Previous Article | Next Article 
Molecular and Cellular Biology, December 1998, p. 7546-7555, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
RMP, a Novel RNA Polymerase II Subunit 5-Interacting Protein,
Counteracts Transactivation by Hepatitis B Virus X Protein
Dorjbal
Dorjsuren,
Yong
Lin,
Wenxiang
Wei,
Tatsuya
Yamashita,
Takahiro
Nomura,
Naoyuki
Hayashi, and
Seishi
Murakami*
Department of Molecular Oncology, Cancer
Research Institute, Kanazawa University, Kanazawa 920-0934, Japan
Received 11 May 1998/Returned for modification 22 June
1998/Accepted 2 September 1998
 |
ABSTRACT |
To modulate transcription, regulatory factors communicate with
basal transcription factors and/or RNA polymerases in a variety of
ways. Previously, it has been reported that RNA polymerase II subunit 5 (RPB5) is one of the targets of hepatitis B virus X protein (HBx) and
that both HBx and RPB5 specifically interact with general transcription
factor IIB (TFIIB), implying that RPB5 is one of the communicating
subunits of RNA polymerase II involved in transcriptional
regulation. In this context, we screened for a host protein(s) that
interacts with RPB5. By far-Western blot screening, we cloned a novel
gene encoding a 508-amino-acid-residue RPB5-binding protein from a
HepG2 cDNA library and designated it RPB5-mediating protein (RMP).
Expression of RMP mRNA was detected ubiquitously in various tissues.
Bacterially expressed recombinant RMP strongly bound RPB5 but neither
HBx nor TATA-binding protein in vitro. Endogenous RMP was
immunologically detected interacting with assembled RPB5 in RNA
polymerase in mammalian cells. The central part of RMP is responsible
for RPB5 binding, and the RMP-binding region covers both the TFIIB- and
HBx-binding sites of RPB5. Overexpression of RMP, but not mutant RMP
lacking the RPB5-binding region, inhibited HBx transactivation of
reporters with different HBx-responsive cis elements in
transiently transfected cells. The repression by RMP was counteracted
by HBx in a dose-dependent manner. Furthermore, RMP has an
inhibitory effect on transcriptional activation by VP16 in the
absence of HBx. These results suggest that RMP negatively modulates RNA polymerase II function by binding to RPB5 and that HBx
counteracts the negative role of RMP on transcription indirectly by
interacting with RPB5.
 |
INTRODUCTION |
In eukaryotes, nuclear RNA
polymerases I, II, and III are highly conserved multisubunit enzymes
involved in the synthesis of rRNAs, mRNAs, and tRNAs, respectively
(48). All these nuclear RNA polymerases share the function
of RNA synthesis but utilize different promoters and require different
transcription factors. For example, promoter-specific transcription
initiation from protein-coding genes requires the concerted action of a
complex array of factors involving RNA polymerase II and general
transcriptional factors (TFIID, TFIIA, TFIIB, TFIIE, TFIIF, and TFIIH)
(14, 46). Transcriptional activators and repressors bind
distal elements of a promoter and modulate transcription through
communication with components of a preinitiation complex, such as
TATA-binding protein (TBP) and its binding proteins, TFIIB,
TFIIA, and TFIIH (18, 19, 24, 42). Recently, another group
of proteins, cofactors (also called mediators), have been
demonstrated to affect transcription positively or negatively by
communicating with promoter-specific regulatory factors and the
transcriptional machinery. These proteins include global coactivator
p300/CBP (20, 25, 31, 34), nuclear silence mediators
(2, 12, 52), and a large number of mediator proteins,
or SRBs (10, 28, 39, 47, 54). RNA polymerase subunits may be
additional targets for transcriptional regulators, because RNA
polymerases are the ultimate target of transcriptional modulation. In
this context, several subunits have been recently reported to interact
with the regulators (8, 9), in addition to the
well-documented regulatory role of the C-terminal domain (CTD) of the
largest subunit of RNA polymerase II (28, 30).
Hepatitis B virus (HBV) X protein (HBx) is essential for HBV infection
and plays an important role in HBV-associated hepatocellular carcinoma
(11, 17, 26, 51). Many reports have shown that HBx
transactivates viral and cellular genes through a wide variety of
cis-acting elements. However, the mechanism of this effect has not been well elucidated (3, 5, 7, 15, 16, 22, 23, 50).
It has been previously demonstrated that HBx directly interacts with
RNA polymerase II subunit 5 (RPB5), a common RNA polymerase subunit
(13), that both RPB5 and HBx communicate with TFIIB but
through different sites (21), and that the trimeric interaction of these three factors is involved in HBx
transactivation (35). These observations suggest that RPB5
is the communicating subunit of RNA polymerase that interacts
with transcriptional regulators (9). To gain insight into
the role of RPB5 in transcriptional regulation, we screened for
proteins that interact with RPB5. Here, we report a novel protein,
RPB5-mediating protein (RMP), which specifically binds RPB5
and whose overexpression inhibits the transactivation function of HBx.
 |
MATERIALS AND METHODS |
cDNA cloning of RPB5-binding protein.
Approximately 2 × 106 plaques of a
gt11 cDNA library of HepG2 cells
(HL1105b; Clontech Laboratories) were screened by far-Western blotting,
essentially as previously reported (13). Briefly, nitrocellulose filters were incubated in modified GBT buffer
(10% glycerol, 50 mM HEPES-NaOH [pH 7.5], 175 mM KCl, 7.5 mM MgCl2, 0.1 mM EDTA, 0.1 mM dithiothreitol, 1% Triton
X-100) and subjected to far-Western blotting. Purified glutathione
S-transferase (GST)-RPB5 was labeled in vitro and used as a
probe with [
-32P]ATP by using the catalytic subunit of
cyclic-AMP-dependent protein kinase (Sigma). Protein-protein binding
reactions (far-Western) were performed with an RPB5 probe (40 to 100 ng
of protein per µl, 2 × 106 to 4 × 106 cpm of protein per µg) in modified GBT buffer
supplemented with 1% bovine serum albumin, 2 mM unlabeled ATP, and
sonicated supernatants of Escherichia coli JM109 transformed
with pGENK1 containing 1 mg of GST per ml (final concentration).
Filters were rotated in the reaction mixture for 1 h at room
temperature, washed four times with modified GBT buffer, and then
exposed on X-ray films (XAR Omat; Kodak) for 1 to 2 days. At the second
screening, several pairs of positive and negative plaques, the latter
closely juxtaposed on the plate, were examined for inserts of identical
size by PCR with
gt11 forward and reverse primers. After the third
screening, seven positive clones were selected. PCR products of these
clones were sequenced by the dideoxy sequence method and were subcloned into the EcoRI site of pBluescript II SK(+) (Stratagene).
The putative full-length cDNA with an initiation codon at the 5' end and a stop codon at the 3' end was obtained with a Marathon cDNA amplification kit (Clontech Laboratories Inc.) according to the manufacturer's protocol.
Plasmid constructions.
The plasmid pSG5UTPL was a mammalian
expression vector derived from pSG5 (Stratagene) (38, 45).
With pSG5UTPL, another FLAG-tagged mammalian expression vector,
pNKFLAG, was constructed. The FLAG tag insert fragment was generated
from pFLAGHis/p53 by PCR with a primer pair, one primer containing
an artificial NotI site and a consensus translation
initiation site and the other containing a BamHI site. The
plasmids pGENK1 and pGENKS were used as vectors for GST fusion
proteins, and they contained a thrombin cleavage site and a
phosphorylation site for cyclic-AMP-dependent protein kinase (13,
44, 45). pYFLAG, used as the E. coli expression vector
for FLAG-tagged proteins, was derived from pLHis (36) by
replacing the NdeI-BamHI fragment with an insert
containing a multicloning site to generate the EcoRI,
SacI, and BamHI digestion sites.
GST-HBx, GST-TFIIB, GST-CTD, and the full-length and truncated GST-RPB5
expression plasmids have been described (13, 35). cDNA
covering the long open reading frame was prepared by PCR with
pBluescript II SK(+) plasmid containing the full-length RMP cDNA as a
template and a primer set, GCGAGCTCCATGAGGCTAGGAAATGTA and
GCGGATCCGTCTTTCTGTTGCAA, generating an artificial
SacI site at the 5' end and a BamHI site at the
3' end, respectively. The PCR products were inserted into the
SacI and BamHI sites of pSG5UTPL. The resultant
plasmid, pSG5UTPL-RMP, was used as the template to construct truncated
versions of RMP by PCR cloning. The sequences encoding RMP-D1, -D2,
-D6, -D11, -D12, -D13, -D14, -D15, and -D16 have an initiation codon
followed by codons corresponding to amino acids (aa) 137 to 231, 232 to
431, 137 to 315, 232 to 508, 88 to 136, 88 to 150, 175 to 231, 151 to
231, and 151 to 198 of RMP, respectively, and the sequences encoding
RMP-D8, RMP-D7, and RMP-14D2 have codons corresponding to aa 1 to 87, 1 to 150, and 1 to 231, respectively. The internal-deletion mutants
RMP-Id150 and RMP-Id175, lacking amino acid residues 151 to 231 and 175 to 231, respectively, were constructed by splicing PCR. The sequences
encoding full-length or truncated fragments of RMP were inserted into
the SacI or EcoRI and the BamHI sites
of pSG5UTPL, pNKFLAG, pGENKS, and pYFLAG. All the constructs were
sequenced by the dideoxy method with Taq sequencing kits and
a DNA sequencer (370A; Applied Biosystems).
Preparation of recombinant proteins.
GST-fused proteins were
expressed in E. coli by induction with 0.4 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) at 30°C for 3 h. Cells were harvested and sonicated in PBST buffer
(phosphate-buffered saline containing 1% Triton X-100). After
centrifugation, the extracts (supernatants) were collected and stored
at
80°C. For purification, the extracts were incubated with
glutathione-Sepharose 4B (Pharmacia) at room temperature for 1 h.
The beads were precipitated, washed four times with a 50-fold volume of
PBST buffer, and then eluted with 10 mM reduced glutathione in 50 mM
Tris-HCl (pH 8.0). The eluted proteins were divided into aliquots and
stored at
80°C.
Plasmid pLHis-RMP was expressed in BL21 (DE3)/pLys cells by induction
with 0.4 mM IPTG at 30°C. Cells were harvested 3 h postinduction
and sonicated in native binding buffer (20 mM sodium phosphate,
500 mM
NaCl [pH 7.8]). Histidine-tagged RMPs were purified by
incubating the
sonication supernatant with nickel-resin (Invitrogen),
followed by
extensive washing and elution with imidazole elution
buffer (300 mM
imidazole, 20 mM sodium phosphate, 500 mM NaCl
[pH 6.3]).
FLAG-tagged wild-type and mutant RMPs were expressed in BL21 by
induction with 0.4 mM IPTG at 30°C for 3 to 6 h. Cells were
harvested and sonicated in 50 mM Tris-HCl (pH 8.0)-150 mM NaCl-0.1%
Triton X-100. After centrifugation, the supernatant was stored
at

80°C. FLAG-tagged proteins were purified by incubating the
sonication supernatant with anti-FLAG M2 resin (Kodak Scientific
Imaging Systems), followed by several washes and elution with
buffer
containing FLAG peptide (0.2 mg of FLAG peptide per ml,
50 mM
Tris-HCl [pH 8.0], 150 mM
NaCl).
Protein-protein binding assays.
GST resin pull-down assays
were carried out as reported previously (35). Approximately
1 µg of GST or of GST-fused RPB5 and its truncated mutants
immobilized on 15 µl of glutathione-Sepharose 4B preblocked in 0.5%
nonfat milk and 0.05% bovine serum albumin was incubated with 0.2 µg
of full-length or mutated versions of FLAG-RMP, purified from
E. coli lysates, in 0.5 ml of modified GBT buffer for 1 to 2 h on a rotator at 4°C. After being washed four times with
modified GBT buffer, the bound proteins were eluted and subjected to
Western blot analysis with anti-FLAG monoclonal antibody (M2).
Far-Western blotting was performed with ~0.2 µg of purified GST
fusion protein and GST control protein. The proteins were
fractionated
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and transferred onto nitrocellulose membranes. Proteins
on
membranes were denatured, renatured, and far-Western blotted
as
described for library
screening.
Antibodies.
His-tagged RMP (aa 1 to 150) was used to raise
rabbit anti-RMP antibodies. Briefly, approximately 200 µg of
His-tagged RMP mixed with incomplete Freund's adjuvant was injected
into two animals subcutaneously. Booster injections consisting of 100 µg of proteins with a complete Freund's adjuvant were given three times at 2-week intervals. Sera were taken by bleeding from the ear
artery. Immunoglobulin G fractions were purified by affinity chromatography with protein A-Sepharose (Pharmacia LKB). Anti-RPB6 antibody was a generous gift from R. G. Roeder, and anti-CTD
monoclonal antibody (7G5) was kindly provided by M. Vigneron. Anti-RPB5
antibody was reported previously (35), and anti-FLAG M2
antibody was commercially purchased (Kodak Scientific Imaging Systems).
Immunoprecipitation and Western blot analysis.
Transient
transfection of COS1, HeLa, and HepG2 cells was carried out as reported
previously (45). The cells were harvested; washed; sonicated
in LAC buffer, which contained 10% glycerol, 20 mM HEPES (pH 7.9), 50 mM KCl, 0.4 M NaCl, 10 mM MgCl2, 0.1 mM dithiothreitol, 0.1 mM EDTA, 9 mM CHAPS
{3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}, 0.5 mM phenylmethylsulfonyl fluoride, and 10 µg each of aprotinin and
leupeptin per ml; and centrifuged. The total cell lysates were stored
at
80°C. Approximately 200 to 800 µg of total cell lysates in an
appropriate volume of TBST buffer (50 mM Tris-HCl [pH 7.5], 150 mM
NaCl, 0.05% Tween 20) was clarified by incubation with 50 µl of 50%
swollen agarose beads for 30 min followed by centrifugation. The
supernatants with FLAG-tagged proteins were immunoprecipitated with 20 µl of 50% anti-FLAG M2 resin and rotated for 2 h, followed by
four washes with washing buffer (50 mM Tris-HCl [pH 7.5], 150 mM
NaCl). For precipitation of endogenous proteins, HepG2 cell lysates
were incubated with the primary antibodies for several hours at 4°C,
and then 20 µl of 50% swollen protein A resin was added. After being
rotated for another 2 h and washed four times with washing buffer
(20 mM Tris-HCl [pH 7.4], 150 mM NaCl, 0.1% SDS, 1 mM EDTA), the
bound proteins were eluted, fractionated by SDS-PAGE, transferred onto
nitrocellulose membranes, and subjected to Western blot analysis with
the secondary antibodies. The proteins were visualized by enhanced
chemiluminescence according to the manufacturer's instructions (Amersham).
Northern blot analysis.
An RMP cDNA probe was prepared
with [
-32P]dCTP by using a random primer kit
(Stratagene). Poly(A) RNA fractions of various human tissues (Clontech
Laboratories) were subjected to Northern blotting with the RMP cDNA
probe. The blots were hybridized with 32P-labeled probes
for 1 to 2 h with ExpressHyb hybridization solution (Clontech
Laboratories), washed with 0.1× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS at 58°C, and exposed on X-ray film at
70°C for 4 h. Each lane contained approximately 2 µg of
poly(A)+ RNA from each tissue. To control the relative
amount of RNA in each lane, after hybridization with RMP, blots were
stripped by incubation in 0.5% SDS at 95°C and reprobed with a human
-actin cDNA probe.
Transfection and CAT assays.
Cell culture, transient
transfection, and chloramphenicol acetyltransferase (CAT) assays were
carried out as reported previously (38, 44). The CAT
reporters pHECx2CAT, pNF
Bx3CAT, and pGalCAT have two tandem repeats
of the HBV enhancer 1 (Enh1) core, three tandem repeats of the
NF
B-binding site, and five tandem repeats of the Gal4-binding site,
respectively, as binding sites for transcriptional activators. Total
cell lysates were prepared from cells harvested 48 h after
transfection. CAT assay reactions were performed for 60 min at 37°C
with 20 µg of protein from the transfected cell lysates
(44). The fractionated thin-layer chromatography plates were
exposed on imaging plates, and the CAT activities were measured as the
percentage of conversion to acetylated forms of
[14C]chloramphenicol (Amersham) with a Bioimage
analyzer (BAS1000; Fuji). Transfection and CAT assays were performed at
least three times with each combination of transactivator and CAT
reporter construct.
Nucleotide sequence accession number.
The nucleotide
sequence of the cDNA clone has been deposited in the DNA Data Bank of
Japan (DDBJ) and assigned no. AB 006572.
 |
RESULTS |
Cloning of RPB5-binding protein by far-Western blotting.
To
identify cDNA encoding proteins that bind to RPB5, we applied
far-Western blotting, a cloning method to detect protein-protein interaction in situ (13). A HepG2 cDNA library in
a
phage expression vector was screened with a labeled
recombinant human RPB5 probe. After the third screening, seven
positive clones were selected from a total of 107 plaques
and subjected to sequence analysis of the insert termini. Of the five
clones two groups had identical sequences in the inserts (Fig.
1A). The remaining two clones with short
stretches of sequence in frame have not been subjected to further
analysis.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
DNA and amino acid sequence of RMP. (A) Schematic
representation of five positive RMP cDNA clones screened by far-Western
blotting. Open boxes indicate the predicted open reading frames. The
RPB5-binding region was included in all the inserts of the positive
clones. (B) Deduced amino acid sequence of RMP. The two different
putative NLS are in bold letters, and the Asp-rich region is
underlined.
|
|
All inserts of the five positive clones were subcloned and
completely sequenced. Two different fragments covered 1.2 kb of
cDNA
encoding 306 continuous amino acids in frame with the LacZ
gene. 5' and
3' rapid amplification of cDNA ends with HepG2 mRNA
was applied to
clone the full-length cDNA (see Materials and Methods),
and a putative
full-length clone of 2,088 bp was obtained. The
cDNA harbors an open
reading frame of 1.5 kb, beginning at a consensus
sequence for
initiation at nucleotide 468 and ending at nucleotide
1992. A
nucleotide homology search of the GenBank and EMBL databases
revealed
that several human and rodent sequences of cDNA from
different tissues
matched different parts of the cloned cDNA with
high scores. The 508-aa
polypeptide RMP is a novel protein which
has no homology to known
sequences in protein databases. There
is an Asp-rich region, including
13 contiguous Asp residues, in
the central part of RMP which shows a
high degree of homology
to several unrelated proteins with different
functions. RMP has
no known motif except for two putative nuclear
localization signals
(NLS) from aa 98 to 111 and from aa 339 to 344 (Fig.
1B).
Expression of RMP mRNA and protein in mammalian cells.
The
expression of RMP mRNA was examined in RNA samples from various sources
by Northern blot analysis (Fig. 2A). RMP
mRNA (approximately 2.4 kb in length) was detected at different levels in all human tissues examined. An additional weak band of 1.6 kb was
detected in some tissues, such as testis (Fig. 2, lane 4). Low levels
of RMP expression were observed in peripheral tissue, leukocytes, and
lung. Under high-stringency conditions, RMP mRNA was also
detected in RNA samples of mouse and rat tissues (data not shown).
These results suggest that the RMP gene is conserved among
mammals and ubiquitously expressed in various tissues.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
RMP is ubiquitously expressed in mammalian cells. (A)
Poly(A) RNA fractions of various human tissues were subjected to
Northern blotting with RMP (upper panels) and human -actin cDNA
probes (lower panels) as described in Materials and Methods. Each lane
contained 2 µg of poly(A)+ RNA from each tissue. (B)
Detection of endogenous and overexpressed RMPs. Total cell lysates of
COS1, HepG2, and HeLa cells transiently transfected with the FLAG-RMP
expression vector (F-RMP) or the pSG5UTPL vector alone were
fractionated by SDS-10% PAGE and subjected to Western blotting with
anti-RMP antibody.
|
|
The presence of RMP was examined in different cell lines by
immunoblotting with polyclonal antibody raised against bacterially
expressed recombinant His-tagged RMP. The anti-RMP antibody recognized
a 69-kDa protein in human cell lines, such as HepG2 and HeLa,
and also
in the monkey cell line COS1. To confirm the specificity
of the
endogenous RMP detected with anti-RMP antibody, these cells
were
transiently transfected with FLAG-tagged RMP. A protein migrating
slightly slower than the endogenous RMP was detected by anti-RMP
antibody in the FLAG-RMP-transfected cell lysates but not in
cells
transfected with the vector alone (Fig.
2B). This protein
was
also detected with anti-FLAG M2 antibody (data not shown).
The
apparent molecular sizes of the endogenous and FLAG-tagged
RMPs
were much larger than the calculated molecular mass (57 kDa).
The
migration behavior of RMP detected by SDS-PAGE was due not
to
modification of the protein but probably to the high content
of charged
amino acid residues, since similar discrepancies were
observed with
bacterial recombinant
RMPs.
RMP specifically interacts with RPB5 in vitro.
Since the
positive clones of RMP cDNA were selected from a
gt11 library
with a GST-RPB5 probe, it remained possible that the LacZ-fused RMP
portion but not the RMP moiety was recognized by RPB5. To exclude
this possibility, GST-RMP was used as a probe to examine the
interaction between RPB5 and RMP by far-Western blot analysis under the
same binding conditions as those used to isolate the RMP clones (Fig.
3). Comparable amounts of purified bacterial recombinant proteins were fractionated by SDS-PAGE (Fig. 3A)
and subjected to far-Western blot analysis (Fig. 3B). Only GST-RPB5
(Fig. 3B, lane 2) bound to the RMP probe. The other GST-fused proteins,
such as CTD and TBP, showed no binding to RMP. Interestingly, RMP did
not bind HBx (Fig. 3, lanes 1). These results indicated the specificity
of the binding of RMP and RPB5 in vitro.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
RMP specifically binds RPB5 in vitro. Partially purified
bacterial recombinant proteins were fractionated by SDS-12.5% PAGE
and stained with Coomassie brilliant blue (A) or transferred onto
nitrocellulose membranes for far-Western blot analysis (B). Coomassie
brilliant blue staining showed that comparable amounts of GST-fused
HBx, human RPB5, TBP, CTD, and GST proteins were applied. (B) The
GST-RMP probe bound specifically to RPB5 but not to HBx, CTD, TBP, or
GST.
|
|
The RPB5-binding region resides in the region shared by the
positive clones.
To further confirm the specific binding of RPB5,
mapping of the RPB5-binding site in RMP was carried out with a GST-RPB5
probe (Fig. 4B). The GST-fused full-length and truncated RMPs were
bacterially expressed and purified (Fig.
4A and C). The RPB5 probe bound strongly to the full-length RMP (Fig. 4A and B, lanes 1) as well as RMP-D1, -D2,
-D6, -14D2, and -D15 (lanes 8, 5, 7, 4, and 14, respectively) and
weakly to RMP-D13, -D14, and -D16 (lanes 10, 16, and 15, respectively) but not to the other truncated proteins or GST (lanes 2, 3, 6, and 11).
Since RMP-D1 strongly bound RPB5, the RPB5-binding site was
within the region from aa 137 to 231, the sequence of which was
included in the two different inserts of the positive
gt11 phage
clones (Fig. 1A). Further examination of the region around RMP-D1 with
constructs RMP-D13 (aa 88 to 150), RMP-D14 (aa 176 to 231),
RMP-D15 (aa 150 to 231), and RMP-D16 (aa 151 to 198) showed
that only RMP-D15 had strong GST-RPB5-binding ability. RMP-D13, -D14,
and -D16 had much weaker RPB5-binding ability than RMP-D15.
Internal-deletion mutants of RMP, RMP-Id150 and RMP-Id175, did not
exhibit RPB5 binding (Fig. 4A and B, lanes 12 and 13). These
results indicated that the region covered by RMP-D16 (aa 151 to 198) is
essential for RPB5 binding and that the region from aa 198 to 231 may
have an accessory role in this binding (Fig. 4B, lane 14).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
Delineation of the RPB5-binding region of RMP. (A)
Coomassie brilliant blue staining of the fractionated full-length and
truncated RMPs in GST-fused forms. (B) GST-RMP and truncated mutant
proteins were subjected to far-Western blot analysis with a GST-RPB5
probe as described in the legend to Fig. 3. (C) Map of various RMP
deletion constructs. The expression plasmids were constructed as
described in Materials and Methods. The sequences encoding RMP-D1, -D2,
-D6, -D11, -D12, and -D14 have an initiation codon followed by codons
for various fragments of RMP. RMP-Id150 and RMP-Id175 have an internal
deletion from aa 150 to 231 and from 175 to 231, respectively. The
relative RPB5-binding abilities detected by far-Western blot analysis
in panel B are shown at the right. (D) GST resin pull-down assay.
Bacterially expressed FLAG-tagged full-length RMP and truncated mutants
RMP-Id150, -14D2, and -D11 were incubated with GST (G) or GST-RPB5 (R).
Approximately 1 µg of GST or GST-fused protein immobilized on
glutathione resin was incubated with 100 ng of partially purified,
bacterially expressed FLAG-RMP in GBT buffer for 2 h at 4°C.
After being washed extensively, the bound proteins were eluted,
fractionated by SDS-12.5% PAGE, and Western blotted with anti-FLAG M2
antibody. Lanes 1, 4, 7, and 10 show 5% of the input (I).
|
|
The mapping results by far-Western blot analysis were further confirmed
by GST resin pull-down assay (Fig.
4D). Bacterially
expressed FLAG-RMP
(Fig.
4D, lane 3) and FLAG-RMP-14D2 (aa 1 to
231 [lane 9]) harboring
the RPB5-binding region were efficiently
recovered by the immobilized
GST-RPB5 resin, whereas neither a
C-terminal part, RMP-D11 (aa 232 to
508 [lane 12]), nor RMP-Id150
(lane 6) (lacking aa 151 to 231) was
recovered. The negative-control
GST bound none of the RMPs. From the
consistent results obtained
by the two different methods in vitro, we
concluded that RMP specifically
interacts with RPB5 through its central
region.
The RMP-binding region covers the TFIIB- and HBx-binding sites in
RPB5.
We used a similar approach to delineate the RMP-binding
region of RPB5 by far-Western blot analysis (Fig.
5). The GST-RMP probe strongly bound to
full-length RPB5 and RPB5-d5 (aa 1 to 160) but showed no or only weak
binding to all other truncated forms of RPB5 (Fig. 5B, lanes 3 to 9).
The region of RPB5 necessary for RMP binding was confirmed by GST resin
pull-down assay (Fig. 5D). In this experiment, bacterially expressed
and purified FLAG-RMP was incubated with immobilized GST fusion
proteins harboring different portions of RPB5, and the recovered
FLAG-tagged RMP was detected with an anti-FLAG antibody.
Consistent with the results of far-Western blotting, RPB5-d5 as well as
RPB5, but not the other truncated forms, associated with FLAG-RMP.
These results suggest that RMP binding requires a region of more
than two-thirds of RPB5, which completely covers both the TFIIB- and
HBx-binding sites (aa 1 to 46 and 47 to 120, respectively) (13,
35).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 5.
Mapping of the RMP-binding region of RPB5. (A) Coomassie
brilliant blue staining of the applied GST-RPB5 and its mutant
proteins. (B) GST-fused RPB5 and its truncated mutants were subjected
to far-Western blot analysis with the GST-RMP probe. (C) Schematic map
of RPB5 deletion constructs. GST-fused forms have been reported
previously (13, 28). The relative RPB5-binding abilities
detected by far-Western blot analysis in panel B are shown at the
right. (D) GST resin pull-down assay. Bacterial recombinant FLAG-RMP
was incubated with immobilized GST, GST-RPB5, or GST-RPB-d5, -d3, -d4,
-d2, or -d13 on resin as described in the legend to Fig. 4. The bound
FLAG-RMP was detected by anti-FLAG M2 antibody. Lane 1 shows 5% of the
input of the FLAG-RMP. h, human.
|
|
RMP binds RPB5 in vivo.
Next, we determined whether the
interaction of RMP and RPB5 occurs in vivo by immunoprecipitation and
Western blot analysis. COS1 cells were transiently cotransfected
with mammalian expression vectors of RPB5 and FLAG-tagged RMP, and the
cell lysates were precipitated with anti-FLAG M2 resin (Fig.
6A). The nontagged RPB5 protein was
efficiently recovered in the immunoprecipitates with FLAG-RMP and the
FLAG-RMP-14D2 mutant (Fig. 6A, lanes 1 and 3) but was not
coprecipitated at all with FLAG-RMP-Id150 or RMP-D11 lacking the
RPB5-binding region (lanes 2 and 4). Conversely, when the lysate of the
COS1 cells cotransfected with FLAG-tagged RPB5 and RMP was precipitated
with anti-FLAG M2 resin, FLAG-RPB5 also coimmunoprecipitated RMP (Fig.
6B, lane 1). RMP was barely recovered in the precipitates with
anti-FLAG M2 resin in lysates of nontransfected cells (Fig. 6B, lane
2). These results clearly indicate that RMP interacts with RPB5 in
mammalian cells and that the RPB5-binding region of RMP delineated in
vivo is consistent with the mapping results obtained in vitro (Fig. 4).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
RMP binds RPB5 in vivo. (A) COS1 cells were
cotransfected with mammalian expression plasmids of RPB5 and FLAG-RMP
(F-RMP), FLAG-RMP-Id150 (F-Id150), FLAG-RMP-14D2 (F-14D2), or
FLAG-RMP-D11 (F-D11). Total cell lysates were immunoprecipitated with
anti-FLAG M2 antibody-bound resin. After being washed, the bound
proteins were eluted, fractionated by SDS-12.5% PAGE, and subjected
to Western blotting with anti-FLAG antibody ( -FLAG) or anti-RPB5
antibody ( -RPB5). (B) COS1 cells were cotransfected with FLAG-RPB5
and RMP mammalian expression plasmids. Total cell lysates were
precipitated as described for panel A and detected with anti-FLAG and
anti-RMP ( -RMP) antibodies.
|
|
The interaction of RMP and RPB5 described above was detected in
the lysates of cells overexpressing both proteins, but it
may not
reflect the interaction of endogenous RMP and RPB5. Therefore,
we
examined whether endogenous RMP interacts with RPB5 (Fig.
7).
At first, relative amounts of
endogenous RMP and RPB5 in HepG2
cells were determined immunologically
(Fig.
7A). As determined
by comparison of the band intensities of the
various amounts of
the purified recombinant RMP and RPB5, the amount of
endogenous
RMP in 60 µg of the total proteins is close to 2.5 ng of
the recombinant
RMP (Fig.
7A, lanes 3 and 4), and the amount of
endogenous RPB5
in 20 µg of the total protein is close to 5 ng of the
recombinant
RPB5 (lanes 6 and 9). Therefore, the relative molecular
ratio
of endogenous RMP to RPB5 is approximately 1:10, indicating that
RMP is substoichiometric to RPB5 or to RNA polymerases. Next,
the
possible interaction of endogenous RMP and RPB5 in HepG2 cells
was
examined by coimmunoprecipitation with anti-RMP antibody.
RPB5 was
weakly detected in the anti-RMP immunoprecipitates, and
two other
polymerase II subunits, RPB1 and RPB6, were also faintly
detected in
the immunoprecipitates, whereas all of the examined
subunits were not
recovered in the control immunoprecipitates
(Fig.
7B, lanes 3 and 4).
This result suggests that RMP, at least
in part, is complexed with RNA
polymerase II. To confirm this
notion, coimmunoprecipitation with
anti-RPB6 antibody was used
to detect the RMP-polymerase II
interaction, since the anti-RPB5
antibody we raised was not able to
coimmunoprecipitate RMP and
RNA polymerase subunits. Anti-RPB6
coimmunoprecipitated RMP and
the other RNA polymerase subunits (Fig.
7B, lane 2). This result
indicates that endogenous RMP is complexed
with RNA polymerase
II through RPB5 in HepG2 cells. The RPB5-binding
region of RMP
mapped in vitro is necessary for the association to RNA
polymerase
II, since anti-RPB6 antibody coimmunoprecipitated RMP but
not
RMP-Id150 in the overexpressed cell lysates (data not shown).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 7.
Endogenous RMP associates with RNA polymerase II
complex. (A) Western blot analysis of molar ratio of endogenous RMP to
RPB5 in HepG2 cells. Proteins were loaded in lanes as follows: lanes 4 to 6, 60, 40, and 20 µg, respectively, of HepG2 total cell lysate;
lanes 1 to 3, 15, 5, and 2.5 ng, respectively, of bacterially expressed
recombinant FLAG-RMP; and lanes 7 to 9, 2, 10, and 5 ng, respectively,
of FLAG-RPB5. Proteins were fractionated by SDS-PAGE and subjected to
Western blot analysis with anti-RMP (upper panel) and anti-RPB5 (lower
panel) antibodies. (B) Coimmunoprecipitation of RMP with RNA polymerase
II subunits. HepG2 cell lysates were precipitated with the indicated
antibodies. The immunoprecipitates (IP) together with an aliquot of the
lysate (Input 5%), were separated by SDS-PAGE and detected with
antibodies directed against RPB1 (anti-CTD), RMP ( -RMP), RPB5, and
RPB6 ( -RPB6). The asterisk shows the heavy chain of the first
antibody used in the immunoprecipitation. -Tub, antitubulin.
|
|
RMP counteracts transactivation by HBx.
Because the
RMP-binding region of RPB5 (aa 1 to 160) covers the regions
necessary for TFIIB binding (aa 1 to 46) and HBx binding (aa 47 to 120), RMP may interfere with the trimeric interaction of
RPB5, TFIIB, and HBx. Overexpression of RMP, therefore, may inhibit HBx
transactivation. To examine this possibility, HepG2 cells were
transiently cotransfected with RMP and HBx expression plasmids
together with pHECx2CAT, an HBx-responsive CAT reporter, under the
control of the X-responsive element derived from the core sequence in
HBV Enh1 (Fig. 8A). Cotransfection of RMP
inhibited the transactivation by HBx (Fig. 8A, bars 12 to 14), although the inhibition was not complete in the presence of excess RMP. Expression levels of HBx immunologically detected by anti-HBx antibody
were similar among cotransfected cell lysates in the absence or
presence of RMP (data not shown). Coexpression of RMP-Id150 and
RMP-Id175, which lack 57 and 82 aa in the RPB5-binding region, respectively, exhibited no inhibitory effect on the transactivation by
HBx (Fig. 8A, bars 16 to 18, and data not shown), implying that RPB5
binding is essential for the inhibitory effect. Because HBx has been
reported to transactivate a wide variety of cis elements (16, 37, 38), we examined the possibility that RMP may
inhibit transactivation of HBx through the other X-responsive
cis element. A similar inhibitory effect of RMP was observed
when pNF
Bx3CAT, harboring three tandem repeats of the
NF
B-binding site, another X-responsive cis element, was
used as the reporter (Fig. 8B). This result suggests that RMP inhibits
transactivation by HBx of different X-responsive cis
elements.

View larger version (36K):
[in this window]
[in a new window]

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 8.
RMP inhibits HBx transactivation. (A) Transfection of
HepG2 cells and CAT assays were described in Materials and Methods.
Various amounts of HBx and RMP plasmids were transfected together with
the reporter plasmid, pHECx2CAT, in which the CAT gene is under the
control of the dimeric sequence of the HBV Enh1 core. The
transfected plasmid DNA was 5 µg of pHECx2CAT together with the
following: bar 1, 5 µg of pSG5UTPL; bars 2 to 4, 1, 2, and 4 µg of
pSG5UTPL-HBx, respectively; bars 5 to 7, 1, 2, and 4 µg of
pSG5UTPL-RMP, respectively; bars 8 to 10, 1, 2, and 4 µg of
pSG5UTPL-RMP-Id150, respectively; bars 11 to 14, 0, 1, 2, and 4 µg of
pSG5UTPL-RMP, respectively, plus 1 µg of pSG5UTPL-HBx; and bars 15 to
18, 0, 1, 2, and 4 µg of pSG5UTPL-RMP-Id150, respectively, plus 1 µg of pSG5UTPL-HBx. HBx counteracted the corepressor activity of RMP
in the system in a dose-dependent manner: bars 19 to 22, 0, 1, 3, and 4 µg of pSG5UTPL-HBx, respectively, plus 1 µg of
pSG5UTPL-RMP; and bars 23 to 25, 1, 3, and 4 µg of
pSG5UTPL-HBx-3D5, respectively, plus 1 µg of pSG5UTPL-RMP.
The total amount of DNA added per transfection was adjusted to 10 µg
with the control vector, pSG5UTPL. (B) RMP inhibits the transactivation
by HBx of the reporter. The NF Bx3CAT harbors a trimeric repeat of
the NF B-binding site, which is responsive to HBx. The transfected
plasmid DNA was 5 µg of pNF Bx3CAT together with the following: bar
1, 5 µg of pSG5UTPL; bars 2 to 4, 1, 2, and 3 µg of pSG5UTPL-HBx,
respectively; bars 5 to 8, 0, 1, 2, and 3 µg of pSG5UTPL-RMP,
respectively, plus 1 µg of pSG5UTPL-HBx; and bars 9 to 12, 0, 1, 2, and 3 µg of pSG5UTPL-RMP-Id150, respectively, plus 1 µg of
pSG5UTPL-HBx. The total amount of DNA added per transfection was
adjusted to 10 µg with the control vector, pSG5UTPL. Error bars show
standard deviations.
|
|
HBx counteracts the inhibitory effect of RMP.
The inhibitory
function of RMP on activated transcription implies that HBx may
counteract the negative regulatory role of RMP, which may be involved
in HBx transactivation. To address this possibility, we examined
whether HBx can release the corepressor effect of RMP in the
pHECx2CAT reporter system, in which the CAT gene is under the control
of the dimeric sequence of the HBV Enh1 core. HBx counteracted the
corepressor activity of RMP in this system in a dose-dependent manner
(Fig. 8A, bars 19 to 22). The anticorepressor function of HBx resides
in its transactivation domain, since HBx-5D1 bearing the
transactivation domain similarly counteracted the corepressor function
of RMP (data not shown). Overexpression of HBx-3D5 lacking the RPB5
binding site had no counteracting effect on RMP (Fig. 8A, bars 23 to 25).
RMP inhibits activated transcription in mammalian cells.
Since
RMP has no HBx-binding ability, the negative effect of RMP on
transcription may occur in the absence of HBx. Therefore, we
examined the effects of RMP on activated transcription by Gal-VP16, a
chimeric activator with the Gal4 DNA-binding domain fused to the
VP16 activation domain. pGalCAT, a CAT reporter with the simian virus 40 promoter driven by five Gal4-binding sites, was used as the
reporter (Fig. 9). The transactivation of Gal-VP16 was inhibited
twofold by the coexpression of RMP, indicating that RMP negatively
affects a wide variety of activated transcriptions (Fig.
9, bars 9 to 11). No such effect was
observed with pSG9RMP in which the RMP cDNA was inserted in the
reverse orientation (data not shown). If RMP inhibits
activated transcription through the RPB5 binding of RMP, deletion
mutants lacking RPB5-binding abilities may have no such inhibitory
effect. The internal-deletion mutant RMP-Id150, lacking the 82 amino
acid residues in the RPB5-binding region, had no effect on pGalCAT in
the absence of Gal-VP16 (Fig. 9, bars 12 to 15) but augmented CAT
activity in the presence of Gal-VP16 (lanes 16 to 19). These results
suggest that RMP has a corepressor activity and that the mutant RMP
lacking the RPB5-binding ability acts positively, probably by
perturbing the negative regulation in which endogenous RMP is involved.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 9.
RMP inhibits activated transcription by Gal-VP16. HepG2
cells were cotransfected with pGalCAT and Gal-VP16 together with HBx or
RMP constructs. The transfected plasmid DNA was 5 µg of pGalx5CAT
together with the following: bars 1 to 4, 0, 5, 10, and 20 ng of
pGal-VP16, respectively; bars 5 to 7, 1, 2, and 3 µg of pSG5UTPL-RMP,
respectively; bars 8 to 11, 0, 1, 2, and 3 µg of pSG5UTPL-RMP,
respectively, plus 10 ng of pGal-VP16; bars 12 to 15, 0, 1, 2, and 3 µg of pSG5UTPL-RMP-Id150, respectively; and bars 16 to 19, 0, 1, 2, and 3 µg of pSG5UTPL-RMP-Id150, respectively, plus 5 ng of pGal-VP16.
The total amount of DNA added per transfection was adjusted to 10 µg
with the control vector, pSG5UTPL. Error bars show standard
deviations.
|
|
 |
DISCUSSION |
Most RNA polymerase subunits are unique to their respective
RNA polymerases, while some subunits are common among RNA
polymerases I, II, and III. With the exception of RPB5, all of the
common subunits in human RNA polymerases I, II, and III can substitute for their yeast homologues, although RPB5 is highly conserved among
humans, Saccharomyces cerevisiae, and
Schizosaccharomyces pombe, and is essential in yeast
(40, 41, 55). Yeast RPB5 has been reported to interact with
RPB3 in vitro, and both RPB5 and RPB3 are present in two molar amounts
in RNA polymerase II (4, 55) and seem to play an important
role in subunit assembly (29, 43), as does human RPB5
(1). In a recent study using photo-cross-linking of RNA
polymerase II preinitiation complex on DNA, RPB5 was suggested as one
of the subunits of RNA polymerase II positioned close to DNA
(27). Although anti-RPB5 antibody has been reported to block
transcription in vitro, the actual role of RPB5 in transcription
remains unclear. It has previously been demonstrated that human RPB5
directly interacts with HBx and TFIIB and that the trimeric interaction
seems to be necessary for HBx transactivation (13, 35). Here
we report that a novel protein, RMP, specifically binds to RPB5 both in
vitro and in vivo and negatively modulates transcription through
binding to RPB5. Endogenous RMP associates, at least partially, with
the assembled RPB5 in RNA polymerase II in HepG2 cells as detected immunologically. The results with RMP further support the
hypothesis that RPB5 is a communicating subunit of RNA polymerase
II for transcriptional modulators (13, 35). Evidence
for transcriptional regulation through the interaction of RNA
polymerase subunits and modulators has been accumulating (6, 8,
9). Interestingly, recent studies showed that
hTAFII68 and its homologue pro-oncoproteins, TLS/FUS and
EWS, complexed with TFIID and RNA polymerase II. These oncoproteins
seem to modulate RNA polymerase II activity by interacting with RNA
polymerase II subunits, including RPB3 and RPB5 (8, 9).
Therefore, the multiple interactions of RPB5 with the transcriptional regulators may be reminiscent of the activator-binding property of the
prokaryotic
subunit, provided that the core assembly of the
two molars of RPB5 and RPB3 has a short stretch of homology, or
"
-motif" (1, 29, 32, 43).
RMP has inhibitory effects on various types of activated transcription,
but they seem not to be global, since activated transcription by p53
seems to be unaffected by RMP (data not shown). The inhibitory effect
of RMP requires the RPB5-binding region, and RMP may
interfere with the association of TFIIB and RPB5, since the
TFIIB-binding region is overlapped by the RMP-binding region of RPB5
(35). Because overexpression of HBx released the inhibitory
effect of RMP on activated transcription, it remains to be determined
whether HBx replaces RMP complexed with RPB5 and facilitates the
interaction of TFIIB and RPB5. The negative effect of RMP on the
activated transcription by Gal-VP16 suggests that RMP behaves as a
corepressor. Such a corepressor function of RMP seems to be
substantial, since HBx acts as a coactivator in the same artificial
reporter system (21, 23) but could not act as a
transactivator in the Gal4-fused form (36a). Taken together,
these results imply that HBx may be a functional antagonist of RMP and
that both RMP and HBx act as transcriptional cofactors which require
direct communication with RPB5. However, this notion should be
evaluated carefully, since RMP is substoichiometric to RPB5 and even
overexpressed RMP has a moderate inhibitory effect on
activated transcription. Interestingly, the internal-deletion
mutant RMP-Id150 lacking the RPB5-binding ability positively
augmented Gal-VP16-activated transcription but had no effect on
transactivation by HBx. RMP-Id150 may augment transcription by
competitively binding to the partner(s) of endogenous RMP, whereas HBx
by itself competes out endogenous RMP for RPB5 binding. It is possible
that RMP requires signaling processes for its function (2,
12, 53) or that RMP negatively modulates genes in the chromatin
structure (49). Additionally, RMP may require a
functional partner(s) for its function in addition to the RPB5 binding.
RMP has no known motifs except for two different putative NLS, the
roles of which are not yet clear (unpublished data). Interestingly, RMP
has several long helix-rich regions in which many charged amino acid
residues are clustered. These characteristics are also found in RPB5.
The amino acid sequence of RMP harbors 13 contiguous Asp residues in
its middle region, in which 18 Asp residues are clustered with 24 amino
acid residues. Interestingly, the 13-Asp stretch is encoded by two
different stretches of the triplets GAC and GAT. Thus, the Asp-rich
region seems to avoid destabilizing the DNA structure by a long triplet
repeat (33), although this region is dispensable for the
RPB5 binding and the inhibitory effect on activated transcription.
 |
ACKNOWLEDGMENTS |
We are grateful to R. G. Roeder for anti-RPB6 antibody, to
M. Vigneron for anti-CTD monoclonal antibody, and to R. G. Roeder and A. Ishihama for encouraging discussions. We thank C. Matsushima, F. Momoshima, M. Yasukawa, and K. Kuwabara for their technical assistance.
This study was partly supported by a Science Grant from the Ministry of
Education and Culture of Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Oncology, Cancer Research Institute, Kanazawa University,
Takara-machi 13-1, Kanazawa 920-0934. Japan. Phone: 81-76-265-2731. Fax: 81-76-234-4501. E-mail:
semuraka{at}kenroku.kanazawa-u.ac.jp.
 |
REFERENCES |
| 1.
|
Acker, J.,
D. M. Graaf,
I. Cheynel,
V. Khazak,
C. Kedinger, and M. Vigneron.
1997.
Interactions between the human RNA polymerase II subunits.
J. Biol. Chem.
272:16815-16821[Abstract/Free Full Text].
|
| 2.
|
Alland, L.,
R. Muhle,
H. Hou, Jr.,
J. Potes,
L. Chin,
N. S. Agus, and R. A. DePinho.
1997.
Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression.
Nature
387:49-55[Medline].
|
| 3.
|
Antunovic, J.,
N. Lemieux, and J. A. Cromlish.
1993.
The 17 kDa HBx protein encoded by hepatitis B virus interacts with the activation domains of Oct-1, and functions as a coactivator in the activation and repression of a human U6 promoter.
Cell. Mol. Biol. Res.
39:463-482[Medline].
|
| 4.
|
Archambault, J., and J. D. Friesen.
1993.
Genetics of eukaryotic RNA polymerases I, II, and III.
Microbiol. Rev.
57:703-724[Abstract/Free Full Text].
|
| 5.
|
Aufiero, B., and R. J. Schneider.
1990.
The hepatitis B virus X-gene product transactivates both RNA polymerase II and III promoters.
EMBO J.
9:497-504[Medline].
|
| 6.
|
Awrey, D. E.,
R. G. Weilbaecher,
S. A. Hemming,
S. M. Orlicky,
C. M. Kane, and A. M. Edwards.
1997.
Transcriptional elongation through DNA arrest sites: a multistep process involving both RNA polymerase II subunit RPB9 and TFIIS.
J. Biol. Chem.
272:14747-14754[Abstract/Free Full Text].
|
| 7.
|
Benn, J., and R. J. Schneider.
1994.
Hepatitis B virus HBx protein activates Ras-GTP complex formation and establishes a Ras, Raf, MAP kinase signaling cascade.
Proc. Natl. Acad. Sci. USA
91:10350-10354[Abstract/Free Full Text].
|
| 8.
|
Bertolotti, A.,
Y. Lutz,
D. J. Heard,
P. Chambon, and L. Tora.
1996.
hTAF68, a novel RNA/ssDNA-binding protein with homology to the pro-oncoproteins TLS/FUS and EWS, is associated with both TFIID and RNA polymerase II.
EMBO J.
15:5022-5031[Medline].
|
| 9.
|
Bertolotti, A.,
T. Melot,
J. Acker,
M. Vigneron,
O. Delattre, and L. Tora.
1998.
EWS, but not EWS-FLI-1, is associated with both TFIID and RNA polymerase II: interactions between two members of the TET family, EWS and hTAFII68, and subunits of TFIID and RNA polymerase II complexes.
Mol. Cell. Biol.
18:1489-1497[Abstract/Free Full Text].
|
| 10.
|
Chao, D. M.,
E. L. Gadbois,
P. J. Murray,
S. F. Anderson,
M. S. Sonu,
J. D. Parvin, and R. A. Young.
1996.
A mammalian SRB protein associated with an RNA polymerase II holoenzyme.
Nature
380:82-85[Medline].
|
| 11.
|
Chen, H.-S.,
S. Kaneko,
R. Girones,
R. W. Anderson,
W. E. Hornbuckle,
B. C. Tennant,
P. J. Cote,
J. L. Gerin,
R. H. Purcell, and R. H. Miller.
1993.
The woodchuck hepatitis virus X gene is important for establishment of virus infection in woodchucks.
J. Virol.
67:1218-1226[Abstract/Free Full Text].
|
| 12.
|
Chen, J. D., and R. M. Evans.
1995.
A transcriptional co-repressor that interacts with nuclear hormone receptors.
Nature
377:454-457[Medline].
|
| 13.
|
Cheong, J. H.,
M. Yi,
Y. Lin, and S. Murakami.
1995.
Human RPB5, a subunit shared by eukaryotic nuclear RNA polymerases, binds human hepatitis B virus X protein and may play a role in X transactivation.
EMBO J.
14:143-150[Medline].
|
| 14.
|
Conaway, R. C., and J. W. Conaway.
1993.
General initiation factors for RNA polymerase II.
Annu. Rev. Biochem.
62:161-190[Medline].
|
| 15.
|
Cross, J. C.,
P. Wen, and J. W. Rutter.
1993.
Transactivation by hepatitis B virus X protein is promiscuous and dependent on mitogen-activated cellular serine/threonine kinase.
Proc. Natl. Acad. Sci. USA
90:8078-8082[Abstract/Free Full Text].
|
| 16.
|
Doria, M.,
N. Klein,
R. Lucito, and R. J. Schneider.
1995.
The hepatitis B virus HBx protein is a dual specificity cytoplasmic activator of Ras and a nuclear activator of transcription factors.
EMBO J.
14:4747-4757[Medline].
|
| 17.
|
Feitelson, M. A.,
M. Zhu,
L. X. Duan, and W. T. London.
1993.
Hepatitis B x antigen and p53 are associated in vitro and in liver tissues from patients with primary hepatocellular carcinoma.
Oncogene
8:1109-1117[Medline].
|
| 18.
|
Ge, H., and R. G. Roeder.
1994.
Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes.
Cell
78:513-523[Medline].
|
| 19.
|
Goodrich, J. A.,
T. Hoey,
C. J. Thut,
A. Admon, and R. Tjian.
1993.
Drosophila TAFII40 interacts with both a VP16 activation domain and the basal transcription factor TFIIB.
Cell
75:519-530[Medline].
|
| 20.
|
Gu, W.,
X. L. Shi, and R. G. Roeder.
1997.
Synergistic activation of transcription by CBP and p53.
Nature
387:819-823[Medline].
|
| 21.
|
Haviv, I.,
M. Shamay,
G. Doitsh, and Y. Shaul.
1998.
Hepatitis B virus pX targets TFIIB in transcription coactivation.
Mol. Cell. Biol.
18:1562-1569[Abstract/Free Full Text].
|
| 22.
|
Haviv, I.,
D. Vaizel, and Y. Shaul.
1996.
pX, the HBV-encoded coactivator, interacts with components of the transcription machinery and stimulates transcription in a TAF-independent manner.
EMBO J.
15:3413-3420[Medline].
|
| 23.
|
Haviv, I.,
D. Vaizel, and Y. Shaul.
1995.
The X protein of hepatitis B virus coactivates potent activation domains.
Mol. Cell. Biol.
15:1079-1085[Abstract].
|
| 24.
|
Inostroza, J. M.,
F. H. Mermelstein,
I. Ha,
W. S. Lane, and D. Reinberg.
1992.
Dr1, a TATA-binding protein associated phosphoprotein and inhibitor of class II gene transcription.
Cell
70:477-489[Medline].
|
| 25.
|
Kamei, Y.,
L. Xu,
T. Heinzel,
J. Torchia,
R. Kurokawa,
B. Gloss,
S. C. Lin,
R. A. Heyman,
D. W. Rose,
C. K. Glass, and M. G. Rosenfeld.
1996.
A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors.
Cell
85:403-414[Medline].
|
| 26.
|
Kim, C. M.,
K. Koike,
I. Saito,
T. Miyamura, and G. Jay.
1991.
HBx gene of hepatitis B virus induces liver cancer in transgenic mice.
Nature
351:317-320[Medline].
|
| 27.
|
Kim, T. K.,
T. Lagrange,
Y. H. Wang,
J. D. Griffith,
D. Reinberg, and R. H. Ebright.
1997.
Trajectory of DNA in the RNA polymerase II transcription preinitiation complex.
Proc. Natl. Acad. Sci. USA
94:12268-12273[Abstract/Free Full Text].
|
| 28.
|
Kim, Y.-J.,
S. Bjorklund,
S. Li,
M. H. Sayer, and R. D. Kornberg.
1994.
A multiprotein complex mediator of transcriptional activation and its interaction with C-terminal domain of RNA polymerase II.
Cell
77:599-608[Medline].
|
| 29.
|
Kimura, M.,
A. Ishiguro, and A. Ishihama.
1997.
RNA polymerase II subunits 2, 3, and 11 form a core subassembly with DNA binding activity.
J. Biol. Chem.
272:25851-25855[Abstract/Free Full Text].
|
| 30.
|
Koleske, A. J., and R. A. Young.
1994.
An RNA polymerase II holoenzyme responsive to activators.
Nature
368:466-469[Medline].
|
| 31.
|
Kwok, R. P.,
J. R. Lundblad,
J. C. Chrivia,
J. P. Richards,
H. P. Bachinger,
R. G. Brennan,
S. G. Roberts,
M. R. Green, and R. H. Goodman.
1994.
Nuclear protein CBP is a coactivator for the transcription factor CREB.
Nature
370:223-226[Medline].
|
| 32.
|
Lalo, D.,
C. Carles,
A. Sentenac, and P. Thuriaux.
1993.
Interactions between three common subunits of yeast RNA polymerases I and III.
Proc. Natl. Acad. Sci. USA
90:5524-5528[Abstract/Free Full Text].
|
| 33.
|
La-Spada, A. R.,
H. L. Paulson, and K. H. Fischbeck.
1994.
Trinucleotide repeat expansion in neurological disease.
Ann. Neurol.
36:814-822[Medline].
|
| 34.
|
Lill, N. L.,
S. R. Grossman,
D. Ginberg,
J. DeCaprio, and D. M. Livingston.
1997.
Binding and modulation of p53 by p300/CBP coactivators.
Nature
387:823-827[Medline].
|
| 35.
|
Lin, Y.,
T. Nomura,
J. H. Cheong,
D. Dorjsuren,
K. Iida, and S. Murakami.
1997.
Hepatitis B virus X protein is a transcriptional modulator that communicates with transcriptional factor IIB and RNA polymerase II subunit 5.
J. Biol. Chem.
272:7132-7139[Abstract/Free Full Text].
|
| 36.
|
Lin, Y.,
T. Nomura,
T. Yamashita,
D. Dorjsuren,
H. Tang, and S. Murakami.
1997.
The transactivation and p53-interacting functions of hepatitis B virus X protein are mutually interfering but distinct.
Cancer Res.
57:5137-5142[Abstract/Free Full Text].
|
| 36a.
|
Lin, Y.,
H. Tang,
T. Nomura,
D. Dorjsuren,
N. Hayashi,
W. Wei,
T. Ohta,
R. Roeder, and S. Murakami.
1998.
The hepatitis B virus X protein is a co-activator of activated transcription that modulates the transcription machinery and distal binding activators.
J. Biol. Chem.
273:27097-27103[Abstract/Free Full Text].
|
| 37.
|
Lucito, R., and R. J. Schneider.
1992.
Hepatitis B virus X protein activates transcription factor NF- B without a requirement for protein kinase C.
J. Virol.
66:983-991[Abstract/Free Full Text].
|
| 38.
|
Mahe, Y.,
N. Mukaida,
K. Kuno,
M. Akiyama,
N. Ikeda,
K. Matsushima, and S. Murakami.
1991.
Hepatitis B virus X protein transactivates human interleukin-8 gene through acting on nuclear factor kB and CCAAT/enhancer-binding protein-like cis-elements.
J. Biol. Chem.
266:13759-13763[Abstract/Free Full Text].
|
| 39.
|
Maldonaldo, E.,
R. Siekhatter,
M. Shelton,
H. Cho,
R. Drapkin,
P. Rickert,
E. Lees,
C. W. Anderson,
S. Linn, and D. Reinberg.
1996.
A human RNA polymerase II complex associated with SRB and DNA-repair proteins.
Nature
381:86-89[Medline].
|
| 40.
|
McKune, K.,
P. A. Moore,
M. W. Hull, and N. A. Woychik.
1995.
Six human RNA polymerase subunits functionally substitute for their yeast counterparts.
Mol. Cell. Biol.
15:6895-6900[Abstract].
|
| 41.
|
McKune, K., and N. A. Woychik.
1994.
Functional substitution of an essential yeast RNA polymerase subunit by a highly conserved mammalian counterpart.
Mol. Cell. Biol.
14:4155-4159[Abstract/Free Full Text].
|
| 42.
|
Meisterernst, M., and R. G. Roeder.
1991.
Family of proteins that interacts with TFIID and regulates promoter activity.
Cell
67:557-567[Medline].
|
| 43.
|
Miyao, T.,
K. Yasui,
H. Sakurai,
M. Yamaguchi, and A. Ishihama.
1996.
Molecular assembly of RNA polymerase II from fission yeast Schizosaccharomyces pombe: subunit-subunit contact network involving RPB5.
Genes Cells
1:843-854[Abstract].
|
| 44.
|
Murakami, S.,
J. Cheong, and S. Kaneko.
1994.
Human hepatitis B virus X gene encodes a regulatory domain that represses transactivation of X protein.
J. Biol. Chem.
269:15118-15123[Abstract/Free Full Text].
|
| 45.
|
Murakami, S.,
J. Cheong,
S. Ohno,
K. Matsushima, and S. Kaneko.
1994.
Transactivation of human hepatitis B virus X protein, HBx, operates through a mechanism distinct from protein kinase C and okadaic acid activation pathways.
Virology
199:243-246[Medline].
|
| 46.
|
Orphanides, G.,
T. Lagrange, and D. Reinberg.
1996.
The general transcription factors of RNA polymerase II.
Genes Dev.
10:2657-2683[Free Full Text].
|
| 47.
|
Ossipow, V.,
J. P. Tassan,
E. A. Nigg, and U. Schibler.
1995.
A mammalian RNA polymerase II holoenzyme containing all components required for promoter-specific transcription initiation.
Cell
83:137-146[Medline].
|
| 48.
|
Sentenac, A.
1985.
Eukaryotic RNA polymerases.
Crit. Rev. Biochem.
18:31-91[Medline].
|
| 49.
|
Struhl, K.
1998.
Histone acetylation and transcriptional regulatory mechanisms.
Genes Dev.
12:599-606[Free Full Text].
|
| 50.
|
Su, F., and R. J. Schneider.
1996.
Hepatitis B virus HBx protein activates transcription factor NF- B by acting on multiple cytoplasmic inhibitors of rel-related proteins.
J. Virol.
70:4558-4566[Abstract].
|
| 51.
|
Terradillos, O.,
O. Billet,
C. A. Renard,
R. Levy,
T. Molina,
P. Briand, and M. A. Buendia.
1997.
The hepatitis B virus X gene potentiates c-myc induced liver oncogenesis in transgenic mice.
Oncogene
14:395-404[Medline].
|
| 52.
|
Voegel, J. J.,
M. J. S. Heine,
C. Zechel,
P. Chambon, and H. Gronemeyer.
1996.
TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors.
EMBO J.
15:3667-3675[Medline].
|
| 53.
|
Wada, T.,
T. Takagi,
Y. Yamaguchi,
A. Ferdous,
T. Imai,
S. Hirose,
S. Sugimoto,
K. Yano,
G. A. Hartzog,
F. Winston,
S. Buratowski, and H. Handa.
1998.
DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs.
Genes Dev.
12:343-356[Abstract/Free Full Text].
|
| 54.
|
Wilson, C. J.,
D. M. Chao,
A. N. Imbalzano,
G. R. Schnitzler,
R. E. Kingston, and R. Young.
1996.
RNA polymerase holoenzyme contains SWI/SNF regulators involved in chromatin remodeling.
Cell
84:235-244[Medline].
|
| 55.
|
Woychik, N. A.,
S. M. Liao,
P. A. Kolodziej, and R. A. Young.
1990.
Subunits shared by eukaryotic nuclear RNA polymerases.
Genes Dev.
4:313-323[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1998, p. 7546-7555, Vol. 18, No. 12
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Choudhary, M. K., Basu, D., Datta, A., Chakraborty, N., Chakraborty, S.
(2009). Dehydration-responsive Nuclear Proteome of Rice (Oryza sativa L.) Illustrates Protein Network, Novel Regulators of Cellular Adaptation, and Evolutionary Perspective. Mol. Cell. Proteomics
8: 1579-1598
[Abstract]
[Full Text]
-
Nwachukwu, J. C., Mita, P., Ruoff, R., Ha, S., Wang, Q., Huang, S. J., Taneja, S. S., Brown, M., Gerald, W. L., Garabedian, M. J., Logan, S. K.
(2009). Genome-Wide Impact of Androgen Receptor Trapped clone-27 Loss on Androgen-Regulated Transcription in Prostate Cancer Cells. Cancer Res.
69: 3140-3147
[Abstract]
[Full Text]
-
Kusakawa, T., Shimakami, T., Kaneko, S., Yoshioka, K., Murakami, S.
(2007). Functional Interaction of Hepatitis C Virus NS5B with Nucleolin GAR Domain. J Biochem
141: 917-927
[Abstract]
[Full Text]
-
Corbi, N., Bruno, T., De Angelis, R., Di Padova, M., Libri, V., Di Certo, M. G., Spinardi, L., Floridi, A., Fanciulli, M., Passananti, C.
(2005). RNA Polymerase II subunit 3 is retained in the cytoplasm by its interaction with HCR, the psoriasis vulgaris candidate gene product. J. Cell Sci.
118: 4253-4260
[Abstract]
[Full Text]
-
Le, T. T. T., Zhang, S., Hayashi, N., Yasukawa, M., Delgermaa, L., Murakami, S.
(2005). Mutational Analysis of Human RNA Polymerase II Subunit 5 (RPB5): The Residues Critical for Interactions with TFIIF Subunit RAP30 and Hepatitis B Virus X Protein. J Biochem
138: 215-224
[Abstract]
[Full Text]
-
Zhao, M., Soderhall, I., Park, J. W., Ma, Y. G., Osaki, T., Ha, N.-C., Wu, C. F., Soderhall, K., Lee, B. L.
(2005). A Novel 43-kDa Protein as a Negative Regulatory Component of Phenoloxidase-induced Melanin Synthesis. J. Biol. Chem.
280: 24744-24751
[Abstract]
[Full Text]
-
Tang, H., Delgermaa, L., Huang, F., Oishi, N., Liu, L., He, F., Zhao, L., Murakami, S.
(2005). The Transcriptional Transactivation Function of HBx Protein Is Important for Its Augmentation Role in Hepatitis B Virus Replication. J. Virol.
79: 5548-5556
[Abstract]
[Full Text]
-
Delgermaa, L., Hayashi, N., Dorjsuren, D., Nomura, T., Thuy, L. T.-T., Murakami, S.
(2004). Subcellular Localization of RPB5-Mediating Protein and Its Putative Functional Partner. Mol. Cell. Biol.
24: 8556-8566
[Abstract]
[Full Text]
-
Ma, Y., Shimakami, T., Luo, H., Hayashi, N., Murakami, S.
(2004). Mutational Analysis of Hepatitis C Virus NS5B in the Subgenomic Replicon Cell Culture. J. Biol. Chem.
279: 25474-25482
[Abstract]
[Full Text]
-
Gstaiger, M., Luke, B., Hess, D., Oakeley, E. J., Wirbelauer, C., Blondel, M., Vigneron, M., Peter, M., Krek, W.
(2003). Control of Nutrient-Sensitive Transcription Programs by the Unconventional Prefoldin URI. Science
302: 1208-1212
[Abstract]
[Full Text]
-
Hirano, M., Kaneko, S., Yamashita, T., Luo, H., Qin, W., Shirota, Y., Nomura, T., Kobayashi, K., Murakami, S.
(2003). Direct Interaction between Nucleolin and Hepatitis C Virus NS5B. J. Biol. Chem.
278: 5109-5115
[Abstract]
[Full Text]
-
Shirota, Y., Luo, H., Qin, W., Kaneko, S., Yamashita, T., Kobayashi, K., Murakami, S.
(2002). Hepatitis C Virus (HCV) NS5A Binds RNA-dependent RNA Polymerase (RdRP) NS5B and Modulates RNA-dependent RNA Polymerase Activity. J. Biol. Chem.
277: 11149-11155
[Abstract]
[Full Text]
-
FANCIULLI, M., BRUNO, T., DI PADOVA, M., DE ANGELIS, R., IEZZI, S., IACOBINI, C., FLORIDI, A., PASSANANTI, C.
(2000). Identification of a novel partner of RNA polymerase II subunit 11, Che-1, which interacts with and affects the growth suppression function of Rb. FASEB J.
14: 904-912
[Abstract]
[Full Text]
-
Weil, R., Sirma, H., Giannini, C., Kremsdorf, D., Bessia, C., Dargemont, C., Brechot, C., Israel, A.
(1999). Direct Association and Nuclear Import of the Hepatitis B Virus X Protein with the NF-kappa B Inhibitor Ikappa Balpha. Mol. Cell. Biol.
19: 6345-6354
[Abstract]
[Full Text]
-
Wei, W., Dorjsuren, D., Lin, Y., Qin, W., Nomura, T., Hayashi, N., Murakami, S.
(2001). Direct Interaction between the Subunit RAP30 of Transcription Factor IIF (TFIIF) and RNA Polymerase Subunit 5, Which Contributes to the Association between TFIIF and RNA Polymerase II. J. Biol. Chem.
276: 12266-12273
[Abstract]
[Full Text]
-
Gomez-Gonzalo, M., Carretero, M., Rullas, J., Lara-Pezzi, E., Aramburu, J., Berkhout, B., Alcami, J., Lopez-Cabrera, M.
(2001). The Hepatitis B Virus X Protein Induces HIV-1 Replication and Transcription in Synergy with T-cell Activation Signals. FUNCTIONAL ROLES OF NF-kappa B/NF-AT AND SP1-BINDING SITES IN THE HIV-1 LONG TERMINAL REPEAT PROMOTER. J. Biol. Chem.
276: 35435-35443
[Abstract]
[Full Text]
-
Qin, W., Luo, H., Nomura, T., Hayashi, N., Yamashita, T., Murakami, S.
(2002). Oligomeric Interaction of Hepatitis C Virus NS5B Is Critical for Catalytic Activity of RNA-dependent RNA Polymerase. J. Biol. Chem.
277: 2132-2137
[Abstract]
[Full Text]