Previous Article | Next Article 
Mol Cell Biol, February 1998, p. 1023-1028, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
In Vivo Identification of Nuclear Factors
Interacting with the Conserved Elements of Box C/D Small
Nucleolar RNAs
Elisa
Caffarelli,1
Massimo
Losito,2
Corinna
Giorgi,2
Alessandro
Fatica,2 and
Irene
Bozzoni2,*
Centro Acidi Nucleici of
CNR1 and
Dipartimento di Genetica e
Biologia Molecolare, Istituto-Pasteur Fondazione
Cenci-Bolognetti,2 Università "La
Sapienza," Rome, Italy
Received 28 July 1997/Returned for modification 8 September
1997/Accepted 17 November 1997
 |
ABSTRACT |
The U16 small nucleolar RNA (snoRNA) is encoded by the third intron
of the L1 (L4, according to the novel nomenclature) ribosomal protein
gene of Xenopus laevis and originates from processing of
the pre-mRNA in which it resides. The U16 snoRNA belongs to the box C/D
snoRNA family, whose members are known to assemble in ribonucleoprotein
particles (snoRNPs) containing the protein fibrillarin. We have
utilized U16 snoRNA in order to characterize the factors that interact
with the conserved elements common to the other members of the box C/D
class. In this study, we have analyzed the in vivo assembly of U16
snoRNP particles in X. laevis oocytes and identified the
proteins which interact with the RNA by label transfer after UV
cross-linking. This analysis revealed two proteins, of 40- and 68-kDa
apparent molecular size, which require intact boxes C and D together
with the conserved 5',3'-terminal stem for binding. Immunoprecipitation
experiments showed that the p40 protein corresponds to fibrillarin,
indicating that this protein is intimately associated with the RNA. We
propose that fibrillarin and p68 represent the RNA-binding factors
common to box C/D snoRNPs and that both proteins are essential for the
assembly of snoRNP particles and the stabilization of the snoRNA.
| |
INTRODUCTION |
One of the most interesting recent
findings related to ribosome biogenesis has been the identification of
a large number of small RNAs localized in the nucleolus (snoRNAs). So
far, more than 60 snoRNAs have been identified in vertebrates
(17), and more than 30 have been identified in yeast
(2). The total number of snoRNAs is not known, but it is
likely to be close to 200 (33, 38). These snoRNAs, with the
exception of the mitochondrial RNA processing (MRP) species
(38), can be grouped into two major families on the basis of
conserved structural and sequence elements. The first group includes
molecules referred to as box C/D snoRNAs, whereas the second one
comprises the species belonging to the box H/ACA family (2,
15).
The two families differ in many aspects. The box C/D
snoRNAs are functionally heterogeneous. Most of them function
as antisense RNAs in site-specific ribose methylation of the pre-rRNA
(1, 10, 17, 26); a minority have been shown to play a direct role in pre-rRNA processing in both yeast and metazoan cells (11, 21). The box C/D snoRNAs play their role by means of unusually long (up to 21 contiguous nucleotides) regions of complementarity to
highly conserved sequences of 28S and 18S rRNAs (1). In contrast, several members of the H/ACA RNA family have been shown to
direct site-specific isomerization of uridines into pseudouridines and
to display shorter regions of complementarity to rRNA (14, 24). Mutational analysis suggests that H/ACA snoRNAs can also play a role as antisense RNAs by base pairing with complementary regions on rRNA (15, 24).
Another difference between the two families can be seen by comparison
of secondary structures. A Y-shaped motif, where a 5',3'-terminal stem
adjoins the C and D conserved elements, has been proposed for many box
C/D snoRNAs (16, 26, 40, 42), whereas box H/ACA snoRNAs have
been proposed to fold into two conserved hairpin structures connected
by a single-stranded hinge region, followed by a short 3' tail
(15).
Despite these differences, analogies have been found in the roles
played by the conserved box elements. Mutational analysis and
competition experiments indicated that C/D and H/ACA boxes are required
both for processing and stable accumulation of the mature snoRNA,
suggesting that they represent binding sites for specific
trans-acting factors (2, 3, 8, 15, 16, 28, 36,
41).
All snoRNAs are associated with proteins to form specific
ribonucleoparticles (snoRNPs). The study of these particles began only
recently, and so far, very few aspects of their structure and
biosynthesis have been clarified. The only detailed analysis performed
was on the mammalian U3 (19) and the yeast snR30
(20) snoRNPs. Of the identified components, a few appear to
be more general factors: fibrillarin, which was shown to be associated with C/D snoRNPs (3, 4, 8, 13, 28, 31, 39), and the
nucleolar protein GAR1, which was found associated with H/ACA snoRNAs
in yeast (20). Just as the study of small nuclear RNP (snRNP) particles was crucial to the understanding of the splicing process, a detailed structural and functional analysis of snoRNP particles will be essential to elucidate the complex process of ribosome biosynthesis.
In this study, we have analyzed the snoRNP assembly of wild-type and
mutant U16 snoRNAs by following the kinetics of complex formation in
the in vivo system of the Xenopus laevis oocyte. By a UV
cross-linking technique, we have identified two proteins, of 40- and
68-kDa apparent molecular mass, which require intact boxes C and D
together with the terminal stem for their binding. The 40-kDa species
is specifically recognized by fibrillarin antibodies, indicating that
this protein is intimately associated with the RNA.
| |
MATERIALS AND METHODS |
Oligonucleotides.
The following oligonucleotides were used
for obtaining the templates for in vitro transcription: B5
(TAATACGACTCACTATAGGCTTGCTATGATGTCGTAA), 
U16
(TTTTTGCTCAGAACGCGA), B7
(TAATACGACTCACTATAGGGCTTGCTACAATGTCGTAAT), U16D (TTTTTGCTGGTAACGCGATAT), U16 stem
(AAAAATCAGAACGCGATA), FW22
(TAATACGACTCACTATAGGGGTCGATATGATGAGTTCCAC), and
Ale2 (CCAAGCTTAATCAGAACTTCCAC). The underlined sequence
represents the T7 promoter (23).
Plasmids and templates for RNA transcription.
The following
templates were obtained by PCR amplification of plasmid 003 (12) with the oligonucleotides indicated in parentheses: U16108 (B5 and U16), bC (B7 and U16), bD (B5 and
U16D), and stemM (B5 and U16 stem). 
2 mutant was obtained from
the corresponding mutant plasmid described by Prislei et al.
(30) by PCR amplification with the B5 and U16
oligonucleotides. The template used for T7 transcription of U6 snRNA,
kindly provided by E. Lund, was obtained by PCR amplification of the
X. laevis U6 gene (32); U3 snoRNA was obtained by
SP6 transcription of a PCR template kindly provided by M. P. Terns
(35). The template for U18 snoRNA was obtained by PCR on
plasmid 00234 (6) with oligonucleotides FW22 and Ale2.
In vitro transcription and oocyte microinjection.
RNA
substrates were synthesized in vitro (22) in the presence of
30 µCi of [
-32P]UTP (800 Ci/mmol) and 25 µM UTP.
After transcription, the RNA was gel purified, phenol extracted, and
precipitated with ethanol in the presence of 10 µg of
Escherichia coli tRNA. For oocyte microinjection,
32P-labelled transcripts were dissolved in bidistilled
water at a concentration of 0.75 pmol/µl, and 9.2 nl was injected
into germinal vesicles of stage VI oocytes. In vitro transcription of
cold RNAs was performed in the presence of 500 µM UTP. For competition experiments, 32P-labelled U16 snoRNA was
coinjected with a 100× molar excess of U3 or U6 cold RNAs. After
2 h of incubation, nuclei were dissected and UV cross-linking
analysis was performed as described below.
RNA and snoRNP particle analysis.
After injection of
32P-labelled RNAs, the oocytes were incubated at 19°C and
10 nuclei were manually isolated each time. One nucleus was used for
RNA analysis. Disruption and digestion of the nucleus were carried out
in the presence of 2% sodium dodecyl sulfate (SDS), 0.3 M sodium
acetate (pH 5.5), 10 mM Tris-HCl (pH 7.6), 1.5 mM MgCl2, 10 mM NaCl, and 2 mg of proteinase K per ml. RNA was then extracted with
phenol-chloroform and analyzed on a 6% polyacrylamide-7 M urea gel.
After disruption, three nuclei from the same sample were directly
loaded onto a native 4% polyacrylamide gel
(acrylamide-to-bisacrylamide ratio, 60:1) for snoRNP particle analysis.
The remaining six nuclei were used for the analysis of UV cross-linked
proteins.
UV cross-linking analysis.
Isolated nuclei injected with
32P-labelled transcripts were exposed to an energy of 600 mJ/cm2 under UV light (254-nm wavelength) in a
Spectrolinker XL-1000 apparatus to achieve cross-linking of RNA-protein
complexes. These complexes were then treated with 10 µg of RNase A
per ml, 1,000 U of RNase T1 per ml, and 14 U of RNase V1
per ml for 15 min at 37°C and for 15 min at RT. The samples were
treated with 2% SDS-62.5 mM Tris-HCl (pH 6.8)-100 mM
dithiothreitol-10% glycerol-0.05% bromophenol blue and loaded onto
SDS-13% polyacrylamide gels. The proteins were visualized by
autoradiography.
Immunoprecipitation.
Antifibrillarin serum (20 µl) or
preimmune antiserum was coupled initially to 3 mg of preswollen protein
A-Sepharose (Pharmacia) in IPP 200 buffer (40 mM Tris [pH 7.5], 200 mM NaCl, 0.05% Nonidet P-40) in the presence of 10 µg of tRNA and
incubated for 1 h at room temperature. Isolated nuclei injected
with 32P-labelled RNAs were disrupted in IPP 200, with the
final NaCl concentration adjusted to 400 mM. Following centrifugation
for 10 min (13,000 rpm at 4°C in an Eppendorf centrifuge), the
cleared extracts were added to antibody-coupled protein-A Sepharose in the presence of 80 U of RNase inhibitor (Amersham) per ml in a final
volume of 500 µl and the incubation was carried out for 2 h at
4°C, with constant mixing (27, 39). Washes were performed in IPP 200 buffer. The samples were digested with proteinase K (0.5 mg/ml), and the recovered RNA was analyzed on a 6%
polyacrylamide-urea gel. Immunoprecipitation of cross-linked proteins
was carried out by the same procedure on UV cross-linked nuclei after
digestion with RNases (see UV Cross-Linking Analysis). For supershift
analysis, five 32P-labelled U16-injected nuclei were
disrupted and incubated with monoclonal antibodies against fibrillarin
(72B9) or with preimmune immunoglobulin G for 1 h at 4°C with
stirring; the samples were then directly loaded onto a native 4%
polyacrylamide gel. Monoclonal antibodies 72B9 and antifibrillarin sera
against 34-kDa Xenopus fibrillarin (18) were
kindly provided by M. Caizergues-Ferrer.
| |
RESULTS |
In vivo assembly of snoRNP complexes.
We previously reported
that stable and correctly processed U16 snoRNA is produced in X. laevis oocytes when they are microinjected with an in
vitro-transcribed pre-U16 snoRNA containing 5' and 3' trailer sequences
(7-9). In the present study, we utilized the same approach
to analyze the kinetics of U16 snoRNP particle formation. The
microinjected substrate was U16 snoRNA with two extra G residues at the
5' end and an extension of three nucleotides (A residues) at the 3'
end. This 108-nucleotide-long RNA is converted into the trimmed form,
which is 103 nucleotides long, by endogenous exonucleolytic activity
and stably accumulates with time. In a typical experiment,
32P-labelled snoRNA was injected into the germinal vesicle
of X. laevis oocytes, and for each incubation time, nuclei
were manually dissected from the cytoplasm and utilized for (i)
analysis of nuclear RNA, (ii) electrophoretic mobility shift assay of
the complexes formed on the microinjected labelled RNA, and (iii) identification of RNA-binding proteins by label transfer after UV
cross-linking.
Figure 1a shows the kinetics of U16
snoRNA complex formation. Two major complexes, referred to as A and B,
are visualized. Complex A is already visible at very short incubation
times (2 to 10 min), while significant accumulation of complex B starts later; it is the major complex that persists after 8 h of
incubation (lane 8h). Analysis performed over 24 h showed that
complex B stably accumulates, even at such prolonged incubations (data
not shown). The profile indicates that the rapidly associating complex A is subsequently replaced by complex B. As a control, protease treatment of samples at different incubation times resulted in the
disappearance of both complexes and the release of free RNA (data not
shown).
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 1.
U16 snoRNP analysis. (a) In vitro-transcribed
32P-labelled U16 transcript was injected into the nuclei of
X. laevis oocytes and incubated for the times indicated
below. Purified nuclei, disrupted by pipetting, were directly loaded on
a native 4% acrylamide gel. The bands corresponding to A and B
complexes are indicated together with the free RNA. The lower panel
shows the electrophoretic analysis on a 6% polyacrylamide-7 M urea
gel of the RNA extracted at the corresponding time points. The
108-nucleotide-long injected precursor (p) U16 RNA and the
103-nucleotide-long mature (m) U16 snoRNA are indicated. (b) Proteins
UV cross-linked to 32P-labelled U16 transcript. Samples
were subjected to SDS-polyacrylamide gel electrophoresis on a 13%
polyacrylamide gel. The 40-, 68-, and 98-kDa proteins are indicated by
arrows. Protein molecular weight markers (in thousands) are shown at
the side of the gel.
|
|
The parallel RNA analysis is shown in the lower part of Fig.
1a. Fifty
percent of input RNA is found in the trimmed form after
90 min, and
this amount remains stable over 8 h. From this and
other
experiments, it can be calculated that a single oocyte is
able to
assemble into stable particles with approximately 2 to
4 fmol of box
C/D snoRNA. The difference in the lengths of precursor
and mature RNAs
is not sufficient to account for the differential
mobilities of the A
and B complexes, suggesting that the two complexes
have different
protein compositions.
Figure
1b shows the pattern of the proteins directly interacting with
32P-labelled U16, identified by label transfer after UV
cross-linking.
At short incubations (10 min), approximately 10 proteins, with
molecular masses ranging from 20.5 to 98 kDa, are
detected. After
8 h, three major proteins, with apparent molecular
masses of 40,
68, and 98 (a doublet) kDa, remain bound to the snoRNA,
and their
presence parallels the formation of complex B. These data
indicate
that, soon after the injection, the majority of input RNA is
associated
with a wide range of factors, presumably abundant nuclear
proteins
with low binding specificity, and that subsequently, these
interactions
are replaced by more specific ones.
UV cross-linking analysis on different RNA substrates.
The
specificity of the U16 protein pattern was analyzed on different RNA
substrates containing (U18 and U3) or not containing (U6) the conserved
boxes C and D. A p98 signal is found with all the RNAs, while the p40
and p68 proteins are detected on U18 and U3 snoRNAs and are absent from
U6 snRNA (Fig. 2a). The U6-specific pattern shows a major UV cross-linked protein of approximately 50 kDa
(arrowhead). Previous UV cross-linking analysis in X. laevis oocytes showed that the 50-kDa band corresponded to the La protein (34). This protein is known to have predominant nuclear
localization and to be associated with nascent RNA polymerase III
transcripts through their 3' oligourydilate stretch (29).
Immunoprecipitation with La protein antibodies (data not shown)
demonstrated that the La protein is also bound to U16 snoRNA
(arrowhead); this interaction occurs at short incubation times and is
progressively lost (Fig. 1b), indicating that La is not part of the
snoRNP-specific particle.
View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
UV cross-linking and competition analyses with other
substrates. (a) Gel electrophoresis analysis of the proteins UV
cross-linked in vivo to 32P-labelled U16, U18, U3, and U6
RNAs. Incubation times are indicated below. (b)
32P-labelled U16 snoRNA was microinjected alone (lane  )
or with a 100-fold molar excess of cold competitor RNAs: U16 snoRNA
(lane +U16), U18 snoRNA (lane +U18), U3 snoRNA (lane +U3), or U6 snRNA
(lane +U6). The incubation was allowed to proceed for 2 h, and UV
cross-linked proteins were resolved on a 13% polyacrylamide denaturing
gel. In both panels, the 40-, 68-, and 98-kDa proteins are indicated by
arrows, while the La protein is indicated by an arrowhead.
|
|
Competition experiments, in which excesses of cold competitor
U16, U18, U3, and U6 RNAs were coinjected with
32P-labelled U16 snoRNA, indicated that all C/D box
snoRNAs specifically
compete very efficiently for the binding of
the p68 and p40 proteins
and only partially for the p98 signal, while
U6 competes only
for the La protein (Fig.
2b).
Assembly of RNP complexes on U16 mutant derivatives.
We
further addressed the question of whether the binding of p40 and p68
proteins was dependent on the presence of the boxes C and D and/or on
other structural elements. It is known that most of the components of
the box C/D family, besides the conserved elements, have a Y-shaped
secondary-structure motif in which a terminal stem adjoins the C and D
boxes (16, 25, 40, 42). For this reason, a collection of U16
mutant derivatives were analyzed for their ability to assemble RNP
complexes in vivo, for the resultant pattern of UV cross-linked
proteins, and for RNA stability.
The first mutants tested were bC and bD RNAs, which have two- and
three-base substitutions in boxes C and D, respectively
(Fig.
3b). These mutants were previously shown
to affect both
processing and stability of the snoRNA (
8).
Figure
3a shows
the band shift analysis performed with these mutants;
bC and bD
RNAs do not accumulate stable complexes, only a smeared band
at
short incubation times. This finding corresponds perfectly with
the
instability of the RNA, which at 2 h is completely degraded
(Fig.
3b, lower panel). UV cross-linking analysis reveals that,
at incubation
times when RNA is not yet degraded (lanes 10 and
40 min), the p40 and
p68 proteins are absent from both mutants
(Fig.
3b). Notice that in
these mutants the p98 signal is present,
demonstrating that the binding
of this protein is not dependent
on C and D boxes. These results
suggest that the two boxes are
required for the binding of the p40 and
p68 proteins and that
this interaction is necessary to confer stability
to the RNA molecule.
Furthermore, both boxes should be intact for the
binding of the
two proteins.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Box C/D mutant analysis. (a) Time course of in vivo
snoRNP complex assembly on U16 snoRNA and its mutant derivatives bC and
bD. The sequences of the boxes C and D are reported in panel b together
with the substituted nucleotides. 32P-labelled U16, bC, and
bD RNAs were injected into oocytes and incubated for 10 min or for
2 h. The nuclei were loaded onto a native 4% polyacrylamide gel.
The bands corresponding to complexes A and B are indicated. (b) Upper
part, gel electrophoresis analysis of the proteins UV cross-linked in
vivo to 32P-labelled U16, bC, and bD RNAs. Samples were
analyzed on denaturing SDS-13% polyacrylamide gel. The 40- and 68-kDa
proteins are indicated. Incubation times are noted below. The base
substitutions inside the conserved boxes are shown in the schematic
representation at the right. Lower part, 6% polyacrylamide-7 M urea
gel of the RNA extracted at the corresponding time points. The input
RNA (p) and trimmed form (m) are indicated.
|
|
Figure
4 shows the pattern of UV
cross-linked proteins on the stemM mutant, in which four base
substitutions prevent the formation
of the conserved 5',3'-terminal
stem. Despite its instability,
this RNA survives for almost 40 min
(data not shown), during which
time it is possible to analyze the
protein pattern. Again, neither
the p40 nor the p68 protein is
detected. These data indicate that,
in addition to the conserved boxes,
correct structure of the terminal
stem is required for binding of the
two C/D-specific proteins.
The oocytes utilized in this experiment
produce a very specific
protein pattern by 10 min. Variability in the
timing of protein
binding was observed in all the experiments performed
with different
batches of oocytes. This difference is very likely due
to the
already reported and well-known variability of the oocyte
system.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Gel electrophoresis analysis of the proteins UV
cross-linked in vivo to 32P-labelled U16 and its mutant
derivative stemM RNA. Samples were obtained and analyzed as shown in
the previous figures. The base substitutions of the 5',3'-terminal stem
are shown in the schematic representation at the right.
|
|
2 mutant RNA harbors a 28-nucleotide deletion of the apical
stem-loop but has intact boxes C and D (see schematic representation
in
Fig.
5). In Fig.
5a, the band shift
analysis shows that
2
RNA produces a different B-type complex (B').
In addition, its
assembly is considerably delayed; at 8 h, almost
50% of the complexes
are in the B' form, while 80% of wild-type U16
snoRNA is in complex
B (lane U16). RNA analysis (shown in the lower
part of Fig.
5a)
indicates that this mutant stably accumulates as the
wild-type
RNA. The pattern of UV cross-linked proteins, shown in Fig.
5b,
reveals the presence of both p40 and p68 proteins, indicating
that
binding of the two proteins does not require the apical stem-loop
structure. On the basis of this analysis, it is impossible to
determine
whether the faster migration of complex B' is due to
a different
protein composition or to the different size and/or
structure of the
mutant RNA. Nevertheless, the different size
of the RNA does not seem
to affect the migration of complex A,
which corresponds to that of the
wild-type RNA. Additional mutations
in the conserved central stem,
previously reported to be important
for U16 processing from the
pre-mRNA (
30), were also shown not
to affect p40 and p68
binding (data not shown).
View larger version (54K):
[in this window]
[in a new window]
|
FIG. 5.
2 RNA mutant analysis. (a) Upper part, time course of
in vivo snoRNP complex assembly on 2 RNA. The schematic
representation at the right indicates the extension of the deletion.
32P-labelled 2 RNA was injected into oocytes, and
incubation was allowed to proceed for the times indicated below. Lane
U16, 32P-labelled U16 snoRNA was injected, and incubation
was allowed to proceed for 8 h. The nuclei were loaded onto a
native 4% polyacrylamide gel. The bands corresponding to complexes A,
B', and B are indicated. Lower part, 6% polyacrylamide-7 M urea gel
of the RNA extracted at the corresponding time points. The
80-nucleotide-long injected 2 snoRNA precursor (p) and the
74-nucleotide-long mature (m) forms are indicated. (b) Gel
electrophoresis analysis of the proteins UV cross-linked in vivo to
32P-labelled U16 and 2 RNAs after 8 h of
incubation. Samples were obtained and analyzed as in the previous
figures.
|
|
Fibrillarin association with U16 snoRNA.
We previously showed
that U16 snoRNA is associated in vivo in complexes containing
fibrillarin (13), and so far its presence is considered
diagnostic for the formation of box C/D snoRNPs (3, 8, 28, 39,
41). It was previously shown that fibrillarin association relies
on the presence of box C, as in the case of U3 (3), or on
the presence of both boxes, as demonstrated for U8 snoRNA
(28). In order to determine the presence of fibrillarin in
U16 snoRNP particles, we followed three different approaches. The first
comprises a supershift assay of in vivo-assembled complexes with
monoclonal antibodies against fibrillarin. Figure
6a shows that complex B is almost
quantitatively supershifted when extracts from injected nuclei are
incubated with antifibrillarin antibodies. The second approach used the
immunoprecipitation of fibrillarin-containing complexes from
microinjected nuclei followed by RNA analysis. Figure 6b shows that
fibrillarin has already become associated with a small fraction of U16
by 10 min of incubation (compare lanes 1); at 2 h of incubation,
RNA is almost quantitatively immunoprecipitated (compare lanes 2). 2
mutant RNA, which harbors the longest deletion we have analyzed (28 nucleotides), is also immunoprecipitated by antifibrillarin antibodies
(data not shown), indicating that the U16 apical stem-loop is not
necessary for fibrillarin association. The third approach was
immunoprecipitation with antibodies against fibrillarin of UV
cross-linked proteins. Figure 6c shows that antibodies already
specifically recognize the p40 protein at 10 min (lane 10') and more
significantly at prolonged incubation times (lane 5h). As a control,
none of the proteins bound to U6 snRNA was immunoprecipitated (lane U6
anti-Fib.). These data indicate that fibrillarin is intimately
associated with U16 snoRNA.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of fibrillarin association. (a) Supershift
analysis was performed with monoclonal antibodies against fibrillarin
(lane anti-Fib.) or with preimmune immunoglobulin G (lane pre-imm.) on
five nuclei injected with 32P-labelled U16 RNA and
incubated for 2 h; in lane , five control nuclei were loaded.
Complexes A and B are indicated by arrows, and the supershifted complex
is indicated by an arrowhead. (b) Nuclei were dissected from oocytes
injected with 32P-labelled U16 RNA and incubated for 10 min
(lanes 1) or 5 h (lanes 2). RNA was extracted from 20 control
nuclei (lanes ) or from the pellets of 20 nuclei immunoprecipitated
with antifibrillarin (lanes anti-Fib.) or preimmune (lane pre-imm.)
serum. The samples were loaded on a 6% polyacrylamide-urea gel. (c)
Oocytes were injected with U16 or U6 32P-labelled
transcripts, and nuclei were manually dissected, UV irradiated, and,
after RNase digestion, immunoprecipitated with antifibrillarin
antibodies (lanes anti-Fib.) or preimmune serum (lanes pre-imm.). Lanes show control UV cross-linking to U16 and to U6 RNAs. The products
were run on an SDS-13% polyacrylamide gel. Incubation times are
indicated below. The arrow indicates the p40 protein.
|
|
| |
DISCUSSION |
The identification of the numerous snoRNAs has indicated that the
nucleolus, the site of ribosome assembly, may be by far the most
complex of the known cellular RNA machines. All the different snoRNAs
are associated with proteins forming specific complexes (snoRNPs), and
so far very little is known about their identity and function. The
discovery that most snoRNPs mediate posttranscriptional modifications
of rRNA is quite recent. While it is believed that the role of the RNA
component is to function as a guide in the selection of the specific
residue to be modified, much less is known about the role played by the
protein components. They can play a structural role or directly
participate in the modifying and/or processing reactions as catalytic
components. The only information available indicates that
temperature-sensitive mutations of fibrillarin and Gar1 in yeast cause
lower levels of methylation and pseudourydilation, respectively
(5, 37). Nevertheless, the specific role of snoRNP protein
components is not known.
In this study, we have analyzed the nuclear factors that associate in
vivo with the X. laevis intron-encoded U16 snoRNA, which is
a member of the box C/D snoRNA family (13). The results
indicate that, after the injection, the RNA is rapidly assembled into a fast-migrating complex which is replaced in time by a slow-mobility complex. This particle represents the major species after 8 h and
is the only one observed after overnight incubation. At short intervals, the pattern of UV cross-linked proteins is quite complex; however, it becomes much simpler after prolonged incubations when the
stable, larger complex accumulates. At long incubation times, three
major UV cross-linked proteins are detected, with apparent molecular
masses of 40, 68, and 98 (a doublet) kDa. While the specificity of p98
is still difficult to assess, since proteins of this size are
visualized with all the U16 mutants, the binding of the 40- and 68-kDa
proteins was shown to be highly specific in a number of ways. The same
two factors were revealed by in vivo UV cross-linking with other C/D
box-containing snoRNAs, such as U18 and U3, while they were not
visualized on the unrelated spliceosomal U6 snRNA. Specificity was also
verified by competition experiments. C/D box-containing snoRNAs were
able to compete out the binding of the two proteins from U16, while U6
snRNA could not.
Band shift and UV cross-linking analyses with several U16 mutants
allowed us to identify the sequences required for p40 and p68 binding.
Mutations in the boxes C and D and in the conserved 5',3'-terminal stem
were tested first. Since mutations in these regions are known to
strongly affect the stability of the RNA, we analyzed the UV
cross-linked proteins at very short incubation times, when the RNA had
not yet been degraded and when both proteins were already present in
the wild-type substrate. Under these conditions, neither the p40 nor
the p68 protein could be detected. Since mutations in other parts of
the U16 molecule did not affect binding, we could conclude that only
the conserved boxes and terminal stem are necessary for p40 and p68
association.
Since fibrillarin is the only protein known to associate with the C/D
class of snoRNAs, we sought to determine whether it is present in U16
complexes. Supershift analysis and immunoprecipitation experiments with
antifibrillarin antibodies confirmed that fibrillarin is present in the
U16 complex and demonstrated that it corresponds to the p40 protein.
Interestingly, binding of fibrillarin and p68 was affected by the same
mutations, suggesting that the two proteins cooperate for the binding
to the conserved C/D box region. In conclusion, these two RNA-binding
proteins appear to represent general factors associated with all box
C/D snoRNAs. It is very likely that, similarly to the
well-characterized snRNPs, other proteins, specific for single snoRNA
species, associate with these common factors. If U16-specific factors
exist, they have been underscored in our assay, since U16 snoRNPs
constitute a small fraction of the overall population of box C/D
snoRNPs. If specific factors have to be studied, large-scale
fractionation of endogenous U16 snoRNP particles will be required.
| |
ACKNOWLEDGMENTS |
We thank Elsebet Lund and Michael Terns for kindly providing
plasmids, Michèle Caizergues-Ferrer for fibrillarin antibodies, and Paola Pierandrei-Amaldi for the La antibodies. We also thank Jorg
Hamm and Paola Fragapane for helpful discussion. We thank Massimo
Arceci and Roberto Gargamelli for skillful technical help and Fabio
Riccobono and M-medical for oligonucleotide facilities.
This work was partially supported by grants from 5% Biotecnologie of
C.N.R. and by CEC contract no. CHRX-CT94-0677.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Istituto-Pasteur
Fondazione Cenci-Bolognetti, Dipartimento di Genetica e Biologia
Molecolare, Universita "La Sapienza," 00185 Rome, Italy. Phone:
39-6-49912202. Fax: 39-6-49912500. E-mail:
Bozzoni{at}axcasp.caspur.it.
| |
REFERENCES |
| 1.
|
Bachellerie, J. P.,
B. Michot,
M. Nicoloso,
A. Balakin,
J. Ni, and M. J. Fournier.
1995.
Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA.
Trends Biochem. Sci.
20:261-264[Medline].
|
| 2.
|
Balakin, A. G.,
L. Smith, and M. J. Fournier.
1996.
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Cell
86:823-834[Medline].
|
| 3.
|
Baserga, S. J.,
X. W. Yang, and J. A. Steitz.
1991.
An intact box C sequence in the U3 snRNA is required for binding of fibrillarin, the protein common to the major family of nucleolar snRNPs.
EMBO J.
10:2645-2651[Medline].
|
| 4.
|
Baserga, S. J.,
M. Gilmore-Hebert, and X. W. Yang.
1992.
Distinct molecular signals for nuclear import of the nucleolar snRNA, U3.
Genes Dev.
6:1120-1130[Abstract/Free Full Text].
|
| 5.
|
Bousquet-Antonelli, C.,
Y. Henry,
J. P. Gélugne,
M. Caizergues-Ferrer, and T. Kiss.
1997.
A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs.
EMBO J.
16:4770-4776[Medline].
|
| 6.
|
Caffarelli, E.,
P. Fragapane,
C. Gehring, and I. Bozzoni.
1987.
The accumulation of mature RNA for the Xenopus laevis ribosomal protein L1 is controlled at the level of splicing and turnover of the precursor RNA.
EMBO J.
6:3493-3498[Medline].
|
| 7.
|
Caffarelli, E.,
M. Arese,
B. Santoro,
P. Fragapane, and I. Bozzoni.
1994.
In vitro study of processing of the intron-encoded U16 small nucleolar RNA in Xenopus laevis.
Mol. Cell. Biol.
14:2966-2974[Abstract/Free Full Text].
|
| 8.
|
Caffarelli, E.,
A. Fatica,
S. Prislei,
E. De Gregorio,
P. Fragapane, and I. Bozzoni.
1996.
Processing of intron-encoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing reaction and the stability of the mature snoRNA.
EMBO J.
15:1121-1131[Medline].
|
| 9.
|
Caffarelli, E.,
L. Maggi,
A. Fatica,
J. Jiricnj, and I. Bozzoni.
1997.
A novel Mn++-dependent ribonuclease that functions in U16 snoRNA processing in X. laevis.
Biochem. Biophys. Res. Commun.
233:514-517[Medline].
|
| 10.
|
Cavaillé, J.,
M. Nicoloso, and J. P. Bachellerie.
1996.
Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides.
Nature
383:732-735[Medline].
|
| 11.
|
Fournier, M. J., and E. S. Maxwell.
1993.
The nucleolar snRNAs: catching up with the spliceosomal snRNAs.
Trends Biochem. Sci.
18:131-135[Medline].
|
| 12.
|
Fragapane, P.,
E. Caffarelli,
M. Lener,
S. Prislei,
B. Santoro, and I. Bozzoni.
1992.
Identification of the sequences responsible for the splicing phenotype of the regulatory intron of the L1 ribosomal protein gene of Xenopus laevis.
Mol. Cell. Biol.
12:1117-1125[Abstract/Free Full Text].
|
| 13.
|
Fragapane, P.,
S. Prislei,
A. Michienzi,
E. Caffarelli, and I. Bozzoni.
1993.
A novel small nucleolar RNA (U16) is encoded inside a ribosomal protein intron and originates by processing of the pre-mRNA.
EMBO J.
12:2921-2928[Medline].
|
| 14.
|
Ganot, P.,
M.-L. Bortolin, and T. Kiss.
1997.
Site specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs.
Cell
89:799-809[Medline].
|
| 15.
|
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 16.
|
Huang, G. M.,
A. Jarmolowski,
J. C. R. Struck, and M. J. Fournier.
1992.
Accumulation of U14 small nuclear RNA in Saccharomyces cerevisiae requires box C, box D, and a 5',3' terminal stem.
Mol. Cell. Biol.
12:4456-4463[Abstract/Free Full Text].
|
| 17.
|
Kiss-Laszlò, Z.,
Y. Henry,
J. P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 18.
|
Lapeyre, B.,
P. Mariottini,
C. Mathieu,
P. Ferrer,
F. Amaldi,
F. Amalric, and M. Caizergues-Ferrer.
1990.
Molecular cloning of Xenopus fibrillarin, a conserved U3 small nuclear ribonucleoprotein recognized by antisera from humans with autoimmune disease.
Mol. Cell. Biol.
10:430-434[Abstract/Free Full Text].
|
| 19.
|
Lubben, B.,
C. Marshallsay,
N. Rottmann, and R. Luhrmann.
1993.
Isolation of U3 snoRNP from CHO cells: a novel 55 kDa protein binds to the central part of U3 snoRNA.
Nucleic Acids Res.
21:5377-5385[Abstract/Free Full Text].
|
| 20.
|
Lubben, B.,
P. Fabrizio,
B. Kastner, and R. Luhrmann.
1995.
Isolation and characterization of the small nucleolar ribonucleoprotein particle snR30 from Saccharomyces cerevisiae.
J. Biol. Chem.
270:11549-11554[Abstract/Free Full Text].
|
| 21.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
35:897-934.
|
| 22.
|
Melton, D. A.,
P. A. Krieg,
M. R. Rebagliati,
T. Maniatis,
K. Zinn, and M. R. Green.
1984.
Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucleic Acids Res.
12:7035-7056[Abstract/Free Full Text].
|
| 23.
|
Milligan, J. F.,
D. R. Groebe,
G. W. Witherell, and O. C. Uhlembeck.
1987.
Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates.
Nucleic Acids Res.
15:8783-8798[Abstract/Free Full Text].
|
| 24.
|
Ni, J.,
A. L. Tien, and M. J. Fournier.
1997.
Small nucleolar RNAs direct site-specific synthesis of pseudouridines in ribosomal RNA.
Cell
89:565-573[Medline].
|
| 25.
|
Nicoloso, M.,
M. Caizergues-Ferrer,
B. Michot,
M. C. Azum, and J. P. Bachellerie.
1994.
U20, a novel small nucleolar RNA, is encoded in an intron of the nucleolin gene in mammals.
Mol. Cell. Biol.
14:5766-5776[Abstract/Free Full Text].
|
| 26.
|
Nicoloso, M.,
L. H. Qu,
B. Michot, and J. P. Bachellerie.
1996.
Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs.
J. Mol. Biol.
260:178-195[Medline].
|
| 27.
|
Peculis, B. A., and J. A. Steiz.
1993.
Disruption of U8 nucleolar snRNA inhibits 5.8S and 28S rRNA processing in the Xenopus oocyte.
Cell
73:1233-1245[Medline].
|
| 28.
|
Peculis, B. A., and J. A. Steiz.
1994.
Sequence and structural elements critical for U8 snRNP function in Xenopus oocytes are evolutionarily conserved.
Genes Dev.
8:2241-2255[Abstract/Free Full Text].
|
| 29.
|
Peek, R.,
G. J. M. Pruijn, and W. J. Van Venrooij.
1996.
Interaction of the La (SS-B) autoantigen with small ribosomal subunits.
Eur. J. Biochem.
236:649-655[Medline].
|
| 30.
|
Prislei, S.,
S. Sperandio,
P. Fragapane,
E. Caffarelli,
C. Presutti, and I. Bozzoni.
1992.
The mechanisms controlling ribosomal protein L1 pre-mRNA splicing are maintained in evolution and rely on conserved intron sequences.
Nucleic Acids Res.
20:4473-4479[Abstract/Free Full Text].
|
| 31.
|
Prislei, S.,
A. Michienzi,
C. Presutti,
P. Fragapane, and I. Bozzoni.
1993.
Two different snoRNAs are encoded in introns of amphibian and human L1 ribosomal protein genes.
Nucleic Acids Res.
21:5824-5830[Abstract/Free Full Text].
|
| 32.
|
Reddy, R., and H. Busch.
1988.
Small nuclear ribonucleoprotein particles, p. 1-37. In
M. L. Birnstiel (ed.), Structure and function of major and minor small nuclear ribonucleotide particles.
Springer-Verlag, Berlin, Germany.
|
| 33.
|
Smith, C. M., and J. A. Steitz.
1997.
Sno storm in the nucleolus: new roles for myriad small RNPs.
Cell
89:669-672[Medline].
|
| 34.
|
Terns, M. P.,
E. Lund, and J. E. Dahlberg.
1992.
3'-end-dependent formation of U6 small nuclear ribonucleoprotein particles in Xenopus laevis oocyte nuclei.
Mol. Cell. Biol.
12:3032-3040[Abstract/Free Full Text].
|
| 35.
|
Terns, M. P., and J. E. Dahlberg.
1994.
Retention and 5' cap trimethylation of U3 snRNA in the nucleus.
Science
264:959-961[Abstract/Free Full Text].
|
| 36.
|
Terns, M. P.,
C. Grimm,
E. Lund, and J. E. Dahlberg.
1995.
A common maturation pathway for small nucleolar RNAs.
EMBO J.
14:4860-4871[Medline].
|
| 37.
|
Tollervey, D.,
H. Lehtonen,
R. Jansen,
H. Kern, and E. C. Hurt.
1993.
Temperature-sensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly.
Cell
72:443-457[Medline].
|
| 38.
|
Tollervey, D., and T. Kiss.
1997.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
9:337-342[Medline].
|
| 39.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 40.
|
Tycowski, K. T.,
M. D. Shu, and J. A. Steitz.
1993.
A small nucleolar RNA is processed from an intron of the human gene encoding ribosomal protein S3.
Genes Dev.
7:1176-1190[Abstract/Free Full Text].
|
| 41.
|
Watkins, N. J.,
R. D. Leverette,
L. Xia,
M. T. Andrews, and E. S. Maxwell.
1996.
Elements essential for processing intronic U14 snoRNA are located at the termini of the mature snoRNA sequence and include conserved nucleotide boxes C and D.
RNA
2:118-133[Abstract].
|
| 42.
|
Xia, L.,
N. J. Watkins, and E. S. Maxwell.
1997.
Identification of specific nucleotide sequences and structural elements required for intronic U14 snoRNA processing.
RNA
3:17-26[Abstract].
|
Mol Cell Biol, February 1998, p. 1023-1028, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Appel, C. D., Maxwell, E. S.
(2007). Structural features of the guide:target RNA duplex required for archaeal box C/D sRNA-guided nucleotide 2'-O-methylation. RNA
13: 899-911
[Abstract]
[Full Text]
-
Granneman, S., Pruijn, G. J. M., Horstman, W., van Venrooij, W. J., Luhrmann, R., Watkins, N. J.
(2002). The hU3-55K Protein Requires 15.5K Binding to the Box B/C Motif as Well as Flanking RNA Elements for Its Association with the U3 Small Nucleolar RNA in Vitro. J. Biol. Chem.
277: 48490-48500
[Abstract]
[Full Text]
-
Watkins, N. J., Dickmanns, A., Luhrmann, R.
(2002). Conserved Stem II of the Box C/D Motif Is Essential for Nucleolar Localization and Is Required, Along with the 15.5K Protein, for the Hierarchical Assembly of the Box C/D snoRNP. Mol. Cell. Biol.
22: 8342-8352
[Abstract]
[Full Text]
-
Kuhn, J. F., Tran, E. J., Maxwell, E. S.
(2002). Archaeal ribosomal protein L7 is a functional homolog of the eukaryotic 15.5kD/Snu13p snoRNP core protein. Nucleic Acids Res
30: 931-941
[Abstract]
[Full Text]
-
Henras, A., Dez, C., Noaillac-Depeyre, J., Henry, Y., Caizergues-Ferrer, M.
(2001). Accumulation of H/ACA snoRNPs depends on the integrity of the conserved central domain of the RNA-binding protein Nhp2p. Nucleic Acids Res
29: 2733-2746
[Abstract]
[Full Text]
-
Speckmann, W. A., Terns, R. M., Terns, M. P.
(2000). The Box C/D motif directs snoRNA 5'-cap hypermethylation. Nucleic Acids Res
28: 4467-4473
[Abstract]
[Full Text]
-
Kufel, J., Allmang, C., Chanfreau, G., Petfalski, E., Lafontaine, D. L. J., Tollervey, D.
(2000). Precursors to the U3 Small Nucleolar RNA Lack Small Nucleolar RNP Proteins but Are Stabilized by La Binding. Mol. Cell. Biol.
20: 5415-5424
[Abstract]
[Full Text]
-
Michienzi, A., Cagnon, L., Bahner, I., Rossi, J. J.
(2000). Ribozyme-mediated inhibition of HIV 1 suggests nucleolar trafficking of HIV-1 RNA. Proc. Natl. Acad. Sci. USA
97: 8955-8960
[Abstract]
[Full Text]
-
Darzacq, X., Kiss, T.
(2000). Processing of Intron-Encoded Box C/D Small Nucleolar RNAs Lacking a 5',3'-Terminal Stem Structure. Mol. Cell. Biol.
20: 4522-4531
[Abstract]
[Full Text]
-
Yang, Y., Isaac, C., Wang, C., Dragon, F., Meier, U. T.
(2000). Conserved Composition of Mammalian Box H/ACA and Box C/D Small Nucleolar Ribonucleoprotein Particles and Their Interaction with the Common Factor Nopp140. Mol. Biol. Cell
11: 567-577
[Abstract]
[Full Text]
-
Narayanan, A., Speckmann, W., Terns, R., Terns, M. P.
(1999). Role of the Box C/D Motif in Localization of Small Nucleolar RNAs to Coiled Bodies and Nucleoli. Mol. Biol. Cell
10: 2131-2147
[Abstract]
[Full Text]
-
Lange, T. S., Ezrokhi, M., Borovjagin, A. V., Rivera-León, R., North, M. T., Gerbi, S. A.
(1998). Nucleolar Localization Elements of Xenopus laevis U3 Small Nucleolar RNA. Mol. Biol. Cell
9: 2973-2985
[Abstract]
[Full Text]
Top
Abstract
Introduction
