INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Thyroid transcription factor 1 (TTF-1) is a homeodomain protein that was initially identified as a thyroid-specific factor responsible for thyroglobulin (TG) gene transcription (24, 42). It was later shown to be important in the thyroid for maximal and tissue-specific expression of the thyroperoxidase (TPO), thyrotropin (TSH) receptor (TSHR), and sodium iodide symporter (NIS) genes (14, 19, 21, 41, 45, 57), as well as for maximal expression of the major histocompatibility complex (MHC) class I gene (54). In the thyroid, TTF-1 is, therefore, a transcription factor which can regulate the expression of ubiquitous as well as tissue-specific genes. In the thyroid, TSH-cyclic AMP (cAMP) regulates TTF-1 levels and thereby coordinately regulates the above genes. This process decreases MHC class I levels and preserves self-tolerance in the presence of TSH-cAMP-induced increases in the thyroid-specific proteins important for thyrocyte function (30, 45, 54, 57).

TTF-1 was subsequently identified in lung epithelial cells and in neural cells of restricted regions of the brain during studies of thyroid development (34). It was then shown to be essential for the organogenesis of lung, ventral forebrain, and pituitary, as well as thyroid, tissues in knockout experiments (29). TTF-1 is now recognized as regulating surfactant expression in adult lung tissue (12, 67), but its role as a transcription factor regulating adult neural tissues remains unknown. Other than TSH-cAMP, which decreases TTF-1 gene expression in the thyroid (45, 54, 57), nothing is known about ligands or signals which might regulate TTF-1 levels in other tissues.

In the course of in situ hybridization studies examining the role of TTF-1 in thyroid function in adult rat thyroids in vivo, we identified TTF-1 mRNA in parafollicular C cells and in parathyroid cells (61). This observation had not been previously made in developmental or knockout studies (29, 34). We hypothesized that TTF-1 might be a transcription factor regulating genes involved in extracellular Ca²⁺ homeostasis, since this is the dominant function of these two types of cells.

In the present study, we validate this hypothesis by using a parafollicular C-cell model. We suggest that TTF-1 is a sensor of increased or decreased internal Ca²⁺ levels in C cells and that it provides a transcriptional mechanism to coordinately control, by a single transcription factor, multiple genes affecting Ca²⁺ homeostasis within the cell and in the organism. This mechanism is a hitherto-unrecognized transcriptional regulatory path which complements the secretory signal of high extracellular Ca²⁺ levels by enhancing the ability of C cells to detect changes in extracellular Ca²⁺ levels and by replenishing calcitonin stores used to lower extracellular Ca²⁺ levels, thereby rebalancing Ca²⁺ homeostasis (11, 22, 37, 40). This transcriptional regulatory action should, however, be common to all other cells that express both TTF-1 and the Ca²⁺-sensing receptor (CaSR) and whose growth, differentiation, or function is regulated by Ca²⁺, i.e., not only C and parathyroid cells but also keratinocytes, neural cells in the hippocampus, and anterior pituitary cells (8, 13, 18, 36, 61). We speculate that this may also be true of cells expressing TTF-1 but not the CaSR, i.e., thyroid cells, Purkinje cells, and neural cells in the retina. In sum, these data establish an additional and novel functional role for TTF-1.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

In situ hybridization and immunohistochemistry. Nonisotopic in situ hybridization with deparaffinized tissue sections fixed in 4% paraformaldehyde was performed as described previously (59, 61). The riboprobe was a 756-bp SacII fragment (bp 149 to 905) of TTF-1 cDNA that had been subcloned into pBluescript SK() (Stratagene, La Jolla, Calif.). Antisense and sense riboprobes were transcribed in the presence of digoxigenin-11-UTP (Boehringer Mannheim Biochemica, Mannheim, Federal Republic of Germany) with T7 and T3 RNA polymerases, respectively. An indirect immunoperoxidase method was used to identify calcitonin-expressing C cells after TTF-1 in situ hybridization (61). In brief, sections were treated with 3% H₂O₂ and incubated with rabbit anticalcitonin sera (DAKO, Glostrup, Denmark). Preimmune antisera served as controls. After being washed with phosphate-buffered saline (PBS) (pH 7.5), sections were exposed to 1:100 dilutions of horseradish peroxidase-labeled swine anti-rabbit immunoglobulin G (DAKO) and rinsed with PBS before peroxidase activity was detected with 3,3'-diaminobenzidine solution containing 0.003% H₂O₂. All procedures were done at room temperature.

RNA isolation and Northern analysis. RNA was prepared by use of RNeasy Mini Kits (Qiagen Inc.) and minor modifications of the manufacturer's protocol as described previously (60, 61). RNA samples (20 µg, as measured by optical density) were run on denatured agarose gels, capillary blotted on Nytran membranes (11 by 14 cm; Schleicher & Schuell), UV cross-linked, and used for hybridization. Probes were labeled with [³²P]dCTP by use of a Multiprime DNA labeling system (Amersham Life Science Inc.). Membranes were hybridized and washed as described previously (59-61). The rat TTF-1 probe was a 465-bp SacII-BglII fragment excised from a pRcCMV vector (24). The rat -actin probe was prepared by reverse transcription-PCR (RT-PCR) (see below) with FRTL-5 cell total RNA to amplify 220 bp of specific cDNA and then was purified from an agarose gel by use of a Jetsorb Kit (Genomed Inc.). Rat TG, TSHR, and TPO probes were described previously (27, 53). The glyceraldehyde phosphate dehydrogenase (GAPDH) probe was cut from a pTR1-GAPDH-Rat template (Ambion) and subcloned into a pBluescript SK() vector.

RT-PCR. cDNA was synthesized by use of a First Strand cDNA Synthesis Kit (5 Prime  3 Prime, Inc.). PCRs were performed by "touchdown" PCR (16) with a GeneAmp 9600 PCR apparatus (The Perkin-Elmer Corp., Norwalk, Conn.), Pfu DNA polymerase (Stratagene), and the following forward and reverse primer pairs (5'3'): for TTF-1, ACCTTACCAGGACACCATGC and TACTTCTGCTGCTTGAAGCG; for CaSR, ACAAGCCATGATATTCGCC and TTGGATCACTTCGACCACC; for calmodulin III (CAM-III), CTGACTGAAGAGCAGATCGC and TCTGCTGCACTGATGTAGCC; for E-cadherin (E-CAD), AGAAGGAGGTGGAGAAGAAGACC and AGTGAGACCACTATGCAATCTGC; for calcitonin, CTCAGTGAAGAAGAAGCTCGC and GCATGCAGGTACTCAGATTCC; and for rat -actin, AGCCATGTACGTAGCCATCC and TGTGGTGGTGAAGCTGTAGC. In each case, these sequences crossed an intron-exon boundary. PCRs without reverse transcriptase served as negative controls.

Nuclear extracts. A method previously used to prepare nuclear extracts (26) was modified to prepare extracts from small numbers of cells. Cells were washed, scraped into 1 ml of PBS, pelleted in a microcentrifuge, and resuspended in 5 volumes of buffer A (10 mM HEPES-KOH [pH 7.9], 10 mM KCl, 1.5 mM MgCl₂, 0.1 mM EDTA) containing 0.3 M sucrose and 2% Tween 40. To release nuclei, cells were frozen and thawed once and then repetitively pipetted (50 to 100 times) by use of a micropipette with a yellow tip (200-µl capacity). Samples were overlaid on 1 ml of 1.5 M sucrose in buffer A and microcentrifuged for 10 min at 4°C. Pelleted nuclei were washed with 1 ml of buffer A, centrifuged for 30 s, and then resuspended in 50 µl of buffer B (20 mM HEPES-KOH [pH 7.9], 420 mM NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 25% glycerol). Samples were placed on ice for 20 min with occasional vortexing and centrifuged for 20 min at 4°C. The supernatant fraction containing the nuclear protein was divided into aliquots and stored at 70°C. Buffers A and B also contained 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2 ng of pepstatin A per ml, and 2 ng of leupeptin per ml. All procedures were performed on ice or at 4°C.

EMSA. Oligonucleotides were labeled with [-³²P]ATP by use of T4 polynucleotide kinase and then purified on 8% native polyacrylamide gels (26, 57). Electrophoretic mobility shift analysis (EMSA) was performed as described previously (26, 57) with 3 µg of nuclear extract or 20 ng of recombinant TTF-1. In some applications, a 100-fold excess of unlabeled oligonucleotide or 1 µl of rabbit TTF-1 antiserum was added to the mixtures during the preincubation period. A radiolabeled double-stranded oligonucleotide probe (50,000 cpm) was added, and the incubation was continued for 20 min at 4°C. Mixtures were analyzed on 5% native polyacrylamide gels and autoradiographed.

Plasmids. The TTF-1 expression vector pRcCMV-THA was constructed by ligating the rat TTF-1 coding sequence with the pRcCMV vector (24). Rat TTF-1 or thyroid enhancer binding protein (T/EBP) promoter-luciferase constructs were prepared by PCR amplification of TTF-1 (T/EBP) gene upstream sequences with a rat genomic clone as a template (28, 41). To clone the 5'-flanking region of the rat CaSR gene, we used the Promoter Finder DNA Walking Kit (Clontech, Palo Alto, Calif.) as described by the manufacture. Briefly, nested PCR was used with an adaptor-ligated rat genomic DNA library. The gene-specific primer for the first PCR was 5'-AATGCACTCCACAGACTCTGGTCTTG-3'; for the second PCR, it was 5'-AGCGTTGCCTTCTCTTCAGGGGACAG-3'. The successfully amplified clone was subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, Calif.) and sequenced, and the 1,095-bp fragment was subcloned into the pGL3-Promoter plasmid (Promega, Madison, Wis.) by use of a luciferase reporter gene (Promega).

Cell culture. Buffalo rat liver (BRL) cells (BRL 3A; ATCC CRL 1442), nonfunctioning rat FRT thyroid cells (3), and a fresh subclone (F₁) of functioning rat FRTL-5 thyroid cells (ATCC CRL 8305) (Interthyr Research Foundation, Baltimore, Md.), which had all the functional properties previously detailed (15, 26, 27, 30-32, 45, 53, 54, 57, 59, 60), were grown as described previously (26). Fresh medium was added every 2 or 3 days, and cells were passaged every 7 to 10 days. Rat medullary thyroid carcinoma (rMTC) cells (rMTC 6-23; ATCC CRL 1607) were maintained in Dulbecco's modified Eagle's medium supplemented with 2 mM glutamine, 1 mM nonessential amino acids, and 10% heat-inactivated horse serum. Medium was changed every other day, and cells were passaged every 6 to 8 days.

Transient expression analysis. Lipofectamine (GIBCO BRL, Gaithersburg, Md.) was used to transfect promoter-reporter gene constructs into FRTL-5 or FRT cells. Briefly, cells were grown in six-well plastic plates to about 50% confluency and washed with 2 ml of warmed (37°C) serum-free culture medium (6H0 medium), and 1 ml of a premade plasmid-Lipofectamine mixture was added. The plasmid-Lipofectamine mixture was made by incubation of 1 µg of plasmid DNA with 10 µl of Lipofectamine and 200 µl of 6H0 medium for 30 min at room temperature and then dilution with 800 µl of 6H0 medium. Cells were incubated for 4 h at 37°C in a CO₂ incubator before 4 ml of complete medium with serum was added. Fresh medium was added after 24 h, with or without added ligands or reagents as noted in individual experiments, and reporter activity was measured 4 to 36 h later. To measure luciferase activity, cells were washed, scraped into 1 ml of Dulbecco's PBS, pelleted in a microcentrifuge, resuspended, and lysed with 30 µl of 1× Reporter Lysis Buffer (Promega) by repetitive pipetting (30 times) by use of a micropipette with a yellow tip (200-µl capacity). The lysate was incubated for 30 min at room temperature, frozen on dry ice, thawed, and then centrifuged at 4°C for 10 min. Twenty microliters of the supernatant was mixed with 100 µl of luciferase assay reagent (Promega) and analyzed with a luminometer (Monolight 2090; Analytical Luminescence Laboratory). Two microliters of the supernatant was taken for protein measurements with bicinchoninic acid protein assay reagent (Pierce) as described by the manufacturer.

Measurement of intracellular calcium levels. FRTL-5 cells were grown to 60% confluency on a glass disk and exposed to 4 mM Fura-2 (Molecular Probes, Eugene, Oreg.) for 1 h. Cells were then washed, and ATP, ADP, or CTP was added. Specific absorbances at 340 and 380 nm were measured simultaneously with an Axiovert 135 microscope (Carl Zeiss, Oberkochen, Germany) and an Attofluor digital fluorescence microscopy system (Atto Instruments, Rockville, Md.) by a previously described method (33).

Statistical significance. All experiments were repeated at least three times with different batches of cells. Values are the means ± standard deviations (SD) for these experiments. Significance between experimental values was determined by two-way analysis of variance; significance was set at a P value of <0.05.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

TTF-1 mRNA exists in parafollicular C cells of multiple species. Because the percentage and location of C cells within the thyroid vary widely among species, we initially measured TTF-1 in C cells of multiple species to ensure that the study of TTF-1 function in C cells was broadly relevant. TTF-1 mRNA was visualized by in situ hybridization of rat thyrocytes as a black coloration in the perinuclear region of anticalcitonin serum-stained cells (Fig. 1A). Probe specificity was established by showing that the sense probe did not detect TTF-1 mRNA by in situ hybridization (Fig. 1B) and by Northern analysis (61). Additionally, the antisense TTF-1 riboprobe did not detect TTF-1 mRNA in total RNA preparations from BRL cells or nonfunctioning FRT thyroid cells, both of which lack TTF-1 (Fig. 2A) (45, 57). In the rat, TTF-1 mRNA expression was much stronger in C cells than in thyrocytes (Fig. 1A). The relatively low level of TTF-1 mRNA expression in adult rat thyrocytes in vivo has been explained by data showing that TSH-cAMP and thyroglobulin within the follicular lumen are transcriptional suppressors of TTF-1 gene expression (45, 57, 59, 60). This characteristic may be a major difference between adult thyroid and fetal thyroid (34).

View larger version (125K): [in this window] [in a new window]   FIG. 1.   TTF-1 RNA is present in rat, dog, and human parafollicular C cells. In situ hybridization with an antisense TTF-1 riboprobe was done with normal rat and dog thyroids as well as human thyroid medullary carcinoma tissue (A, C, and D, respectively). The normal rat and dog thyroids were immunostained with anticalcitonin sera to identify C cells. As a control, the rat thyroid was hybridized with a sense TTF-1 riboprobe and then immunostained with anticalcitonin sera (B). TTF-1 mRNA (black coloration) is observed in the perinuclear area of thyroid follicular epithelium (thin arrows) and parafollicular C cells (thick arrows); calcitonin protein is seen as a brown coloration (arrowheads) of the cytoplasm of parafollicular C cells. Tissues were counterstained with methyl green. Bars, 25 µm.

View larger version (37K): [in this window] [in a new window]   FIG. 2.   rMTC cells express TTF-1 RNA but not thyroid-specific or restricted genes such as the TG or TSHR genes; TTF-1 in nuclear extracts of rMTC C cells and rat FRTL-5 thyroid cells has the same DNA binding properties. (A) Northern analysis was performed with functioning rat FRTL-5 thyroid cells as a positive control and nonfunctioning rat FRT thyroid cells as well as BRL cells as negative controls. Blots were sequentially hybridized with radiolabeled rat TTF-1, TSHR, TG, and -actin probes. (B) A radiolabeled oligonucleotide containing the upstream TTF-1 binding element within the TSHR 5'-flanking region was incubated with nuclear extracts from FRTL-5 or rMTC cells and subjected to EMSA. Incubations in lanes 3 and 4 included a 100-fold molar excess of unlabeled oligo C, the TTF-1 or Pax-8 binding site within the TG promoter (24). (C) EMSA shows that anti-TTF-1 inhibits complex formation by C-cell and FRTL-5 cell nuclear extracts. Lanes 1 to 3 contained 3, 1, and 0.1 µg, respectively, of nuclear extract. Lanes 5 to 7 and 9 to 11 contained the same respective amounts of the extract plus 1 µl of immune serum directed against a synthetic TTF-1 peptide. Lanes 4 and 8 contained 3 µg of extract plus 1 µl of preimmune serum. Lane 12 contained an incubation mixture of the radiolabeled probe with 20 ng of recombinant TTF-1 (rTTF-1).

TTF-1 protein is expressed in C cells and has properties of TTF-1 protein in thyroid cells. To establish that TTF-1 RNA is functionally expressed as TTF-1 protein in C cells, we performed EMSA. We used nuclear extracts and an oligonucleotide containing the upstream TTF-1 binding element of the TSHR as a probe (45). The upstream as well as downstream TTF-1 binding sites in the TSHR are TTF-1 specific and do not act with Pax-8 (45). Nuclear protein from rMTC cells formed a DNA-protein complex which had the same mobility and intensity as that formed by nuclear extract from FRTL-5 cells (Fig. 2B, lane 1 versus lane 2).

TTF-1 regulatory elements exist in C-cell genes important for calcium homeostasis. The main function of C cells is to sense increases in extracellular Ca²⁺ and secrete calcitonin. The critical gene product involved in the sensing process is the CaSR (11, 22, 40). Calcitonin decreases extracellular Ca²⁺ by its action on bone and kidney (5, 37). Although an oversimplification, the function of parathyroid cells counterbalances the action of C cells. Parathyroid cells sense decreases in extracellular Ca²⁺ and secrete parathyroid hormone, which increases extracellular Ca²⁺ by its action on bone and kidney (5, 10, 50). As in C cells, the CaSR is the critical extracellular Ca²⁺-sensing component of parathyroid cells (11). Since C cells and parathyroid cells function coordinately to maintain Ca²⁺ homeostasis throughout the body and since both contain TTF-1, we questioned whether TTF-1 might regulate genes important for Ca²⁺ homeostasis in C or parathyroid cells.

View larger version (44K): [in this window] [in a new window]   FIG. 3.   Expression of genes important for calcium homeostasis in rMTC cells. RT-PCR was carried out with total RNA and the primers described in Materials and Methods. The marker used was a X174 DNA HaeIII digest. The sizes of the PCR products anticipated for the CaSR, CAM-III, E-CAD, and calcitonin (CT/CGRP) genes, based on the primers used, are, respectively, 568, 302, 515, and 157 bp.

View larger version (45K): [in this window] [in a new window]   FIG. 4.   Ability of putative TTF-1 binding sequences found in the CaSR, CAM-III, E-CAD, and calcitonin (CT/CGRP) genes to form a TTF-1-DNA complex with rMTC or FRTL-5 thyroid cell nuclear extracts. (A) Oligonucleotides containing the putative TTF-1 binding sequences shown in Table 2 were synthesized, radiolabeled, and incubated with nuclear extracts from FRTL-5 cells (top) or rMTC cells (bottom). Migration was compared to that of complexes formed between the same extracts and a radiolabeled oligonucleotide with the sequence of the downstream TTF-1 binding site of the TSHR (TSHR DS) (45). (B) Formation of protein-DNA complexes between nuclear extracts from rMTC cells and radiolabeled oligonucleotides containing putative TTF-1 binding sites, i.e., CaSR-C, CAM-III-A, CAM-III-B, E-CAD-A, and CT/CGRP-C (lanes 3 to 12), was evaluated in the presence of a 100-fold molar excess of unlabeled oligonucleotide containing the TTF-1 binding element (oligo C) or TTF-2 binding element (oligonucleotide K) of the TG promoter (24, 56). An oligonucleotide with the sequence of the downstream TTF-1 binding site of the TSHR (TSHR DS) was the control (lanes 1 and 2). (C) Protein-DNA complexes formed between nuclear extracts from rMTC cells and radiolabeled CaSR-C, CAM-III-A, CAM-III-B, E-CAD-A, or CT/CGRP-C (lanes 3 to 12) were compared to those formed with the downstream TTF-1 binding site of the TSHR (TSHR DS) (lanes 1 and 2) in the presence of an antiserum to a specific TTF-1 peptide or its preimmune control. The arrow denotes the supershifted complex in the presence of the immune serum. (D) Recombinant TTF-1 protein (20 ng) was incubated with radiolabeled oligonucleotides containing putative TTF-1 binding sites from the CaSR, CAM-III, E-CAD, or CT/CGRP genes (lanes 2 to 12) or the downstream TTF-1 binding site of the TSHR (TSHR DS) (lane 1). The presence of a multiplicity of complexes with recombinant TTF-1 is related to oligomerization of the TTF-1 protein during the incubation (4).

TTF-1 regulates transcription of the CaSR gene. We obtained a 1,095-bp fragment of the 5'-flanking region of the rat CaSR by PCR of rat genomic DNA (Fig. 5). The portion between bp 243 and 1 of the 5'-flanking region (Fig. 5) is identical to the published untranslated region of the rat CaSR cDNA sequence (52) and contains the putative TTF-1 site termed CaSR-C. The remainder of the PCR-derived genomic 1,095-bp fragment is not identical to the sequence of the untranslated region of the rat CaSR cDNA and does not contain the CaSR-A and CaSR-B sites (Fig. 5).

View larger version (53K): [in this window] [in a new window]   FIG. 5.   Structure (A) and sequence (B) of a 5'-flanking region of the rat CaSR by comparison to the untranslated region (UTR) of the rat CaSR. The sequence of 1,095 bp of the 5'-flanking region of the rat CaSR was obtained by nested PCR. The sequence of the untranslated region of the rat CaSR cDNA is from Riccardi et al. (52). The boxed region in panel B denotes a region of sequence identity between the two sequences. Thick underlining between bp 201 and 192 denotes the putative TTF-1 CaSR-C site. Thin underlining at bp 544 to 535 and bp 249 to 240 denotes the putative TTF-1 CaSR-A and CaSR-B sites, respectively.

View larger version (19K): [in this window] [in a new window]   FIG. 6.   TTF-1 suppresses native CaSR promoter activity when transfected into FRTL-5 cells and is a suppressor of the TTF-1 binding site on the CaSR 5'-flanking region when CaSR-C is ligated to an SV40 promoter-driven luciferase reporter gene and transfected into FRTL-5 or FRT thyroid cells. (A) FRTL-5 cells were grown in the presence (+) or absence () of TSH, which decreases endogenous TTF-1 levels (57). Cells were transfected with pGL3-CaSR, which contains 1,095 kb of the 5'-flanking region of the CaSR linked to a luciferase reporter gene in the pGL3-Promoter vector; transfected pGL3-Promoter (pGL3-Prom.) vector alone was the control. The promoter activity of a chloramphenicol acetyltransferase chimera containing 199 bp of the minimal TSHR promoter, pTR(199)CAT, was the positive control [pTR(199)]; its counterpart vector with no TSHR insert was the negative control (p8CAT). The activity of pTR(199)CAT, which contains the downstream TTF-1 binding site of the TSHR, was measured as described previously (57). (B) FRT cells, which contain no endogenous TTF-1 (Fig. 2A), were cotransfected with pGL3-CaSR or the pGL3-Promoter vector plus an expression vector containing TTF-1, pRcCMV-THA (+), or the control vector pRcCMV containing no TTF-1 (). The activity of the pGL3-Promoter vector cotransfected with the pRcCMV vector was arbitrarily set at 1. (C) One, two, or seven copies of the CaSR-C oligonucleotide (Table 2) were tandemly ligated and inserted in either the positive or the negative orientation into the pGL3-Promoter vector (arrows). Each was transfected into FRTL-5 cells, which contain endogenous TTF-1, and luciferase activity was measured 48 h after transfection. Results in panels A to C are expressed as the mean ± SD luciferase activity of each construct relative to that of the respective control vector with no insert (data shown without error bars). (D) FRT cells, which contain no endogenous TTF-1 (Fig. 2A), were transfected with TTF-1 cDNA, pRcCMV-THA (+), or the control vector pRcCMV () plus the SV40 promoter-driven plasmid containing one, two, or seven copies of the CaSR-C oligonucleotide (arrows) ligated and inserted in a positive orientation, as represented. The control was the pGL3-Promoter vector with an SV40 promoter but no CaSR-C oligonucleotide insert. Data are expressed as the mean ± SD of the ratio of activities in the presence and absence of TTF-1 cotransfection. In all panels, data are from at least three different experiments with three different batches of transfected cells. A statistically significant change from the control with a P value of <0.05, <0.01, or <0.001 is denoted, respectively, by one, two, or three asterisks.

Expression of TTF-1 and CaSR or CT/CGRP genes is inversely regulated by the intracellular calcium signal. Altered extracellular Ca²⁺ levels signal C cells by modulating the inositol phosphate (IP) signal system and thereby changing intracellular Ca²⁺ levels (11, 22, 40). We evaluated the effect on TTF-1 and CaSR gene expression of several agents known to increase the internal Ca²⁺ signal. We initially used FRTL-5 thyrocytes, since the effects of these agents are well described for these cells, since FRTL-5 cells contain endogenous TTF-1, and since FRTL-5 cells can be readily transfected by both exogenous TTF-1 and the CaSR (see above).

View larger version (26K): [in this window] [in a new window]   FIG. 7.   TTF-1 RNA levels (A) and TTF-1 binding to the CaSR-C TTF-1 element (B) are decreased by the ATP- or A23187-increased the internal Ca2+ signal, and kinase C activation can synergistically increase the Ca2+ signal effect. (A) FRTL-5 cells were grown to 70% confluency in complete medium containing TSH and then maintained in medium with no TSH plus 0.2% calf serum for 6 days. TPA (1.0, 10, or 100 nM), A23187 (0.1, 1.0, or 10 µM), ATP (0.1 or 1.0 mM), or 1 nM TPA plus A23187 (0.1, 1.0, or 10 µM) was then added to the medium (panels a to d, filled bars, respectively). After 4 h, total RNA was recovered and subjected to Northern analysis with radiolabeled cDNAs encoding TTF-1 and -actin. The TTF-1/-actin ratio was calculated after densitometric quantitation of autoradiograms of the blots. Data (filled bars) are expressed relative to the TTF-1/-actin ratio in cells maintained with basal medium with no addition, which was arbitrarily set at one (open bars). There was no change in -actin levels with any treatment. Data are the mean ± SD for four separate experiments with different batches of cells. A statistically significant (P < 0.05) decrease, compared to the control, caused by one agent is denoted by a single asterisk. A statistically significant (P < 0.01 or P < 0.001) additive or synergistic effect of TPA and A231871 is denoted by two or three asterisks, respectively. (B) FRTL-5 cells were identically grown and treated with TPA (1.0, 10, or 100 nM; lanes 2 to 4, respectively), A23187 (0.1, 1.0, or 10 µM; lanes 5 to 7, respectively), ATP (0.1 or 1.0 mM; lanes 8 and 9, respectively), or 1 nM TPA plus A23187 (0.1 or 1.0 µM, lanes 10 and 11, respectively). Lane 1, basal activity. Nuclear protein was isolated 24 h after treatment. EMSA was performed with a radiolabeled oligonucleotide having the sequence of the TTF-1 element of the CaSR-C oligonucleotide.

View larger version (22K): [in this window] [in a new window]   FIG. 8.   Effect of A23187 (A) or ATP (B) on TTF-1, CaSR, or CT/CGRP RNA levels in rMTC cells and the decrease in TTF-1 promoter activity caused by ATP treatment of cells (C). (A) rMTC cells were grown to 70% confluency and then exposed to (+) or not exposed to () 1.0 µM A23187 for 4 h. Total RNA was recovered and subjected to Northern analysis (top). After densitometric quantitation of autoradiograms or after quantitation of the blots with a BAS 1500 phosphorimager, the TTF-1/GAPDH, CaSR/GAPDH, or CT/CGRP/GAPDH ratios were calculated. (B) rMTC cells were identically grown and treated with 1.0 mM ATP for 2 or 4 h, at which times total RNA was recovered and subjected to Northern analysis as in panel A. Data are compared to results from cells maintained without ATP. (C) FRTL-5 cells were grown to 70% confluency in complete medium containing TSH and then maintained in medium with no TSH plus 0.2% calf serum for 6 days. Cells were transfected with the indicated TTF-1-luciferase chimeras containing different lengths of the 5'-flanking region. ATP (1 mM) was added to the medium 24 h after transfection, and 4 h later reporter gene activity was measured and normalized to data obtained with the pSV control after correction for transfection efficiency. Data in all panels are the means ± SD for three different experiments. One, two, and three asterisks represent significant changes from the control with P values of <0.05, <0.01, and <0.001, respectively.

View larger version (25K): [in this window] [in a new window]   FIG. 9.   Effect of ATP on TTF-1 (A) and CaSR (B) promoter activity is specific and associated with increased internal Ca2+ levels (C), and suppression of the TTF-1 promoter induced by ATP is reversed by decreasing extracellular Ca2+ levels (D). (A and B) FRTL-5 cells were grown to 70% confluency in complete medium containing TSH and then maintained in medium with no TSH plus 0.2% calf serum for 6 days. The 5.18-kb fragment of the TTF-1 5'-flanking region linked to a luciferase reporter gene was transfected into one set of cells (A). A duplicate set of cells (B) was transfected with a plasmid containing seven copies of the native CaSR-C oligonucleotide ligated and inserted in a positive orientation in the pGL3-Promoter vector (Fig. 6). ATP, ADP, or CTP (1.0 mM) was added to the medium 24 h after transfection, and reporter gene activity was measured 4 h later. Data are expressed relative to the promoter activity of the control, with no addition. (C) The ability of each nucleotide to increase intracellular calcium levels in duplicate batches of transfected cells was measured. Results are the superimposed kinetics of 30 different cells as a function of time. (D) The 5.18-kb fragment of the TTF-1 5'-flanking region linked to a luciferase reporter gene was transfected into cells exactly as in panel A. At 24 h after transfection, cells were treated with 1.0 mM ATP as in panel A. Four hours after the ATP addition, one set of cells was washed with PBS without Ca2+ and incubated for the noted times with Ca2+-free Dulbecco's modified Eagle's medium containing 10 mM HEPES, 1.8 mM MgSO4, glutamine, 0.2% calf serum, hormones other than TSH used to grow FRTL-5 cells (32), and 2 mM EGTA (tEGTA). A second set of cells was washed in the same way and incubated with the same medium except that no EGTA was added (EGTA). Cells were harvested to measure luciferase activity. In panels A, B, and D, data are the means ± SD for at least three experiments, each done in duplicate with different batches of cells. A statistically significant change from the control with a P value of <0.01 or <0.001 is denoted by two or three asterisks, respectively.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

When we identified TTF-1 mRNA in rat parafollicular C cells in the thyroid and in chief cells in the parathyroid (61), we hypothesized that TTF-1 might play a role in the expression of genes important for calcium regulation in cells and/or calcium homeostasis in the organism. In the present study, we showed that TTF-1 RNA exists in C cells of diverse species. Its levels in C cells in vivo may in fact be higher than that in thyroid cells in vivo, possibly reflecting the fact that follicular TG and TSH additively suppress TTF-1 levels in thyroid cells (45, 57, 59, 60). We examined the question of function in a parafollicular C-cell model, rMTC cells in continuous culture. We showed that TTF-1 RNA in rMTC cells results in the expression of a functional TTF-1 protein, based on the ability of TTF-1 protein to form protein-DNA complexes with TTF-1 binding sites in the TSHR and TG 5'-flanking regions. We showed that rMTC cells express the CaSR, calmodulin, and calcitonin genes, that there are putative TTF-1 binding sequences on each of these genes, and that at least one site on each gene is able to bind TTF-1. We used the CaSR gene as a representative calcium-sensitive gene to show that the TTF-1 binding site functions as a silencer in the presence of TTF-1 and that changes in internal Ca²⁺ levels reciprocally regulate TTF-1 and CaSR gene expression at the transcriptional level. We showed that the potential Ca²⁺ modulation site of the TTF-1 gene exists within 1.15 kb of its 5'-flanking region, although we do not know how Ca²⁺ might regulate the putative element, e.g., via modulation of a kinase activity, a binding protein, a coregulatory molecule, or a combination of these activities. Nevertheless, we showed that increased intracellular Ca²⁺ in C cells decreases TTF-1 and increases CaSR levels; conversely, decreased Ca²⁺ increases TTF-1 and decreases CaSR levels. We showed that the expression of the CT/CGRP gene is coincidentally and similarly regulated by Ca²⁺ and TTF-1.

We used FRTL-5 thyroid cells to complement studies with rMTC cells, since FRTL-5 cells contain TTF-1, since intracellular Ca²⁺ is an important signal within the cells, and since the cells do not contain either the CaSR or the CT/CGRP genes. FRTL-5 cells are, therefore, convenient "null" cells with which to examine the regulation of transfected CaSR or CT/CGRP genes. Using FRTL-5 cells, we showed that TPA alone causes a minimal decrease in TTF-1 RNA levels and TTF-1 complex formation with the TTF-1 binding element of the CaSR but that TPA acts synergistically with A23187 to decrease TTF-1 RNA levels and TTF-1 complex formation with the CaSR. Since TPA acts synergistically with A23187 to stimulate calcitonin secretion from rMTC cells (25), it is reasonable to conclude that data derived from FRTL-5 cell experiments are consistent with and applicable to C cells. Moreover, it seems clear that the Ca²⁺-regulated, TTF-1-mediated changes in CaSR and CT/CGRP gene expression described here complement and are consistent with the secretory process by which calcitonin is released from C cells by altered internal Ca²⁺.

In sum, TTF-1 levels are transcriptionally regulated by changes in intracellular Ca²⁺ levels which are brought about by changes in extracellular Ca²⁺ levels or by stimulation of cells with a physiologically active ligand that interacts with the cells and modulates the IP-Ca²⁺ signal system, i.e., ATP. TTF-1 regulatory elements exist on tissue-restricted or -specific genes associated with calcium homeostasis in C cells just as they exist on tissue-restricted or -specific genes associated with the formation and secretion of thyroid hormones in thyrocytes. In C cells, the IP-calcium signal is the coordinator; in the thyroid, the cAMP signal has this function. The relationship between the two control mechanisms for TTF-1 levels and function in both C cells and thyroid cells will, however, become an interesting question, since the two signals are functionally interactive in both types of cells (17, 25, 31, 62).

The intracellular Ca²⁺ signal is important in almost all cell types, including neurons. The extracellular Ca²⁺ level is one means of regulating the intracellular Ca²⁺ signal in neurons and is known to be important for the hormone secretory activity of or neuropeptide synthesis in the pituitary as well as the parathyroid and C cells (1, 10, 23, 43, 65, 66, 68). One means to sense the extracellular Ca²⁺ level involves Ca²⁺ channels. The pituitary, the parathyroid, and parafollicular C cells use, instead, the CaSR. The CaSR recognizes high extracellular Ca²⁺ levels, initiates a Gq protein-mediated increase in IP and intracellular Ca²⁺ levels, and thereby induces the secretion of the hormones (11, 18, 22, 40, 49). Using a pituitary cell model, however, Emanuel et al. (18) showed that, whereas acute increases in Ca²⁺ levels in the medium increased IP, cytosolic Ca²⁺, and cAMP levels and the associated secretion process, similar changes in extracellular Ca²⁺ levels for a period of 24 h increased CaSR RNA levels two- to fourfold. It is reasonable to presume that the change in CaSR RNA levels reflects the effect of internal Ca²⁺ on TTF-1 levels and that the change in TTF-1 regulates CaSR gene expression, in analogy to the C-cell model described here.

The following model emerges (Fig. 10). The CaSR senses acute increases in extracellular Ca²⁺ levels. This change induces acute increases in IP and intracellular Ca²⁺ levels and initiates a secretory response in which secretory vesicles release calcitonin (Fig. 10, secretory phase). If persistent, the change in internal Ca²⁺ will regulate TTF-1 levels, and the altered TTF-1 levels will coordinately regulate the transcription of multiple genes; i.e., increased Ca²⁺ will decrease TTF-1 and decrease the silencing activity of TTF-1 on the CaSR and CT/CGRP genes (Fig. 10, synthesis phase). Increased CaSR levels should enhance the responsiveness of the cell to high extracellular Ca²⁺; increased calcitonin levels would replenish the secreted calcitonin which was used to lower serum Ca²⁺. The priming signal of the synthesis phase (Fig. 10) would appear to be increased intracellular Ca²⁺ levels; however, increased kinase C activity may synergistically increase the functional response. If extracellular Ca²⁺ levels were decreased, a suppression phase would ensue (Fig. 10). Internal Ca²⁺ levels would be decreased by the CaSR, TTF-1 levels would be increased, and CaSR or CT/CGRP gene expression would be decreased. Synergistic activity by kinase C would also decrease. The suppression phase would complement a decrease in secretory activity.

View larger version (27K): [in this window] [in a new window]   FIG. 10.   Proposed model of extracellular calcium-altered, TTF-1-mediated regulation of the expression of genes controlling calcium homeostasis in C cells. The CaSR on C cells senses acute changes in extracellular Ca2+ levels ([Ca2+]o). The calcium-CaSR interaction causes an acute increase in IP and intracellular Ca2+ levels ([Ca2+]i). This change initiates the secretory response in which calcitonin (CT) is released from secretory vesicles into the circulation (secretion phase). If persistent, however, the change in internal Ca2+ levels mediated by the CaSR will regulate TTF-1 levels, and altered TTF-1 levels will coordinately regulate genes important for calcium homeostasis, i.e., the CaSR and CT/CGRP genes (synthesis and suppression phases). Both the synthesis and suppression phases of gene expression would complement changes in secretory activity by altering the ability of the cell to sense extracellular Ca2+ or its ability to replenish CT in secretory vesicles. We suggest that the model is applicable to the secretion of hormones by other cells that contain the CaSR and TTF-1, i.e., pituitary trophic hormones in anterior pituitary cells or parathyroid hormone in parathyroid cells. Solid arrows indicate positive signals, T-bars indicate suppression, and broken arrows indicate the translocation of RNA and protein. This model focuses only on the potential role of TTF-1, although we recognize that other factors regulate these synthesis and secretion in C cells (see Discussion and references 7, 17, 62, and 68). PKC, protein kinase C.

This model does not integrate the Ca²⁺ TTF-1 transcriptional signal mechanism with effects of glucocorticoids, serotonin type 1 agonists, or cAMP on the transcription of the noted genes or on secretion (7, 17, 62, 68). Integration with the activity of Ras-responsive elements is also not considered. In part, this is the result of our desire to simplify and focus the model only on TTF-1; in part, however, integration of the activities of multiple promoter elements is best presented after their direct evaluation in the C-cell system used here, since conflicting data are obtained for several of these agents when different systems are used (7, 17).

TTF-1 may have a role in regulating the transcriptional expression of calcium-responsive genes in many cells, and the model may be generally applicative. TTF-1 exists in keratinocytes, Purkinje cells of the cerebellum, and neurons of the hippocampus and retina (61). Keratinocytes and hippocampus neurons contain the CaSR in addition to TTF-1. Keratinocytes proliferate and form a differentiated squamous cell layer when they are cultured in physiological concentrations of Ca²⁺ (36, 51). We hypothesize, therefore, that TTF-1 may be an important Ca²⁺-sensing factor which responds to altered intracellular Ca²⁺ levels and coordinately regulates the gene expression responsible for calcium homeostasis in each of these types of cells.

Finally, two additional points should be noted. First, TTF-1 elements can be positive regulatory elements, as in the case of the TSHR, TG, TPO, NIS, or MHC genes (14, 19, 21, 24, 41, 42, 45, 54, 57), or negative regulatory elements, as unequivocally shown here for the CaSR gene. In the case of the parathyroid hormone gene, a TTF-1 element would be expected to function in opposition to the TTF-1 element on the CaSR or CT/CGRP gene, i.e., be an enhancer responding to high TTF-1 levels induced by low extracellular Ca²⁺ levels. Second, TTF-1 data from whole thyroids or primary thyroid cell cultures must be interpreted cautiously because TTF-1 is present and functional in more than one cell type. In the dog, particularly, there are large numbers of C cells, and these cells express much higher levels of TTF-1 RNA in vivo than thyroid follicular epithelia (61). This fact may explain why TSH-cAMP does not appear to suppress TSHR gene expression in primary cultures of dog thyrocytes and may contribute to apparent species specificity (38, 64). The functional role of TTF-1 is, therefore, best studied in cell lines FRTL-5 or rMTC, where no ambiguity exists as to cell type.