane
1) were grown to saturation in SD medium containing the necessary
supplements for 2 days, diluted 1:50 into 50 ml of fresh SD medium, and
grown to an OD600 of 0.5 to 1. Cells were harvested,
resuspended in 50 ml of SGal medium, and grown overnight. Whole-cell
extracts were prepared, and 20 µg of total protein was resolved by
isoelectric focusing PAGE and then subjected to immunoblot analysis
using polyclonal eIF2 antibodies as described previously
(16). The positions of basally phosphorylated (eIF2 ) and
eIF2 phosphorylated on Ser-51 (eIF2 ~P) are indicated at the
right. The intensities of both signals were quantitated with a scanner
(Silverscanner III) and NIH Image software (version 1.61), and the
resulting data are shown graphically below the blot expressed as the
percentage of total eIF2 phosphorylated on Ser-51.
|
|
E3 and PKR interact in vivo in a manner dependent on both the DRBM
and the N-terminal domain of E3.
To investigate whether E3 and PKR
physically interact in yeast cells, we asked whether PKR could be
coimmunoprecipitated with E3 from extracts prepared from strains
coexpressing PKR and the HA-tagged mutant or wild-type E3 proteins.
These experiments were carried out with the eIF2
-S51A strain to
eliminate autoregulation of PKR expression. As shown in Fig.
5, PKR was immunoprecipitated with
anti-HA antibodies from the extract containing wild-type HA-tagged
E3 but not from one lacking E3 (lanes 1, 2, 6, and 7), indicating that
PKR is physically associated with wild-type E3 in cell extracts. In
these experiments, 15 to 20% of the total PKR in the cell extracts was
coimmunoprecipitated with 20 to 40% of the wild-type E3. After
correction for the efficiency of immunoprecipitating E3, these data
suggest that 50 to 70% of the PKR in the cell is physically associated
with E3.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 5.
Coimmunoprecipitation of wild-type PKR with mutant
and wild-type E3 proteins from yeast cell extracts. The
gcn2 eIF-2 -S51A strain J82 bearing wild-type
PKR on plasmid p1545 was transformed with plasmids encoding
the indicated HA-tagged E3L alleles (see the legend to Fig.
2A) or with the vector p1079 alone. Transformants were grown under
inducing conditions in SGal medium for ~12 h, and whole-cell extracts
were prepared. Aliquots containing 500 µg of total protein were
immunoprecipitated (IP) with monoclonal antibodies against the HA
epitope. Immune complexes were fractionated by SDS-PAGE on 8 to 16%
polyacrylamide gradient gels and subjected to immunoblot analysis using
a monoclonal antibody against PKR (71/10) and a polyclonal antibody
against the HA epitope (HA.11). Lanes 6 to 10 contain
immunoprecipitated proteins; lanes 1 to 5 contain 50 µg of the
starting extracts used for the immunoprecipitations. WT-E3L,
wild-type E3L allele.
|
|
The K167A,R168A mutation abolished complex formation between E3
and PKR (Fig. 5, lane 10), suggesting that the dsRNA binding activity of E3 is required for a stable interaction with PKR in vivo.
This conclusion implies that PKR-E3 complexes also contain dsRNA. The
7-86 and
15-56 mutations reproducibly decreased the yield of PKR
in immune complexes compared to that seen with wild-type E3 (lanes
7 and 8 and data not shown). After correcting for the efficiencies of
immunoprecipitating wild-type E3 and E3
7-86, we found that
7-86 reduced complex formation with PKR to 60% of the level
seen for wild-type E3. By contrast, E3-W66A complexed with PKR as
efficiently as did wild-type E3 (lanes 7 and 9). (The amount of
E3-W66A protein was atypically reduced relative to that of
wild-type E3 in this particular extract; nevertheless, a similar amount of PKR was coimmunoprecipitated with wild-type E3 and
E3-W66A.) This last result indicates that Trp-66 in the N-terminal half of E3 does not function in the inhibition of PKR by mediating complex
formation between the two proteins.
Evidence for multiple interactions involving different segments of
E3 and PKR.
We used the yeast two-hybrid assay to investigate
physical interactions between different segments of E3 and PKR. Protein fusions between the GAL4 AD and various PKR segments were tested for interactions with GAL4 BD fusions bearing various E3 segments (Fig.
6). The full-length AD-PKR fusion
contains the K296R mutation because the corresponding fusion containing
wild-type PKR is toxic in yeast (19). It was shown
previously that these AD-PKR fusion proteins were expressed at
comparable levels in yeast cells (19). Immunoblot
analysis of whole-cell extracts using anti-HA antibodies showed that
the different BD-E3 fusion proteins also were expressed at similar
levels (data not shown).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Summary of interactions between PKR and E3 segments in
the yeast two-hybrid assay. Strain Y190 was cotransformed with
TRP1 plasmids encoding the GAL4 BD alone (vector) or fused
with wild-type E3 protein (WT) or the indicated E3 mutant proteins
(BD-E3 fusions) and with a LEU2 plasmid encoding the GAL4 AD
alone (vector) or fused with the indicated PKR proteins (AD-PKR
fusions). Transformants were streaked for single colonies on SC medium
containing 30 mM 3-AT and lacking histidine, leucine, and tryptophan.
The colony size was scored for each transformant and ranked as ,
/+, +/ , +, 2+, 3+, or 4+. DRBD, dsRNA binding domain; PK, protein
kinase domain.
|
|
The two PKR fusions bearing the DRBMs but lacking the protein kinase
domain,
243-551 and
297-551, interacted strongly with all of the
E3 fusions containing the wild-type DRBM but not with those
containing the K167A,R168A mutation or with the E3-
105-190 fusion
which lacks the DRBM entirely (Fig. 6, columns 3 and 4). The
full-length PKR fusion showed a moderate interaction with wild-type
E3 but little or no interaction with the E3-K167A,R168A fusion (column
2, rows 2 and 4). These data suggest that E3 interacts with PKR through
its DRBM and that the dsRNA binding activity of this domain is
required for E3-PKR complex formation.
Interestingly, the E3 N-terminal deletions
60-82 and
7-86 showed
no interaction with full-length PKR (Fig. 6, column 2, rows 5 and 6).
These data suggest that the E3 N-terminal domain contributes to
the stability of complexes containing full-length PKR and E3 proteins,
in accordance with results of the coimmunoprecipitation experiments
described above. In contrast, the
60-82 and
7-86 E3 fusions
interacted strongly with the truncated PKR fusions containing DRBMs but
lacking the kinase domain (columns 3 and 4, rows 5 and 6). Thus, it
appears that the E3 N-terminal half is required for interaction with
full-length PKR but dispensable for interaction with PKR segments
containing DRBMs but lacking the kinase domain. This seemingly
paradoxical result could be explained by proposing that the PKR DRBMs
are masked by interactions with the kinase domain, as suggested
recently (42, 51). If the N-terminal half of E3 interacts
with the kinase domain, this could free the DRBM-half of PKR for
interaction with the DRBM-half of E3.
The N-terminal half of E3 (
105-190) interacted with
full-length PKR (Fig. 6, column 2, row 8); however, this E3
segment interacted weakly or not at all with two kinase domain
segments (columns 5 and 6, row 8). We could not test the effect of the
W66A mutation on interaction between the N-terminal half of E3 and
full-length PKR because the BD-E3-
105-190,W66A fusion activated
transcription in the absence of any AD fusion (data not shown).
Full-length E3 failed to interact with the kinase domain segments;
however, while this work was in progress, Sharp et al. found that
full-length E3 fused to the GAL4 AD interacted with the PKR kinase
domain segment
1-366 fused to the GAL4 BD (42). Thus,
the two-hybrid assay provides some evidence that the N-terminal half of
E3 can interact with PKR.
We sought to confirm the two-hybrid interactions between different
segments of PKR and E3 by in vitro binding assays using recombinant
proteins. Selected E3 segments were expressed in E. coli as
GST fusion proteins, and bacterial cell extracts containing the
fusions were incubated with radiolabeled PKR polypeptides synthesized by in vitro translation. The GST-E3 proteins were precipitated with glutathione-Sepharose beads, and the
bound PKR proteins were analyzed by SDS-PAGE and
autoradiography (GST pull-down assays). Full-length PKR and
PKR peptides containing the DRBMs bound to GST fusions containing
either full-length E3 or the C-terminal half of the protein bearing the
DRBM (Fig. 7, III and IV, lanes 1 to 3).
Binding of the PKR polypeptides to GST-E3-
7-86 was greatly reduced
by the K167A and R168A substitutions in the E3 DRBM (IV and V, lanes 1 to 3). The two PKR fragments containing only the protein kinase domain
(PKR-
1-243 and PKR-
1-367) showed little or no binding to
these three GST-E3 fusions (I to V, lanes 4 and 5). Although
binding of the PKR-
243-551 polypeptide occurred without addition of dsRNA to the reactions, we found that its interaction with GST-E3-
7-86 (and even with the E3 derivative containing the K167A and R168A substitutions) was stimulated by addition of poly(I-C) at 500 ng/ml (Fig.
8). Apparently, the K167A and R168A
substitutions greatly diminish but do not completely abolish E3 dsRNA
binding activity. These last results support the idea that complex
formation between segments of PKR and E3 containing their DRBMs is
dependent on dsRNA binding by E3.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
Analysis of in vitro interactions between segments of
PKR and E3 containing their respective DRBMs. Aliquots of bacterial
extracts containing 20 to 100 µg of total protein predetermined to
contain similar amounts of GST or GST-E3 fusion proteins (as indicated
at bottom of panel B, sections II to V) were combined with an extract
prepared from the parental bacterial strain devoid of GST proteins to
achieve 200 µg of total bacterial protein. These mixtures were
incubated with the 35S-labeled PKR proteins indicated at
the top of panel A, section I, and the GST or GST-E3 fusion proteins,
along with any bound 35S-labeled PKR proteins, were
precipitated by using glutathione-agarose beads and resolved by
SDS-PAGE. The 35S-labeled proteins were visualized by
autoradiography (A, sections II to V), and the GST or GST-E3 fusion
proteins were visualized by Coomassie blue staining (B, sections II to
V). Section I in panel A, shows 1/20 (lanes 1 to 4) or 1/10 (lane 5) of
the input amounts of 35S-labeled PKR proteins used in the
binding assays depicted in sections II to V. Arrowheads in panel B
identify GST or the relevant GST-E3 fusion protein.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 8.
dsRNA binding is required for strong
interaction between the DRBM-containing segments of E3 and
PKR in vitro. Binding reactions between 35S-labeled
PKR- 243-551 and either GST (I), GST-E3- 7-86 (II), or
GST-E3- 7-86,K167A,R168A (III) were carried out exactly as
described for Fig. 7 except that poly(I-C) was added to the reactions
at the final concentrations shown above the lanes in panel A. The
35S-labeled PKR- 243-551 proteins precipitated with GST
or the GST-E3 fusions were visualized by autoradiography (A), and
the precipitated GST or GST-E3 fusion proteins were visualized by
Coomassie blue staining (B).
|
|
In contrast with both the two-hybrid and coimmunoprecipitation
results, removing the N-terminal domain of E3 (in GST-E3-
7-86) did not detectably impair its interaction with full-length PKR (Fig. 7, III and IV, lanes 1 to 3). Moreover, we did not observe a
significant interaction between the N-terminal half of E3 and full-length PKR in these in vitro binding experiments (data not shown). To explain this last result, it could be proposed that the E3
N-terminal fragment does not fold properly or lacks an important
posttranslational modification when expressed in bacterial cells, or
that the GST moiety interfered with its PKR binding activity.
Alternatively, the rate of dissociation of this particular PKR-E3
complex may too great to allow its detection by the GST pull-down
technique, which involves washing immobilized complexes with large
volumes of buffer.
To obtain corroborative evidence for interaction between the N-terminal
half of E3 and PKR, we turned to the
repressor dimerization assay
for protein-protein interactions (23). In this system, the
protein segments of interest are expressed in E. coli as
fusions to the N-terminal domain of
cI repressor, which contains
the DNA binding domain but lacks the dimerization domain of cI.
Interaction between the protein segments under study mediates
dimerization of the
N fusion proteins, leading to repression of the
pR promoter that can be assayed in several
ways. With this technique, it was shown that PKR contains a
dimerization domain located between the DRBMs and kinase subdomain II
(residues 244 to 296) in addition to the previously identified
dimerization domain in the N-terminal half of PKR (residues 1 to 167)
(48). Moreover, dimerization of full-length PKR in
this assay was disrupted by coexpression of a GST fusion to
P58IPK protein, a cellular inhibitor of PKR active
during influenza virus infections that binds PKR residues 244 to 296 (19). These findings provided evidence that
P58IPK inhibits PKR function, at least partly, by
interfering with PKR dimerization through residues 244 to 296 (48).
We used the same approach to determine whether the N-terminal half
of E3 can interact with the kinase domain of PKR. PKR residues 244 to
551, containing the complete kinase domain, can mediate dimerization in
the
repressor dimerization assay (48). We found that
coexpressing full-length GST-E3 or the GST fusion containing the
N-terminal half of E3 (GST-E3-
105-190), but not the W66A derivatives of these GST-E3 proteins, blocked dimerization by the
N-PKR fusion containing kinase domain residues 244 to 551 (
N-PKR-
1-243) (Fig. 9, column 1, rows 2, 3, 7, and 8). As expected, inactivating the dsRNA
binding activity of full-length GST-E3 by the K167A and R168A
mutations had no effect on its ability to disrupt
N-PKR-
1-243
dimerization. Moreover, the DRBM half of E3 (GST-E3-
7-86) had no
effect on dimerization of this
N-PKR kinase domain fusion (column 1, rows 4, 5, and 6). These findings suggest that the N-terminal half of
E3 can interact with the C-terminal half of PKR and prevent
dimerization via PKR residues 244 to 296, independent of dsRNA
binding by the E3 protein.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 9.
Summary of inhibition of PKR dimerization by E3 segments
in the repressor dimerization assay. E. coli AG1688 was
cotransformed with pC168-derived plasmids encoding N fused with the
indicated PKR proteins and with p2645-derived plasmids encoding GST
alone or GST fused with the indicated E3 proteins. Cotransformants were
tested for immunity to superinfection by KH54, a mutant lacking the
ability to synthesize its own repressor, by using a dot plaque assay.
GST alone had no or minimal effect on N-PKR fusion
dimerization-induced resistance to superinfection ( ).
Coexpression of a GST-E3 fusion that reduced resistance to superinfection by at least 10-fold (+) or 100-fold (2+) was scored as
disruption of N-PKR fusion dimerization. DRBD, dsRNA binding domain;
PK, protein kinase domain.
|
|
Quite different results were obtained with the full-length
N-PKR-K296R fusion in the dimerization assay. In this case, the GST
fusions containing full-length E3 or the DRBM half, but not the
N-terminal half, of E3 blocked dimerization by
N-PKR-K296R in a
manner dependent on residues K167 and R168 in the E3 DRBM (Fig. 9,
column 2). In addition, the W66A mutation had no effect on the ability
of full-length GST-E3 to interfere with
N-PKR-K296R dimerization.
These findings suggest that the DRBM-bearing portion of E3 is required
to disrupt dimerization mediated by the DRBM-containing segment of PKR
and, as concluded above, that the interaction between DRBM-bearing
segments of E3 and PKR is dependent on dsRNA binding by E3.
The fact that the N-terminal half of E3 is not necessary or sufficient
to disrupt dimerization by full-length PKR in this assay could indicate
that the DRBM-containing region of PKR can mediate dimerization even
when the self-interaction of PKR residues 244 to 296 is blocked by
binding of the N-terminal half of E3 to the kinase domain. This
contrasts with the finding that binding of P58IPK to
residues 244 to 296 is sufficient to disrupt dimerization by
full-length PKR (48). It is possible, however, that the
isolated E3 N-terminal half can bind to PKR residues 244 to 551 without impeding self-interactions in the N-terminal region of PKR, whereas binding of P58IPK to the 244 to 296 region impairs
self-interactions by both PKR dimerization domains. Our results also
suggest that self-interactions by PKR residues 244 to 296 cannot
mediate dimerization by full-length PKR when the DRBM half of E3 is
bound to the N-terminal region of PKR containing the DRBMs, despite the
fact that residues 244 to 296 are sufficient for dimerization
of the isolated C-terminal half of PKR. Perhaps binding of the E3
DRBM to the N-terminal region of PKR sterically blocks
self-interactions between PKR residues 244 to 296. Finally, none of the
GST-E3 proteins could prevent dimerization by a
N-PKR fusion
containing only residues 244 to 296 (data not shown), indicating that
the N-terminal half of E3 requires residues in the kinase domain,
located C terminally to position 296, in order to bind to PKR and block
dimerization by residues 244 to 296. This last finding is in agreement
with recent results discussed below indicating that E3 makes contact with the C-terminal lobe of the PKR kinase domain (42).
E3 blocks ribosome binding by PKR, but this activity is
insufficient to inhibit PKR function.
It was reported that the
DRBMs in PKR mediate a stable interaction with yeast ribosomes and that
the ribosome targeting of PKR could be an important aspect of the
requirement for DRBMs to achieve high-level phosphorylation of
eIF2
in yeast cells (54). Accordingly, we asked whether
coexpression of E3 would interfere with ribosome binding by
PKR. In the absence of E3 expression, a substantial fraction of PKR in
the cell extract cosedimented through sucrose gradients with 40S and
60S ribosomal subunits, 80S ribosomes, and polysomes (Fig.
10A), in agreement with previous findings (54). Coexpression of wild-type E3 shifted
the distribution of PKR from the ribosomal particles to the top of the
gradient. A minor fraction of the total E3 cosedimented with
40S subunits and polysomes (Fig. 10B). Interestingly, coexpression of
E3-K167A,R168A did not alter the ribosome association of PKR, and a
smaller proportion of this mutant E3 protein than of wild-type E3
cosedimented with 40S subunits (Fig. 10C). These findings suggest that
displacement of PKR from ribosomes is dependent on the dsRNA
binding activity of E3. This could be accounted for by proposing
that E3 competes with PKR for dsRNA binding sites in rRNA.
Alternatively, since complex formation between E3 and PKR requires the
dsRNA binding activity of E3, displacement of PKR from the
ribosomes could depend on complex formation with E3.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 10.
Expression of E3 displaces PKR from ribosomes in a
manner that depends on the dsRNA binding activity of E3 but not its
N-terminal domain. Transformants of strain J82 (expressing
eIF2 -S51A) containing PKR plasmid p1545 and either a
plasmid encoding wild-type E3 (p2245), E3-K167A,R168A (p2612), or
E3- 7-86 (p2246) (B to D) or the empty vector p1079 (A) were grown in
SGal medium to an OD600 of 1.5. Whole-cell extracts
prepared in the presence of 50 mg of cycloheximide per ml and 10 mM
MgCl2 were resolved by velocity sedimentation on 5 to 47%
sucrose gradients. The gradients were fractionated, and absorbance at
254 nm was recorded to determine the position of the free 40S and 60S
subunits, 80S monosomes, and polysomes (indicated by arrows). The
OD254 absorbance profile is shown for the gradient analyzed
in panel A; the OD254 profiles for panels B to D were
essentially identical to that shown in panel A. The distribution of
proteins along the gradients was visualized by SDS-PAGE and immunoblot
analysis. The first and last lanes in each panel were loaded with 1/20
of the input (I) extracts applied to the gradients.
|
|
Expression of the E3-
7-86 mutant led to complete displacement of
PKR from the ribosomes and showed even greater association with
ribosomes than did wild-type E3 (Fig. 10D). It has been shown that
the N-terminal domain of E3 promotes oligomerization of E3 in
high-molecular-weight complexes (22). Perhaps in lacking the
ability to oligomerize, E3-
7-86 can interact more stably with
ribosomes. The fact that expression of E3-
-7-86 displaced PKR from
ribosomes, but did not detectably decrease eIF2
phosphorylation by
PKR, suggests that ribosome binding is not essential for
high-level phosphorylation of eIF2
by PKR in yeast and that
displacement of PKR from ribosomes is not the sole function of E3
required for inhibiting PKR. We propose that binding of the
N-terminal half of E3 to the kinase domain of PKR is also crucial for
preventing eIF2
phosphorylation by PKR.
 |
DISCUSSION |
It is generally thought that E3 inhibits PKR solely by
sequestering dsRNA molecules required for activation of PKR function. We questioned whether this was its only mode of action after finding that E3 could inhibit PKR in yeast, because previous observations with
dominant-negative PKR alleles had suggested that dsRNA
activators are very abundant in yeast cells (40). We
considered an alternative possibility in which the complete inhibition
of PKR by E3 would additionally require complex formation by the two
proteins. Consistent with this possibility, E3 inhibitory activity was
reversed by coexpressing the mutant PKR-K296R protein along with
wild-type PKR (Fig. 1B and C). If E3 inhibited PKR in yeast solely
by sequestering dsRNA, then overexpression of PKR-K296R should enhance
rather than antagonize E3 by further reducing the levels of free
dsRNA. Instead, we propose that overexpression of PKR-K296R
displaced E3 from wild-type PKR, forming inactive PKR-K296R-E3
complexes and partially functional PKR/PKR-K296R dimers.
Additional evidence for a second mode of E3 function came from the fact
that mutations in the N-terminal half of E3, including a single alanine
substitution at Trp-66, led to complete loss of its anti-PKR function
in yeast. Chang and Jacobs reported that deletion of the
N-terminal 83 residues of E3 did not affect its ability to bind dsRNA
in vitro (8). Ho and Shuman showed that the apparent
dissociation constants for dsRNA bound by full-length E3 and a
fragment containing only the C-terminal 90 residues were virtually
identical (22), indicating that the N-terminal half of
E3 makes no contribution to the binding affinity of E3 for dsRNA in
vitro. We found that the K167A,R168A double mutation in the E3 DRBM
abolished in vitro binding of GST-E3-
7-86 to PKR, indicating
that dsRNA binding by E3 is required for its interaction with PKR.
In contrast, the
7-86 mutation in the N-terminal half of E3 had no
effect on GST-E3 binding to PKR (Fig. 7), implying that the
7-86
mutation does not reduce dsRNA binding by E3 in vitro. The same
conclusion can be drawn from the fact that coimmunoprecipitation of PKR
with E3 was abolished by the K167A and R168A mutations but unaffected
by the W66A mutation in E3, indicating that the latter mutation did not
impair dsRNA binding by E3 in vivo (Fig. 5). Similarly, the W66A,
60-82, and
7-86 mutations did not impair the in vivo interaction
of E3 with PKR-
243-551 in the two-hybrid assay, whereas
E3-K167A,R168A failed to interact with this PKR segment. Combined with
the previous results of Ho and Shuman, these observations indicate that
the N-terminal half of E3, and Trp-66 in particular, does not
contribute to dsRNA binding in vitro or in vivo and thus is
involved in a distinct aspect of E3 anti-PKR function.
Using four different assays for protein-protein interactions, we
obtained strong evidence for heterocomplex formation by PKR and E3. The
assay of greatest physiological relevance, coimmunoprecipitation from
yeast extracts, suggested that a majority of the PKR molecules in yeast
were physically associated with E3 in a manner dependent on the dsRNA
binding activity of E3. The yeast two-hybrid and GST pull-down
assays revealed complex formation between the C-terminal half of E3 and
the N-terminal half of PKR, the segments containing their DRBMs, and
this interaction also depended on dsRNA binding by the E3 partner.
These observations, plus the fact that binding between
PKR-
243-551 and E3-
7-86,K167A,R168A was rescued by high concentrations of dsRNA, indicated that complex formation is critically dependent on the DRBM-containing segments of both proteins and dsRNA
binding by E3. Because the N-terminal half of E3 was not essential
for coimmunoprecipitation of PKR with E3, we suggest that
protein-protein contacts involving the DRBM-containing segments, plus
mutual binding to the same dsRNA molecules, make the most important
contributions to the stability of these E3-PKR-dsRNA complexes in vivo
(Fig. 11). Similar protein contacts via
DRBMs have been proposed to explain dimerization by PKR N-terminal
segments, and heterocomplex formation by PKR and TRBP, in cases where
the DRBMs contained point mutations that abolish dsRNA binding in vitro (4, 12, 35, 37, 38, 50). In addition, the purified E3
DRBM dimerizes in solution (22), and purified segments
containing the DRBMs of PKR (41) or E3 (22) each
show cooperative binding to dsRNA in vitro, indicating the
existence of protein-protein interactions by DRBMs bound to the same
dsRNA molecules.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 11.
Hypothetical model for inhibition of PKR function by E3
through the formation of inactive heteromeric complexes. PKR is shown
schematically with its two DRBMs (R) connected by a linker to the
dimerization domain located between residues 244 and 296 (shown as a
rectangle) and the N-terminal and C-terminal lobes of the kinase domain
(depicted as two ovals). E3 is depicted with its single DRBM (R)
hatched and the N-terminal domain (N) shaded. The active form of PKR is
depicted as a dimer bound to dsRNA (28, 31, 40), with
dimerization mediated by interactions involving the N-terminal region
containing the DRBMs (12, 37, 48, 50), the kinase domain
(37, 40), and the region from residues 244 to 296 (48) and by binding to the same dsRNA molecule (12,
37, 51). E3 is shown inhibiting PKR by forming inactive
heterocomplexes, disrupting PKR homodimers. In addition, the N-terminal
domain of E3 is shown interacting with the kinase domain of PKR,
interfering with some aspect of kinase function. Binding to dsRNA by E3
greatly contributes to the stability of the PKR-E3 complex. E3 can also
inhibit kinase activation by sequestering dsRNA molecules. See text for
details.
|
|
The fact that coimmunoprecipitation of PKR with E3 was dependent on
Lys-167 and Arg-168 in the E3 DRBM suggests that PKR resides in
heteromeric complexes containing both E3 and dsRNA. This seems at
odds with the dsRNA sequestration model, in which E3 prevents PKR from
interacting with dsRNA, and more consistent with the notion that E3
inhibits PKR via heterocomplex formation. It could be argued that E3
and PKR do not directly interact with one another in these complexes
but simply bind independently to the same dsRNA molecules. To explain
our coimmunoprecipitation results by this hypothesis, the numbers of
dsRNA and E3 molecules would have to be nearly equivalent in yeast
cells. If dsRNA molecules were in large molar excess of E3, then PKR
would most frequently bind to dsRNA molecules lacking E3. If E3 was in
large molar excess of dsRNA, it would compete with PKR for limited
dsRNA binding sites (as suggested by the dsRNA sequestration
model). In either case, most of the PKR would not be physically linked
with E3. It is conceivable that the dsRNAs are long enough to
accommodate multiple protein molecules and that the prevailing E3/PKR
ratio is such that most of the PKR is bound to dsRNAs containing at least one molecule of E3 without postulating protein-protein contacts between E3 and PKR. Even if this were true, however, it would still be
necessary to propose a second function for E3 besides sequestration of
dsRNA to explain why the PKR molecules bound to dsRNA in heteromeric
complexes with E3 are catalytically inactive.
Another argument in favor of protein-protein contacts between E3 and
PKR comes from the fact that expression of E3 displaced PKR from
ribosomes even though it appeared that most of the wild-type E3 was
not stably bound to ribosomes (Fig. 10B). If E3 was competing with PKR
for dsRNA binding sites in rRNA, one would expect to find a large
fraction of E3 associated with ribosomes. A possible obje