Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7304-7316, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Inhibition of Double-Stranded RNA-Dependent Protein Kinase PKR by
Vaccinia Virus E3: Role of Complex Formation and the E3
N-Terminal Domain
Patrick R.
Romano,1,
Fan
Zhang,1
Seng-Lai
Tan,2
Minerva T.
Garcia-Barrio,1
Michael G.
Katze,2
Thomas E.
Dever,1 and
Alan G.
Hinnebusch1,*
Laboratory of Eukaryotic Gene Regulation,
National Institute of Child Health and Human Development, Bethesda,
Maryland 20892,1 and
Department of
Microbiology, School of Medicine, University of Washington,
Seattle, Washington 981952
Received 3 June 1998/Returned for modification 3 August
1998/Accepted 18 August 1998
 |
ABSTRACT |
The human double-stranded RNA (dsRNA)-dependent protein kinase
PKR inhibits protein synthesis by phosphorylating translation initiation factor 2
(eIF2
). Vaccinia virus E3L
encodes a dsRNA binding protein that inhibits PKR in virus-infected
cells, presumably by sequestering dsRNA activators. Expression of
PKR in Saccharomyces cerevisiae inhibits
protein synthesis by phosphorylation of eIF2
, dependent on its two
dsRNA binding motifs (DRBMs). We found that expression of
E3 in yeast overcomes the lethal effect of PKR in a manner requiring
key residues (Lys-167 and Arg-168) needed for dsRNA binding by
E3 in vitro. Unexpectedly, the N-terminal half of E3, and residue
Trp-66 in particular, also is required for anti-PKR function. Because
the E3 N-terminal region does not contribute to dsRNA binding in
vitro, it appears that sequestering dsRNA is not the sole function of
E3 needed for inhibition of PKR. This conclusion was supported by the
fact that E3 activity was antagonized, not augmented, by overexpressing
the catalytically defective PKR-K296R protein containing functional
DRBMs. Coimmunoprecipitation experiments showed that a majority of PKR
in yeast extracts was in a complex with E3, whose formation was
completely dependent on the dsRNA binding activity of E3 and
enhanced by the N-terminal half of E3. In yeast two-hybrid assays and
in vitro protein binding experiments, segments of E3 and PKR
containing their respective DRBMs interacted in a manner requiring E3
residues Lys-167 and Arg-168. We also detected interactions between PKR
and the N-terminal half of E3 in the yeast two-hybrid and
repressor
dimerization assays. In the latter case, the N-terminal half of E3
interacted with the kinase domain of PKR, dependent on E3 residue
Trp-66. We propose that effective inhibition of PKR in yeast requires
formation of an E3-PKR-dsRNA complex, in which the N-terminal half of
E3 physically interacts with the protein kinase domain of PKR.
 |
INTRODUCTION |
Mammalian PKR is a double-stranded
RNA (dsRNA)-dependent protein kinase that is transcriptionally induced
by interferon and becomes activated in virus-infected cells by dsRNAs
produced during the virus life cycle. PKR interferes with virus
propagation by phosphorylating the
subunit of translation
initiation factor 2 (eIF2
), converting eIF2 from a substrate to an
inhibitor of its guanine nucleotide exchange factor, eIF2B. This leads
to inhibition of viral protein synthesis at the translation initiation
step. PKR is activated by dsRNA in vitro, and the N-terminal half of the protein contains two copies of a dsRNA binding motif (DRBM) also present in other dsRNA binding proteins (reviewed in
references 11 and 33). When
expressed in yeast (Saccharomyces cerevisiae) cells, PKR
inhibits general translation initiation and cell growth due to
hyperphosphorylation of eIF2
. Mutations in the DRBMs which impair
dsRNA binding by PKR in vitro also reduce the ability of PKR to
phosphorylate eIF2
in yeast, consistent with the idea that the DRBMs
mediate the stimulatory effect of dsRNA on PKR kinase activity
(10, 40). The importance of dsRNA binding for kinase
activation in vivo is also shown by the fact that viruses encode
negative regulators of PKR that interfere with the binding of dsRNA
activators to the enzyme. VA RNAI, encoded by adenovirus, binds to the DRBMs but fails to activate the enzyme. The vaccinia virus
E3L product is a dsRNA-binding protein capable of
inhibiting PKR by sequestering dsRNA activators (3, 7, 26,
49).
Vaccinia virus E3 contains one copy of the conserved DRBM
in the C-terminal half of the protein that is necessary and sufficient for dsRNA binding in vitro (8) and also to provide the
host range (9), replication efficiency, and interferon
resistance in cultured cells characteristic of wild-type vaccinia virus
(45). The ability of E3 to inhibit PKR in cell extracts can
be partially reversed by adding large amounts of dsRNA (1, 14,
26), leading to the conclusion that E3 inhibits PKR by
sequestering dsRNA activators. Consistent with this view, an
E3L-deleted virus can be functionally complemented by
expression of heterologous dsRNA binding proteins, including
rotavirus NSP3 (32), reovirus S4 (2), the
cellular human immunodeficiency virus transactivation response (TAR)
RNA binding protein (TRBP) (36), and Escherichia coli RNase III (44). Additionally, E3 was found to
suppress the dsRNA-dependent 2',5'-oligoadenylate
synthetase/RNase L portion of the interferon response
pathway (2).
The C-terminal portion of E3 containing the DRBM exists as a dimer in
solution and appears to bind dsRNA cooperatively; thus, protein-protein interactions contribute to the dsRNA binding
affinity of E3. Removal of the N-terminal half of the protein had
no significant effect on the affinity of E3 for dsRNA; however, it
reduced the formation of higher-order oligomers in solution
(22). Although the N-terminal domain was not required for
replication or interferon sensitivity of vaccinia virus during
infections of cultured cells, it remains possible that it confers a
replication advantage in infected whole animals (45).
There is evidence that PKR acts as a dimer and that the N-terminal
region containing the DRBMs mediates dimerization in addition to dsRNA
binding. PKR activation exhibits second-order kinetics with respect
to protein concentration (28), and the enzyme was purified
as a phosphorylated dimer from L cells (31). In addition, two mutant PKR alleles containing deletions in DRBM-1 or
DRBM-2 functionally complemented when coexpressed in the same
yeast cells (40). It was also shown that an N-terminal
segment of PKR containing both DRBMs was coimmunoprecipitated with
full-length PKR from transfected COS cells (50).
Similarly, N-terminal segments were shown to interact with
themselves and with full-length PKR in various in vivo and in vitro
protein interaction assays (12, 37, 38, 48).
The observation that PKR activation is inhibited by very high
concentrations of dsRNAs (24) suggested that dimer formation is promoted by binding of two PKR molecules to the same dsRNA molecule. Accordingly, high concentrations of dsRNAs would favor dissociation of dimers into monomers bound to different dsRNA molecules
(28). In agreement with this view, binding of
full-length PKR to an N-terminal fragment containing the DRBMs in
vitro was dependent on dsRNA (12). Moreover, chemical
cross-linking and gel filtration experiments indicated that TAR RNA
promotes PKR dimerization (4a). Other studies indicated that
PKR dimerization is relatively unaffected by point mutations in the
DRBMs which impair dsRNA binding in vitro (12, 35, 37, 38,
50), suggesting that dimerization can occur through
protein-protein interactions in the absence of dsRNA binding.
Cooperative binding to dsRNA of PKR N-terminal fragments
(41) confirms that the DRBMs are capable of protein-protein
interactions regardless of whether these are sufficient for
dimerization in the absence of dsRNA binding.
Interestingly, mutations that reduced dsRNA binding in vitro
impaired dimerization in vivo by full-length PKR but not by the isolated N-terminal domain of the protein. To account for these last
observations, it was proposed that the dimerization domain in the
N-terminal region of PKR is masked by interactions between the
N-terminal and C-terminal halves of the protein and that dsRNA binding stimulates a conformational change that exposes the
N-terminal dimerization surface, leading to autophosphorylation and PKR
activation (51). The idea that the N-terminal region
functions negatively was originally prompted by observations that its
removal leads to constitutively active PKR function (50,
54). A recent study using the yeast two-hybrid assay
confirmed that the N-terminal and C-terminal halves of PKR can
physically interact (42).
Previously, we obtained genetic evidence that high-level PKR
activity requires self-interactions between the protein kinase domains in a PKR dimer. Expression of PKR-K296R (and
several other kinase domain point mutants) did not detectably interfere
with wild-type PKR in yeast cells, whereas mutant PKR
alleles with deletions in the kinase domain did interfere with
wild-type PKR function in yeast (40). Since PKR mutants with
point mutations or deletions in the kinase domain were comparably
expressed and were presumed to bind dsRNA equally well, the
dominant interference by the deletion alleles was difficult to explain
by sequestering of dsRNA activators. Accordingly, we proposed that
kinase domain deletion mutants formed heterodimers with wild-type PKR
that were less active than those formed with PKR-K296R because the
deletions eliminated important interactions between the kinase domains
in the dimer (40). In vitro studies with recombinant
PKR have provided independent evidence for self-interactions in
the kinase domain and the relative inactivity of heterodimers formed
between wild-type and kinase domain deletion mutants (37).
In addition, a recent study using in vivo protein interaction assays
confirmed the existence of a second dimerization domain in PKR located
between residues 244 and 296 (48).
The fact that overexpression of PKR-K296R protein did not detectably
interfere with PKR function in yeast (40) suggested that
dsRNA activators may be too abundant in yeast cells to allow inhibition
of PKR by sequestering of dsRNA. Accordingly, we reasoned that if
expression of E3 inhibited PKR in yeast, this might indicate that E3
does not rely exclusively on sequestering dsRNA. In this report, we
show that E3 can indeed inhibit PKR in yeast and that this
inhibition requires the nonconserved N-terminal half of E3 in addition
to its DRBM. In addition, we provide several lines of evidence
indicating that E3 inhibits PKR by forming inactive E3-PKR-dsRNA
complexes. Our results lead us to propose that E3 inhibits PKR by a
novel mechanism in which the inhibitory E3 N-terminal domain is
tethered to PKR by interactions between the DRBMs of the two proteins.
 |
MATERIALS AND METHODS |
Plasmids and yeast strains.
Construction of the plasmids
containing PKR-K296R (p1470) and PKR-
K (p1766)
under the control of the GAL-CYC1 promoter was described
previously (40). Plasmid p1545, from which wild-type PKR was
produced in strains coexpressing various E3 proteins, contains a
2.8-kbp ApaI-PstI fragment from p1420
(15) inserted into the high-copy-number TRP1
yeast plasmid pRS424 (46). p2521 containing
PKR-
K was constructed by inserting a 2.8-kbp
ApaI-BamHI fragment from p1766 into the
high-copy-number LEU2 plasmid pRS425 (46).
Plasmid pHY26, containing the vaccinia virus E3L coding sequence on an EcoRI-BamHI fragment in vector
pSG5, has been previously described (53). An
EcoRI fragment containing E3L was isolated from
pHY26, blunted ended, and further digested with BamHI. The resulting fragment was inserted between the SmaI and
BamHI sites of pEMBLyex4 (6), creating
plasmid pC178.
To facilitate subcloning and mutagenesis of the E3L coding
sequence, an SstI-BamHI fragment from plasmid
pC178 was inserted into SstI-, BamHI-digested
pUC19, creating p2286. A PCR fusion technique (52) was used
to insert the nine codons encoding the hemagglutinin (HA) epitope (TAC
CCA TAC GAC GTA CCA GAC TAT GCA) immediately following the
E3L start codon in plasmid p2286, creating plasmid pR124.
p2245 was created by inserting an SstI-BamHI
fragment from pR124 containing the HA-tagged E3L
coding sequence into pEMBLyex4. p2558 was created by inserting an
SstI-BamHI fragment from p2245 into p2444,
a modified pEMBLyex4 vector in which the URA3 marker is
replaced by TRP1 (39). Silent mutations which
generated ClaI restriction sites within the E3L
coding sequence were introduced by PCR fusion. ClaI sites
were created by altering the codons for Asp-7 (GAC to GAT) and Ile-85
(ATA to ATC) of plasmid p2286 to create pR49. pR49 was digested with
ClaI and religated to produce the E3L
7-86
allele in pR50. The HA epitope was inserted immediately after the
E3L start codon in pR50 as described above, and the sequence containing the HA-tagged version of E3L
7-86
(HA-E3L
7-86) was inserted as an
SstI-BamHI fragment into pEMBLyex4, creating plasmid p2446. PCR fusion was used to introduce a BsrGI site
at the codon for Ser-81 (TCG to TAC) and Asp-82 (GAC to AGC) of pR124 to create pR141. Digestion with BsrGI followed by religation
generated pR144. The HA-E3L
60-82 allele was isolated from
pR144 as an SstI-XbaI fragment and ligated with
SstI-, XbaI-digested pEMBLyex4 to create p2604. A BsrGI site was introduced by PCR fusion at the
Val-15 codon (GTG to GTA) and Cys-16 codon (TGT to CAT) in pR124,
and digestion of pR124 with BsrGI followed by religation
generated pR143 containing HA-E3L
15-56. This tagged
allele was inserted into pEMBLyex4 as an
SstI-BamHI fragment, creating p2602. PCR fusion was used to construct E3L-K167A,R168A by changing
the codon for Lys-167 to GCA and the codon for Arg-168 to GCA in p2245, creating pR187. PCR fusion was used to construct
E3L-W66A,F67A,M68A by changing the three relevant codons
to GCG, GCT, and GCG, respectively, in p2245, creating p2601.
Similarly each codon was individually changed to GCG, GCT, or GCG,
respectively, using the same PCR fusion technique, creating p2603
(W66A), p2638 (F67A), and p2639 (M68A).
The plasmid vectors for yeast two-hybrid analysis, pGBT10 and pGAD425,
and the constructs encoding the fusion proteins containing
the GAL4
activation domain (AD) and various PKR segments, pAD-PKR-K296R,
pAD-PKR

243-451, pAD-PKR

297-551, pAD-PKR

1-366, and
pAD-PKR

1-243,
have been described previously (
19).
Plasmids encoding fusion
proteins between the GAL4 DNA
binding domain (BD) (pGBT10) and
wild-type E3 (pR162),
E3-K167A,R168A (pL194-4), E3-W66A (pL181-10),
E3

60-82
(pL182-3), E3

7-86 (pL165-2), E3

7-86,K167A,R168A (PL199-1),
E3

105-190,W66A (pL168-3), and E3

105-190 (PL166-4), were
constructed
by PCR using as primers oligonucleotides that introduce
NdeI and
BamHI sites at the beginning and end,
respectively, of the
E3L coding sequence. Where necessary, a
stop codon was included in
the 3' oligonucleotide. Following
amplification, the PCR products
were digested with
NdeI
and
BamHI and ligated with
NdeI-,
BamHI-digested
pGBT10.
Plasmids encoding GST-E3 fusions were constructed by using p2645, a
derivative of vector pGEX-5X-3 (Pharmacia) produced by
inserting a pair
of annealed oligonucleotides, RO97 (5' GATCGTCCATATGCTCG)
and RO98 (5' GATCCGAGCATATGGAC), which contain an
NdeI site at
the
BamHI site of pGEX-5X-3. In
p2645, the ATG initiation codon
is within the
NdeI site, and
a
BamHI site was reintroduced downstream.
Plasmids encoding
GST-E3 WT (wild type) (pR194), GST-E3-W66A (pR195),
GST-E3-

7-86
(pR196), GST-E3-

7-86,K167A,R168A (pL201-2),
GST-E3-

105-190
(pR198), and GST-E3-

105-190,W66A (pR199)
were made by inserting
into p2645 the appropriate
NdeI-
SalI fragment obtained from the
plasmids
described above encoding fusions between the GAL4 BD
and various E3
segments.
Plasmids used for in vitro transcription and translation of PKR
mutant proteins, pcDNA1/Neo, pcDNA1/Neo-PKR WT,
pcDNA1/Neo-PKR-K296R,
pcDNA1/Neo-PKR-

297-551, and
pcDNA1/Neo-PKR-

1-243, were described
previously
(
19). pcDNA-PKR-

1-367 was made by synthesizing a
HindIII-
BamHI fragment by PCR using
primers FZP29 (5'
CCGG
AAGCTTGCCGCCACC
ATGTTCTGTGATAAAGG
3')
and P68-3' (5'
TATCAGAAGCAGGATCCCGG
GGATCCCTAACATGTGTGTCGTTCA
3'),
with
HindIII and
BamHI sites shown in
italics and start and
stop codons shown in boldface, and inserting it
between the
HindIII
and
BamHI sites of
pcDNA1/Neo. The inserted fragment contains
an ATG codon in the optimum
Kozak sequence context (
29) in frame
with the PKR-

1-367
coding sequence. The sequence of the inserted
fragment was verified by
using a Sequenase version 2.0 DNA sequencing
kit from United States
Biochemical/Amersham Life
Sciences.
Construction of the isogenic
S. cerevisiae strains RY1-1 and
RY1-12 (
a ura3-52 leu2-3 leu2-112 gcn2
trp1-
63),
containing
two copies and a single copy, respectively, of the wild-type
human
PKR coding sequence under control of the
GAL-CYC1
promoter integrated
at the
LEU2 locus, was described
previously (
40).
S. cerevisiae J82 (
a
ura3-52 leu2-3 leu2-112 gcn2
sui2
trp1-
63, p1098
[
SUI2-S51A, LEU2]) and H1894 (
a ura3-52 leu2-3
leu2-112 gcn2
trp1-63
) (
15) are derivatives of
strain H1645 (
16).
Strain Hf7c (
a ura3-52
his3-200 lys2-801 ade2-101 trp1-901 leu2-3,112 gal4-542 gal80-538
LYS2::GAL1-HIS3 URA3::[
GAL
17-mers]
3-
CYC1-lacZ)
(
18) was
used for yeast two-hybrid analysis. Media used to culture
yeast strains
and to conduct growth tests for phenotypic analysis
of
PKR
alleles were described previously (
40).
Immunoblot analysis of E3 and PKR protein expression.
Whole-cell extracts were prepared, proteins were resolved by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
blotted to nitrocellulose membranes, and the membranes were treated
with blocking solution exactly as described previously (40)
except for the addition of complete protease inhibitor (CPI) cocktail
(Boehringer Mannheim) to the lysis buffer and the use of 8 to 16%
gradient gels. Immunodetection of E3 protein was conducted with
monoclonal or polyclonal antibodies against the HA epitope,
HA-12CA5 (Boehringer Mannheim) or HA.11 (BabCo), respectively, used at
a dilution of 1:500 in blocking solution. Immunodetection of PKR was
conducted with a PKR-specific monoclonal antibody (71/10; Ribogene) at
a dilution of 1:1,000 in blocking solution. Visualization of immune
complexes by using the enhanced chemiluminescence (ECL) detection
system (Amersham) was conducted as specified by the manufacturer.
Poly(I-C) binding assays.
Whole-cell extracts were
prepared by breaking cells with glass beads in KR lysis buffer (20 mM
Tris-HCl [pH 8.0], 50 mM KCl, 400 mM NaCl, 20% glycerol, 0.1%
Triton X-100, 0.5 mM EDTA) containing CPI cocktail; 100 µg of
whole-cell extract was incubated with poly(I-C)-agarose in 200 µl of
buffer A (150 mM KCl, 20 mM HEPES, 10% glycerol, 5 mM magnesium
acetate) plus CPI cocktail for 1 h at 4°C. The agarose beads
were collected and washed three times with KR lysis buffer, and the
pellet was resuspended in 30 µl of 2× Laemmli sample buffer
(30). Proteins in the supernatant were precipitated with
trichloroacetic acid, washed once with 80% ethanol, dried, resuspended
in 30 µl of 2× Laemmli sample buffer, and boiled for 5 min. The
proteins were resolved by SDS-PAGE on 8 to 16% polyacrylamide gradient
gels. Immunodetection of E3 proteins was conducted as described above.
Coimmunoprecipitation of PKR and E3.
Whole-cell extracts
were prepared by breaking the cells with glass beads in
immunoprecipitation lysis buffer (20 mM Tris-HCl [pH 8.0], 150 mM
KCl, 1 mM magnesium acetate, 1 mM dithiothreitol) containing CPI
cocktail (Boehringer Mannheim). To immunoprecipitate PKR and E3,
protein samples (500 µg) were diluted to a final volume of 0.05 ml in
nondenaturing binding buffer (20 mM Tris-HCl [pH 8.0], 150 mM
KCl, 1 mM magnesium acetate, 0.1% Triton X-100) containing CPI
cocktail (Boehringer Mannheim). Three microliters of monoclonal antibodies against the HA epitope (HA-12CA5; Boehringer Mannheim) was
added, and samples were incubated at 4°C for 2 h with rocking. Immune complexes were collected using GammaBind Plus protein
G-Sepharose beads and washed three times with 0.10 ml of nondenaturing
binding buffer. The beads were resuspended in 30 µl of 2×
Laemmli sample buffer (30), boiled for 3 min, resolved by
SDS-PAGE on 8 to 16% gradient gels, and subjected to immunoblot
analysis for detection of PKR and E3 proteins as described above. The
efficiencies of immunoprecipitating E3 proteins and PKR were estimated
by video image densitometry of the resulting films, using the NIH Image software (version 1.61).
In vivo protein interaction assays.
For yeast two-hybrid
analysis, GAL4 fusion constructs were introduced into yeast strain Y190
(obtained from S. Elledge, Baylor College of Medicine) by standard
techniques (25). Transformants were selected on synthetic
complete dextrose (SC) medium (43) lacking tryptophan and
leucine. The strength of the protein-protein interactions was measured
by stimulation of the HIS3 reporter present in this strain
as assayed by growth on SC medium lacking histidine, tryptophan, and
leucine and containing 24 or 30 mM 3-aminotriazole. The procedures
followed in performing
repressor dimerization assays and the
N-PKR-
1-243 and
N-PKR-K296R constructs used in these
experiments were described previously (48). Plasmids encoding glutathione S-transferase (GST)-E3 fusions were
described above. PC168-derived plasmids encoding the
repressor
N-terminal DNA-binding domain (
N) fused with the indicated PKR
proteins and p2645-derived plasmids encoding GST alone or GST fused
with the indicated E3 proteins were cotransformed into E. coli AG1688 (obtained from J. C. Hu, Texas A&M University).
Cotransformants were selected on B medium containing 50 µg of
ampicillin and 20 µg of chloramphenicol per ml. Cultures grown
overnight (30°C) in LB supplemented with the antibiotics, 10 mM
MgSO4, and 0.2% maltose were used to create bacterial
lawns containing 100 nM isopropylthio-
-D-galactoside
(IPTG). Lawns were then spotted with 5-µl aliquots of serial
dilutions of a
KH54 phage lysate (109 PFU) at 10-fold
intervals. Infected lawns were incubated overnight at 30°C, and the
inhibition of dimerization mediated by
N-PKR fusions was scored by
appearance of dot plaques on the lawns.
GST binding assays.
Transformants of E. coli
BL21(DE3) bearing plasmids encoding GST or different GST-E3 fusion
proteins were grown to an optical density at 600 nm (OD600)
of 0.6 to 0.7, and IPTG was added to 1 mM to induce expression of the
GST proteins for 2 h. Total proteins were extracted by sonicating
cells in 1× phosphate-buffered saline containing CPI cocktail
(Boehringer Mannheim), followed by centrifugation at 12,000 × g for 30 min at 4°C. 35S-labeled proteins
PKR-K296R, PKR-
243-551, PKR-
297-551, PKR-
1-243, and
PKR-
1-367 were produced by in vitro transcription and
translation using plasmids pcDNA1/Neo-PKR K296R, pcDNA1/Neo-PKR WT
linearized with BanI, pcDNA1/Neo-PKR-
297-551,
pcDNA1/Neo-PKR-
1-234, and pcDNA1/Neo-PKR-
1-367, respectively,
[35S]-Pro Mix (mixture of [35S]methionine
and [35S]cysteine; Amersham), and the TNT T7 coupled
reticulocyte lysate system (Promega) as instructed by the manufacturer.
GST binding assays were conducted essentially as described
previously (19), with the following modifications:
binding buffer (1× phosphate-buffered saline) contained CPI
cocktail (Boehringer Mannheim) as the only source of protease
inhibitors; 15 µl of glutathione-Sepharose beads (50% slurry)
instead of 50 µl was added to each reaction mixture; after washing,
the glutathione-Sepharose beads were resuspended in 15 µl of 2× SDS
sample buffer, boiled, and resolved by SDS-PAGE on 10 to 20%
polyacrylamide gradient gels.
Assays of ribosome binding by E3 and PKR in yeast cell
extracts.
Detection of ribosome association in whole-cell
extracts was conducted essentially as described previously
(54). The distribution of proteins in the gradients was
analyzed by separating 25 µl from each 600-µl fraction by
SDS-PAGE on 10 to 20% gradient gels followed by immunoblot analysis of
PKR and HA-E3 proteins conducted as described above.
 |
RESULTS |
Genetic evidence that E3 inhibits PKR in yeast through
complex formation.
S. cerevisiae contains a protein
kinase known as GCN2 that phosphorylates eIF2
on serine-51
(16), the same reaction catalyzed by PKR in mammalian cells.
To test whether E3 can inhibit PKR activity in yeast, we used a
gcn2
strain (RY1-1) expressing wild-type PKR cDNA under
the control of a galactose-inducible (GAL) promoter from a
plasmid integrated in the genome. When RY1-1 is cultured on medium
containing galactose as the carbon source (SGal medium [10%
galactose, 2% raffinose]), PKR is expressed at levels high enough to cause extensive phosphorylation of eIF2
, with attendant inhibition of protein synthesis and cell growth (15) (Fig.
1A, lane 8). When PKR is expressed at low
levels on medium with glucose as the carbon source (SD medium), the
amount of eIF2
phosphorylation is not great enough to reduce growth
rate (lane 4). A multicopy plasmid containing E3L cDNA under
the control of the same GAL promoter was introduced
into strain RY1-1 and assayed for inhibition of PKR function
in cells grown on SGal medium. In parallel, two PKR alleles
encoding catalytically defective proteins with wild-type DRBMs were
compared with E3L for the ability to inhibit wild-type PKR function: (i) PKR-K296R, which is recessive
to wild-type PKR in yeast, and (ii) PKR-
K,
completely lacking the kinase domain, which is dominant negative
to wild-type PKR (40). When expressed at
high levels, the recessive PKR-K296R allele had no
effect on wild-type PKR function (compare lanes 5 and 8),
whereas the dominant-negative PKR-
K allele inhibited
wild-type PKR and restored growth on SGal medium (lane 7),
as reported previously (40). The E3L construct resembled PKR-
K and reversed the growth inhibition
associated with PKR overexpression (lane 6), indicating that E3
interferes with PKR function in yeast cells.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic evidence that E3 inhibits PKR in yeast through
heterocomplex formation. (A) A plasmid containing the
PKR-K296R (p1470), PKR- K (p1766), or
wild-type E3L (p2245) cDNA, all under the control of the
CYC1-GAL promoter, or empty vector p1079 (none) was
introduced into the gcn2 yeast strain RY1-1 containing
two copies of the wild-type PKR allele (also under
CYC1-GAL control) integrated at the LEU2
locus. Patches of transformants were grown on SD medium, replica
plated to SD or SGal medium, and incubated for 3 to 4 days at 30°C.
(B) Plasmids containing E3L (p2558) and PKR K296R
(p1470) or the corresponding empty vectors (p2444 and p1079) were
introduced into strain RY1-1, and transformants were streaked for
single colonies on SGal medium and incubated for 5 to 6 days at 30°C.
(C) The parental strain of RY1-1 lacking the integrated copies of
PKR, H1894, was transformed with plasmids containing
E3L (p2558), plus either PKR-K296R (p1470) or
empty vector (pEMBLyex4), and grown on SGal medium for ~12
h. Whole-cell extracts were prepared, and 20 µg of total cell protein
was fractionated by SDS-PAGE and subjected to immunoblot analysis using
monoclonal antibodies against PKR and against HA to detect HA-tagged
E3. ECL (Amersham) was used to visualize immune complexes.
Transformants of strain H1894 rather than the RY1-1 transformants
described for panel B were analyzed to eliminate differential effects
of wild-type PKR on expression of E3.
|
|
The fact that E3 inhibited wild-type PKR in yeast
whereas PKR-K296R did not, even though both proteins
contain DRBMs, could
be explained by proposing that E3 is
expressed at higher levels
and thus can sequester dsRNA activators
more effectively than
PKR-K296R. Alternatively, E3 could inhibit PKR by
forming defective
heteromeric complexes, in the manner proposed
previously to account
for the dominant-negative phenotype of
PKR-
K (
40). If the former
explanation is
correct, then coexpressing PKR-K296R and E3 in
the same cells should
enhance down-regulation of wild-type PKR
by increasing the abundance of
functional DRBMs without changing
the number of active kinase
domains. Alternatively, if E3 must
form complexes with PKR to
inhibit kinase activity, then coexpressing
PKR-K296R might
interfere with E3 inhibitory function by displacing
it from the
inhibited PKR-E3 complexes and forming PKR-PKR-K296R
heterodimers of
relatively higher activity plus inactive PKR-K296R-E3
complexes.
To test these predictions, we introduced the
PKR-K296R
construct into RY1-1 transformants containing integrated
wild-type
PKR and plasmid-borne
E3L. As
described above, cells overexpressing
wild-type PKR on
galactose medium failed to grow, whereas coexpressing
E3 suppressed the
toxicity of PKR and rescued growth on galactose
medium (Fig.
1B,
PKR + Vector versus
PKR + E3L).
Coexpressing
the inactive PKR-K296R protein together with E3
neutralized the
effect of E3 and restored the toxicity of
the wild-type PKR (Fig.
1B,
PKR + E3L + PKR-K296R). Immunoblot analysis showed that E3
levels were
unaffected by coexpressing PKR-K296R in the same cells
(Fig.
1C);
thus, the ability of PKR-K296R to reverse E3 inhibitory
function is
unlikely to result from a reduction in E3 expression.
Our results can
be explained by proposing that E3 inactivates
PKR by forming a complex
with it and that the defective PKR-K296R
protein rescues the
wild-type kinase by sequestering E3 in nonfunctional
PKR-K296R-E3
complexes.
Identification of residues in the N-terminal domain of E3 required
for inhibition of PKR.
To determine the importance of dsRNA
binding by E3 for its ability to inhibit PKR in yeast, we
introduced alanine substitutions at Lys-167 and Arg-168 in the E3 DRBM.
These residues are conserved in the DRBMs of other dsRNA binding
proteins (47), and it was shown that alanine substitutions
in the corresponding residues of PKR DRBM-1 abolished or weakened dsRNA
binding in vitro (34, 38). Moreover, a single threonine
substitution in E3 at Lys-167 was shown previously to abolish dsRNA
binding in vitro (8). We also constructed several
deletion and point mutations in the N-terminal half of E3 to determine
whether this uncharacterized part of the protein was required for E3
inhibitory function (Fig. 2A). These mutations
were introduced into a plasmid-borne E3L construct identical
to that described above except that coding sequences for the influenza
virus HA epitope were added to the beginning of the coding
region to facilitate immunodetection of E3 proteins. Addition of
the HA epitope had no effect on E3 function, as judged by growth
assays of the type represented in Fig. 1A (data not shown).

View larger version (21K):
[in this window]
[in a new window]

View larger version (52K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Genetic evidence that the N-terminal domain of E3 is
critically required for inhibition of PKR. (A) Summary of growth
phenotypes on SGal medium conferred by different E3L
alleles in strain RY1-1, indicating their ability to inhibit PKR
function in yeast. The mutant E3 proteins are represented
schematically at the bottom, from amino acids 1 to 190. Transformants of RY1-1 bearing the indicated plasmid-borne
E3L alleles were analyzed for growth as described for Fig. 1
and scored relative to transformants containing wild-type
E3L or vector alone. The E3L alleles were
introduced into RY1-1 on the follow
ing plasmids: E3L (wild type [WT]), p2445;
E3-K167A,R168A, p2612; E3- 15-56, p2602;
E3- 7-86, p2446; E3- 60-82, p2604;
E3-W66A, p2603; E3-F67A, p2638;
E3-M68A, p2639; E3-W66A,F67A,M68A, p2601; NONE,
empty vector p1079. (B) Transformants of RY1-1 bearing the indicated
plasmid-borne alleles or vector alone, described above, were streaked
for single colonies on SGal medium and incubated for 7 to 10 days at
30°C. (C) The gcn2 eIF-2 -S51A yeast strain J82
expressing wild-type PKR from plasmid p1545 was transformed with
plasmids containing the indicated E3L alleles described
above, grown in SD medium at 30°C for ~30 h, and shifted to SGal
medium for ~12 h. Whole-cell extracts were prepared and 20 µg
of total protein was fractionated by SDS-PAGE and subjected to
immunoblot analysis using monoclonal antibodies against the HA epitope
to detect the HA-tagged E3. The ECL system was used to detect the
immune complexes. Transformants of strain J82 rather than the RY1-1
transformants described for panel A were analyzed to eliminate the
differential effects of wild-type PKR on the expression of the
various mutant E3 proteins. The blot was stripped and probed with
antibodies against poly(A) binding protein (PAB1) to verify that equal
amounts of whole-cell protein were loaded in all lanes (data not
shown). Lanes 1 and 2 and lanes 3 to 7 derived from different
experiments.
|
|
The K167A,R168A double substitution in the DRBM abolished E3 function,
restoring the lethal effect of high-level PKR expression
on SGal
medium (Fig.
2A and B). To verify that this mutant protein
was
incapable of binding dsRNA, we compared it to wild-type E3
for
the ability to bind to poly(I-C)-agarose beads. As shown in
Fig.
3, under conditions where ca. 50% of
wild-type E3 in the
extract bound to the resin (lanes 6 and 7 versus 2 and 3), none
of the E3-K167A,R168A mutant protein was
recovered in the bound
fraction (lanes 4 and 5 versus 8 and 9).
Interestingly, the

7-86
and

60-82 deletions and the W66A
substitution also abolished
the anti-PKR function of E3 (Fig.
2A and
B), whereas Ala substitutions
at Phe-67 and Met-68, flanking Trp-66,
had no effect on E3 function
(Fig.
2A). It was shown previously that
the N-terminal half of
E3 makes no contribution to the binding
affinity for dsRNA, as
purified full-length E3 and the C-terminal
half of E3 containing
the DRBM had indistinguishable dissociation
constants (
22).
Thus, the requirement for the N-terminal
half of E3 for inhibition
of PKR cannot be explained by a reduction in
dsRNA binding.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
The K167A and R168A mutations impair dsRNA binding
by E3 in vitro. Transformants of strain J82 containing the indicated
HA-tagged E3L alleles or vector alone (p1079) were
grown in SD medium for ~30 h and then shifted to inducing conditions
(SGal medium) for ~12 h, and whole-cell extracts were prepared.
Aliquots containing 100 µg of total protein were incubated with
poly(I-C)-agarose for 1 h at 4°C. Proteins which bound to
poly(I-C)-agarose were collected by centrifugation and eluted by
boiling in 2× Laemmli sample buffer. Unbound proteins in the
supernatant were trichloroacetic acid precipitated, washed with
ethanol, and resuspended by boiling in 2× Laemmli sample buffer.
Proteins were resolved by SDS-PAGE using 8 to 16% gradient gels and
subjected to immunoblot analysis using monoclonal antibodies
against the HA epitope (HA-12CA5) and ECL to detect
immune complexes. Lanes 1 to 5 contain the fraction of E3 proteins
which bound to poly(I-C)-agarose; lanes 6 to 9 contain the fraction of
E3 proteins which did not bind to poly(I-C)-agarose.
|
|
We conducted immunoblot analysis of mutant and wild-type E3
proteins in whole-cell extracts to determine whether the
impaired
functions of the
K167A R168A,
15-56,
7-86, and
W66A E3L
alleles
resulted from instability of the mutant proteins. For this
experiment,
the
E3L constructs were expressed in a
strain containing a nonphosphorylatable
form of eIF2

(eIF2

-S51A) to eliminate the inhibitory effect
of PKR
function on protein synthesis in strains containing defective
E3
proteins. The results shown in Fig.
2C indicated that all of
the mutant
proteins were present in amounts similar or even greater
than that of
wild-type E3. Thus, the mutations seem to impair
E3 function, not
its expression or
stability.
PKR down-regulates its own expression in yeast by a mechanism that
depends on phosphorylation of eIF2

, such that PKR abundance
is
inversely proportional to its eIF2

kinase activity (
15,
27,
40). Accordingly, the levels of PKR in strains coexpressing
E3 proteins should be inversely proportional to the anti-PKR function
of the E3 proteins. This expectation was borne out by immunoblot
analysis of PKR levels in strains expressing wild-type
eIF2

,
where we found that PKR accumulated to higher levels in
transformants
expressing wild-type E3 than in those containing the
inactive
E3 protein E3-

7-86, E3-W66A, or E3-K167A,R168A (data not
shown).
To demonstrate more directly that E3 inhibits PKR function in yeast, we
measured the relative amounts of eIF2

phosphorylated
and
unphosphorylated on serine-51 in extracts from yeast strains
expressing PKR and various E3 proteins. As shown in Fig.
4, the
presence of wild-type E3
decreased the proportion of phosphorylated
eIF2

from ca. 70% to ca.
35%. In contrast, the E3-

7-86, E3-W66A,
and E3-K167A,R168A
proteins produced little or no reduction in
the extent of eIF2

phosphorylation. Taken together, the results
in Fig.
2 to
4 indicate
that both the dsRNA binding activity of
E3 and residues in its
N-terminal domain between amino acids 60
and 82 are critically required
for the inhibition of PKR function
in yeast cells.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of E3 reduces eIF2 phosphorylation by PKR
in yeast cells. Transformants of strain RY1-12 (containing the
single-copy chromosomal PKR construct) bearing the indicated
E3L alleles or vector alone (lanes 2 to 6) and the vector
transformant of strain H1894 lacking the PKR construct (lane
1) were grown to saturation in SD medium containing the necessary
supplements for 2 days, diluted 1:50 into 50 ml of fresh SD medium, and
grown to an OD600 of 0.5 to 1. Cells were harvested,
resuspended in 50 ml of SGal medium, and grown overnight. Whole-cell
extracts were prepared, and 20 µg of total protein was resolved by
isoelectric focusing PAGE and then subjected to immunoblot analysis
using polyclonal eIF2 antibodies as described previously
(16). The positions of basally phosphorylated (eIF2 ) and
eIF2 phosphorylated on Ser-51 (eIF2 ~P) are indicated at the
right. The intensities of both signals were quantitated with a scanner
(Silverscanner III) and NIH Image software (version 1.61), and the
resulting data are shown graphically below the blot expressed as the
percentage of total eIF2 phosphorylated on Ser-51.
|
|
E3 and PKR interact in vivo in a manner dependent on both the DRBM
and the N-terminal domain of E3.
To investigate whether E3 and PKR
physically interact in yeast cells, we asked whether PKR could be
coimmunoprecipitated with E3 from extracts prepared from strains
coexpressing PKR and the HA-tagged mutant or wild-type E3 proteins.
These experiments were carried out with the eIF2
-S51A strain to
eliminate autoregulation of PKR expression. As shown in Fig.
5, PKR was immunoprecipitated with
anti-HA antibodies from the extract containing wild-type HA-tagged
E3 but not from one lacking E3 (lanes 1, 2, 6, and 7), indicating that
PKR is physically associated with wild-type E3 in cell extracts. In
these experiments, 15 to 20% of the total PKR in the cell extracts was
coimmunoprecipitated with 20 to 40% of the wild-type E3. After
correction for the efficiency of immunoprecipitating E3, these data
suggest that 50 to 70% of the PKR in the cell is physically associated
with E3.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 5.
Coimmunoprecipitation of wild-type PKR with mutant
and wild-type E3 proteins from yeast cell extracts. The
gcn2 eIF-2 -S51A strain J82 bearing wild-type
PKR on plasmid p1545 was transformed with plasmids encoding
the indicated HA-tagged E3L alleles (see the legend to Fig.
2A) or with the vector p1079 alone. Transformants were grown under
inducing conditions in SGal medium for ~12 h, and whole-cell extracts
were prepared. Aliquots containing 500 µg of total protein were
immunoprecipitated (IP) with monoclonal antibodies against the HA
epitope. Immune complexes were fractionated by SDS-PAGE on 8 to 16%
polyacrylamide gradient gels and subjected to immunoblot analysis using
a monoclonal antibody against PKR (71/10) and a polyclonal antibody
against the HA epitope (HA.11). Lanes 6 to 10 contain
immunoprecipitated proteins; lanes 1 to 5 contain 50 µg of the
starting extracts used for the immunoprecipitations. WT-E3L,
wild-type E3L allele.
|
|
The K167A,R168A mutation abolished complex formation between E3
and PKR (Fig.
5, lane 10), suggesting that the dsRNA binding
activity of E3 is required for a stable interaction with PKR in
vivo.
This conclusion implies that PKR-E3 complexes also contain
dsRNA. The

7-86 and

15-56 mutations reproducibly decreased the
yield of PKR
in immune complexes compared to that seen with wild-type
E3 (lanes
7 and 8 and data not shown). After correcting for the
efficiencies of
immunoprecipitating wild-type E3 and E3

7-86,
we found that

7-86 reduced complex formation with PKR to 60%
of the level
seen for wild-type E3. By contrast, E3-W66A complexed
with PKR as
efficiently as did wild-type E3 (lanes 7 and 9). (The
amount of
E3-W66A protein was atypically reduced relative to that
of
wild-type E3 in this particular extract; nevertheless, a similar
amount of PKR was coimmunoprecipitated with wild-type E3 and
E3-W66A.)
This last result indicates that Trp-66 in the N-terminal half
of E3 does not function in the inhibition of PKR by mediating
complex
formation between the two
proteins.
Evidence for multiple interactions involving different segments of
E3 and PKR.
We used the yeast two-hybrid assay to investigate
physical interactions between different segments of E3 and PKR. Protein fusions between the GAL4 AD and various PKR segments were tested for interactions with GAL4 BD fusions bearing various E3 segments (Fig.
6). The full-length AD-PKR fusion
contains the K296R mutation because the corresponding fusion containing
wild-type PKR is toxic in yeast (19). It was shown
previously that these AD-PKR fusion proteins were expressed at
comparable levels in yeast cells (19). Immunoblot
analysis of whole-cell extracts using anti-HA antibodies showed that
the different BD-E3 fusion proteins also were expressed at similar
levels (data not shown).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Summary of interactions between PKR and E3 segments in
the yeast two-hybrid assay. Strain Y190 was cotransformed with
TRP1 plasmids encoding the GAL4 BD alone (vector) or fused
with wild-type E3 protein (WT) or the indicated E3 mutant proteins
(BD-E3 fusions) and with a LEU2 plasmid encoding the GAL4 AD
alone (vector) or fused with the indicated PKR proteins (AD-PKR
fusions). Transformants were streaked for single colonies on SC medium
containing 30 mM 3-AT and lacking histidine, leucine, and tryptophan.
The colony size was scored for each transformant and ranked as ,
/+, +/ , +, 2+, 3+, or 4+. DRBD, dsRNA binding domain; PK, protein
kinase domain.
|
|
The two PKR fusions bearing the DRBMs but lacking the protein kinase
domain,

243-551 and

297-551, interacted strongly with
all of the
E3 fusions containing the wild-type DRBM but not with
those
containing the K167A,R168A mutation or with the E3-

105-190
fusion
which lacks the DRBM entirely (Fig.
6, columns 3 and 4).
The
full-length PKR fusion showed a moderate interaction with
wild-type
E3 but little or no interaction with the E3-K167A,R168A
fusion (column
2, rows 2 and 4). These data suggest that E3 interacts
with PKR through
its DRBM and that the dsRNA binding activity
of this domain is
required for E3-PKR complex
formation.
Interestingly, the E3 N-terminal deletions

60-82 and

7-86 showed
no interaction with full-length PKR (Fig.
6, column 2,
rows 5 and 6).
These data suggest that the E3 N-terminal domain
contributes to
the stability of complexes containing full-length
PKR and E3 proteins,
in accordance with results of the coimmunoprecipitation
experiments
described above. In contrast, the

60-82 and

7-86
E3 fusions
interacted strongly with the truncated PKR fusions
containing DRBMs but
lacking the kinase domain (columns 3 and
4, rows 5 and 6). Thus, it
appears that the E3 N-terminal half
is required for interaction with
full-length PKR but dispensable
for interaction with PKR segments
containing DRBMs but lacking
the kinase domain. This seemingly
paradoxical result could be
explained by proposing that the PKR DRBMs
are masked by interactions
with the kinase domain, as suggested
recently (
42,
51). If
the N-terminal half of E3 interacts
with the kinase domain, this
could free the DRBM-half of PKR for
interaction with the DRBM-half
of
E3.
The N-terminal half of E3 (

105-190) interacted with
full-length PKR (Fig.
6, column 2, row 8); however, this E3
segment interacted
weakly or not at all with two kinase domain
segments (columns
5 and 6, row 8). We could not test the effect of the
W66A mutation
on interaction between the N-terminal half of E3 and
full-length
PKR because the BD-E3-

105-190,W66A fusion activated
transcription
in the absence of any AD fusion (data not shown).
Full-length
E3 failed to interact with the kinase domain segments;
however,
while this work was in progress, Sharp et al. found that
full-length
E3 fused to the GAL4 AD interacted with the PKR kinase
domain
segment

1-366 fused to the GAL4 BD (
42). Thus,
the two-hybrid
assay provides some evidence that the N-terminal half of
E3 can
interact with
PKR.
We sought to confirm the two-hybrid interactions between different
segments of PKR and E3 by in vitro binding assays using
recombinant
proteins. Selected E3 segments were expressed in
E. coli as
GST fusion proteins, and bacterial cell extracts containing
the
fusions were incubated with radiolabeled PKR polypeptides
synthesized by in vitro translation. The GST-E3 proteins were
precipitated with glutathione-Sepharose beads, and the
bound PKR
proteins were analyzed by SDS-PAGE and
autoradiography (GST pull-down
assays). Full-length PKR and
PKR peptides containing the DRBMs
bound to GST fusions containing
either full-length E3 or the C-terminal
half of the protein bearing the
DRBM (Fig.
7, III and IV, lanes
1 to 3).
Binding of the PKR polypeptides to GST-E3-

7-86 was greatly
reduced
by the K167A and R168A substitutions in the E3 DRBM (IV
and V, lanes 1 to 3). The two PKR fragments containing only the
protein kinase domain
(PKR-

1-243 and PKR-

1-367) showed little
or no binding to
these three GST-E3 fusions (I to V, lanes 4 and
5). Although
binding of the PKR-

243-551 polypeptide occurred
without addition of dsRNA to the reactions, we found that its
interaction with GST-E3-

7-86 (and even with the E3 derivative
containing the K167A and R168A substitutions) was stimulated by
addition of poly(I-C) at 500 ng/ml (Fig.
8). Apparently, the K167A
and R168A
substitutions greatly diminish but do not completely
abolish E3 dsRNA
binding activity. These last results support
the idea that complex
formation between segments of PKR and E3
containing their DRBMs is
dependent on dsRNA binding by E3.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
Analysis of in vitro interactions between segments of
PKR and E3 containing their respective DRBMs. Aliquots of bacterial
extracts containing 20 to 100 µg of total protein predetermined to
contain similar amounts of GST or GST-E3 fusion proteins (as indicated
at bottom of panel B, sections II to V) were combined with an extract
prepared from the parental bacterial strain devoid of GST proteins to
achieve 200 µg of total bacterial protein. These mixtures were
incubated with the 35S-labeled PKR proteins indicated at
the top of panel A, section I, and the GST or GST-E3 fusion proteins,
along with any bound 35S-labeled PKR proteins, were
precipitated by using glutathione-agarose beads and resolved by
SDS-PAGE. The 35S-labeled proteins were visualized by
autoradiography (A, sections II to V), and the GST or GST-E3 fusion
proteins were visualized by Coomassie blue staining (B, sections II to
V). Section I in panel A, shows 1/20 (lanes 1 to 4) or 1/10 (lane 5) of
the input amounts of 35S-labeled PKR proteins used in the
binding assays depicted in sections II to V. Arrowheads in panel B
identify GST or the relevant GST-E3 fusion protein.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 8.
dsRNA binding is required for strong
interaction between the DRBM-containing segments of E3 and
PKR in vitro. Binding reactions between 35S-labeled
PKR- 243-551 and either GST (I), GST-E3- 7-86 (II), or
GST-E3- 7-86,K167A,R168A (III) were carried out exactly as
described for Fig. 7 except that poly(I-C) was added to the reactions
at the final concentrations shown above the lanes in panel A. The
35S-labeled PKR- 243-551 proteins precipitated with GST
or the GST-E3 fusions were visualized by autoradiography (A), and
the precipitated GST or GST-E3 fusion proteins were visualized by
Coomassie blue staining (B).
|
|
In contrast with both the two-hybrid and coimmunoprecipitation
results, removing the N-terminal domain of E3 (in GST-E3-

7-86)
did not detectably impair its interaction with full-length PKR
(Fig.
7, III and IV, lanes 1 to 3). Moreover, we did not observe
a
significant interaction between the N-terminal half of E3 and
full-length PKR in these in vitro binding experiments (data not
shown). To explain this last result, it could be proposed that
the E3
N-terminal fragment does not fold properly or lacks an
important
posttranslational modification when expressed in bacterial
cells, or
that the GST moiety interfered with its PKR binding
activity.
Alternatively, the rate of dissociation of this particular
PKR-E3
complex may too great to allow its detection by the GST
pull-down
technique, which involves washing immobilized complexes
with large
volumes of
buffer.
To obtain corroborative evidence for interaction between the N-terminal
half of E3 and PKR, we turned to the

repressor dimerization
assay
for protein-protein interactions (
23). In this system,
the
protein segments of interest are expressed in
E. coli as
fusions
to the N-terminal domain of

cI repressor, which contains
the
DNA binding domain but lacks the dimerization domain of cI.
Interaction
between the protein segments under study mediates
dimerization
of the

N fusion proteins, leading to repression of the
pR promoter
that can be assayed in several
ways. With this technique, it was
shown that PKR contains a
dimerization domain located between
the DRBMs and kinase subdomain II
(residues 244 to 296) in addition
to the previously identified
dimerization domain in the N-terminal
half of PKR (residues 1 to 167)
(
48). Moreover, dimerization
of full-length PKR in
this assay was disrupted by coexpression
of a GST fusion to
P58
IPK protein, a cellular inhibitor of PKR active
during influenza
virus infections that binds PKR residues 244 to 296 (
19). These
findings provided evidence that
P58
IPK inhibits PKR function, at least partly, by
interfering with PKR
dimerization through residues 244 to 296 (
48).
We used the same approach to determine whether the N-terminal half
of E3 can interact with the kinase domain of PKR. PKR residues
244 to
551, containing the complete kinase domain, can mediate
dimerization in
the

repressor dimerization assay (
48). We
found that
coexpressing full-length GST-E3 or the GST fusion containing
the
N-terminal half of E3 (GST-E3-

105-190), but not the W66A
derivatives of these GST-E3 proteins, blocked dimerization by
the

N-PKR fusion containing kinase domain residues 244 to 551
(

N-PKR-

1-243) (Fig.
9, column 1, rows 2, 3, 7, and 8). As expected,
inactivating the dsRNA
binding activity of full-length GST-E3
by the K167A and R168A
mutations had no effect on its ability
to disrupt

N-PKR-

1-243
dimerization. Moreover, the DRBM half
of E3 (GST-E3-

7-86) had no
effect on dimerization of this

N-PKR
kinase domain fusion (column 1, rows 4, 5, and 6). These findings
suggest that the N-terminal half of
E3 can interact with the C-terminal
half of PKR and prevent
dimerization via PKR residues 244 to 296,
independent of dsRNA
binding by the E3 protein.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 9.
Summary of inhibition of PKR dimerization by E3 segments
in the repressor dimerization assay. E. coli AG1688 was
cotransformed with pC168-derived plasmids encoding N fused with the
indicated PKR proteins and with p2645-derived plasmids encoding GST
alone or GST fused with the indicated E3 proteins. Cotransformants were
tested for immunity to superinfection by KH54, a mutant lacking the
ability to synthesize its own repressor, by using a dot plaque assay.
GST alone had no or minimal effect on N-PKR fusion
dimerization-induced resistance to superinfection ( ).
Coexpression of a GST-E3 fusion that reduced resistance to superinfection by at least 10-fold (+) or 100-fold (2+) was scored as
disruption of N-PKR fusion dimerization. DRBD, dsRNA binding domain;
PK, protein kinase domain.
|
|
Quite different results were obtained with the full-length

N-PKR-K296R fusion in the dimerization assay. In this case, the
GST
fusions containing full-length E3 or the DRBM half, but not
the
N-terminal half, of E3 blocked dimerization by

N-PKR-K296R
in a
manner dependent on residues K167 and R168 in the E3 DRBM
(Fig.
9,
column 2). In addition, the W66A mutation had no effect
on the ability
of full-length GST-E3 to interfere with

N-PKR-K296R
dimerization.
These findings suggest that the DRBM-bearing portion
of E3 is required
to disrupt dimerization mediated by the DRBM-containing
segment of PKR
and, as concluded above, that the interaction between
DRBM-bearing
segments of E3 and PKR is dependent on dsRNA binding
by
E3.
The fact that the N-terminal half of E3 is not necessary or sufficient
to disrupt dimerization by full-length PKR in this
assay could indicate
that the DRBM-containing region of PKR can
mediate dimerization even
when the self-interaction of PKR residues
244 to 296 is blocked by
binding of the N-terminal half of E3
to the kinase domain. This
contrasts with the finding that binding
of P58
IPK to
residues 244 to 296 is sufficient to disrupt dimerization
by
full-length PKR (
48). It is possible, however, that the
isolated
E3 N-terminal half can bind to PKR residues 244 to 551 without
impeding self-interactions in the N-terminal region of PKR, whereas
binding of P58
IPK to the 244 to 296 region impairs
self-interactions by both PKR
dimerization domains. Our results also
suggest that self-interactions
by PKR residues 244 to 296 cannot
mediate dimerization by full-length
PKR when the DRBM half of E3 is
bound to the N-terminal region
of PKR containing the DRBMs, despite the
fact that residues 244
to 296 are sufficient for dimerization
of the isolated C-terminal
half of PKR. Perhaps binding of the E3
DRBM to the N-terminal
region of PKR sterically blocks
self-interactions between PKR
residues 244 to 296. Finally, none of the
GST-E3 proteins could
prevent dimerization by a

N-PKR fusion
containing only residues
244 to 296 (data not shown), indicating that
the N-terminal half
of E3 requires residues in the kinase domain,
located C terminally
to position 296, in order to bind to PKR and block
dimerization
by residues 244 to 296. This last finding is in agreement
with
recent results discussed below indicating that E3 makes contact
with the C-terminal lobe of the PKR kinase domain (
42).
E3 blocks ribosome binding by PKR, but this activity is
insufficient to inhibit PKR function.
It was reported that the
DRBMs in PKR mediate a stable interaction with yeast ribosomes and that
the ribosome targeting of PKR could be an important aspect of the
requirement for DRBMs to achieve high-level phosphorylation of
eIF2
in yeast cells (54). Accordingly, we asked whether
coexpression of E3 would interfere with ribosome binding by
PKR. In the absence of E3 expression, a substantial fraction of PKR in
the cell extract cosedimented through sucrose gradients with 40S and
60S ribosomal subunits, 80S ribosomes, and polysomes (Fig.
10A), in agreement with previous findings (54). Coexpression of wild-type E3 shifted
the distribution of PKR from the ribosomal particles to the top of the
gradient. A minor fraction of the total E3 cosedimented with
40S subunits and polysomes (Fig. 10B). Interestingly, coexpression of
E3-K167A,R168A did not alter the ribosome association of PKR, and a
smaller proportion of this mutant E3 protein than of wild-type E3
cosedimented with 40S subunits (Fig. 10C). These findings suggest that
displacement of PKR from ribosomes is dependent on the dsRNA
binding activity of E3. This could be accounted for by proposing
that E3 competes with PKR for dsRNA binding sites in rRNA.
Alternatively, since complex formation between E3 and PKR requires the
dsRNA binding activity of E3, displacement of PKR from the
ribosomes could depend on complex formation with E3.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 10.
Expression of E3 displaces PKR from ribosomes in a
manner that depends on the dsRNA binding activity of E3 but not its
N-terminal domain. Transformants of strain J82 (expressing
eIF2 -S51A) containing PKR plasmid p1545 and either a
plasmid encoding wild-type E3 (p2245), E3-K167A,R168A (p2612), or
E3- 7-86 (p2246) (B to D) or the empty vector p1079 (A) were grown in
SGal medium to an OD600 of 1.5. Whole-cell extracts
prepared in the presence of 50 mg of cycloheximide per ml and 10 mM
MgCl2 were resolved by velocity sedimentation on 5 to 47%
sucrose gradients. The gradients were fractionated, and absorbance at
254 nm was recorded to determine the position of the free 40S and 60S
subunits, 80S monosomes, and polysomes (indicated by arrows). The
OD254 absorbance profile is shown for the gradient analyzed
in panel A; the OD254 profiles for panels B to D were
essentially identical to that shown in panel A. The distribution of
proteins along the gradients was visualized by SDS-PAGE and immunoblot
analysis. The first and last lanes in each panel were loaded with 1/20
of the input (I) extracts applied to the gradients.
|
|
Expression of the E3-

7-86 mutant led to complete displacement of
PKR from the ribosomes and showed even greater association
with
ribosomes than did wild-type E3 (Fig.
10D). It has been shown
that
the N-terminal domain of E3 promotes oligomerization of E3
in
high-molecular-weight complexes (
22). Perhaps in lacking
the
ability to oligomerize, E3-

7-86 can interact more stably
with
ribosomes. The fact that expression of E3-

-7-86 displaced
PKR from
ribosomes, but did not detectably decrease eIF2

phosphorylation
by
PKR, suggests that ribosome binding is not essential for
high-level
phosphorylation of eIF2

by PKR in yeast and that
displacement
of PKR from ribosomes is not the sole function of E3
required
for inhibiting PKR. We propose that binding of the
N-terminal
half of E3 to the kinase domain of PKR is also crucial for
preventing
eIF2

phosphorylation by
PKR.
 |
DISCUSSION |
It is generally thought that E3 inhibits PKR solely by
sequestering dsRNA molecules required for activation of PKR function. We questioned whether this was its only mode of action after finding that E3 could inhibit PKR in yeast, because previous observations with
dominant-negative PKR alleles had suggested that dsRNA
activators are very abundant in yeast cells (40). We
considered an alternative possibility in which the complete inhibition
of PKR by E3 would additionally require complex formation by the two
proteins. Consistent with this possibility, E3 inhibitory activity was
reversed by coexpressing the mutant PKR-K296R protein along with
wild-type PKR (Fig. 1B and C). If E3 inhibited PKR in yeast solely
by sequestering dsRNA, then overexpression of PKR-K296R should enhance
rather than antagonize E3 by further reducing the levels of free
dsRNA. Instead, we propose that overexpression of PKR-K296R
displaced E3 from wild-type PKR, forming inactive PKR-K296R-E3
complexes and partially functional PKR/PKR-K296R dimers.
Additional evidence for a second mode of E3 function came from the fact
that mutations in the N-terminal half of E3, including a single alanine
substitution at Trp-66, led to complete loss of its anti-PKR function
in yeast. Chang and Jacobs reported that deletion of the
N-terminal 83 residues of E3 did not affect its ability to bind dsRNA
in vitro (8). Ho and Shuman showed that the apparent
dissociation constants for dsRNA bound by full-length E3 and a
fragment containing only the C-terminal 90 residues were virtually
identical (22), indicating that the N-terminal half of
E3 makes no contribution to the binding affinity of E3 for dsRNA in
vitro. We found that the K167A,R168A double mutation in the E3 DRBM
abolished in vitro binding of GST-E3-
7-86 to PKR, indicating
that dsRNA binding by E3 is required for its interaction with PKR.
In contrast, the
7-86 mutation in the N-terminal half of E3 had no
effect on GST-E3 binding to PKR (Fig. 7), implying that the
7-86
mutation does not reduce dsRNA binding by E3 in vitro. The same
conclusion can be drawn from the fact that coimmunoprecipitation of PKR
with E3 was abolished by the K167A and R168A mutations but unaffected
by the W66A mutation in E3, indicating that the latter mutation did not
impair dsRNA binding by E3 in vivo (Fig. 5). Similarly, the W66A,
60-82, and
7-86 mutations did not impair the in vivo interaction
of E3 with PKR-
243-551 in the two-hybrid assay, whereas
E3-K167A,R168A failed to interact with this PKR segment. Combined with
the previous results of Ho and Shuman, these observations indicate that
the N-terminal half of E3, and Trp-66 in particular, does not
contribute to dsRNA binding in vitro or in vivo and thus is
involved in a distinct aspect of E3 anti-PKR function.
Using four different assays for protein-protein interactions, we
obtained strong evidence for heterocomplex formation by PKR and E3. The
assay of greatest physiological relevance, coimmunoprecipitation from
yeast extracts, suggested that a majority of the PKR molecules in yeast
were physically associated with E3 in a manner dependent on the dsRNA
binding activity of E3. The yeast two-hybrid and GST pull-down
assays revealed complex formation between the C-terminal half of E3 and
the N-terminal half of PKR, the segments containing their DRBMs, and
this interaction also depended on dsRNA binding by the E3 partner.
These observations, plus the fact that binding between
PKR-
243-551 and E3-
7-86,K167A,R168A was rescued by high concentrations of dsRNA, indicated that complex formation is critically dependent on the DRBM-containing segments of both proteins and dsRNA
binding by E3. Because the N-terminal half of E3 was not essential
for coimmunoprecipitation of PKR with E3, we suggest that
protein-protein contacts involving the DRBM-containing segments, plus
mutual binding to the same dsRNA molecules, make the most important
contributions to the stability of these E3-PKR-dsRNA complexes in vivo
(Fig. 11). Similar protein contacts via
DRBMs have been proposed to explain dimerization by PKR N-terminal
segments, and heterocomplex formation by PKR and TRBP, in cases where
the DRBMs contained point mutations that abolish dsRNA binding in vitro (4, 12, 35, 37, 38, 50). In addition, the purified E3
DRBM dimerizes in solution (22), and purified segments
containing the DRBMs of PKR (41) or E3 (22) each
show cooperative binding to dsRNA in vitro, indicating the
existence of protein-protein interactions by DRBMs bound to the same
dsRNA molecules.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 11.
Hypothetical model for inhibition of PKR function by E3
through the formation of inactive heteromeric complexes. PKR is shown
schematically with its two DRBMs (R) connected by a linker to the
dimerization domain located between residues 244 and 296 (shown as a
rectangle) and the N-terminal and C-terminal lobes of the kinase domain
(depicted as two ovals). E3 is depicted with its single DRBM (R)
hatched and the N-terminal domain (N) shaded. The active form of PKR is
depicted as a dimer bound to dsRNA (28, 31, 40), with
dimerization mediated by interactions involving the N-terminal region
containing the DRBMs (12, 37, 48, 50), the kinase domain
(37, 40), and the region from residues 244 to 296 (48) and by binding to the same dsRNA molecule (12,
37, 51). E3 is shown inhibiting PKR by forming inactive
heterocomplexes, disrupting PKR homodimers. In addition, the N-terminal
domain of E3 is shown interacting with the kinase domain of PKR,
interfering with some aspect of kinase function. Binding to dsRNA by E3
greatly contributes to the stability of the PKR-E3 complex. E3 can also
inhibit kinase activation by sequestering dsRNA molecules. See text for
details.
|
|
The fact that coimmunoprecipitation of PKR with E3 was dependent on
Lys-167 and Arg-168 in the E3 DRBM suggests that PKR resides in
heteromeric complexes containing both E3 and dsRNA. This seems at
odds with the dsRNA sequestration model, in which E3 prevents PKR from
interacting with dsRNA, and more consistent with the notion that E3
inhibits PKR via heterocomplex formation. It could be argued that E3
and PKR do not directly interact with one another in these complexes
but simply bind independently to the same dsRNA molecules. To explain
our coimmunoprecipitation results by this hypothesis, the numbers of
dsRNA and E3 molecules would have to be nearly equivalent in yeast
cells. If dsRNA molecules were in large molar excess of E3, then PKR
would most frequently bind to dsRNA molecules lacking E3. If E3 was in
large molar excess of dsRNA, it would compete with PKR for limited
dsRNA binding sites (as suggested by the dsRNA sequestration
model). In either case, most of the PKR would not be physically linked
with E3. It is conceivable that the dsRNAs are long enough to
accommodate multiple protein molecules and that the prevailing E3/PKR
ratio is such that most of the PKR is bound to dsRNAs containing at least one molecule of E3 without postulating protein-protein contacts between E3 and PKR. Even if this were true, however, it would still be
necessary to propose a second function for E3 besides sequestration of
dsRNA to explain why the PKR molecules bound to dsRNA in heteromeric
complexes with E3 are catalytically inactive.
Another argument in favor of protein-protein contacts between E3 and
PKR comes from the fact that expression of E3 displaced PKR from
ribosomes even though it appeared that most of the wild-type E3 was
not stably bound to ribosomes (Fig. 10B). If E3 was competing with PKR
for dsRNA binding sites in rRNA, one would expect to find a large
fraction of E3 associated with ribosomes. A possible objection to this
interpretation could be that E3 was produced in large excess of the
ribosomes, such that all dsRNA binding sites in rRNA would be bound
by E3 even though most of the E3 was nonribosomal. This seems unlikely
considering that a greater fraction of E3-
7-86 than of wild-type
E3 was bound to ribosomes (Fig. 10B and D), with no differences in the
overall levels of these two proteins (Fig. 2C). We suggest that
E3-PKR heterocomplexes interact with ribosomes less efficiently than do
PKR monomers or homodimers, although the molecular explanation for this
difference in binding remains to be elucidated.
Results from coimmunoprecipitation and two-hybrid assays indicating
that deletion of the N-terminal half of E3 decreased the yield of
E3-PKR complexes provided evidence for E3-PKR interactions involving
the N-terminal half of E3 and PKR. Direct interaction of the isolated
N-terminal half of E3 with PKR was detected in both the yeast
two-hybrid and
dimerization assays. Results of the latter
experiments localized the interaction to the kinase domain of PKR and
revealed a dependence on Trp-66, the E3 residue critically required for
its anti-PKR function in yeast. Based on these findings, we suggest
that the N-terminal half of E3 binds to the PKR kinase domain in a
manner that interferes with kinase activation or catalysis and is
tethered to PKR through interactions between their DRBMs and mutual
binding to the same dsRNA molecules (Fig. 11). From the results of
the
dimerization assays, it could be proposed that the N-terminal
half of E3 impedes dimerization of PKR via segment 244-296, as
suggested previously for P58IPK (48).
Interestingly, Trp-66 resides within the largest stretch of amino acids
shared between E3 and the parapoxvirus orf virus OV20.0L gene product,
a DRBM-containing PKR inhibitor that is 31% identical to E3
(21). Thus, the importance of the N-terminal half of E3 for
inhibition of PKR may be a conserved feature of these related proteins.
Our model for E3 action (Fig. 11) combines mechanisms of PKR
inhibitors which bind to the kinase domain, including
hepatitis c virus NS5A (20), baculovirus
Autographa californica PK2 (17),
P58IPK, and vaccinia virus K3 protein, with that of TRBP,
which forms heterodimers with PKR through interactions between their
respective DRBMs (4). K3, also encoded by vaccinia virus,
functions as a pseudosubstrate inhibitor by binding to PKR (5,
13, 27) between kinase subdomains VI and XI (12, 13,
19).
We could not confirm a physical interaction between the N-terminal half
of E3 and PKR in the GST pull-down assays. Moreover, the N-terminal
half of E3 interacted with full-length PKR but not with the isolated
kinase domain in the yeast two-hybrid experiments. Finally, in the
dimerization assay, the N-terminal half of E3 was dispensable for
the interaction between E3 and full-length PKR even though it
interacted with the isolated kinase domain in this assay. These
discrepancies concerning interactions of the E3 N-terminal half and the
PKR kinase domain could reflect a high off rate for this interaction;
alternatively, it might be impaired by juxtaposition of E3 with GST or
the GAL4 BD in certain protein fusions where it failed to interact with
PKR. In agreement with the latter suggestion, Sharp et al. observed a
significant interaction between full-length E3 and PKR kinase domain
segment 367-551 in the two-hybrid assay when these segments were fused
to the GAL4 AD and BD, respectively, but not when the fusions were
constructed vice versa (42). They also reported that
radiolabeled full-length E3 bound to the PKR kinase domain segment
242-551, but not to the larger PKR segment 99-551. Interestingly, the interaction between E3 and PKR segment 242-551 was competed with unlabeled E3, eIF2
, or K3 proteins (42). These
last findings imply that E3 and K3 have overlapping binding sites
in the C-terminal lobe of the PKR kinase domain.
E3 is localized in both the nucleus and the cytoplasm of vaccinia
virus-infected cells (53), and nuclear localization is dependent on its N-terminal domain (9). This finding led us to consider that the N-terminal half of E3 might function by
sequestration of E3-PKR heterodimers in the nucleus. Using
indirect immunofluorescence and monoclonal antibodies against
PKR and HA-tagged E3, we found that both proteins were
localized in the cytoplasm whether expressed individually or
coexpressed in the same yeast cells (data not shown). Thus, we have no
evidence that E3 inhibits the ability of PKR to phosphorylate eIF2
by sequestering it in the nucleus. It is conceivable, however, that the
N-terminal half of E3 leads to sequestration of PKR in
cytoplasmic aggregates where it cannot interact efficiently with eIF2.
The previous finding that the ability of E3 to inhibit PKR in
cell extracts could be partially reversed by adding large amounts of dsRNA (1, 14, 26) was an important observation indicating that E3 inhibits PKR by sequestering dsRNA activators. Can this result
be reconciled with our proposal that E3 inhibits PKR by heterocomplex
formation? One possibility is that an E3 dimer is required to interact
with each PKR monomer to prevent PKR dimerization (Fig. 11), and that
E3 dimers would be dissociated (through binding to separate
dsRNA molecules) at dsRNA concentrations lower than required
to dissociate PKR dimers. In accordance with the latter stipulation,
certain mutations in the PKR DRBMs that abolish dsRNA binding
activity do not eliminate dimer formation (12, 35, 37, 38,
50), whereas we showed that E3 must bind dsRNA to interact
stably with PKR. Thus, the protein-protein contacts may be
stronger or more extensive in a PKR dimer than in an E3 dimer.
Deletion of the N-terminal 83 amino acids of E3 did not affect its
ability to confer upon vaccinia virus interferon resistance during
infections of RK-13 cells and the ability to replicate in HeLa cells
(45). These findings suggest that inhibition of PKR by E3 in
these cells requires only sequestration of dsRNA activators. There is
evidence, cited above, that E3 can prevent PKR activation in vitro by
sequestering dsRNA activators. Because the DRBMs in E3 and PKR bind
dsRNA with comparable affinities (22, 41), the dsRNA
sequestration mechanism requires that E3 be produced in large molar
excess of both PKR and dsRNA activators. Presumably, these conditions
were satisfied in RK-13 and HeLa cells, where a vaccinia virus mutant
lacking the N-terminal domain of E3 could prevent PKR activation
(45). It is possible that these conditions were not met in
our yeast strains because they contain endogenous dsRNAs in
considerable excess of the E3 protein being produced. Consequently, the
E3 DRBM alone could not prevent PKR activation, and the N-terminal
domain was additionally required for full inhibition of PKR function in
the context of E3-PKR heterocomplexes. This latter mechanism could be
important during viral infections when the concentration of dsRNA is
very high, allowing E3 to block PKR activation even when it cannot
completely prevent the occurrence of some free dsRNA. Another
possibility is that the N-terminal half of E3 is required to prevent
PKR activation by a dsRNA-independent mechanism that might operate in
yeast and, presumably, in certain mammalian cells. At least in yeast,
this would require that the PKRDRBMs are needed primarily for
dimerization rather than dsRNA binding. Based on the findings in
this paper, it will be interesting to examine the effects of N-terminal
mutations in E3 on virus propagation in different cell types and during
a systemic infection of the natural animal host.
 |
ACKNOWLEDGMENTS |
We thank Tyson Sharp and Rosemary Jagus for extensive discussion
of results prior to publication and Bobbie Felix for help in
preparation of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Eukaryotic Gene Regulation, National Institute of Child Health & Human Development, Bldg. 6A, Room B1A-13A, Bethesda, MD 20892. Phone: (301)
496-4480. Fax: (301) 496-6828. E-mail: ahinnebusch{at}nih.gov.
Present address: Small Molecule Therapeutics, Inc., Monmouth
Junction, NJ 08852.
 |
REFERENCES |
| 1.
|
Akkaraju, G. R.,
P. Whitaker-Dowling,
I. S. Younger, and R. Jagus.
1989.
Vaccinia specific kinase inhibitory factor prevents translational inhibition by double-stranded RNA in rabbit reticulocyte lysate.
J. Biol. Chem.
264:10321-10325[Abstract/Free Full Text].
|
| 2.
|
Beattie, E.,
K. L. Denzler,
J. Tartaglia,
M. E. Perkus,
E. Paoletti, and B. L. Jacobs.
1995.
Reversal of the interferon-sensitive phenotype of a vaccinia virus lacking E3L by expression of the reovirus S4 gene.
J. Virol.
69:499-505[Abstract].
|
| 3.
|
Beattie, E.,
E. Paoletti, and J. Tartaglia.
1995.
Distinct patterns of IFN sensitivity observed in cells infected with vaccinia K3L and E3L mutant viruses.
Virology
210:254-263[Medline].
|
| 4.
|
Benkirane, M.,
C. Neuveut,
R. F. Chun,
S. M. Smith,
C. E. Samuel,
A. Gatignol, and K. T. Jeang.
1997.
Oncogenic potential of TAR RNA binding protein TRBP and its regulatory interaction with RNA-dependent protein kinase PKR.
EMBO J.
16:611-624[Medline].
|
| 4a.
|
Carpick, B. W.,
V. Graziano,
D. Schneider,
R. K. Maitra,
X. Lee, and B. R. G. Williams.
1997.
Characterization of the solution complex between the interferon-induced, double-stranded RNA-activated protein kinase and HIV-1 trans-activating region RNA.
J. Biol. Chem.
272:9510-9516[Abstract/Free Full Text].
|
| 5.
|
Carroll, K.,
O. Elroy-Stein,
B. Moss, and R. Jagus.
1993.
Recombinant vaccinia virus K3L gene product prevents activation of double-stranded RNA-dependent, initiation factor 2 -specific protein kinase.
J. Biol. Chem.
268:12837-12842[Abstract/Free Full Text].
|
| 6.
|
Cesareni, G., and J. A. H. Murray.
1987.
Plasmid vectors carrying the replication origin of filamentous single-stranded phages, p. 135-154.
In
J. K. Setlow, and A. Hollaender (ed.), Genetic engineering: principals and methods, vol. 9. Plenum Press, New York, N.Y.
|
| 7.
|
Chang, H. W.,
J. C. Watson, and B. L. Jacobs.
1992.
The E3L gene of vaccinia virus encodes an inhibitor of the interferon-induced, double-stranded RNA-dependent protein kinase.
Proc. Natl. Acad. Sci. USA
89:4825-4829[Abstract/Free Full Text].
|
| 8.
|
Chang, H.-W., and B. L. Jacobs.
1993.
Identification of a conserved motif that is necessary for binding of the vaccinia virus E3L gene products to double-stranded.
Virology
194:537-547[Medline].
|
| 9.
|
Chang, H.-W.,
L. H. Uribe, and B. L. Jacobs.
1995.
Rescue of vaccinia virus lacking the E3L gene by mutants of E3L.
J. Virol.
69:6605-6608[Abstract].
|
| 10.
|
Chong, K. L.,
L. Feng,
K. Schappert,
E. Meurs,
T. F. Donahue,
J. D. Friesen,
A. G. Hovanessian, and B. R. G. Williams.
1992.
Human p68 kinase exhibits growth suppression in yeast and homology to the translational regulator GCN2.
EMBO J.
11:1553-1562[Medline].
|
| 11.
|
Clemens, M. J.
1996.
Protein kinases that phosphorylate eIF2 and eIF2B, and their role in eukaryotic cell translational control, p. 139-172.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 12.
|
Cosentino, G. P.,
S. Venkatesan,
F. C. Serluca,
S. R. Green,
M. B. Mathews, and N. Sonenberg.
1995.
Double-stranded-RNA-dependent protein kinase and TAR RNA-binding protein form homo- and heterodimers in vivo.
Proc. Natl. Acad. Sci. USA
92:9445-9449[Abstract/Free Full Text].
|
| 13.
|
Craig, A. W. B.,
G. P. Cosentino,
O. Donze, and N. Sonenberg.
1996.
The kinase insert domain of interferon-induced protein kinase PKR is required for activity but not for interaction with the pseudosubstrate K3L.
J. Biol. Chem.
271:24526-24533[Abstract/Free Full Text].
|
| 14.
|
Davies, M. V.,
H. W. Chang,
B. L. Jacobs, and R. J. Kaufman.
1993.
The E3L and K3L vaccinia virus gene products stimulate translation through inhibition of the double-stranded RNA-dependent protein kinase by different mechanisms.
J. Virol.
67:1688-1692[Abstract/Free Full Text].
|
| 15.
|
Dever, T. E.,
J. J. Chen,
G. N. Barber,
A. M. Cigan,
L. Feng,
T. F. Donahue,
I. M. London,
M. G. Katze, and A. G. Hinnebusch.
1993.
Mammalian eukaryotic initiation factor 2 kinases functionally substitute for GCN2 in the GCN4 translational control mechanism of yeast.
Proc. Natl. Acad. Sci. USA
90:4616-4620[Abstract/Free Full Text].
|
| 16.
|
Dever, T. E.,
L. Feng,
R. C. Wek,
A. M. Cigan,
T. D. Donahue, and A. G. Hinnebusch.
1992.
Phosphorylation of initiation factor 2 by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast.
Cell
68:585-596[Medline].
|
| 17.
|
Dever, T. E.,
R. Sripriya,
J. R. McLachlin,
J. Lu,
J. R. Fabian,
S. R. Kimball, and L. K. Miller.
1998.
Disruption of cellular translational control by a viral truncated eukaryotic translation initiation factor 2 kinase homolog.
Proc. Natl. Acad. Sci. USA
95:4164-4169[Abstract/Free Full Text].
|
| 18.
|
Feilotter, H. E.,
G. J. Hannon,
C. J. Ruddell, and D. Beach.
1994.
Construction of an improved host strain for two hybrid screening.
Nucleic Acids Res.
22:1502-1503[Free Full Text].
|
| 19.
|
Gale, M.,
S.-L. Tan,
M. Wambach, and M. G. Katze.
1996.
Interaction of the interferon-induced PKR protein kinase with inhibitory proteins P58IPK and vaccinia virus K3L is mediated by unique domains: implications for kinase regulation.
Mol. Cell. Biol.
16:4172-4181[Abstract].
|
| 20.
|
Gale, M. J.,
M. J. Korth,
N. M. Tang,
S. L. Tab,
D. A. Hopkins,
T. E. Dever,
S. J. Polyak,
D. R. Gretch, and M. G. Katze.
1997.
Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein.
Virology
230:217-227[Medline].
|
| 21.
|
Haig, D. M.,
C. J. McInnes,
J. Thomson,
A. Wood,
K. Bunyan, and A. Mercer.
1998.
The orf virus OV20.0L gene product is involved in interferon resistance and inhibits an interferon-inducible, double-stranded RNA-dependent kinase.
Immunology
93:335-340[Medline].
|
| 22.
|
Ho, C. K., and S. Shuman.
1996.
Physical and functional characterization of the double-stranded RNA binding protein encoded by the vaccinia virus E3 gene.
Virology
217:272-284[Medline].
|
| 23.
|
Hu, J. C.,
E. K. O'Shea,
P. S. Kim, and R. T. Sauer.
1990.
Sequence requirements for coiled coils: analysis with lambda repressor-GCN4 leucine zipper fusions.
Science
250:1400-1403[Abstract/Free Full Text].
|
| 24.
|
Hunter, T.,
T. Hunt,
R. J. Jackson, and H. D. Robertson.
1975.
The characteristics of inhibition of protein synthesis by double-stranded ribonucleic acid in reticulocyte lysates.
J. Biol. Chem.
250:409-417[Abstract/Free Full Text].
|
| 25.
|
Ito, H.,
Y. Fukada,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 26.
|
Jagus, R., and M. M. Gray.
1994.
Proteins that interact with PKR.
Biochimie
76:779-791[Medline].
|
| 27.
|
Kawagishi-Kobayashi, M.,
J. B. Silverman,
T. K. Ung, and T. E. Dever.
1997.
Regulation of the protein kinase PKR by the vaccinia virus pseudosubstrate inhibitor K3L is dependent on residues conserved between the K3L protein and the PKR substrate eIF2 .
Mol. Cell. Biol.
17:4146-4158[Abstract].
|
| 28.
|
Kostura, M., and M. B. Mathews.
1989.
Purification and activation of the double-stranded RNA-dependent eIF-2 kinase DAI.
Mol. Cell. Biol.
9:1576-1586[Abstract/Free Full Text].
|
| 29.
|
Kozak, M.
1983.
Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles.
Microbiol. Rev.
47:1-45[Free Full Text].
|
| 30.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 31.
|
Langland, J. O., and B. L. Jacobs.
1992.
Cytosolic double-stranded RNA-dependent protein kinase is likely a dimer of partially phosphorylated Mr = 66,000 subunits.
J. Biol. Chem.
267:10729-10736[Abstract/Free Full Text].
|
| 32.
|
Langland, J. O.,
S. M. Pettiford,
B. Jiang, and B. L. Jacobs.
1994.
Products of the porcine N5P3 gene bind specifically to double-stranded RNA and inhibit activation of the interferon-induced protein kinase, PKR.
J. Virol.
68:3821-3829[Abstract/Free Full Text].
|
| 33.
|
Mathews, M. B.
1993.
Viral evasion of cellular defense mechanisms: regulation of the protein kinase DAI by RNA effectors.
Semin. Virol.
4:247-257.
|
| 34.
|
McMillan, N. A.,
B. W. Carpick,
B. Hollis,
W. M. Toone,
M. Zamanian-Daryoush, and B. R. G. Williams.
1995.
Mutational analysis of the double-stranded RNA (dsRNA) binding domain of the dsRNA-activated protein kinase, PKR.
J. Biol. Chem.
270:2601-2606[Abstract/Free Full Text].
|
| 35.
|
Ortega, L. G.,
M. D. McCotter,
G. L. Henry,
S. J. McCormack,
D. C. Thomis, and C. E. Samuel.
1996.
Mechanism of interferon action. Biochemical and genetic evidence for the intermolecular association of the RNA-dependent protein kinase PkR from human cells.
Virology
215:31-39[Medline].
|
| 36.
|
Park, H.,
M. V. Davies,
J. O. Langland,
H. W. Chang,
Y. S. Nam,
J. Tartaglia,
E. Paoletti,
B. L. Jacobs,
R. J. Kaufman, and S. Venkatesan.
1994.
TAR RNA-binding protein is an inhibitor of the interferon-induced protein kinase PKR.
Proc. Natl. Acad. Sci. USA
91:4713-4717[Abstract/Free Full Text].
|
| 37.
|
Patel, R. C.,
P. Stanton,
N. M. J. McMillan,
B. R. G. Williams, and G. C. Sen.
1995.
The interferon-inducible double-stranded RNA-activated protein kinase self-associates in vitro and in vivo.
Proc. Natl. Acad. Sci. USA
92:8283-8287[Abstract/Free Full Text].
|
| 38.
|
Patel, R. C.,
P. Stanton, and G. C. Sen.
1996.
Specific mutations near the amino terminus of double-stranded RNA-dependent protein kinase (PKR) differentially affect its double-stranded RNA binding and dimerization properties.
J. Biol. Chem.
271:25657-25663[Abstract/Free Full Text].
|
| 39.
|
Pavitt, G. D.,
W. Yang, and A. G. Hinnebusch.
1997.
Homologous segments in three subunits of the guanine nucleotide exchange factor eIF2B mediate translational regulation by phosphorylation of eIF2.
Mol. Cell. Biol.
17:1298-1313[Abstract].
|
| 40.
|
Romano, P. R.,
S. R. Green,
G. N. Barber,
M. B. Mathews, and A. G. Hinnebusch.
1995.
Structural requirements for double-stranded RNA binding, dimerization, and activation of the human eIF-2 kinase DAI in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:365-378[Abstract].
|
| 41.
|
Schmedt, C.,
S. R. Green,
L. Manche,
D. R. Taylor,
Y. Ma, and M. B. Mathews.
1995.
Functional characterization of the RNA-binding domain and motif of the double-stranded RNA-dependent protein kinase DAI (PKR).
J. Mol. Biol.
249:29-44[Medline].
|
| 42.
| Sharp, T. V., A. Romashko, F. Moonan, B. Joshi,
G. N. Barber, and R. Jagus. The vaccinia virus E3L gene
product interacts with both the regulatory and substrate binding
regions of PKR: implications for PKR autoregulation. Virology, in
press.
|
| 43.
|
Sherman, F.,
G. R. Fink, and C. W. Lawrence.
1974.
Methods of yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 44.
|
Shors, T., and B. L. Jacobs.
1997.
Complementation of deletion of the vaccinia virus E3L gene by the Escherichia coli RNase III gene.
Virology
227:77-87[Medline].
|
| 45.
|
Shors, T.,
K. V. Kibler,
K. B. Perkins,
R. Seidler-Wulff,
M. P. Banaszak, and B. L. Jacobs.
1997.
Complementation of vaccinia virus deleted of the E3L gene by mutants of E3L.
Virology
239:269-272[Medline].
|
| 46.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 47.
|
St Johnston, D.,
N. H. Brown,
J. G. Gall, and M. Jantsch.
1992.
A conserved double-stranded RNA-binding domain.
Proc. Natl. Acad. Sci. USA
89:10979-10983[Abstract/Free Full Text].
|
| 48.
|
Tan, S. L.,
M. J. Gale, and M. G. Katze.
1998.
Double-stranded RNA-independent dimerization of the interferon-induced protein kinase PKR and inhibition of dimerization by the cellular P58IPK inhibitor.
Mol. Cell. Biol.
18:2431-2443[Abstract/Free Full Text].
|
| 49.
|
Watson, J. C.,
H. W. Chang, and B. L. Jacobs.
1991.
Characterization of a vaccinia virus-encoded double-stranded RNA-binding protein that may be involved in inhibition of the double-stranded RNA-dependent protein kinase.
Virology
185:206-216[Medline].
|
| 50.
|
Wu, S., and R. J. Kaufman.
1996.
Double-stranded (ds) RNA binding and not dimerization correlates with the activation of the dsRNA-dependent protein kinase (PKR).
J. Biol. Chem.
271:1756-1763[Abstract/Free Full Text].
|
| 51.
|
Wu, S., and R. J. Kaufman.
1997.
A model for the double-stranded RNA (dsRNA)-dependent dimerization and activation of the dsRNA-activated protein kinase PKR.
J. Biol. Chem.
272:1291-1296[Abstract/Free Full Text].
|
| 52.
|
Yon, J., and M. Fried.
1988.
Precise gene fusion by PCR.
Nucleic Acids Res.
17:4895[Free Full Text].
|
| 53.
|
Yuwen, H.,
J. H. Cox,
J. W. Yewdell,
J. R. Bennink, and B. Moss.
1993.
Nuclear localization of a double-stranded RNA-binding protein encoded by the vaccinia virus E3L gene.
Virology
195:732-744[Medline].
|
| 54.
|
Zhu, S.,
P. R. Romano, and R. C. Wek.
1997.
Ribosome targeting of PKR is mediated by two double-stranded RNA-binding domains and facilitates in vivo phosphorylation of eukaryotic initiation factor-2.
J. Biol. Chem.
272:14434-14441[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1998, p. 7304-7316, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Myskiw, C., Arsenio, J., van Bruggen, R., Deschambault, Y., Cao, J.
(2009). Vaccinia Virus E3 Suppresses Expression of Diverse Cytokines through Inhibition of the PKR, NF-{kappa}B, and IRF3 Pathways. J. Virol.
83: 6757-6768
[Abstract]
[Full Text]
-
Short, J. A.L.
(2009). Viral evasion of interferon stimulated genes. Bioscience Horizons
2: 212-224
[Abstract]
[Full Text]
-
Child, S. J., Geballe, A. P.
(2009). Binding and Relocalization of Protein Kinase R by Murine Cytomegalovirus. J. Virol.
83: 1790-1799
[Abstract]
[Full Text]
-
Deng, L., Dai, P., Parikh, T., Cao, H., Bhoj, V., Sun, Q., Chen, Z., Merghoub, T., Houghton, A., Shuman, S.
(2008). Vaccinia Virus Subverts a Mitochondrial Antiviral Signaling Protein-Dependent Innate Immune Response in Keratinocytes through Its Double-Stranded RNA Binding Protein, E3. J. Virol.
82: 10735-10746
[Abstract]
[Full Text]
-
Zhang, P., Jacobs, B. L., Samuel, C. E.
(2008). Loss of Protein Kinase PKR Expression in Human HeLa Cells Complements the Vaccinia Virus E3L Deletion Mutant Phenotype by Restoration of Viral Protein Synthesis. J. Virol.
82: 840-848
[Abstract]
[Full Text]
-
Domingo-Gil, E., Perez-Jimenez, E., Ventoso, I., Najera, J. L., Esteban, M.
(2008). Expression of the E3L Gene of Vaccinia Virus in Transgenic Mice Decreases Host Resistance to Vaccinia Virus and Leishmania major Infections. J. Virol.
82: 254-267
[Abstract]
[Full Text]
-
Van Quyen, D., Ha, S. C., Lowenhaupt, K., Rich, A., Kim, K. K., Kim, Y.-G.
(2007). Characterization of DNA-binding activity of Z{alpha} domains from poxviruses and the importance of the -wing regions in converting B-DNA to Z-DNA. Nucleic Acids Res
35: 7714-7720
[Abstract]
[Full Text]
-
Guerra, S., Najera, J. L., Gonzalez, J. M., Lopez-Fernandez, L. A., Climent, N., Gatell, J. M., Gallart, T., Esteban, M.
(2007). Distinct Gene Expression Profiling after Infection of Immature Human Monocyte-Derived Dendritic Cells by the Attenuated Poxvirus Vectors MVA and NYVAC. J. Virol.
81: 8707-8721
[Abstract]
[Full Text]
-
Fenner, B. J., Goh, W., Kwang, J.
(2007). Dissection of Double-Stranded RNA Binding Protein B2 from Betanodavirus. J. Virol.
81: 5449-5459
[Abstract]
[Full Text]
-
Ostertag, D., Hoblitzell-Ostertag, T. M., Perrault, J.
(2007). Overproduction of Double-Stranded RNA in Vesicular Stomatitis Virus-Infected Cells Activates a Constitutive Cell-Type-Specific Antiviral Response. J. Virol.
81: 503-513
[Abstract]
[Full Text]
-
Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M.
(2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev.
70: 1032-1060
[Abstract]
[Full Text]
-
Hakki, M., Marshall, E. E., De Niro, K. L., Geballe, A. P.
(2006). Binding and Nuclear Relocalization of Protein Kinase R by Human Cytomegalovirus TRS1. J. Virol.
80: 11817-11826
[Abstract]
[Full Text]
-
Deng, L., Dai, P., Ding, W., Granstein, R. D., Shuman, S.
(2006). Vaccinia virus infection attenuates innate immune responses and antigen presentation by epidermal dendritic cells.. J. Virol.
80: 9977-9987
[Abstract]
[Full Text]
-
Langland, J. O., Kash, J. C., Carter, V., Thomas, M. J., Katze, M. G., Jacobs, B. L.
(2006). Suppression of Proinflammatory Signal Transduction and Gene Expression by the Dual Nucleic Acid Binding Domains of the Vaccinia Virus E3L Proteins.. J. Virol.
80: 10083-10095
[Abstract]
[Full Text]
-
Child, S. J., Hanson, L. K., Brown, C. E., Janzen, D. M., Geballe, A. P.
(2006). Double-Stranded RNA Binding by a Heterodimeric Complex of Murine Cytomegalovirus m142 and m143 Proteins.. J. Virol.
80: 10173-10180
[Abstract]
[Full Text]
-
Mulvey, M., Arias, C., Mohr, I.
(2006). Resistance of mRNA translation to acute endoplasmic reticulum stress-inducing agents in herpes simplex virus type 1-infected cells requires multiple virus-encoded functions.. J. Virol.
80: 7354-7363
[Abstract]
[Full Text]
-
Guerra, S., Lopez-Fernandez, L. A., Garcia, M. A., Zaballos, A., Esteban, M.
(2006). Human Gene Profiling in Response to the Active Protein Kinase, Interferon-induced Serine/threonine Protein Kinase (PKR), in Infected Cells: INVOLVEMENT OF THE TRANSCRIPTION FACTOR ATF-3 IN PKR-INDUCED APOPTOSIS. J. Biol. Chem.
281: 18734-18745
[Abstract]
[Full Text]
-
Cardenas, W. B., Loo, Y.-M., Gale, M. Jr., Hartman, A. L., Kimberlin, C. R., Martinez-Sobrido, L., Saphire, E. O., Basler, C. F.
(2006). Ebola Virus VP35 Protein Binds Double-Stranded RNA and Inhibits Alpha/Beta Interferon Production Induced by RIG-I Signaling.. J. Virol.
80: 5168-5178
[Abstract]
[Full Text]
-
Kwon, J.-A., Rich, A.
(2005). Biological function of the vaccinia virus Z-DNA-binding protein E3L: Gene transactivation and antiapoptotic activity in HeLa cells. Proc. Natl. Acad. Sci. USA
102: 12759-12764
[Abstract]
[Full Text]
-
Nie, Y., Ding, L., Kao, P. N., Braun, R., Yang, J.-H.
(2005). ADAR1 Interacts with NF90 through Double-Stranded RNA and Regulates NF90-Mediated Gene Expression Independently of RNA Editing. Mol. Cell. Biol.
25: 6956-6963
[Abstract]
[Full Text]
-
Hakki, M., Geballe, A. P.
(2005). Double-Stranded RNA Binding by Human Cytomegalovirus pTRS1. J. Virol.
79: 7311-7318
[Abstract]
[Full Text]
-
Hung, M.-L., Chao, P., Chang, K.-Y.
(2003). dsRBM1 and a proline-rich domain of RNA helicase A can form a composite binder to recognize a specific dsDNA. Nucleic Acids Res
31: 5741-5753
[Abstract]
[Full Text]
-
Hornemann, S., Harlin, O., Staib, C., Kisling, S., Erfle, V., Kaspers, B., Hacker, G., Sutter, G.
(2003). Replication of Modified Vaccinia Virus Ankara in Primary Chicken Embryo Fibroblasts Requires Expression of the Interferon Resistance Gene E3L. J. Virol.
77: 8394-8407
[Abstract]
[Full Text]
-
Kim, Y.-G., Muralinath, M., Brandt, T., Pearcy, M., Hauns, K., Lowenhaupt, K., Jacobs, B. L., Rich, A.
(2003). A role for Z-DNA binding in vaccinia virus pathogenesis. Proc. Natl. Acad. Sci. USA
100: 6974-6979
[Abstract]
[Full Text]
-
Gonzalez-Lopez, C., Martinez-Costas, J., Esteban, M., Benavente, J.
(2003). Evidence that avian reovirus {sigma}A protein is an inhibitor of the double-stranded RNA-dependent protein kinase. J. Gen. Virol.
84: 1629-1639
[Abstract]
[Full Text]
-
Khoo, D., Perez, C., Mohr, I.
(2002). Characterization of RNA Determinants Recognized by the Arginine- and Proline-Rich Region of Us11, a Herpes Simplex Virus Type 1-Encoded Double-Stranded RNA Binding Protein That Prevents PKR Activation. J. Virol.
76: 11971-11981
[Abstract]
[Full Text]
-
Xiang, Y., Condit, R. C., Vijaysri, S., Jacobs, B., Williams, B. R. G., Silverman, R. H.
(2002). Blockade of Interferon Induction and Action by the E3L Double-Stranded RNA Binding Proteins of Vaccinia Virus. J. Virol.
76: 5251-5259
[Abstract]
[Full Text]
-
Smith, V. P., Alcami, A.
(2002). Inhibition of Interferons by Ectromelia Virus. J. Virol.
76: 1124-1134
[Abstract]
[Full Text]
-
Gil, J., Rullas, J., Alcami, J., Esteban, M.
(2001). MC159L protein from the poxvirus molluscum contagiosum virus inhibits NF-{kappa}B activation and apoptosis induced by PKR. J. Gen. Virol.
82: 3027-3034
[Abstract]
[Full Text]
-
Bergmann, M., Romirer, I., Sachet, M., Fleischhacker, R., Garcia-Sastre, A., Palese, P., Wolff, K., Pehamberger, H., Jakesz, R., Muster, T.
(2001). A Genetically Engineered Influenza A Virus with ras-Dependent Oncolytic Properties. Cancer Res.
61: 8188-8193
[Abstract]
[Full Text]
-
Lane, P., Hao, G., Gross, S. S.
(2001). S-Nitrosylation Is Emerging as a Specific and Fundamental Posttranslational Protein Modification: Head-to-Head Comparison with O-Phosphorylation. Sci Signal
2001: re1-re1
[Abstract]
[Full Text]
-
He, Y., Tan, S.-L., Tareen, S. U., Vijaysri, S., Langland, J. O., Jacobs, B. L., Katze, M. G.
(2001). Regulation of mRNA Translation and Cellular Signaling by Hepatitis C Virus Nonstructural Protein NS5A. J. Virol.
75: 5090-5098
[Abstract]
[Full Text]
-
Brandt, T. A., Jacobs, B. L.
(2001). Both Carboxy- and Amino-Terminal Domains of the Vaccinia Virus Interferon Resistance Gene, E3L, Are Required for Pathogenesis in a Mouse Model. J. Virol.
75: 850-856
[Abstract]
[Full Text]
-
PARKER, L.M., FIERRO-MONTI, I., REICHMAN, T.W., GUNNERY, S., MATHEWS, M.B.
(2001). Double-stranded RNA-binding Proteins and the Control of Protein Synthesis and Cell Growth. Cold Spring Harb Symp Quant Biol
66: 485-498
[Abstract]
-
Poppers, J., Mulvey, M., Khoo, D., Mohr, I.
(2000). Inhibition of PKR Activation by the Proline-Rich RNA Binding Domain of the Herpes Simplex Virus Type 1 Us11 Protein. J. Virol.
74: 11215-11221
[Abstract]
[Full Text]
-
Basler, C. F., Wang, X., Mühlberger, E., Volchkov, V., Paragas, J., Klenk, H.-D., García-Sastre, A., Palese, P.
(2000). The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
10.1073/pnas.220398297v1
[Abstract]
[Full Text]
-
Coolidge, C. J., Patton, J. G.
(2000). A new double-stranded RNA-binding protein that interacts with PKR. Nucleic Acids Res
28: 1407-1417
[Abstract]
[Full Text]
-
Sood, R., Porter, A. C., Olsen, D., Cavener, D. R., Wek, R. C.
(2000). A Mammalian Homologue of GCN2 Protein Kinase Important for Translational Control by Phosphorylation of Eukaryotic Initiation Factor-2{alpha}. Genetics
154: 787-801
[Abstract]
[Full Text]
-
Smith, E. J., Marie, I., Prakash, A., Garcia-Sastre, A., Levy, D. E.
(2001). IRF3 and IRF7 Phosphorylation in Virus-infected Cells Does Not Require Double-stranded RNA-dependent Protein Kinase R or Ikappa B Kinase but Is Blocked by Vaccinia Virus E3L Protein. J. Biol. Chem.
276: 8951-8957
[Abstract]
[Full Text]
-
Zhang, F., Romano, P. R., Nagamura-Inoue, T., Tian, B., Dever, T. E., Mathews, M. B., Ozato, K., Hinnebusch, A. G.
(2001). Binding of Double-stranded RNA to Protein Kinase PKR Is Required for Dimerization and Promotes Critical Autophosphorylation Events in the Activation Loop. J. Biol. Chem.
276: 24946-24958
[Abstract]
[Full Text]
-
Parker, L. M., Fierro-Monti, I., Mathews, M. B.
(2001). Nuclear Factor 90 Is a Substrate and Regulator of the Eukaryotic Initiation Factor 2 Kinase Double-stranded RNA-activated Protein Kinase. J. Biol. Chem.
276: 32522-32530
[Abstract]
[Full Text]
-
Basler, C. F., Wang, X., Muhlberger, E., Volchkov, V., Paragas, J., Klenk, H.-D., Garcia-Sastre, A., Palese, P.
(2000). The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
97: 12289-12294
[Abstract]
[Full Text]