Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7478-7486, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification of a Class of Chromatin
Boundary Elements
Olivier
Cuvier,
Craig M.
Hart, and
Ulrich K.
Laemmli*
Departments of Biochemistry and Molecular
Biology, University of Geneva, CH-1211 Geneva 4, Switzerland
Received 24 June 1998/Accepted 25 August 1998
 |
ABSTRACT |
Boundary elements are thought to define the ends of functionally
independent domains of genetic activity. An assay for boundary activity
based on this concept measures the ability to insulate a bracketed,
chromosomally integrated reporter gene from position effects. Despite
their presumed importance, the few examples identified to date
apparently do not share sequence motifs or DNA binding proteins. The
Drosophila protein BEAF binds the scs' boundary element of
the 87A7 hsp70 locus and roughly half of polytene
chromosome interband loci. To see if these sites represent a class of
boundary elements that have BEAF in common, we have isolated and
studied several genomic BEAF binding sites as candidate boundary
elements (cBEs). BEAF binds with high affinity to clustered, variably
arranged CGATA motifs present in these cBEs. No other sequence
homologies were found. Two cBEs were tested and found to confer
position-independent expression on a mini-white
reporter gene in transgenic flies. Furthermore, point mutations in
CGATA motifs that eliminate binding by BEAF also eliminate the ability
to confer position-independent expression. Taken together, these
findings suggest that clustered CGATA motifs are a
hallmark of a BEAF-utilizing class of boundary elements found
at many loci. This is the first example of a class of
boundary elements that share a sequence motif and a binding protein.
| |
INTRODUCTION |
Chromatin appears to be partitioned
into chromosomal domains that are operationally defined by bracketing
DNA regions called boundary elements or insulators
(10; see reference 34 for a
review). Boundary elements are presumably necessary to curtail the
potentially promiscuous behavior of enhancers, limiting their action to
the domain in which they reside. The biological activity of a
boundary element is experimentally measured by either
position-independent expression or enhancer-blocking assays. If
this view of chromosomal organization is correct, boundary elements
play a very important functional role. Yet only a few examples have
been identified, and each is so far a unique case, as they do not
appear to have notable sequence homologies or to have binding
activities in common.
The best-characterized boundary elements are the scs and scs' regions
found to bracket the 87A7 hsp70 heat shock puff of
Drosophila melanogaster polytene chromosomes
(33) and a 340-bp fragment from the gypsy
retrotransposon (11). The scs/scs' and the
gypsy-derived elements have a boundary function in both of the assays
mentioned above. They confer position-independent expression on a
bracketed reporter gene by insulating the transgene from both
activating and repressive effects at the site of chromosomal
integration, and they block communication between a specific
enhancer and promoter when interposed (20, 21, 31). It is
important to note that boundary elements do not inactivate
promoters or enhancers; they only block communication when interposed
(2, 3, 21, 32). For instance, if an enhancer and boundary
element are located between two divergently transcribed promoters, the
enhancer cannot activate the promoter with the intervening boundary
element but can activate the other promoter. Thus, the positional
functioning of boundary elements is distinct from the bidirectional
repressive effect of silencer elements.
The boundary activity of the gypsy-derived element is known to be
mediated by the binding of the zinc finger protein su(Hw) to its
reiterated binding sites (31). The su(Hw) protein has been
studied in some detail, and regions involved in DNA binding, enhancer blocking, and interactions with
mod(mdg4) have been identified (8, 13,
22). Interactions between the mod(mdg4)
gene product and the su(Hw) protein are necessary for boundary function
(9). In addition to loss of enhancer blocking, it has been
suggested that some mod(mdg4) mutations lead to
an unmasked activity that represses certain promoters (3).
To address the boundary activity of scs' at a biochemical level, we
previously characterized two cDNAs encoding the related scs'
boundary element-associated factors BEAF-32A and -32B (14, 38). The BEAF activity in Drosophila nuclear extracts
appears to be composed predominantly of trimers of one 32A and two 32B subunits. Interactions between BEAF subunits results in
cooperative binding to the three CGATA motifs of the
high-affinity binding site in scs' which, in turn, facilitates
binding to the lower-affinity binding site located some 200 bp away
(14).
Evidence of a role for BEAF in boundary activity derives from an
enhancer-blocking assay in Drosophila D1 cells: seven tandem copies of a 48-bp oligonucleotide containing the scs' high-affinity binding site had enhancer-blocking activity (although less than that obtained by using scs'), while point mutations that eliminated BEAF binding further reduced this activity (38).
We immunolocalized BEAF to numerous interbands and puff
boundaries on polytene chromosomes, suggesting the
existence of a common class of boundary elements in
Drosophila and that the band-interband structure of
polytene chromosomes could be related to the localization of
boundary elements.
In this study, we isolated some of these genomic BEAF binding
sites and used transgenic flies to demonstrate that the newly isolated sequences tested represent boundary elements. The only homology found between these candidate boundary elements (cBEs) and
scs' are clusters of CGATA motifs. Despite the varied spacing and
orientations of the motifs in the different clusters, BEAF interacts
with all of the clusters. We also used transgenic flies to directly
establish the functional importance of BEAF binding sites by
mutagenesis of CGATA motifs. This strongly indicates that the hundreds
of BEAF binding sites in the Drosophila genome represent an
abundant class of boundary elements, providing the first example of a
class of binding elements that share a sequence motif and a binding protein.
| |
MATERIALS AND METHODS |
Plasmids and DNA methods.
Genomic DNA fragments were ligated
into EcoRI (cBE28 and -51)- or BamHI (cBE76)-cut
pBluescript KS (Stratagene) after five cycles of the enrichment
protocol (see below) and selected by alpha complementation. From 101 plasmids, 11 cBEs were obtained, and of these, 4 had sequences related
to cBE28. Both strands of the cBEs were dideoxy sequenced, and sequence
comparisons and database searches were performed with the GCG Bestfit
and Fasta programs. Plasmids for transfections had cBE or control
sequences inserted into the BamHI site at 
145 of the
hsp227 minimal promoter (upstream activating sequence assay)
or into the KpnI site at 250 of the hsp27
promoter of a p1200CAT derivative (enhancer-blocking assay;
30). The luciferase-encoding transfection efficiency control plasmid pAcluc has been previously described (38).
P-element transposon constructs were made by insertion of the 990-bp
PvuII scs fragment (35) into the NsiI
site 3' of the mini-white gene in pCasper4 (27),
followed by insertion of different boundary or control elements into
the BamHI site 5' of the mini-white gene. The
215-bp scs' derivatives M and M* were cloned into a derivative of pSP64
in which an oligonucleotide encoding a BglII site was inserted into the EcoRI site after PCR amplification using
primers encoding a BamHI site on one end and a
BglII site on the other. M* differs from M only in having
the three CGATA motifs of the D site mutated to CTCGA as previously
described (14). Dimerization was performed by ligating
appropriate BamHI-ScaI and
BglII-ScaI fragments of the M or M* plasmid to
themselves, resulting in direct repeats. The spacing between the two D
sites in the MM construct is the same as that found between the D site
and the lower-affinity B site in scs'. The DNA fragment used as a probe
in DNase I-hypersensitive site mapping experiments was derived from a
plasmid containing the 4 kb of IMPdH genomic sequences,
kindly provided by D. Nash (26).
Enrichment protocol for obtaining genomic cBEs.
Genomic DNA
was isolated from Kc cells, sonicated to an average size of 0.5 kb, and
ligated to a linker prepared from two oligonucleotides, a 25-mer with
the sequence 5'GCGGTGACCCGGGAGATCTGAATTC and an 11-mer with
the sequence 5'GAATTCAGATC. Affinity-purified, bacterially
expressed protein 32B was allowed to bind the DNA in a standard gel
shift reaction (38) scaled up by a factor of 2. The protein
was immunoprecipitated as previously described by using mouse
antibodies raised against the bacterially expressed 32B protein unique
amino-terminal domain (14) affinity purified by a filter
method (1). Briefly, after a 15-min room temperature binding
reaction, 20 µl of protein A-Sepharose beads preincubated with the
affinity-purified mouse antibodies was added and the incubation was
continued at 4°C for 1 h. The beads were pelleted by 10 s
of centrifugation, washed rapidly several times with binding buffer,
and digested with proteinase K. The coprecipitated DNA was purified by
phenol extraction (yield of about 10 ng) and amplified by
ligation-mediated (LM)-PCR (25) with the 25-mer
oligonucleotide described above as the primer, and 500 (cycle 1) or 100 (cycles 2, 3, 4, and 5) ng of the resulting amplified DNA was subjected to further cycles of binding, immunoprecipitation, and LM-PCR.
Band shift and DNase I footprinting assays.
Band shift and
DNase I footprinting assays were performed as previously described
(14). Band shift assays contained either the end-labelled
scs' D subfragment and unlabelled cBE fragments as competitors or
end-labelled cBE fragments together with the desired protein
(Drosophila nuclear extract or the affinity-purified, bacterially expressed BEAF-32A or -32B protein). Providing end-labelled fragments were of different sizes, up to four probes were mixed in one
band shift reaction to limit the total number of assays to be performed
and to see their relative affinities (37).
Transfections.
Transient transfections of D1 cells and
chloramphenicol acetyltransferase (CAT) and luciferase assays of cell
extracts were done essentially as previously described (38),
by using 10 µg of CAT plasmids and 1 µg of the transfection
efficiency control plasmid pAcluc coprecipitated with calcium
phosphate. Briefly, cell extracts were prepared 48 h after adding
the DNA, induction with 5 µM ecdysone was done for 24 h, and
cells were allowed to recover at 25°C for 12 h after a 2-h heat
shock in a 37°C air incubator.
Cells, nuclei, and DNase I treatment.
The
Drosophila tissue culture cell lines Kc 161 and D1 were
grown as previously described (38). Nuclei were prepared as previously described (24) from exponentially growing Kc
cells and used directly for nuclease treatments as already described (19). Nuclei at an A260 of 10 in 850 µl were digested with 0.1-U/ml DNase I or 0.02-U/ml micrococcal
nuclease for 0.5 to 6 min at 37°C. For detection of
nuclease-hypersensitive sites upstream of the IMPdH gene by
the indirect end-labelling method (36), purified DNA samples
were digested with PvuII. Genomic DNA digested with
PvuII, PvuII plus EcoRI, and
PvuII plus XhoI was used for internal size
standards. Gel electrophoresis, Southern blotting, and detection of
cleavage products were done as previously described (19) by
using the purified 742-bp PvuII-XhoI DNA fragment
from the IMPdH coding region as a probe. As a control, we
successfully mapped the hypersensitive sites in scs (33) by
using genomic DNA digested with BamHI and BglII,
with additional digestion with NdeI or HpaI for
internal size standards. The probe was the 291-bp BamHI-PvuII fragment from the 1.7-kb
BamHI-BglII scs fragment (35).
P-element transformation and scoring of reporter gene
expression.
Transposon injections into early embryos of
Df(1)w67c23(c) flies were
done as described by Pirrotta et al. (28), and transformants were selected by rescue of the eye color. Crosses to marked balancer chromosomes were performed to generate stocks and to determine the
chromosome of insertion for each line as previously described (35). Levels of mini-white expression of the
different transgenic lines were determined from the eye color observed
in 2-day-old females of approximately the same size that were
heterozygous for the transgene, which allows sensitive detection of
differences in eye color (29). To ensure proper analysis of
transformant lines, two levels of control were made. First, females of
all transformant lines were backcrossed for three generations to the recipient w67c23 flies to allow separation of inserts on the
same chromosome by recombination (29). Second, lines that
were suspected of containing more than one insert (i.e., any transgenic
line with orange or red eyes) were subjected to Southern analyses to see if the phenotype could be due to the additive effects of expression of several P elements (20). All flies were found to have
single P-element insertions, except those indicated by asterisks in
Fig. 6.
| |
RESULTS |
Isolation of new genomic BEAF binding sites.
BEAF was
previously immunolocalized to numerous interbands and puff boundaries
on polytene chromosomes (38). Because BEAF binds to the scs'
boundary element and has been implicated in boundary function, we were
interested in characterizing a number of these genomic BEAF binding
sites to see if they have boundary activity and to derive a consensus
sequence and structure for BEAF binding. Genomic BEAF binding
sites were isolated as depicted in Fig.
1A. Briefly, appropriate oligonucleotides
were ligated onto sheared genomic DNA to facilitate LM-PCR.
Subsequently, specific complexes were formed between the genomic DNA
and bacterially expressed BEAF-32B, the 32B protein was
immunoprecipitated, and the associated DNA was amplified by LM-PCR. We
used 32B since its footprints on scs' are virtually identical to those
of affinity-purified BEAF (14) and we wished to ensure the
absence of any contaminating Drosophila DNA binding factors.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Isolation of new genomic BEAF binding sites. (A) DNA
fractions enriched in BEAF binding sites were prepared from fragmented
genomic DNA by an enrichment procedure as outlined schematically in
this panel. oligos, oligonucleotides. (B) The relative enrichment for
BEAF binding fragments was assayed by competition gel shift analysis.
The samples contained a fixed amount of BEAF to titrate about half of
the radiolabeled scs' D subfragment and two levels of competitor DNA
(500 and 50 ng) obtained after each enrichment cycle, as indicated. IP,
immunoprecipitation. (C) Some features of the scs' boundary element are
indicated. The arrowheads refer to the CGATA motifs (* for motifs
mutated to CTCGA), the black bar indicates the nuclease-resitant core,
and the open bars represent the nuclease-hypersensitive regions. The
positions of the D and M subfragments are indicated. The dimerized MM
boundary construct and its mutant derivative M*M* are also
schematically represented.
|
|
The cycle of binding, immunoprecipitation, and amplification was
repeated several times, and the relative enrichment for fragments
with
BEAF binding sites was assessed by a competition band shift
experiment
(Fig.
1B). Binding reaction mixtures contained the
radiolabelled scs' D
subfragment as the probe and a fixed amount
of BEAF sufficient to shift
about 50% of the DNA probe. Two amounts
of amplified DNA obtained
after each enrichment cycle were added
to the reaction mixtures as
competitors. While it took 500 ng
of DNA obtained after the third cycle
of enrichment to achieve
significant dissociation of the probe-BEAF
complex, only 50 ng
of DNA from the fifth cycle was needed to achieve a
similar level
of competition (Fig.
1B).
Individual DNA fragments were cloned from the enriched DNA and
submitted to gel shift analyses. More than 10% of the 101 clones
tested were shifted by 32B (data not shown). Thus, the procedure
described above yielded a DNA fraction enriched in cBEs. Here,
we focus
our attention on three fragments: cBE76, cBE28, and
cBE51.
BEAF binds to variably arranged CGATA motifs in the cBEs.
The
two BEAF target sequences of the scs' element are both composed of
three CGATA sequences arranged as a palindrome plus a singlet motif.
This arrangement is depicted in Fig. 2A
for the high- and low-affinity sites (the D and B sites, respectively) present in scs', where arrowheads represent the CGATA motifs
(38). Sequence comparison of scs' with the new cBEs revealed
no homology other than clustered CGATA motifs. Interestingly, the
arrangement of these motifs varies (Fig. 2A). Two elements, cBE76 and
cBE28, have divergent motifs that overlap at the CG, creating an 8-bp palindrome containing a ClaI site, as indicated by
overlapping arrowheads. These extended ClaI sites often have
adjacent single CGATA motifs in either orientation. cBE51 is unique in
that it does not have an inverted repeat or an extended ClaI
site, although it does have three clustered CGATA motifs and a fourth
one a short distance away, all in the same orientation. In addition,
cBE51 has two ClaI sites that have a 1-bp terminal mismatch
with the extended motif. Despite variability in CGATA motif position
and orientation between the cBEs and scs', the sequences can be aligned to indicate a striking level of homology that encompasses as many as
four clustered CGATA motifs with one extended ClaI site
(Fig. 2B). Note that the low-affinity scs' B site aligns least well with these other sequences.
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 2.
The selected cBEs share CGATA motifs and contain
high-affinity sites for BEAF. (A) The position and arrangement of the
CGATA motifs (arrowheads) are shown for the scs' fragment and the new
cBEs cBE76, -28, and -51. The shaded boxes highlight the sequences
shown in panel B. (B) The highest sequence homologies found among the
various cBEs and scs' correspond to CGATA clusters. Only the bases
shared by at least half of the sequences are shaded. The CGATA motifs
are indicated by arrows above the sequences. The positions of the point
mutations introduced into the scs' D site are marked with asterisks.
(C) The isolated cBEs contain high-affinity binding sites for BEAF.
Affinity-purified BEAF was added in steps increased by a factor of 3. From the relative intensities of the shifted probes, we estimated that
BEAF binds the cBEs as well as or better than the high-affinity D site
of scs'.
|
|
Like bacterially expressed 32B, BEAF purified from
Drosophila binds to these cBEs with very high affinity (Fig.
2C). We roughly
estimated the affinity for these cBEs to be 2 to 10 times higher
than that for the scs' D subfragment, for which BEAF has a
Kd of about 25 pM. The
Kd
of BEAF for the scs' B site is about 600
pM. Perhaps this lower
affinity is related to the lesser homology
with the sequences presented
in Fig.
2B.
DNase I footprinting experiments confirmed the importance of the CGATA
clusters for binding. As for scs', all CGATA motifs
were protected by
BEAF from DNase I, while other sequences remained
accessible (Fig.
3), and similar footprints were obtained
for
both BEAF and 32B proteins (Fig.
3C and data not shown). It is
of
particular interest that the footprints on cBE76 and cBE28
are
bipartite, protecting the two CGATA clusters that are separated
by
about 70 and 50 bp, respectively, but not the sequences in
between. As
previously observed for the scs' D site (
14), the
DNase I
footprints of BEAF often have adjacent hypersensitive
sites (Fig.
3A
and B) that are less prominent or absent when 32B
is used (data not
shown).
View larger version (100K):
[in this window]
[in a new window]
|
FIG. 3.
Footprint analysis of cBEs: protected regions and
hypersensitive sites. Footprint analyses of cBE76 (A), cBE28 (B), and
cBE51 (C) were done by using increasing amounts of either
affinity-purified BEAF or bacterially expressed 32B protein, as
indicated. Induced hypersensitive sites (hs) are marked. Boxed regions
indicate the DNase I footprints, and the arrowheads indicate the CGATA
motifs.
|
|
In conclusion, the different genomic BEAF binding sites consist
of several clustered CGATA motifs to which BEAF binds with
high
affinity despite the varied arrangement of the
motifs.
cBEs neither activate transcription nor block upstream
enhancers in transient expression assays.
The sequence of
cBE76 was present in the Drosophila DNA databases, but
those of the other cBEs were not. This 320-bp fragment corresponds
to upstream sequences from 350 to 670 of the inosine monophosphate dehydrogenase gene (IMPdH) at the
raspberry locus (26; see Fig. 5A). This
prompted us to test whether cBEs act as upstream activating sequences.
All cBEs were placed 5' of a 227-bp hsp27 CAT reporter gene
which contains no upstream activating elements (30, 38). The
full-length 1,200-bp hsp27 promoter, which encompasses an
ecdysone response element (ERE), as well as three heat shock elements
(HSE; 30), was used as a positive control.
Furthermore, all transfections included a plasmid expressing a
luciferase gene from an actin 5C promoter to assess the
efficiency of transfection. CAT enzyme activity levels were measured
after transient transfection of Drosophila D1 cells.
In line with previous observations made for the scs' element
(38), the presence of the cBEs did not stimulate CAT
significantly above the background. In contrast, high-level
expression was observed following activation of the 1,200-bp promoter
construct by ecdysone or heat shock (Fig. 4A).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
cBEs do not activate transcription, and cBE76 does not
block upstream enhancers in transient expression assays. Different CAT
reporter constructs were assayed by transient transfection into
Drosophila D1 cells. (A) Upstream activating sequence
assay. Relative CAT activities obtained when the indicated sequences
were inserted upstream of the minimal 227-bp hsp27 CAT
reporter gene. Ecdysone or heat shock induction of a 1.2-kb
hsp27 promoter (B), which contains the ERE and HSE, served
as the positive control. (B) The enhancer-blocking capacities of cBE76
(both orientations), scs', and a 200-bp fragment containing a Gal4
binding site were tested. These fragments were inserted into the
1,200-bp hsp27 promoter between the promoter and the
upstream HSE and ERE as shown. Relative CAT activity obtained following
treatment with ecdysone (ecd) or heat shock (h.s.) or without treatment
() is shown.
|
|
We also tested the enhancer-blocking potential of cBE76 by inserting it
between the promoter and the upstream ERE and HSE
enhancers of the
1,200-bp
hsp27 reporter gene (Fig.
4B). A fragment
containing Gal4 binding sites was used as a neutral sequence to
control
for spacing effects. Neither cBE76, in either orientation,
nor scs'
affected the CAT activity in extracts prepared from transiently
transfected cells after heat shock or ecdysone induction (Fig.
4B).
These sequences act as neutral spacers; they do not activate
or
insulate in transient expression assays. We have previously
used the
same reporter gene to demonstrate that enhancer blocking
by scs' is
only observed following stable genomic integration
of the transgene
(
38).
Boundary elements do not block upstream enhancers in transient
expression assays and do not activate transcription. Therefore,
these
results are consistent with the possibility that the cBEs
are boundary
elements.
cBE76 contains a nuclease-hypersensitive site.
Regulatory DNA
elements often form structures in chromatin that are hypersensitive to
nuclease digestion, and the scs and scs' special chromatin structures
were originally identified as major nuclease-hypersensitive sites
bracketing the heat shock puff (33). Indeed, it appears that
boundary elements are generally associated with hypersensitive sites
(4, 6, 18, 34, 35). It was of interest, therefore, to
examine cBE76 for nuclease hypersensitivity. Our analysis revealed a
major hypersensitive site in the cBE76 region and a second one about
200 bp closer to the transcription start site (Fig.
5A). The sequences in between are notably
AT rich. Similar results were obtained with micrococcal nuclease
digestions (data not shown). As with the transient expression results,
this result is consistent with the possibility that cBE76 is a boundary
element.
View larger version (65K):
[in this window]
[in a new window]
|
FIG. 5.
Two hypersensitive sites are present in the 5' region of
the IMPdH raspberry gene, one of which overlaps cBE76.
Nuclei isolated from Kc cells were treated with DNase I for different
lengths of time. The isolated DNA was subjected to indirect end
labelling with a PvuII-XhoI fragment from the
IMPdH gene as a probe (shown in the map on the right). A
major hypersensitive site (hatched box) localizes to the cBE76 fragment
(filled box). A second hypersensitive site is located 200 bp closer to
the IMPDH gene. Lane EcoRI contained genomic DNA cut with
PvuII and EcoRI (which cuts within cBE76) as a
size standard.
|
|
The two hypersensitive sites upstream of the
IMPdH gene are
reminiscent of scs and scs', which contain a pair of sites separated
by
an AT-rich region. It needs to be stressed, however, that while
our
data (see below) implicate cBE76 in boundary function, we
do
not know if sequences encompassing the
IMPdH
promoter-proximal
hypersensitive site could enhance boundary activity
or function
as a transcription regulation element of this
promoter.
cBE76 and cBE28 function as boundary elements in transgenic
flies.
We investigated the boundary activity of the cBEs by
testing their ability to shield a mini-white reporter gene
(27) from chromosomal position effects, as originally done
for scs and scs' by Kellum and Schedl (20). This gene has a
minimal promoter which drives low levels of expression, although after
chromosomal integration, it is often activated to higher levels through
adventitious interactions with endogenous enhancers in the vicinity.
Consequently, when the gene is integrated into fly strains that have
white eyes, the transformed flies display a range of eye color
phenotypes. The relative level of expression is conveniently assessed
on the basis of eye color, which changes with increased
expression from yellow through orange to dark red (20, 34).
When bracketed by boundary elements, the mini-white gene is
insulated from these chromosomal position effects so that there is less
variability in eye color between independent transgenic lines, and most
lines have yellow eyes.
For this assay, we placed cBE76 or cBE28 5' of a mini-
white
gene construct that had a 3' scs element (Fig.
6D and E). As negative
controls, we used
the mini-
white reporter without bracketing elements
or with
only a 3' scs element, and as a positive control, we used
the
mini-
white reporter bracketed by the scs' and scs elements
(Fig.
6A, B, and C). At least 10 independent transgenic lines
were
obtained for each construct by P-element-mediated transformation.
We
then scored animals from each line for their eye color phenotype.
The
data are summarized in Table
1, and
representative photographs
of the different transgenic lines are shown
in Fig.
6.
View larger version (98K):
[in this window]
[in a new window]
|
FIG. 6.
cBEs confer position-independent expression on a
mini-white reporter gene, and point mutations in a BEAF
binding site abolish this activity. Young (~48-h-old), heterozygous
females are shown, each representing one independent transgenic fly
line obtained by P-element-mediated transformation with the indicated
mini-white constructs. (A) Mini-white gene
without bracketing elements. (B) The 990-bp scs PvuII
fragment was inserted 3' of the mini-white gene. (C through
G) Derived from B by inserting the following DNA sequences 5' of the
mini-white gene: C, 515-bp scs' fragment; D, cBE76; E,
cBE28; F, scs'-derivative MM dimerized fragment; G, scs'-derivative
M*M* dimerized fragment. MM consists of a 227-bp fragment containing
the scs' D (high-affinity) site as a dimer such that the spacing
between BEAF binding sites is the same as that found in scs' for the B
(low-affinity) and D sites, and the M*M* sequence differs only in
having point mutations in all CGATA motifs to eliminate binding by
BEAF.
|
|
As found previously by others (
4,
20), mini-
white
gene expression levels varied greatly between transgenic lines lacking
flanking boundary elements. Among the 12 transgenic lines, 7 had
red
eyes, 3 had orange eyes, and only 2 displayed yellow eyes.
Thus, the
expression was strongly skewed toward high levels (red
and orange),
supposedly due to chromosomal position effects caused
by activation by
enhancers near the sites of integration. A similar
effect was observed
for the mini-
white reporter flanked only on
the 3' side by
scs; eye colors were skewed toward high-level,
unbuffered expression
(Fig.
6A and B and Table
1). In contrast,
as shown originally by Kellum
and Schedl (
20), bracketing of
the mini-
white
gene by scs' and scs greatly reduces these position
effects so that
most transgenic lines have yellow eyes (Fig.
6C
and Table
1).
Similar insulated expression was obtained when cBE76 replaced scs'.
Among the 12 lines transgenic for cBE76, 10 had yellow
eyes, only 2 had
(light) orange eyes, and none displayed red eyes
(Fig.
6D and Table
1).
These data identify cBE76 as a boundary
element
hereafter called
BE76
that is located upstream of the
IMPdH gene.
The 270-bp cBE28 fragment (hereafter called BE28) was also found to
have a boundary function. Of 19 lines transgenic for BE28,
13 had
yellow eyes, 5 had orange eyes (4 had light orange eyes),
and 1 had red
eyes (Fig.
6E and Table
1). Southern analyses showed
that most lines
had a single P-element insertion, but the red-eyed
BE28 line had
multiple P elements (see Materials and Methods),
so in this case, the
red-eye phenotype could be due to gene dosage.
Thus, both cBEs insulate
the mini-
white gene from chromosomal
position effects,
identifying them as new boundary
elements.
BEAF binding sites are involved in boundary function.
BEAF
binds to the CGATA clusters present in scs' and the cBEs, so we
evaluated the functional importance of BEAF binding sites by
mutagenesis of CGATA motifs. A tandem repeat of a 215-bp region of scs'
(fragment M) encompassing the high-affinity D site (Fig. 1C) was
constructed such that the spacing between the two binding sites (227 bp) was the same as that between the high (D)- and low (B)-affinity
binding sites in scs' (Fig. 1C). A similar dimer was constructed in
which all CGATA motifs were changed to CTCGA; these mutations abolished
binding by Drosophila BEAF (14 and data
not shown). We refer to the first dimer as MM and the mutated version
as M*M*.
These constructs were placed 5' of the mini-
white gene with
scs positioned 3' and tested in flies as described above. We obtained
10 transgenic lines for each construct (Fig.
6F and G and Table
1). The
MM construct convincingly buffered mini-
white gene
expression
from position effects; seven lines had yellow eyes, while
only
two had (light) orange eyes and one had red eyes. Hence, the dimer
construct containing the tight binding sites of scs' serves as
an
efficient boundary element. In stark contrast, the majority
of fly
lines containing the M*M* construct had red eyes and only
two lines had
yellow eyes. Thus, the BEAF binding site is necessary
for the boundary
element function of this sequence, strongly suggesting
that binding by
BEAF is
necessary.
| |
DISCUSSION |
BEAF binds to the scs' boundary element and immunolocalizes to
hundreds of interband regions on Drosophila polytene
chromosomes (38). We isolated genomic DNA fragments
containing BEAF binding sites in order to assess whether these binding
sites possess boundary activity and to identify their consensus
sequence motifs. Our demonstration that these sequences protect a
reporter gene from chromosomal position effects and that the BEAF
binding site is important for this activity provides the first example
of a class of boundary elements that have a binding protein in common
and argues that the numerous genomic BEAF binding sites represent boundary elements.
Protein binding sites in the cBEs.
Like scs', the cBEs
described here have clustered CGATA motifs. Interestingly, no
preferential arrangement of these motifs emerged and perfect inverted
repeats, as present in scs', are not necessary for binding by BEAF.
That BEAF primarily recognizes the CGATA motifs was demonstrated by
DNase I footprinting experiments. For instance, BE76 and BE28 both have
two clusters of motifs separated by 50 to 70 bp and BEAF protects both
clusters but not the intervening DNA. We previously reported evidence
that BEAF in Drosophila nuclear extracts binds DNA
predominantly as trimers composed of one 32A and two 32B subunits, and
it is 32B that recognizes the CGATA motif (14). Here we
observed that all CGATA motifs present in the cBEs were protected,
suggesting that complexes larger than trimers might stabilize binding
to low-affinity sites as observed for scs' (14).
One reason for isolating genomic cBEs was to search for further
associated factors. Indeed, an additional binding activity
which bound
to BE76 and BE28 was detected in
Drosophila nuclear
extracts. This activity was purified by DNA affinity
chromatography
and identified by peptide sequencing as transcription
factor DREF
(
15). DREF binds to extended
ClaI
sites, as found in BE76 and
BE28, and is implicated in the regulation
of several genes, including
some involved in DNA replication (
16,
17,
23). The in vitro
interaction of DREF with these boundary
elements is intriguing.
However, neither the transient expression nor
the transgenic fly
data presented here provided evidence that BE28 or
BE76 significantly
activated transcription. We also found that binding
by BEAF and
DREF to these elements was mutually exclusive. It is
possible
that, depending on the developmental stage or the specific
tissue,
binding by one excludes any effect of the other and the
conditions
we assayed did not allow activation by
DREF.
Boundary activity of the cBEs and BEAF binding sites.
We have
biochemically characterized three of the cBEs, and two were assayed for
the ability to confer position-independent expression of the
mini-white gene. The ability of a sequence to insulate
against chromosomal position effects is inferred by examining the
distribution of eye colors obtained from a suitable number of
independent transformants. In our case, position-independent expression
would result in low-level expression manifested as yellow or light
orange eyes in nearly all lines with a particular construct. We have
obtained at least 10 lines for each construct and found BE76 and BE28
to be at least as effective as scs' at buffering mini-white
expression (Table 1). The few lines with darker eyes obtained for
constructs containing boundary elements presumably result from
infrequent integration events near enhancers with particularly strong
affinity for the white promoter. It is known that not all
enhancer-promoter combinations are blocked in enhancer-blocking assays.
For instance, Vazquez and Schedl (35) found that scs' does
not effectively block interactions between the promoter and eye
enhancer of the white gene. They went on to show that simple
reiteration of a 200-bp scs subfragment up to a tetramer resulted
in progressive improvement in enhancer-blocking ability from no
blocking to an effectiveness equivalent to that of the original scs
element. Although BE28 and BE76 are potent boundary elements
despite their small sizes (320 and 270 bp, respectively), it would be
of interest to see if reiteration or inclusion of flanking sequences
would further improve their potency.
The functional importance of BEAF binding sites was addressed with an
artificial construct composed of a dimerized fragment
of scs'
containing the high-affinity binding site. This 215-bp
region of scs'
was sufficient for boundary activity as a dimer.
Mutating the CGATA
motifs clearly eliminated boundary activity,
demonstrating the
importance of these
motifs.
Interestingly, the mutations eliminated binding by 32B and BEAF
purified from
Drosophila but not by bacterially expressed
32A protein. Either 32A does not bind these sequences in vivo
despite its ability to do so in vitro, or 32A alone is not sufficient
for boundary activity, at least in this sequence context.
Immunostaining
of polytene chromosomes suggested that the ratio of 32A
to 32B
varies at different loci (
14), raising the
possibility that
32A can act without 32B in some sequence contexts. Our
transgenic
fly data extend the somewhat equivocal results obtained by
using
cultured cells containing many copies of the integrated transgene
per transgenic line (
38). In that study, seven tandem copies
of a 48-bp oligonucleotide containing the scs' high-affinity binding
site blocked an upstream enhancer, although not as effectively
as scs'.
Point mutations in the CGATA motifs identical to those
used in the
present study impaired, but did not completely eliminate,
the
enhancer-blocking ability of the 7-mer. Perhaps those results
were not
clearer because the large tandem arrays of transgenes
integrated into
the chromosomes compromised the assay, or perhaps
some aspect of the
constructs, such as spacing between BEAF binding
sites, was not
optimal. The dimerized fragment used here maintained
the spacing of the
BEAF binding sites of scs'. It will be important
to determine the role
of spacing between binding sites and to
find out whether scs'
sequences, in addition to the BEAF binding
sites, are involved. In this
regard, neither BE76 nor BE28 has
BEAF binding sites separated by 200 bp, as found in scs'. Combined
with the BE76 and BE28 data, we propose
that the role of BEAF
in boundary function relies on a somewhat
flexible clustering
of CGATA
motifs.
The BEAF class of boundary elements.
If the notion of
partitioning the genome into functional domains is correct, then one
would expect there to be a limited number of classes of boundary
elements that bracket the domains. A class would be defined by
conserved sequence elements and the proteins involved in establishing
boundary activity, although there could be overlap between classes. Yet
no notable sequence homology or common binding activity has been found
for the few boundary elements described so far, such as the su(Hw)
binding sites, scs, scs', Mcp, and Fab7, although in all cases
examined, nuclease-hypersensitive sites localize to these elements
(6, 7, 12, 18, 34). This lack of common features, combined
with the difficulty of identifying boundary elements despite their
proposed importance, has called the functional-domain model into question.
The data presented here identify for the first time a class of boundary
elements that have a sequence motif and binding protein
in common,
i.e., the clustered CGATA sequences to which BEAF binds.
Thus, the
boundary activity of certain elements is not an isolated
phenomenon but appears to occur generally throughout the genome.
This
is based on the function of the cBEs in transgenic flies,
although the
physical location of BE76 upstream of a transcription
unit is also
consistent with its being a domain boundary. BE76
also appears to
localize to a band-interband junction in the
raspberry locus
at 9E3 on polytene chromosomes (
5). Significantly, there
are
roughly 400 copies of BE28 sequences dispersed along the chromosome
arms, suggesting that BE28 represents a family of boundary elements
within the class that interacts with BEAF (
5). We are
currently
analyzing the structure of the repeat and its genomic
distribution
in more detail. Perhaps it will be a better model for
studying
boundary elements and provide a useful tool for gaining
insight
into the functional organization of chromosomes. It might
also
help in addressing the notion that the physical organization of
polytene chromosomes into bands and interbands may reflect a functional
organization into
domains.
| |
ACKNOWLEDGMENTS |
We are grateful to Vincenzo Pirrotta for sharing expertise
and materials to work with flies. We acknowledge the generous
advice of Francois Karch, Christophe Tatout, and Martin Müller.
We thank Therese Durussel-Jost and I. Hogga for technical expertise and N. Roggli for help with the preparation of the figures.
This work was supported by the Swiss National Fund, the Canton of
Geneva, and the Louis Jeantet Foundation.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Biochemistry and Molecular Biology, University of Geneva, 30, Quai
Ernest-Ansermet, CH-1211 Geneva 4, Switzerland. Phone: 41-22-702-6122. Fax: 41-22-702-6868. E-mail: Laemmli{at}sc2a.unige.ch.
| |
REFERENCES |
| 1.
|
Adachi, Y., and U. K. Laemmli.
1992.
Identification of nuclear prereplication centers poised for DNA synthesis in Xenopus egg extracts: immunolocalization study of replication protein A.
J. Cell Biol.
119:1-15[Abstract/Free Full Text].
|
| 2.
|
Cai, H., and M. Levine.
1995.
Modulation of enhancer-promoter interactions by insulators in the Drosophila embryo.
Nature
376:533-536[Medline].
|
| 3.
|
Cai, H., and M. Levine.
1997.
The gypsy insulator can function as a promoter-specific silencer in the Drosophila embryo.
EMBO J.
16:1732-1741[Medline].
|
| 4.
|
Chung, J. H.,
M. Whiteley, and G. Felsenfeld.
1993.
A 5' element of the chicken  -globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila.
Cell
74:505-514[Medline].
|
| 5.
| Cuvier, O., and U. K. Laemmli. Unpublished
data.
|
| 6.
|
Ellis, J.,
K. C. Tan-Un,
A. Harper,
D. Michalovich,
N. Yannoutsos,
S. Philipsen, and F. Grosveld.
1996.
A dominant chromatin-opening activity in 5' hypersensitive site 3 of the human -globin locus control region.
EMBO J.
15:562-568[Medline].
|
| 7.
|
Galloni, M.,
H. Gyurkovics,
P. Schedl, and F. Karch.
1993.
The bluetail transposon: evidence for independent cis-regulatory domains and domain boundaries in the bithorax complex.
EMBO J.
12:1087-1097[Medline].
|
| 8.
|
Gdula, D. A., and V. G. Corces.
1997.
Characterization of functional domains of the su(Hw) protein that mediate the silencing effect of mod(mdg4) mutations.
Genetics
145:153-161[Abstract].
|
| 9.
|
Gerasimova, T. I.,
D. A. Gdula,
D. V. Gerasimov,
O. Simonova, and V. G. Corces.
1995.
A Drosophila protein that imparts directionality on a chromatin insulator is an enhancer of position-effect variegation.
Cell
82:587-597[Medline].
|
| 10.
|
Gerasimova, T. I., and V. G. Corces.
1996.
Boundary and insulator elements in chromosomes.
Curr. Opin. Genet. Dev.
6:185-192[Medline].
|
| 11.
|
Geyer, P. K., and V. G. Corces.
1992.
DNA position-specific repression of transcription by a Drosophila zinc finger protein.
Genes Dev.
6:1865-1873[Abstract/Free Full Text].
|
| 12.
|
Hagström, K.,
M. Muller, and P. Schedl.
1996.
Fab-7 functions as a chromatin domain boundary to ensure proper segment specification by the Drosophila bithorax complex.
Genes Dev.
10:3202-3215[Abstract/Free Full Text].
|
| 13.
|
Harrison, D. A.,
D. A. Gdula,
R. S. Coyne, and V. G. Corces.
1993.
A leucine zipper domain of the suppressor of Hairy-wing protein mediates its repressive effect on enhancer function.
Genes Dev.
7:1966-1978[Abstract/Free Full Text].
|
| 14.
|
Hart, C. M.,
K. Zhao, and U. K. Laemmli.
1997.
The scs' boundary element: characterization of boundary element-associated factors.
Mol. Cell. Biol.
17:999-1009[Abstract].
|
| 15.
| Hart, C. M., O. Cuvier, and U. K. Laemmli. Unpublished data.
|
| 16.
|
Hirose, F.,
M. Yamaguchi,
H. Handa,
Y. Inomata, and A. Matsukage.
1993.
Novel 8-base pair sequence (Drosophila DNA replication-related element) and specific binding factor involved in the expression of Drosophila genes for DNA polymerase alpha and proliferating cell nuclear antigen.
J. Biol. Chem.
268:2092-2099[Abstract/Free Full Text].
|
| 17.
|
Hirose, F.,
M. Yamaguchi,
K. Kuroda,
A. Omori,
T. Hachiya,
M. Ikeda,
Y. Nishimoto, and A. Matsukage.
1996.
Isolation and characterization of cDNA for DREF, a promoter-activating factor for Drosophila DNA replication-related genes.
J. Biol. Chem.
271:3930-3937[Abstract/Free Full Text].
|
| 18.
|
Karch, F.,
M. Galloni,
L. Sipos,
J. Gausz,
H. Gyurkovics, and P. Schedl.
1994.
Mcp and Fab-7: molecular analysis of putative boundaries of cis-regulatory domains in the bithorax complex of Drosophila melanogaster.
Nucleic Acids Res.
22:3138-3146[Abstract/Free Full Text].
|
| 19.
|
Käs, E., and U. K. Laemmli.
1992.
In vivo topoisomerase II cleavage of the Drosophila histone and satellite III repeats: DNA sequence and structural characteristics.
EMBO J.
11:705-716[Medline].
|
| 20.
|
Kellum, R., and P. Schedl.
1991.
A position-effect assay for boundaries of higher order chromosomal domains.
Cell
64:941-950[Medline].
|
| 21.
|
Kellum, R., and P. Schedl.
1992.
A group of scs elements function as domain boundaries in an enhancer-blocking assay.
Mol. Cell. Biol.
12:2424-2431[Abstract/Free Full Text].
|
| 22.
|
Kim, J.,
B. Shen,
C. Rosen, and D. Dorsett.
1996.
The DNA-binding and enhancer-blocking domains of the Drosophila suppressor of Hairy-wing protein.
Mol. Cell. Biol.
16:3381-3392[Abstract].
|
| 23.
|
Matsukage, A.,
F. Hirose,
Y. Hayashi,
K. Hamada, and M. Yamaguchi.
1995.
The DRE sequence TATCGATA, a putative promoter-activating element for Drosophila melanogaster cell-proliferation-related genes.
Gene
166:233-236[Medline].
|
| 24.
|
Mirkovitch, J.,
M. E. Mirault, and U. K. Laemmli.
1984.
Organization of the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold.
Cell
39:223-232[Medline].
|
| 25.
|
Mueller, P. R., and B. Wold.
1989.
In vivo footprinting of a muscle specific enhancer by ligation mediated PCR.
Science
246:780-786[Abstract/Free Full Text].
|
| 26.
|
Nash, D.,
S. Hu,
N. J. Leonard,
S. Y. K. Tiong, and D. Fillips.
1994.
The raspberry locus of Drosophila melanogaster includes an inosine monophosphate dehydrogenase like coding sequence.
Genome
37:333-344[Medline].
|
| 27.
|
Pirrotta, V.
1983.
Vectors for P-mediated transformation in Drosophila, p. 437-456.
In
R. L. Rodriguez, and D. T. Denhardt (ed.), Vectors: a survey of molecular cloning vectors and their uses. Butterworths, London, England.
|
| 28.
|
Pirrotta, V.,
H. Steller, and M. P. Bozzetti.
1985.
Multiple upstream regulatory elements control the expression of the Drosophila white gene.
EMBO J.
4:3501-3508[Medline].
|
| 29.
|
Qian, S., and V. Pirrotta.
1995.
Dosage compensation of the Drosophila white gene requires both the x chromosome environment and multiple intragenic elements.
Genetics
139:733-744[Abstract].
|
| 30.
|
Riddihough, G., and H. R. B. Pelham.
1986.
Activation of the Drosophila hsp27 promoter by heat shock and by ecdysones involves independent and remote regulatory sequences.
EMBO J.
5:1653-1658[Medline].
|
| 31.
|
Roseman, R. R.,
V. Pirrotta, and P. K. Geyer.
1993.
The su(Hw) protein insulates expression of the Drosophila melanogaster white gene from chromosomal position-effects.
EMBO J.
12:435-442[Medline].
|
| 32.
|
Scott, K. S., and P. K. Geyer.
1995.
Effects of the su(Hw) insulator protein on the expression of the divergently transcribed Drosophila yolk protein gene.
EMBO J.
14:6258-6267[Medline].
|
| 33.
|
Udvardy, A.,
E. Maine, and P. Schedl.
1985.
The 87A7 chromomere. Identification of novel chromatin structures flanking the heat shock locus that may define the boundaries of higher order domains.
J. Mol. Biol.
185:341-358[Medline].
|
| 34.
|
Vazquez, J.,
G. Farkas,
M. Gaszner,
A. Udvardy,
M. Muller,
K. Hagstrom,
H. Gyurkovics,
L. Sipos,
J. Gausz,
M. Galloni,
I. Hogga,
F. Karch, and P. Schedl.
1993.
Genetic and molecular analysis of chromatin domains.
Cold Spring Harbor Symp. Quant. Biol.
58:45-53[Abstract/Free Full Text].
|
| 35.
|
Vazquez, J., and P. Schedl.
1994.
Sequences required for enhancer blocking activity of scs are located within two nuclease-hypersensitive regions.
EMBO J.
13:5984-5993[Medline].
|
| 36.
|
Wu, C.
1980.
The 5' ends of Drosophila heat shock genes in chromatin are hypersensitive to DNase I.
Nature
286:854-860[Medline].
|
| 37.
|
Xiao, H.,
O. Perisic, and J. T. Lis.
1991.
Cooperative binding of Drosophila heat shock factor to arrays of a conserved 5 bp unit.
Cell
64:585-593[Medline].
|
| 38.
|
Zhao, K.,
C. M. Hart, and U. K. Laemmli.
1995.
Visualization of chromosomal domains with boundary element-associated factor BEAF-32.
Cell
81:879-889[Medline].
|
Molecular and Cellular Biology, December 1998, p. 7478-7486, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jiang, N., Emberly, E., Cuvier, O., Hart, C. M.
(2009). Genome-Wide Mapping of Boundary Element-Associated Factor (BEAF) Binding Sites in Drosophila melanogaster Links BEAF to Transcription. Mol. Cell. Biol.
29: 3556-3568
[Abstract]
[Full Text]
-
Zhou, J., Zhou, B. O., Lenzmeier, B. A., Zhou, J.-Q.
(2009). Histone deacetylase Rpd3 antagonizes Sir2-dependent silent chromatin propagation. Nucleic Acids Res
37: 3699-3713
[Abstract]
[Full Text]
-
Bushey, A. M., Ramos, E., Corces, V. G.
(2009). Three subclasses of a Drosophila insulator show distinct and cell type-specific genomic distributions. Genes Dev.
23: 1338-1350
[Abstract]
[Full Text]
-
Kyrchanova, O., Chetverina, D., Maksimenko, O., Kullyev, A., Georgiev, P.
(2008). Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements. Nucleic Acids Res
36: 7019-7028
[Abstract]
[Full Text]
-
Pathak, R. U., Rangaraj, N., Kallappagoudar, S., Mishra, K., Mishra, R. K.
(2007). Boundary Element-Associated Factor 32B Connects Chromatin Domains to the Nuclear Matrix. Mol. Cell. Biol.
27: 4796-4806
[Abstract]
[Full Text]
-
Roy, S., Gilbert, M. K., Hart, C. M.
(2007). Characterization of BEAF Mutations Isolated by Homologous Recombination in Drosophila. Genetics
176: 801-813
[Abstract]
[Full Text]
-
Minami, H., Takahashi, J., Suto, A., Saitoh, Y., Tsutsumi, K.-i.
(2006). Binding of AlF-C, an Orc1-Binding Transcriptional Regulator, Enhances Replicator Activity of the Rat Aldolase B Origin. Mol. Cell. Biol.
26: 8770-8780
[Abstract]
[Full Text]
-
Parnell, T. J., Kuhn, E. J., Gilmore, B. L., Helou, C., Wold, M. S., Geyer, P. K.
(2006). Identification of Genomic Sites That Bind the Drosophila Suppressor of Hairy-wing Insulator Protein.. Mol. Cell. Biol.
26: 5983-5993
[Abstract]
[Full Text]
-
Gilbert, M. K., Tan, Y. Y., Hart, C. M.
(2006). The Drosophila Boundary Element-Associated Factors BEAF-32A and BEAF-32B Affect Chromatin Structure. Genetics
173: 1365-1375
[Abstract]
[Full Text]
-
Ramos, E., Ghosh, D., Baxter, E., Corces, V. G.
(2006). Genomic Organization of gypsy Chromatin Insulators in Drosophila melanogaster. Genetics
172: 2337-2349
[Abstract]
[Full Text]
-
Wen, J., Huang, S., Pack, S. D., Yu, X., Brandt, S. J., Noguchi, C. T.
(2005). Tal1/SCL Binding to Pericentromeric DNA Represses Transcription. J. Biol. Chem.
280: 12956-12966
[Abstract]
[Full Text]
-
Sage, B. T., Jones, J. L., Holmes, A. L., Wu, M. D., Csink, A. K.
(2005). Sequence Elements in cis Influence Heterochromatic Silencing in trans. Mol. Cell. Biol.
25: 377-388
[Abstract]
[Full Text]
-
Kuhn, E. J., Hart, C. M., Geyer, P. K.
(2004). Studies of the Role of the Drosophila scs and scs' Insulators in Defining Boundaries of a Chromosome Puff. Mol. Cell. Biol.
24: 1470-1480
[Abstract]
[Full Text]
-
Blanton, J., Gaszner, M., Schedl, P.
(2003). Protein:protein interactions and the pairing of boundary elements in vivo. Genes Dev.
17: 664-675
[Abstract]
[Full Text]
-
Aulner, N., Monod, C., Mandicourt, G., Jullien, D., Cuvier, O., Sall, A., Janssen, S., Laemmli, U. K., Kas, E.
(2002). The AT-Hook Protein D1 Is Essential for Drosophila melanogaster Development and Is Implicated in Position-Effect Variegation. Mol. Cell. Biol.
22: 1218-1232
[Abstract]
[Full Text]
-
Smith, J. E. III, Cronmiller, C.
(2001). The Drosophila daughterless gene autoregulates and is controlled by both positive and negative cis regulation. Development
128: 4705-4714
[Abstract]
[Full Text]
-
Gaszner, M., Vazquez, J., Schedl, P.
(1999). The Zw5 protein, a component of the scs chromatin domain boundary, is able to block enhancer-promoter interaction. Genes Dev.
13: 2098-2107
[Abstract]
[Full Text]
Top
Abstract
Introduction
