Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 1998, p. 7537-7545, Vol. 18, No. 12
Department of Molecular Biophysics and
Biochemistry, Howard Hughes Medical Institute, Yale University, New
Haven, Connecticut 06536
Received 6 July 1998/Returned for modification 21 July
1998/Accepted 23 August 1998
To study the regulation of AUUUA-mediated RNA deadenylation and
destabilization during Xenopus early development, we
microinjected chimeric mRNAs containing Xenopus or
mammalian 3' untranslated region (3'-UTR) sequences into
Xenopus oocytes, mature eggs, or fertilized embryos. We
found that the AU-rich elements (ARE) of Xenopus
c-myc II and the human granulocyte-macrophage
colony-stimulating factor gene (GMCSF) both direct
deadenylation of chimeric mRNAs in an AUUUA-dependent manner. In the
case of the Xenopus c-myc II ARE, mutation of a
single AUUUA within an absolutely conserved 11-nucleotide region in
c-myc 3'-UTRs prevents ARE-mediated deadenylation. AUUUA-specific deadenylation appears to be developmentally regulated: low deadenylation activity is observed in the oocyte, whereas rapid
deadenylation occurs following egg activation or fertilization. Deadenylation results in the accumulation of stable deadenylated RNAs
that become degraded only following mid-blastula transition. We
conclude that ARE-mediated mRNA deadenylation can be uncoupled from
ARE-mediated mRNA decay and that AUUUAs directly signal
deadenylation during Xenopus early development.
mRNA destabilization is a major
mechanism for the posttranscriptional regulation of gene
expression. Many early-response genes, including proto-oncogenes
and cytokine and lymphokine genes, are regulated by the
instability of their mRNAs. The 3' untranslated regions
(3'-UTR) of these mRNAs contain AU-rich elements (AREs) that function to destabilize the mRNA in mammalian cells (7, 9,
43). These cis-acting destabilizing regions can
be quite variable in sequence and length but are characterized by one
or more AUUUA motifs intermittently and/or tandemly repeated within an
AU-rich region (9, 56). The AUUUA motifs within the ARE are
essential for destabilization; deletions or point mutations of the
AUUUAs substantially increase the stability of the mRNA, whereas
insertion of an AUUUA-rich ARE into the 3'-UTR of a stable mRNA
dramatically shortens its half-life (t1/2)
(43). Furthermore, increasing the number of tandem copies of
the AUUUA motif seems to correlate with greater efficiency of
ARE-mediated destabilization (10, 29, 56).
Several studies have suggested that the first step in ARE-mediated
decay is mRNA deadenylation, since partially deadenylated products are the only intermediates detected preceding complete mRNA decay for several different ARE-containing mammalian messages (6, 10, 44, 54). These intermediates are short-lived, suggesting that once the mRNA is deadenylated, it is rapidly degraded. In a mammalian in vitro degradation system, an mRNA lacking a poly(A)
tail is degraded much more rapidly than the same mRNA containing a
poly(A) tail (4, 6). However, since none of these systems
uncouple the deadenylation step from decay, it has not been possible to
determine whether AREs destabilize mRNAs by promoting the single event
of mRNA deadenylation (with resulting obligatory decay of the mRNA) or
whether the ARE also recruits an endo- or exonuclease that initiates
the degradation of the mRNA.
Many genes that are posttranscriptionally regulated by
ARE-mediated decay have been shown to play important roles in cell growth and differentiation. Early development is characterized by cell
growth and differentiation and is also a time when gene expression is
regulated extensively by posttranscriptional mechanisms (12). Xenopus early development is an attractive
system for studying regulatory phenomena because it can be carried out
in vitro and occurs rapidly, allowing the sampling of several stages of
development in a short period. Previous experiments designed to examine
whether ARE-mediated mRNA destabilization occurs in Xenopus laevis used mammalian AREs inserted into the 3'-UTR
of chimeric mRNAs; no ARE-mediated decay was observed in
the oocyte (27, 28). Moreover, during Xenopus
early development, the mammalian ARE was reported not to cause mRNA
destabilization but rather to inhibit the translation of the mRNA
containing the ARE (27, 33).
In contrast to ARE-mediated mRNA decay, variation in the level of
polyadenylation has been documented as an important mechanism for
posttranscriptional regulation of gene expression during
Xenopus early development (53). In the
oocyte nucleus, newly transcribed mRNAs acquire a poly(A) tail
directed by the AAUAAA poly(A) signal (52). Once
the mRNA travels to the cytoplasm, the length of its poly(A) tail
may change. Some mRNAs acquire longer poly(A) tails, whereas
others lose their poly(A) tails altogether (5, 17, 24). Egg
maturation, which results when oocytes advance to meiosis II, is
accompanied by many biochemical changes, including changes in
cytoplasmic poly(A) tail length (53). Cytoplasmic lengthening of the poly(A) tail is dependent on a cytoplasmic polyadenylation element (CPE) and the AAUAAA poly(A) signal
present in the 3'-UTR of the mRNA (19, 34).
Cytoplasmic poly(A) tail shortening is believed to be a
nonspecific default process resulting from an imbalance between
polyadenylation and deadenylation (20, 48). In most cases,
poly(A) tail shortening does not destabilize the mRNA prior to the
mid-blastula transition (MBT) (2, 42); however, there are
strong correlations between an mRNA's poly(A) tail length and its
translatability during this time (14, 21, 23, 41, 45).
To date, only one specific deadenylation signal has been characterized
and shown to act on certain mRNAs during Xenopus early development. The Eg-specific deadenylation element (EDEN) directs the
deadenylation of the Eg mRNAs following fertilization. Deadenylation results in the accumulation of stable poly(A) Our goal here was to ask whether ARE-mediated deadenylation and
decay can be documented in Xenopus and, if so, to study the developmental regulation of this process. Since much evidence suggests
that deadenylation is the first step of ARE-mediated decay
(6, 10, 44, 54), and because poly(A) Plasmid construction, structure of RNA substrates, and
nomenclature.
All plasmid constructs were derived from the Transcription templates.
Transcription templates are
diagrammed in Fig. 1.
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
AUUUA Sequences Direct mRNA Deadenylation Uncoupled
from Decay during Xenopus Early Development
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Eg mRNAs
that do not degrade until the mid-blastula stage of development
(5, 39).
transcripts appear to be relatively stable during early development (5, 39), our experiments were designed to detect
ARE-mediated effects on mRNA deadenylation as well as stability. We
injected chimeric transcripts containing an ARE with or without
a poly(A) tail of defined length (100 nucleotides [nt]) into
stage VI oocytes, fertilized eggs, or activated mature eggs.
Since these transcripts contained neither a CPE nor the AAUAAA
polyadenylation signal, AUUUA-mediated deadenylation could
be monitored in the absence of polyadenylation. We demonstrate that
both a Xenopus and a mammalian AUUUA-containing ARE can direct specific mRNA
deadenylation during Xenopus early development.
Furthermore, the deadenylation step of ARE-mediated decay is
uncoupled from decay of the mRNA body.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
13Tb
vector (22). The human
-globin open reading frame was PCR
amplified from the pSPk
c vector (46) by using a 5' primer
flanked by an NcoI site (5'h
G) and a 3' primer flanked by
a BglII site followed by an XbaI site (3'h
G).
This PCR product was then digested with NcoI and
XbaI and inserted into the NcoI/XbaI
site of the
13Tb vector to replace the cyclin coding region with the
coding region of human
-globin. The resulting
13Tb#2 construct
has a T7 promoter upstream of the Xenopus
-globin 5'-UTR
(already present in the vector) followed by the human
-globin coding
region. The template for a poly(A) tail of defined length (100 nt) was
made by annealing a poly(dA)100 oligonucleotide
(5'pA100) to a poly(dT)100 oligonucleotide (3'pA100). The oligonucleotides were flanked by a 5'
XbaI site and a 3' SacI site to allow insertion
of these annealed oligonucleotides into the
XbaI/SacI site of
13Tb#2; the resulting
construct was named
13Tb#21-2. All of the constructs used for in
vitro transcription were created by inserting the 3'-UTR of choice into
the BglII/XbaI site of
13Tb#21-2. This
insertion places the 3'-UTR between the BglII site following
the
-globin stop codon and the XbaI site preceding the
poly(A)100 tail. Transcripts initiated at the T7 promoter
therefore contain a Xenopus
-globin 5'-UTR (66 nt), a
human
-globin coding region (450 nt), a 3'-UTR of choice, and an
encoded poly(A)100 tail.

View larger version (45K):
[in a new window]
FIG. 1.
Constructs used to make T7 transcripts for
microinjection. Plasmids and corresponding chimeric transcripts are
named according to the 3'-UTR they contain. All in vitro-transcribed
chimeric mRNAs contain the same Xenopus globin 5'-UTR (66 nt) and human
-globin coding region (450 nt); only the 3'-UTR cloned
into the BglII/XbaI site of the
13Tb#21-2
vector differs as indicated. T7 transcription from an
XbaI-cut plasmid yields poly(A)
chimeric
transcripts, whereas T7 transcription from a SacI-cut
plasmid yields the corresponding poly(A)+ chimeric
transcripts with a 100-nt poly(A) tail. All in vitro-transcribed
chimeric RNAs were injected in 5' GpppG capped form.
(i) Xmyc.
The first 342 bp of Xenopus
c-myc II (which has been reported to be maternally
expressed) (51) 3'-UTR was PCR amplified from genomic
Xenopus DNA with a 5' primer flanked by a BglII
site (5'XmycUTR) and a 3' primer flanked by an XbaI site
(3'XmycUTR). The PCR product was cut with
BglII/XbaI and cloned into the
BglII/XbaI site of
Tb#21-2.
(ii) Xmyc-M1, Xmyc-M2,
Xmyc-M3, Xmyc-M2,3, and
Xmyc-M1,2,3.
PCR-based mutagenesis
was used to mutate one, two, or all three ATTTA sequences in the 3'-UTR
of Xmyc to AGGTA, and these PCR products were flanked by
BglII and XbaI sites to be cloned into the
BglII/XbaI site of
13Tb#21-2. The
Xmyc-M1 3'-UTR was PCR amplified by using the 5' primer
5'Xmyc-M1 and the 3' primer 3'XmycUTR. The Xmyc-M2 3'-UTR
was PCR amplified by using the 5' primer 5'XmycUTR and the 3' primer
3'Xmyc-M2, followed by PCR with the 3' primer 3'XmycUTR.
The Xmyc-M3 3'-UTR was PCR amplified by using the 5'
primer 5'XmycUTR and the 3' primer 3'Xmyc-M3, followed by PCR with the
3' primer 3'XmycUTR. The Xmyc-M2,3 3'-UTR was PCR amplified by using the 5' primer 5'XmycUTR and the 3' primer
Xmyc-M2,3, followed by PCR with the 3' primer 3'XmycUTR. The
Xmyc-M1,2,3 3'-UTR was PCR amplified
by using the 5' primer 5'Xmyc-M1 and the 3' primer Xmyc-M2,3, followed
by PCR with the 3' primer 3'XmycUTR.
(iii) AT-GMCSF.
The AT-granulocyte-macrophage
colony-stimulating factor (GMCSF) 3'-UTR sequence was PCR amplified
from the pR
GAT vector (43) with a 5' primer
flanked by a BglII site (5'AT-62) and a 3' primer flanked by
an XbaI site (3'AT-62), cut with
BglII/XbaI, and cloned into the
BglII/XbaI site of
13Tb#21-2.
(iv) GC-GMCSF.
The GC-GMCSF 3'-UTR sequence was made
by annealing complementary oligonucleotides 5'GC-GMCSF and 3'GC-GMCSF.
The annealed fragment was cut with BglII/XbaI and
cloned into the BglII/XbaI site of
13Tb#21-2.
(v) Xglob.
The Xenopus
-globin 3'-UTR
was PCR amplified from the
13Tb vector with a 5' primer flanked by a
BglII site (5'XglobUTR) and a 3' primer flanked by an
XbaI site (3'XglobUTR), cut with BglII/XbaI, and inserted into the
BglII/XbaI site of
13Tb#21-2.
Preparation of RNA substrates, microinjections, and RNA
analysis.
Internally labelled and 5'-capped transcripts were
synthesized in the presence of GpppG (Pharmacia) with a specific
activity of 105 cpm/ng by using [
-32P]UTP (Amersham).
transcripts were made by digesting the plasmid
with XbaI prior to transcription by T7 polymerase.
Poly(A)100+ transcripts were made by digesting
the plasmid with SacI prior to T7 transcription. Stage VI
oocytes were incubated in 1× modified Barth's saline [80 mM NaCl, 1 mM KCl, 0.8 mM MgSO4(H2O)7, 8 mM NaHCO3, 1 mM HEPES (pH 7.4), 0.7 mM CaCl2] and
cytoplasmically injected with 18 nl (20 to 40 pg) of RNA. Eggs,
embryos, and activated eggs were obtained by standard procedures
(26). Eggs and embryos were incubated in 4% Ficoll in 1/3
MMR (33 mM NaCl, 0.6 mM KCl, 0.3 mM MgCl2, 0.66 mM
CaCl2, 1.7 mM Na-HEPES [pH 7.8]) solution prior to
cytoplasmic injection with 18 nl (20 to 40 pg) of RNA. Embryos were
transferred to 1/3 Marc's modified Ringer's solution (MMR) 4 h
following fertilization. Oocytes, eggs, or embryos were collected at
indicated time points (10 per time point) and frozen at
80°C
preceding RNA extraction. RNA was extracted in proteinase K-sodium
dodecyl sulfate (SDS) buffer (50 mM NaCl, 50 mM Tris-Cl [pH 7.5], 5 mM EDTA, 0.5% SDS, 0.2 mg of proteinase K/ml) at 50°C followed by
phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation
and was analyzed by 6% denaturing polyacrylamide gel electrophoresis (PAGE).
Poly(A) tail analysis.
Fertilized eggs were injected with
5'-capped and internally labelled ([
32P]ATP)
poly(A)+ transcripts (20 to 40 pg). Eggs were collected
following injections at 0 and 8 h (for Xmyc) and 0 and
4 h (for AT-GMCSF). RNA was isolated from 20 eggs per
time point, and radioactivity was determined by scintillation counting.
The equivalent of 5,000 cpm of isolated RNA was subjected to RNase A
digestion in a total volume of 10 µl containing 10
4 U
of RNase A and 1 µg of tRNA and was incubated for 15 min at 37°C.
Uninjected poly(A)+ and poly(A)
transcripts were subjected to the same RNase A treatment for comparison. RNase A digestion products were fractionated by 10% denaturing PAGE, and the resistant poly(A) and several large products (see Fig. 2C and 4C) were quantitated by PhosphorImager analysis to
determine the relative levels of the poly(A) tail and the mRNA body.
Oligonucleotides and primers. The sequences of the oligonucleotides and primers used in this study are given in parentheses after their designations as follows: 5'hBG (5'-GACACCATGGTGCACCTG-3'), 3'hBG (5'-GCTCTAGAGCAGATCTTAGTGATACTTGTGGGCCAGG-3'), 5'pA100 [5'-GCTCTAGAA(A)96AAGAGCTCCCC-3'], 3'pA100 [5'-GGGGAGCTC(T)99TCTAGAGC-3'], 5'XmycUTR (5'-GAAGATCTTCACAAACTCTTATT-3'), 3'mycUTR (5'-GCTCTAGACAGAGCCAAACTTCAGG-3'), 5'Xmyc-M1 (5'-GAAGATCTTCACAAACTCTTAGGTAACACTTTA-3'), 3'Xmyc-M2 (5'-TAAATGTTTTACCTACAAAGGTTG-3'), 3'Xmyc-M3 (5'-AAGAAAAATACCTGTTTTAAATAC-3'), 3'Xmyc-M2,3 (5'-GTTTATAAGAAAAATACCTGTTTTACCTACAAAAGGTTG-3'), 5'AT-62 (5'-GAAGATCTGATCAGTAATATTTATAT-3'), 3'AT-62 (5'GCTCTAGATGCTTAAATAAATAAA-3'), 5'-GC-GMCSF (5'-GAAGATCTGATCAGTAATATGAATACATCTGAATGTCTGGAATA TTGATTGATAAGCTTAGTCGACCATCTAGAGC-3'), 3'GC-GMCSF (5'GCTCTAGATGGTCGACTAAGCTTATCAATCAATATTCCAGACATTCAGATGTATTCATATTACTGATCAGATCTTC-3'), 5'XglobUTR (5'-GAAGATCTAACCAGCCTCAAG-3'), and 3'XglobUTR (5'-GCTCTAGAGCAGATACGAATGGC-3').
| |
RESULTS |
|---|
|
|
|---|
The AU-rich portion of the Xenopus c-myc II 3'-UTR directs mRNA deadenylation. The Xenopus c-myc II 3'-UTR was used to test whether a Xenopus AUUUA-rich sequence could direct deadenylation or decay of a chimeric mRNA during Xenopus early development. The c-myc 3'-UTR was chosen because mammalian c-myc mRNA is subject to efficient ARE-mediated decay (6, 10, 25). We focused on the first 342 residues of the Xenopus c-myc II 3'-UTR because this region is AU-rich and contains three AUUUA sequences (the total 3'-UTR is 950 nt). The construct Xmyc, used to generate RNAs for injection into stage VI oocytes and mature or fertilized eggs, is diagrammed in Fig. 1. In vitro transcription from the T7 promoter of the SacI-cut Xmyc vector yields chimeric mRNAs containing a Xenopus globin 5'-UTR, a human globin coding region followed by the first 342 nt of the Xenopus c-myc II 3'-UTR, and a poly(A) tail of 100 nt. The coinjected Xglob mRNA control is identical to Xmyc except that the Xenopus c-myc II 3'-UTR sequences are replaced with the Xenopus globin 3'-UTR, up to but not including the poly(A) signal (Fig. 1). The in vitro-transcribed RNAs contain neither a CPE nor the AAUAAA polyadenylation signal; thus, transcripts should not be subject to poly(A) tail lengthening.
When coinjected into the cytoplasm of stage VI oocytes, both the Xmyc and control Xglob transcript were stable in their polyadenylated forms up to 30 h (Fig. 2A). In oocytes induced to mature in vitro by incubation with progesterone, both transcripts were deadenylated nonspecifically at a similar rate (data not shown). This nonspecific deadenylation activity in mature eggs has been previously described as the default deadenylation of transcripts lacking a CPE or a polyadenylation signal (20, 48).
|
AGGUA mutations in the 3'-UTR of mammalian
mRNAs have been shown previously to abolish the destabilizing effect
conferred by AREs (43, 56). When microinjected into fertilized eggs, the Xmyc-M1,2,3
transcript was not deadenylated as rapidly as Xmyc, and no
prominent deadenylated band appeared (Fig. 2B). Thus, the first 342 nt
of the Xenopus c-myc 3'-UTR are capable of
directing enhanced deadenylation of an mRNA in an AUUUA-dependent
manner in the fertilized Xenopus egg but not in the oocyte.
A highly conserved sequence in the c-myc 3'-UTR is required for deadenylation. Once we had identified the stage at which AUUUA-specific deadenylation activity appears and had observed that mutation of all three AUUUAs in the Xmyc 3'-UTR to AGGUA prevented this ARE sequence from enhancing mRNA deadenylation, we investigated which of the AUUUA motifs is required for enhanced deadenylation. One or two of the three AUUUAs were mutated to AGGUA (Fig. 1), and the rates of deadenylation of these mutant transcripts were compared with those of Xmyc and Xmyc-M1,2,3 in fertilized eggs (Fig. 3A and B). The data are plotted as percentages of total mRNA remaining polyadenylated versus time in Fig. 3B.
|
The mammalian GMCSF ARE directs mRNA deadenylation during Xenopus early development. We next tested whether a mammalian ARE could likewise direct mRNA deadenylation during Xenopus early development. The well-characterized 62-nt mammalian GMCSF ARE contains seven AUUUA sequences and is highly active in signaling ARE-mediated decay in mammalian cells (43). We subcloned this 62-nt sequence to generate the AT-GMCSF vector (Fig. 1). As with the Xmyc vector, in vitro transcription of the SacI-cut AT-GMCSF vector produces chimeric mRNA transcripts with a Xenopus globin 5'-UTR, a human globin coding region, the 62-nt GMCSF ARE 3'-UTR, and a poly(A)100 tail (Fig. 1). In experiments analogous to those presented in Fig. 3, the ability of the mammalian GMCSF ARE sequence to direct deadenylation of the chimeric mRNA was assessed during Xenopus early development (Fig. 4).
|
30 min). In contrast, a transcript in
which all seven AUUUAs in the GMCSF 3'-UTR had been mutated, GC-GMCSF (Fig. 1), was not deadenylated (Fig. 4A). The rate
of deadenylation for the AT-GMCSF transcript was much more
rapid (t1/2
30 min) than the rate of
degradation (t1/2
5 h) for the Xmyc transcript (Fig. 2B) and is likely to reflect the
presence of multiple overlapping AUUUA sequences in its ARE (8,
56).
To determine the effect of deadenylation on transcript stability
following fertilization, we quantitated the data from Fig. 4A along
with data from an equivalent experiment and graphed the stabilities of
the AT-GMCSF and GC-GMCSF transcripts
relative to the coinjected control as a function of time in Fig.
4B. After deadenylation, the deadenylated AT-GMCSF
transcript is relatively stable for 6 to 7 h following
fertilization (t1/2 = 5 h). After this time,
which corresponds to the MBT, the deadenylated transcripts decay with a
t1/2 of
45 min (Fig. 4B). In contrast,
the mutant GC-GMCSF and Xmyc-M2
transcripts remain relatively stable and polyadenylated even
following MBT, maintaining a consistent decay rate pre- and post-MBT
(Fig. 4A and B). Therefore, the AUUUA-rich 3'-UTR appears to
destabilize the mRNA at MBT by promoting prior poly(A) tail loss (Fig.
4B). As in the case of Xmyc (Fig. 2C), quantitation of
RNase A products demonstrated that the change in size of the
AT-GMCSF transcript results from loss of its poly(A) tail (Fig. 4C).
Because activation of mature eggs results in many of the same
biochemical changes that occur in fertilized eggs (31, 38), we next tested whether the AT-GMCSF reporter mRNA also
becomes deadenylated in activated mature eggs. When microinjected into the cytoplasm of activated mature eggs, the AT-GMCSF
transcript was deadenylated with a t1/2 of
30
min, leading to the accumulation of a completely deadenylated
transcript within 2 h of injection (Fig. 4D, top). The mutant
GC-GMCSF transcript was not deadenylated (Fig. 4D, bottom).
Quantitative analysis (Fig. 4E) of the data in Fig. 4D demonstrates
that AUUUA-directed deadenylation does not alter the transcript
stability relative to that of the coinjected Xmyc-M2 control
or compared to the relative stability of the mutant GC-GMCSF
RNAs, which retain their poly(A) tails. In contrast to the decay that
is seen starting at 7 h in the fertilized eggs, all transcripts
with or without a poly(A) tail remain stable in activated mature eggs;
unfortunately, the experiment could not be carried longer because the
eggs begin to die. These data demonstrate that AUUUA-mediated mRNA
deadenylation can be uncoupled from the degradation of the rest of the
RNA in activated mature eggs. The analogous experiment
was done with Xmyc, and it too experienced deadenylation in an AUUUA-dependent manner in the activated
mature egg (data not shown).
Finally, we examined the effect of the human GMCSF ARE when
the chimeric transcript was cytoplasmically injected into stage VI
oocytes. In the oocyte, the AT-GMCSF transcript was
deadenylated with a t1/2 of
8 h and appeared
completely deadenylated after 20 h (Fig. 4F, top). Deadenylation
did not have a significant effect on the stability of the
AT-GMCSF transcript when it was quantitated relative to
the internal polyadenylated control. The mutant GC-GMCSF
transcript remained stable and poly(A)+ for up to 20 h
following injection (Fig. 4F, bottom). Thus, the rate of deadenylation
for the AT-GMCSF transcript in the stage VI oocyte is
approximately 20 to 30 times lower than that in activated mature eggs
or fertilized eggs.
Since the AT-GMCSF transcript that undergoes deadenylation
in Fig. 4F was injected into the cytoplasmic compartment of the stage
VI oocyte, it seemed likely that the AUUUA-specific deadenylation activity resides in the cytoplasm. To confirm that deadenylation is a
cytoplasmic process, oocytes were enucleated and the resulting cytoplasms were injected with the AT-GMCSF transcript.
Deadenylation in the cytoplasm alone occurred at a rate similar to that
in the whole oocyte (data not shown). Although this result demonstrates that AUUUA-directed deadenylation activity is present in the
oocyte cytoplasm, it does not rule out the possibility that
deadenylation also takes place in the nucleus.
Poly(A)
mRNA is not destabilized by an ARE during
Xenopus early development.
When
polyadenylated AT-GMCSF transcripts were injected into
the fertilized egg, they were rapidly deadenylated, but deadenylation appeared to be uncoupled from decay until the embryo reached MBT (Fig.
4B). We therefore asked whether this pattern would be reproduced if
poly(A)
AT-GMCSF transcripts were injected
into the fertilized egg. Poly(A)
AT-GMCSF and GC-GMCSF transcripts
were made by in vitro transcription of the XbaI-cut
plasmids (Fig. 1) and coinjected with a poly(A)
control Xmyc-M2 RNA into the fertilized egg (Fig.
5A).
|
transcripts in
the fertilized egg were determined by quantitative analysis (Fig. 5B)
of the data in Fig. 5A and an equivalent experiment. The
AT-GMCSF transcript was relatively stable in
poly(A)
form until MBT, with a
t1/2 of
5 h (Fig. 5A). The
AT-GMCSF and GC-GMCSF transcripts exhibited
similar stabilities in poly(A)
form and were
approximately twice as stable as the coinjected Xmyc-M2 RNA
in the pre-MBT embryo (Fig. 5B). Together, these data confirm that once
the transcript is deadenylated, the wild-type ARE does not
further destabilize the mRNA in the pre-MBT embryo.
| |
DISCUSSION |
|---|
|
|
|---|
Role of the ARE in Xenopus early development. We examined the regulation of ARE-mediated mRNA decay during Xenopus early development by injecting reporter transcripts into the Xenopus oocyte, activated mature egg, and fertilized embryo and measuring the effect conferred by the ARE on transcript deadenylation and/or decay. Whereas AREs had previously been assigned a role in controlling translation during Xenopus early development (27), we show here a direct involvement in deadenylation.
We found that after fertilization both the Xenopus c-myc II ARE and the mammalian GMCSF ARE signal the deadenylation of reporter transcripts in an AUUUA-dependent manner. The Xenopus c-myc II AUUUA-containing ARE directs deadenylation in the fertilized or activated mature egg but has no noticeable effect in the stage VI oocyte (Fig. 2). The human GMCSF ARE is a more potent deadenylation signal: it directs mRNA deadenylation in the stage VI oocyte, activated mature egg, and fertilized egg (Fig. 4). The potency of the human GMCSF ARE in directing deadenylation compared to that of the Xmyc ARE is consistent with conclusions drawn from studies in mammalian systems, where more tandem copies of the AUUUA motif correlate with more-efficient ARE-mediated deadenylation and decay (56). Interestingly, the rate of ARE-mediated deadenylation changes markedly during development. In the fertilized egg and the activated mature egg, the GMCSF ARE directs rapid deadenylation with a t1/2 of
20 to 30 min,
whereas in the stage VI oocyte the t1/2 is >8 h
(
20 to 30 times slower). We suspect that the c-myc ARE
might also direct deadenylation, but very weakly, in the stage VI
oocyte; since the t1/2 for deadenylation of
transcripts containing this ARE in fertilized eggs is between 4 and
5 h and activity in the oocyte is approximately 20 to 30 times
lower, it should take 4 to 5 days for c-myc constructs to be
noticeably deadenylated in the oocyte.
The stability of ARE-containing mRNAs also appears to be
regulated during Xenopus early development. There is
evidence from several organisms that most mRNAs are relatively
stable in poly(A)
form prior to the MBT and that they
then decay rapidly, while poly(A)+ transcripts are
relatively stable following MBT (2, 42). We used the potent
ARE from GMCSF to ask whether the deadenylation of
transcripts carrying this sequence causes them to become destabilized during early development (Fig. 4B and E). We observed that despite its
rapid deadenylation, the GMCSF transcript was not degraded in the stage VI oocyte, activated mature egg, or pre-MBT embryo (Fig. 4). Following MBT, the AT-GMCSF transcript is
degraded, presumably because it has been deadenylated. We also tested
whether the ARE destabilizes a transcript already in
poly(A)
form relative to the same transcript with a
mutant ARE (Fig. 5). The wild-type poly(A)
AT-GMCSF transcript was as stable as the mutant
poly(A)
GC-GMCSF transcript relative to the
coinjected control in pre-MBT cells; post-MBT, all transcripts lacking
poly(A) disappear rapidly (Fig. 5). This result demonstrates that the
wild-type ARE does not destabilize the poly(A)
form of
the transcript pre-MBT. We conclude that AUUUA-rich AREs can function
as deadenylation elements uncoupled from transcript decay during early
development and suggest that these AREs destabilize mRNAs in post-MBT
cells by a mechanism that involves prior loss of the poly(A) tail.
Previous experiments with Xenopus oocytes
intriguingly demonstrated that placing a mammalian ARE on a
chimeric mRNA resulted in translation inhibition (27).
In the fertilized egg, it was found that AREs could inhibit translation
and that this effect was independent of whether the transcript was
injected in polyadenylated form (33). Our results suggest
that the ARE may influence translation of the polyadenylated form of an
mRNA at least partially by causing its deadenylation. We have replaced
the globin coding region in AT-GMCSF with chloramphenicol
acetyltransferase cDNA and have observed that following injection into
fertilized eggs, the message is initially translated at the same rate
as that for the corresponding GC-GMCSF mutant, but
translation then ceases as the AT-GMCSF transcript becomes deadenylated (data not shown). This correlates with
previous observations that polyadenylated mRNAs are much more
efficiently translated in the oocyte than deadenylated transcripts
(15, 21, 23). Conversely, under certain conditions,
inhibition of translation can increase the deadenylation rate of an
mRNA (35, 37), making it possible that AREs enhance the rate
of deadenylation and subsequent mRNA decay by causing inhibition of translation.
Conservation of signals and mechanism of mRNA decay. We found that the 3'-UTR from the Xenopus c-myc II transcript could direct stage-specific deadenylation during Xenopus early development (Fig. 2). To determine whether the AUUUAs present in the 3'-UTR were important for deadenylation, the AUUUAs were mutated individually and in combination and the effects on deadenylation were measured (Fig. 3A and B). This analysis revealed that the mutation of only one of the AUUUAs disrupted deadenylation directed by the 3'-UTR sequence. This AUUUA resides within an 11-nt sequence (Fig. 3C) previously identified as one of three short sequences (10 to 12 nt long) conserved between Xenopus and mammalian c-myc (50). We propose that this sequence may participate in regulation of the length of the poly(A) tail of endogenous maternally derived c-myc I and c-myc II (51) mRNAs during Xenopus early development; c-myc I mRNA has been reported to be present as a mixed population of polyadenylated and deadenylated forms in the stage VI oocyte and appears completely deadenylated in the mature and the fertilized egg (47). Interestingly, mutation of the conserved AUUUA sequence within the 3'-UTR of mammalian c-myc results in the relocalization of chimeric mRNAs in mammalian fibroblasts (49). Thus, either the localization of the mRNA may have an effect on its deadenylation or deadenylation may cause a change in mRNA localization.
In yeast, deadenylation precedes the degradation of both stable and unstable mRNAs and is often the rate-limiting step of mRNA decay; transcripts that are deadenylated more rapidly tend to decay more rapidly (13). Following deadenylation, the mRNA is decapped and rapidly degraded by a 5'
3' exonuclease activity (3, 36), although mRNAs are susceptible to a common
3'
5' degradation machinery as well (1). In
mammalian cells, deadenylation is also correlated with mRNA decapping
(11). Decapping, in turn, is influenced by the methylation
status of the 5' cap structure (30). Although the
experiments on deadenylation and stability in Fig. 2 through 5 were
performed by using transcripts initiated with a nonmethylated 5' cap,
we have confirmed that m7GpppG-capped transcripts behave
identically (data not shown). Therefore, one explanation for our
results is that prior to MBT, some common component of the
deadenylation-dependent mRNA decay machinery that is required for the
destabilization of ARE-containing transcripts is absent. The
missing component is likely to be a protein factor, since inhibition of
translation at the blastula stage has been reported to prevent several
deadenylated messages from being degraded even after MBT
(16). Perhaps a component of the decapping or the 5'
3'
exonuclease activity is absent prior to the mid-blastula stage of
Xenopus early development, allowing deadenylated
ARE-containing mRNAs to be relatively stable during this time.
How AREs direct deadenylation and decay still remains
unclear. As yet, no factors have been identified as causing
deadenylation or decay. In contrast, several labs have
presented evidence that overexpression of HuR, a human protein with
specificity for ARE sequences, can stabilize ARE-containing mRNAs
(18, 32, 40). ElrA, the Xenopus homolog of HuR,
is present throughout Xenopus early development
(55) and could potentially bind and stabilize ARE-containing transcripts during this time. An alternative
hypothesis is that ElrA may play a role in directing deadenylation of
ARE-containing mRNAs. This hypothesis is supported by the
identification of a highly related factor, embryo deadenylation
element-binding protein (EDEN-BP), which binds to the EDEN
sequence present in the 3'-UTR of the Eg mRNAs and is required for
their deadenylation following egg fertilization in Xenopus
(39). The EDEN sequence shows little similarity to an ARE;
however, the homology between EDEN-BP and ElrA suggests that the
two proteins might play similar roles in the deadenylation of
ARE-containing mRNAs.
In summary, our results argue that AUUUA-rich
ARE-mediated mRNA deadenylation and decay are highly
conserved processes. Previously, AUUUA-dependent
ARE-mediated deadenylation and decay had been shown to occur
only in mammalian tissue culture cells (9, 43). Our findings
suggest that the Xenopus oocyte and egg should prove useful
as a model system for the study of ARE-mediated deadenylation and for the identification of factors involved in this process and its regulation.
| |
ACKNOWLEDGMENTS |
|---|
We thank B. DeDecker, D. Enke, C. Fan, M. Frilander, T. McConnell, L. Scharl, and L. Weinstein for many helpful suggestions and careful reading of the manuscript and B. Egan and S. Baserga for plasmids.
This work was supported by grant CA16038 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Yale University, 295 Congress Ave., New Haven, CT 06536. Phone: (203) 737-4417. Fax: (203) 624-8213. E-mail: joan.steitz{at}yale.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Anderson, J. S. J., and R. Parker. 1998. The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires SK12 DEVH box protein and 3' to 5' exonuclease of the exosome complex. EMBO J. 17:1497-1506[Medline]. |
| 2. |
Audic, Y.,
F. Omilli, and H. B. Osborne.
1997.
Postfertilization deadenylation of mRNAs in Xenopus laevis embryos is sufficient to cause their degradation at the blastula stage.
Mol. Cell. Biol.
17:209-218 |
| 3. | Beelman, C., A. Stevens, G. Caponigro, T. LaGrandeur, L. Hatfield, D. Fortner, and R. Parker. 1996. An essential component of the decapping enzyme required for normal rates of mRNA turnover. Nature 382:642-646[Medline]. |
| 4. |
Bernstein, P.,
S. Peltz, and J. Ross.
1989.
The poly(A)-poly(A)-binding protein complex is a major determinant of mRNA stability in vitro.
Mol. Cell. Biol.
9:659-670 |
| 5. |
Bouvet, P.,
F. Omilli,
A.-B. Yannick,
V. Legagneux,
C. Roghi,
T. Bassez, and H. B. Osborne.
1994.
The deadenylation conferred by the 3' untranslated region of a developmentally controlled mRNA in Xenopus embryos is switched to polyadenylation by deletion of a short sequence element.
Mol. Cell. Biol.
14:1893-1900 |
| 6. |
Brewer, G., and J. Ross.
1988.
Poly(A) shortening and degradation of the 3' A+U-rich sequences of human c-myc mRNA in a cell-free system.
Mol. Cell. Biol.
8:1697-1708 |
| 7. |
Caput, D.,
B. Beutler,
K. Hartog,
R. Thayer,
S. Brown-Shimer, and A. Cerami.
1986.
Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators.
Proc. Natl. Acad. Sci. USA
83:1670-1674 |
| 8. |
Chen, C.-Y.,
T.-M. Chen, and A.-B. Shyu.
1994.
Interplay of two functionally and structurally distinct domains of the c-fos AU-rich element specifies its mRNA-destabilizing function.
Mol. Cell. Biol.
14:416-426 |
| 9. | Chen, C.-Y., and A.-B. Shyu. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20:465-470[Medline]. |
| 10. |
Chen, C.-Y., and A.-B. Shyu.
1994.
Selective degradation of early-response-gene mRNAs: functional analyses of sequence features of the AU-rich elements.
Mol. Cell. Biol.
14:8471-8482 |
| 11. |
Couttet, P.,
M. Fromont-Racine,
D. Steel,
R. Pictet, and T. Grange.
1997.
Messenger RNA deadenylylation precedes decapping in mammalian cells.
Proc. Natl. Acad. Sci. USA
94:5628-5633 |
| 12. | Davidson, E. 1986. Gene activity in early development, 3rd ed. Academic Press, New York, N.Y. |
| 13. |
Decker, C., and R. Parker.
1993.
A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation.
Genes Dev.
7:1632-1643 |
| 14. |
Drummond, D.,
J. Armstrong, and A. Colman.
1985.
The effect of capping and polyadenylation on stability, movement, and translation of synthetic messenger RNAs in Xenopus oocytes.
Nucleic Acids Res.
13:7375-7394 |
| 15. | Drummond, D., J. Armstrong, and A. Colman. 1985. The effect of capping and polyadenylation on the stability, movement and translation of synthetic messenger RNAs in Xenopus oocytes. Nucleic Acids Res. 13:7375-7394. |
| 16. |
Duval, C.,
P. Bouvet,
F. Omilli,
C. Roghi,
C. Dorel,
R. LeGuellec,
J. Paris, and H. B. Osborne.
1990.
Stability of maternal mRNA in Xenopus embryos: role of transcription and translation.
Mol. Cell. Biol.
10:4123-4129 |
| 17. | Dworkin, M., and E. Dworkin-Rastl. 1985. Changes in RNA titers and polyadenylation during oogenesis and oocyte maturation in Xenopus laevis. Dev. Biol. 112:451-457[Medline]. |
| 18. | Fan, X. C., and J. A. Steitz. 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 12:3448-3460. |
| 19. |
Fox, C.,
M. Sheets, and M. Wickens.
1989.
Poly(A) addition during maturation of frog oocytes: distinct nuclear and cytoplasmic activities and regulation by the sequence UUUUUAU.
Genes Dev.
3:2151-2162 |
| 20. |
Fox, C., and M. Wickens.
1990.
Poly(A) removal during oocyte maturation: a default reaction selectively prevented by specific sequences in the 3' UTR of certain maternal mRNAs.
Genes Dev.
4:2287-2298 |
| 21. |
Galili, G.,
E. Kawata,
L. Smith, and B. Larkins.
1988.
Role of the 3'-poly(A) sequence in translational regulation of mRNAs in Xenopus laevis oocytes.
J. Biol. Chem.
263:5764-5770 |
| 22. | Gautier, J., J. Solomon, R. Booher, J. F. Bazan, and M. Kirschner. 1991. cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell 67:197-211[Medline]. |
| 23. | Huarte, J., A. Stutz, M. O'Connell, P. Gubler, D. Belin, A. Darrow, S. Strickland, and J.-D. Vassalli. 1992. Transient translational silencing by reversible mRNA deadenylation. Cell 69:1021-1030[Medline]. |
| 24. |
Hyman, L., and M. Wormington.
1988.
Translational inactivation of ribosomal protein mRNAs during Xenopus oocyte maturation.
Genes Dev.
2:598-605 |
| 25. |
Jones, T., and M. Cole.
1987.
Rapid cytoplasmic turnover of c-myc mRNA: requirement of the 3' untranslated sequences.
Mol. Cell. Biol.
7:4513-4521 |
| 26. | Kay, B., and H. B. Peng (ed.). 1991. Methods in cell biology, vol. 36. Xenopus laevis: practical uses in cell and molecular biology. Academic Press, New York, N.Y. |
| 27. |
Kruys, V.,
O. Marinx,
G. Shaw,
J. Deschamps, and G. Huez.
1989.
Translational blockade imposed by cytokine-derived UA-rich sequences.
Science
245:852-855 |
| 28. |
Kruys, V.,
M. Wathelet,
P. Poupart,
R. Contreras,
W. Fiers,
J. Content, and G. Huez.
1987.
The 3' untranslated region of the human interferon- -mRNA has an inhibitory effect on translation.
Proc. Natl. Acad. Sci. USA
84:6030-6034 |
| 29. |
Lagnado, C.,
C. Brown, and G. Goodall.
1994.
AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/A)(U/A).
Mol. Cell. Biol.
14:7984-7995 |
| 30. | LaGrandeur, T., and R. Parker. 1998. Isolation and characterization of Dcp1p, the yeast mRNA decapping enzyme. EMBO J. 17:1487-1496[Medline]. |
| 31. | Legagneux, V., F. Omilli, and H. B. Osborne. 1995. Substrate-specific regulation of RNA deadenylation in Xenopus embryo and activated egg extracts. RNA 1:1001-1008[Abstract]. |
| 32. |
Levy, N. S.,
S. Chung,
H. Furneaux, and A. P. Levy.
1998.
Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR.
J. Biol. Chem.
273:6417-6423 |
| 33. | Marinx, O., S. Bertrand, E. Karsenti, G. Huez, and V. Kruys. 1994. Fertilization of Xenopus eggs imposes a complete translational arrest of mRNAs containing 3'UUAUUUAU elements. FEBS Lett. 345:107-112[Medline]. |
| 34. |
McGrew, L.,
E. Dworkin-Rastl,
M. Dworkin, and J. Richter.
1989.
Poly(A) elongation during Xenopus oocyte maturation is required for translational recruitment and is mediated by a short sequence element.
Genes Dev.
3:803-915 |
| 35. | Muckenthaler, M., N. Gunkel, R. Stripecke, and M. Hentze. 1997. Regulated poly(A) tail shortening in somatic cells mediated by cap-proximal translational repressor proteins and ribosome association. RNA 3:983-995[Abstract]. |
| 36. |
Muhlrad, D.,
C. Decker, and R. Parker.
1994.
Deadenylation of the unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5' 3' digestion of the transcript.
Genes Dev.
8:855-866 |
| 37. |
Muhlrad, D.,
C. Decker, and R. Parker.
1995.
Turnover mechanisms of the stable yeast PGK1 mRNA.
Mol. Cell Biol.
15:2145-2156 |
| 38. | Murray, A., and M. Kirschner. 1989. Cycline synthesis drives the early embryonic cell cycle. Nature 339:275-280[Medline]. |
| 39. | Paillard, L., F. Omilli, V. Legagneux, T. Bassez, D. Manley, and H. B. Osborne. 1998. EDEN and EDEN-BP, a cis element and an associated factor that mediate sequence-specific mRNA deadenylation in Xenopus embryos. EMBO J. 17:278-287[Medline]. |
| 40. | Peng, S. S.-Y., C.-Y. A. Chen, N. Xu, and A.-B. Shyu. 1998. RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 17:3461-3470[Medline]. |
| 41. | Richter, J. 1991. Translational control in early development. Bioessays 13:179-183[Medline]. |
| 42. | Rosenthal, E. T., T. R. Tansey, and J. V. Ruderman. 1983. Sequence-specific adenylations and deadenylations accompany changes in the translation of maternal messenger RNA after fertilization of Spisula oocytes. J. Mol. Biol. 166:309-327[Medline]. |
| 43. | Shaw, G., and R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46:659-667[Medline]. |
| 44. |
Shyu, A.-B.,
J. Belasco, and M. Greenberg.
1991.
Two distinct destabilizing elements in the c-fos message trigger deadenylation as a first step in rapid mRNA decay.
Genes Dev.
5:221-231 |
| 45. | Standart, N., and R. Jackson. 1990. Do the poly(A) tail and 3' untranslated region control mRNA translation? Cell 62:15-24[Medline]. |
| 46. |
Stolle, C.,
M. Payne, and E. Benz.
1987.
Equal stabilities of normal -globin and nontranslatable -39 thalassemic transcripts in cell-free extracts.
Blood
70:293-300 |
| 47. | Tchang, F., S. Vriz, and M. Mechali. 1991. Postranscriptional regulation of c-myc RNA during early development of Xenopus laevis. FEBS Lett. 291:177-180[Medline]. |
| 48. |
Varnum, S., and M. Wormington.
1990.
Deadenylation of maternal mRNAs during Xenopus oocyte maturation does not require specific cis-sequences: a default mechanism for translational control.
Genes Dev.
4:2278-2286 |
| 49. |
Veyrune, J.,
G. Campbell,
J. Wiseman,
J. Blanchard, and J. Hesketh.
1996.
A localisation signal in the 3' untranslated region of c-myc mRNA targets c-myc mRNA and -globin reporter sequences to the perinuclear cytoplasm and cytoskeletal-bound polysomes.
J. Cell Sci.
109:1185-1194[Abstract].
|
| 50. | Vriz, S., and M. Mechali. 1989. Analysis of 3'-untranslated regions of seven c-myc genes reveals conserved elements prevalent in post-transcriptionally regulated genes. FEBS Lett. 251:201-206[Medline]. |
| 51. | Vriz, S., M. Taylor, and M. Mechali. 1989. Differential expression of two Xenopus c-myc proto-oncogenes during development. EMBO J. 8:4091-4097[Medline]. |
| 52. | Wickens, M. 1990. How the messenger got its tail: addition of poly(A) in the nuclues. Trends Biochem. Sci. 15:277-281[Medline]. |
| 53. | Wickens, M. 1990. In the beginning is the end: regulation of poly(A) addition and removal during early development. Trends Biochem. Sci. 15:320-324[Medline]. |
| 54. | Wilson, T., and R. Treisman. 1988. Removal of poly(A) and consequent degradation of c-fos mRNA facilitated by 3' AU-rich sequences. Nature 336:396-399[Medline]. |
| 55. |
Wu, L.,
P. Good, and J. D. Richter.
1997.
The 36-kilodalton embryonic-type cytoplasmic polyadenylation element-binding protein in Xenopus laevis is ElrA, a member of the ELAV family of RNA-binding proteins.
Mol. Cell. Biol.
17:6402-6409 |
| 56. |
Zubiaga, A.,
J. Belasco, and M. Greenberg.
1995.
The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.
Mol. Cell. Biol.
15:2219-2230 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»