Previous Article | Next Article 
Mol Cell Biol, February 1998, p. 1105-1114, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Ty1 Integrase Nuclear Localization Signal
Required for Retrotransposition
Sharon P.
Moore,
Lori A.
Rinckel,
and
David J.
Garfinkel*
Gene Regulation and Chromosome Biology
Laboratory, ABL-Basic Research Program, NCI-Frederick Cancer
Research and Development Center, Frederick, Maryland 21702-1201
Received 5 September 1997/Returned for modification 22 October
1997/Accepted 7 November 1997
 |
ABSTRACT |
Ty1 retrotransposition in Saccharomyces cerevisiae
requires integrase (IN)-mediated insertion of Ty1 cDNA into the host
genome. The transposition components are assembled in the cytoplasm and must cross the nuclear envelope to reach the genomic target, since, unlike animal cell nuclear membranes, the yeast cell nuclear membrane remains intact throughout the cell cycle. We have identified a bipartite nuclear localization signal (NLS) in IN required for Ty1
transposition (Ty1 IN) that directs IN to the nucleus. Mutations in the
NLS that specifically abolish nuclear localization inactivate transpositional integration but do not affect reverse transcription, protein processing, or catalytic activity in vitro. No additional Ty1-encoded proteins are required for IN nuclear localization. Intragenic complementation experiments suggest that Ty1 IN functions as
a multimer and contains two distinct domains, one required for
integration and the other for nuclear localization. Nuclear targeting
of the preintegration complex by an IN NLS may prove to be a general
strategy used by retrotransposons and retroviruses that infect
nondividing cells.
 |
INTRODUCTION |
Ty1 elements belong to a family of
retrotransposons that replicate through an RNA intermediate in the
budding yeast Saccharomyces cerevisiae (for reviews, see
references 3 and 19). Two
overlapping open reading frames, TYA1 and TYB1,
are analogous to retroviral gag and pol genes,
respectively. TYA1 encodes nucleocapsid proteins that form
the structural components of virus-like particles (VLPs). TYB1 encodes the catalytic proteins protease (PR), integrase
(IN), and reverse transcriptase (RT)/RNase (RH).
An essential step in Ty1 transposition is the cytoplasmic assembly of
VLPs. Within VLPs, linear cDNA is synthesized by RT/RH. IN catalyzes
the integration of this cDNA into the genome (5, 12, 39,
47). In vivo studies have shown that IN and the terminal
nucleotides of Ty1 cDNA are required for transpositional integration
but not for homologous recombination of Ty1 cDNA with resident elements
(13, 47). Ty1 IN contains motifs common to retroviral INs,
including the N-terminal HHCC and the core D,D35E catalytic domain
(33).
For Ty1 integration to occur, the VLP or a subparticle preintegration
complex (PIC) containing at least IN and Ty1 cDNA must return to and
transit the nuclear membrane to access a genomic target. Little is
known about how Ty1 elements return to the nucleus. Since the yeast
nuclear membrane remains intact throughout the cell cycle
(8) and since Ty1 VLPs, which are 60 nm in diameter (20, 38), exceed the 25-nm size limit for active transport of a particle across the nuclear pore complex (for a review, see reference 23), an intact nuclear envelope presents a
potential barrier to the Ty1 PIC. This problem is analogous to that of
retroviral infection of nondividing cells. Whereas most
oncoretroviruses require mitotic nuclear membrane dissolution for
infectivity (35, 46), lentiviruses, such as human
immunodeficiency virus type 1 (HIV-1) and visna virus, can infect
terminally differentiated cells (7, 24, 34, 42, 52).
Translocation of the HIV-1 PIC across the nuclear membrane appears to
require or be augmented by the matrix (MA) protein, which contains a
nuclear localization signal (NLS), and the Vpr protein (6, 15, 36,
51).
Here, we demonstrate that Ty1 IN enters the yeast nucleus with no
requirement for additional Ty1 element-encoded proteins. IN nuclear
localization is mediated by a C-terminal NLS. The IN NLS appears to be
bipartite but with small basic motifs separated by a large spacer
region. Point mutations in the NLS basic motifs block transpositional
integration but affect Ty1 cDNA homologous recombination less severely.
Intragenic complementation analyses indicate that the Ty1 IN NLS region
is functionally separate from the catalytic domain and that Ty1 IN
probably functions as a multimer.
 |
MATERIALS AND METHODS |
Yeast strains and media.
Yeast strains DG1251 (yGS37;
MAT
ura3-167 trp1-GB his3-
200
spt3-101) and DG1286 (yGS38; MAT
ura3-167
trp1-GB his3-
200 spt3-101 rad52-GB) are isogenic
derivatives of strain GRF167 (2, 47). Strain DG531
(MATa ade1-100 ura3-52
leu2-3,2-112 his4-519 spt3-101), an isogenic spt3 derivative of strain
BWG1-7A, was used for indirect immunofluorescence (IIF) of pGTy1 due to
its property of having dispersed VLPs (20, 55). DG1377 is a
transformant of RDKY 1293 (MAT
ura3-52 trp1
leu2-
1 his3-
200
pep4::HIS3 prb1-
1.6R GAL)
containing the Ty1 IN expression plasmid pGTy1-IN. All media were
prepared as described by Sherman et al. (48).
Plasmid constructions.
Construction of the pGTy1-IN
expression plasmid has been described elsewhere (40). Green
fluorescent protein (GFP)-LacZ-IN fusion plasmids contained genes
coding for either full-length IN, N-terminal deletions of IN, and/or
C-terminal truncations of IN that were generated by PCR (41)
by using primers complementary to specific sequences of IN. The
GFP-LacZ vector was a gift from P. Silver and contains a
GAL1-promoted GFP-LacZ fusion. To fuse the IN gene in frame
to lacZ, the vector was digested with SacI, which
recognizes a unique site in lacZ, and
HindIII, which recognizes a unique site 3' of the
lacZ open reading frame. In the ligation reaction, this
fragment was replaced with a lacZ fragment containing a 5'
SacI site and a 3' NotI site. The ligation
reaction included restricted vector and IN fragments comprising a
three-fragment unidirectional ligation. Forward IN primers contained a
NotI restriction site followed by a frame-correcting
nucleotide and IN sequences. Reverse primers contained a
HindIII restriction site, an ochre stop codon, and IN
sequences.
Point mutations in the putative NLS region of IN for GFP visualizations
were constructed by PCR oligonucleotide mutagenesis in which the
reverse PCR primer incorporated the codon for the desired amino acid
substitution(s). Each reverse primer also contained an ochre stop codon
and a HindIII restriction site. The primers and their
sequences are as follows (with codon substitutions in boldface type and
restriction sites underlined): K596G-GFP,
CCGGGCCA AGCTTTTA(A)ATTTCAGTTTCATTATCTTCTAATGATCTTTTACCACT G*;
K596,597G-GFP,
CCGGGCCAAGCTTTTA(A)ATTTCAGTTTCATTATCTTCTAATGATCTACCACCACTG*; K596,597G/R598T-GFP,
CCGGGCCAAGCTTTTA(A)ATTTCAGTTTCATTATCTTCTAATGAAGTACCACCAC TG*;
E601,604,606Q/D602N-GFP,
CGGCCCAAGCTTTTA(A)ATCTGAGTCTGATTATTCTGTAATGATCTTTTCTTACTG*. In these sequences, "(A)" indicates sequence complementary to Ty1 nucleotide 3861 and "G*" indicates sequence complementary to
Ty1 nucleotide 3822. The forward primer contained a NotI
restriction site followed by a frame-correcting nucleotide and in-frame
IN gene sequences beginning at Ty1 nucleotide 3627 (IN amino acid residue 530) in the case of the basic motif mutations. The fragment with acidic-domain mutations included IN amino acids 1 to 607. PCR and
ligation conditions were as previously described (40). For
transposition assays, the point mutations coding for IN-K596G (a K-to-G
mutation at residue 596) and IN-K596,597G were introduced into
pGTy1-H3mhis3AI (10) by
oligonucleotide-directed mutagenesis (designated
pGTy1-H3his3-AI in the text). An IN gene fragment was
generated by PCR by using reverse primers that contained a codon for
the amino acid substitution K
G and a KspI restriction site. The oligonucleotide primers used and their sequences are as
follows (with restriction sites underlined and codon substitutions in
boldface type): K596G-pGTy1,
GGGCCGCCCGCGGAGGTTCTAAACTACGCATATTCTTAGTATTCCATGTGTCTCGTGATACCTTAATTTCAGTTTCATTATCTTCTAATGATCTTTACCACTGTTG; K596, 597G-pGTy1,
GGGCCGCCCGCGGAGGTTCTAAACTACGCATATTCTTAGTATTCCATGTGTCTCGTGATACCTTAATTTCAGTTTCATTATCTTCT AATGATCTACCACCACTGTTG.
For each primer, the C in the fourth position of the restriction
site represents sequence complementary to Ty1 position 3915, and the 3'
G represents sequence complementary to Ty1 position 3819. As a control
for PCR amplification, a wild-type (WT) fragment was also generated by
using a reverse primer of the same length as those listed above. The
forward primer for PCR-amplified fragments contained a SalI
restriction site, which is unique in sequences coding for Ty1 IN and IN
beginning at Ty1 nucleotide 2173. Vector and insert fragments were
digested with SalI and KspI and ligated as
reported previously (40). Amino acid substitutions at
positions 628, 629, and 630 were constructed by oligonucleotide
mutagenesis of pGTy1-H3his3-AI (10). A unique KspI restriction site was introduced into this vector at Ty1
nucleotide 3915 by PCR with an oligonucleotide initiating at the
PvuII site at nucleotide 3944 and containing the mutation.
This mutation did not alter the amino acid sequence of Ty1 IN.
Complementary oligonucleotide pairs containing the sequences coding for
mutations at amino acids 628, 628 and 629, and 628 to 630 were annealed and ligated into this vector at the KspI and
PvuII sites.
NLS point mutations were initially cloned into
URA3-marked
pGTy1-H3
his3-AI. An in-frame linker insertion mutation in
the catalytic
domain of Ty1 IN
in-2600 (
12,
39),
has also been introduced
into
URA3-marked
pGTy1-H3
his3-AI (
47). WT Ty1-H3
his3-AI
was
cloned into vectors that carry either the
URA3 or
TRP1 marker.
WT, NLS mutant, and
in-2600
pGTy1-H3
his3-AI sequences all contain
a unique
BstEII restriction site at nucleotide position 1792,
which
is within the Ty1 PR-coding region, and a unique
NheI
restriction
site at nucleotide 639 within the inverted
HIS3
marker at the
3' end of Ty RT. By using these restriction sites,
fragments from
either mutant were subcloned into vectors marked with
either
TRP1 or
URA3. Mutant clones were checked
by diagnostic restriction
site polymorphisms. The NLS
in-K596,597G mutant contains a
TspRI
site not
present in the WT IN gene, and the
in-2600 linker insertion
includes an
MluI site (
12,
39). Recombinant
plasmids were
introduced into yeast by lithium acetate transformation
(
22).
GFP visualization.
Yeast cells transformed with GFP-LacZ-IN
constructs were isolated as single colonies. Cells were inoculated into
5 ml of SC
ura (synthetic complete medium lacking uracil) with 5%
raffinose and grown overnight at 30°C. To induce protein expression,
the cells were pelleted and resuspended in 5 ml of SC
ura with 2%
galactose. Following induction for 2.5 h and a chase period of
1 h in SC
ura with 2% glucose at 30°C, the cells were fixed by
adding 0.75 ml of 37% formaldehyde and then incubated for 1 h at
30°C. The cells were then washed twice in solution P (0.1 M potassium
phosphate buffer [pH 6.5], 1.2 M sorbitol). Dithiothreitol was added
to a final concentration of 25 mM, and following a 10-min incubation at
room temperature, zymolyase was added to a final concentration of 0.3 µg/ml and the cells were incubated with gentle agitation at 30°C
for 45 min. This incubation time resulted in approximately 80%
spheroplasts. The spheroplasts were pelleted and resuspended in
solution P. Twenty microliters of spheroplast suspension was applied to
polylysine-coated wells of a chamber slide and allowed to attach
for 15 min. After aspiration of excess spheroplasts, 0.5% Nonidet P-40
in solution P was added, and the wells were incubated at room
temperature for 5 min. Attached spheroplasts were rinsed once with
solution P and twice with solution AB2 (0.1 M Tris [pH 9.5], 0.1 M
NaCl) and air dried. Antifade (p-phenylenediamine) containing 200 ng of DAPI (4',6-diamidino-2-phenylindole) was used as
the mounting medium, and coverslips were sealed with clear nail polish.
Cells were visualized with a Zeiss Axiophot fluorescence microscope
with a 100× Plan-NEOFLUAR objective and fluorescein isothiocyanate
(FITC) and DAPI filters.
Yeast IIF of ectopically expressed IN.
Yeast IIF was carried
out essentially as described by Pringle et al. (43). Primary
antibody B2 (21) was added in phosphate-buffered saline
(PBS) containing 1 mg of bovine serum albumin (BSA) at a 1:200
dilution. The secondary antibody, FITC-conjugated goat anti-rabbit
immunoglobulin G (whole molecule; Sigma) in PBS-BSA, was added to the
slides at a 1:400 dilution. Visualization of immunofluorescence
involved the use of the same optical system described above for GFP.
Yeast IIF of pGTy1.
Strain DG531, transformed with either WT
or NLS mutant pGTy1-H3his3-AI plasmids, was grown overnight
at 30°C in SC
ura with 2% raffinose and induced for VLP expression
in SC
ura with 2% galactose at 20°C for 24 h. Cells were fixed
with 1/10 volume of fresh 37% formaldehyde for 90 min at 30°C and
then washed twice with solution SK (1 M sorbitol, 50 mM
KPO4 [pH 7.5]). Cell walls were digested in 1 ml of
solution SK with 1.4 mM 2-mercaptoethanol and 34 ng of zymolyase at
30°C for 15 min. Spheroplasts were washed twice in solution SK and
applied to a chamber slide prepared as described above. After 5 min,
excess cells were aspirated and the wells of the chamber slide were
washed twice with 15 µl of solution SK. The slides were fixed by
immersion in methanol at
20°C for 6 min followed by acetone at
20°C for 30 s. The spheroplasts were then blocked by using 3%
BSA in PBS for 20 min at room temperature. Primary antibody (8B11) was
applied at a 1:4,000 dilution in PBS-BSA and incubated in a humidified
chamber at room temperature for 2 h. The antibody was removed, and
the cells were washed five times with 15 µl of PBS. The secondary
antibody, FITC-conjugated goat anti-mouse immunoglobulin G (whole
molecule; Sigma), was applied at a 1:2,000 dilution in PBS-BSA and the
slides were incubated as described for the primary antibody. After
aspiration of the secondary antibody and washing with PBS, mounting
medium containing DAPI was applied as described above, and coverslips
were sealed with clear nail polish.
VLP isolation and characterization.
VLPs were isolated by
established methods (12). Assays for one-ended IN catalytic
activity and immunoblotting procedures were carried out as described
previously (40). The oligonucleotide substrate used in this
investigation was based on U5 long-terminal-repeat sequences.
Transposition assays.
The effect of NLS mutations on Ty1
transposition was measured as the frequency of histidine prototrophy by
using pGTy1-H3his3-AI (10). Six
early-stationary-phase cultures of each strain grown in SC
ura with
2% raffinose were diluted 1:100 into SC
ura with 2% galactose and
grown for either 3 (for DG1251) or 4 (for DG1286) days at 20°C. The
cells were plated on SC
ura+glucose plates to determine the titer
and on SC
ura
his+glucose plates to determine the number of histidine
prototrophs.
Complementation analysis.
The following
pGTy1-H3his3-AI plasmids were introduced into strain DG1286
by transformation: WT/TRP1 (TRP1-based wild-type pGTy1-H3his3-AI), WT/URA3 (URA-based
wild-type pGTy1-H3his3-AI), in-2600/TRP1
(TRP1-based mutant pGTy1-H3his3-AI/in-2600),
in-2600/URA3 (URA3-based mutant
pGTy1-H3his3-AI/in-2600), in-K596,597G/TRP1 (TRP1-based mutant
pGTy1-H3his3-AI/in-K596,597G, and
in-K596,597G/URA3 (URA3-based mutant
pGTy1-H3his3-AI/in-K596,597G). Plasmid segregation analyses
were performed on each transformant. Qualitative transposition assays
were performed as described previously (47) with strains containing the following pGTy1-H3his3-AI plasmids:
WT/TRP1 and WT/URA3 (strain DG1798),
in-2600/TRP1 and in-2600/URA3 (DG1814), in-K596,597G/TRP1 and in-K596,597G/URA3
(DG1802), WT/TRP1 and in-2600/URA3 (DG1815),
WT/URA3 and in-2600/TRP1 (DG1804),
WT/TRP1 and in-K596,597G/URA3 (DG1797),
WT/URA3 and in-K596,597G/TRP1 (DG1803),
in-2600/TRP1 and in-K596,597G/ URA3
(DG1801), in-K596,597G/TRP1 and in-2600/URA3
(DG1813). Quantitative transposition assays
were performed as described previously (10) with strains
containing WT/TRP1 and WT/URA3 (strain DG1798),
in-2600/TRP1 and in-2600/URA3 (DG1814),
in-K596,597G/TRP1 and in-K596,597G/URA3 (DG1802),
in-2600/TRP1 and in-K596,597G/URA3 (DG1801),
in-2600/TRP1 and WT/URA3 (DG1804), and
in-K596,597G/TRP1 and WT/URA3 (DG1803). In the
complementation experiments, the transposition efficiency was defined
as the number of His+ Trp+ Ura+
cells divided by the number of Trp+ Ura+ cells
present after galactose induction. The complementation efficiency was
calculated by dividing the transposition efficiency obtained with a
given strain, e.g., DG1801(in-2600/TRP1,
in-K596,597G/URA3), by the transposition efficiency obtained
with strain DG1798.
 |
RESULTS |
Ty1 IN localizes to the nucleus.
The expression system used
for the purification of catalytically active recombinant IN
(40) provided an effective approach for studying cellular
localization of IN. Briefly, yeast strain DG1377 contains the IN-coding
region of Ty1 fused to the GAL10 promoter of plasmid pRDK249
(28). When cells are grown in galactose, ectopically
expressed Ty1 IN accumulates in the nucleus. Nuclear localization of
Ty1 IN is demonstrated by the colocalization of antibody B2
(21) visualized by IIF (Fig.
1a) and nuclear staining by DAPI (Fig.
1b).
IN NLS maps to the C terminus.
PCR-generated IN gene fragments
were fused in frame to a lacZ coding region with an
N-terminal GFP-coding sequence expressed from the GAL1
promoter to determine which region of IN contains sequences required
for nuclear localization (Fig. 2).
GFP-LacZ alone was evenly distributed throughout the cytoplasm (Fig.
2a), whereas GFP-LacZ-full-length IN exhibited strong nuclear
localization (Fig. 2b) identical to that observed by IIF of cells
expressing IN ectopically (Fig. 1). Progressive N-terminal deletions of
IN up to amino acid residue 401 did not inhibit nuclear partitioning of
the remainder of the fragment (Fig. 2c to e). Conversely, C-terminal deletions resulted in cytoplasmic distribution of GFP-LacZ-IN fragments
(Fig. 2f to h). A fragment containing IN residues 421 to 623 resulted
in nuclear localization of the GFP-LacZ-IN fragment fusion (Fig. 2i).
Deleting residues 421 to 520 from this fragment did not prevent
GFP-LacZ-IN targeting of the nucleus (Fig. 2j). Within the region of
residues 521 to 623, there is only one sequence of contiguous basic
amino acids characteristic of classical NLSs, i.e., K596, K597, and
R598 (designated basic region 1 [BR1]). An identical basic region
comprising amino acid residues 628 to 630 (BR2) was also considered a
candidate NLS. To test BR2 as an NLS without BR1 in the GFP-LacZ fusion
system, we deleted residues 530 to 622. This fragment also localized to
the nucleus (Fig. 2k).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Mapping of IN NLS by nuclear localization (NUC LOC) of
GFP-LacZ-IN fragment fusions. (a) GFP-LacZ only; (b)
GFP-LacZ-full-length IN; (c to e) N-terminal deletions; (f to h)
C-terminal deletions; (i to j) N- and C-terminal deletions; (k)
internal deletion from amino acid 530 to 622. Dashed lines represent
deleted sections of IN. Numbers represent amino acid (AA) residues of
IN at junctions or termini.
|
|
To determine whether the KKR sequence comprising BR1 plays a role in
nuclear localization, or if the fragment shown in Fig.
2j contains a
cryptic NLS, we analyzed GFP-LacZ-IN fusions with
increments of 6 or 7 amino acids from residues 595 to 614 added
to a fragment containing
residues 530 to 594 (Fig.
3a to d). The
minimally sufficient fragment tested that showed nuclear targeting
included both BR1 and seven additional amino acids (EDNETEI; acidic
domain) (Fig.
3c). The karyophilic property of this fragment was
not
altered by adding amino acid residues 608 to 614 (Fig.
3d).
Therefore,
either BR1 plays no role in nuclear targeting or it
is necessary but
not sufficient. To test the necessity of BR1,
we introduced amino acid
substitutions into BR1 within the fragment
containing residues 530 to
607 (Fig.
4). These substitutions were
IN-K596G, IN-K596,597G, and IN-K596,597G/R598T. Figure
4a shows
a WT
fragment derived independently from that illustrated in Fig.
3c. The
single amino acid change IN-K596G resulted in partial
nuclear
localization, whereas IN containing double (IN-K596,597G)
and triple
(IN-K596,597G/R598T) amino acid substitutions did not
accumulate in the
nucleus.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Incremental inclusion of amino acids (AA) 594 to 614 to
determine residues required for IN nuclear localization (NUC LOC). (a)
GFP-LacZ-IN fragment fusion from IN AA residues 530 to 594. AA 591 to
614 are designated by single-letter abbreviations. (b) GFP-LacZ-IN
fragment fusion from AA 530 to 600. (c) GFP-LacZ-IN fragment fusion
from AA 530 to 607. (d) GFP-LacZ-IN fragment fusion from AA 530 to 614. BR1 is indicated.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of point mutations on nuclear localization (NUC
LOC) of GFP-LacZ-IN fragment fusions. (a) WT sequences of IN fragment
from amino acid (AA) residues 530 to 607; (b) IN-K596G single point
mutation; (c) IN-K596,597G double point mutation; (d)
IN-K596,597G/R598T triple point mutation; (e) point mutations in the
acidic domain IN-E601,604,606Q/D602N. The site of BR1 is indicated.
|
|
The GFP analysis illustrated in Fig.
3c and Fig.
4c to d indicates that
nuclear localization of GFP-LacZ requires BR1 and
adjacent C-terminal
residues. Although the minimal number or the
exact character of
the C-terminal residues has not been determined,
four of the seven
residues are acidic
(
EDN
ET
EI; acidic
residues
underlined). To determine whether any of these
residues plays
a role in nuclear localization or if only random
sequences are
required C-terminal to BR1, we introduced point mutations
into
this region by which all three glutamic acid residues were
replaced
with glutamine and by which asparagine was substituted for the
aspartic acid residue. These four substitutions also prevented
nuclear
accumulation of the GFP-LacZ-IN fragment (Fig.
4e).
To test whether the two basic motifs, BR1 and BR2, are interdependent,
full-length IN containing point mutations in the basic
motifs was
expressed in the
spt3 mutant strain DG1251, in which
genomic
Ty1 elements are not transcribed (
53). The expression
vector
contains neither
GFP nor
lacZ sequences and has
been used
previously for expressing recombinant Ty1 IN (
40).
IIF analysis
showed that WT IN localized to the nucleus in strain
DG1251 (Fig.
5a), indicating that IN
localization does not require the expression
of genomic Ty1 element
proteins. Point mutations in either BR1
(Fig.
5b) or BR2 (Fig.
5c)
resulted in the cytoplasmic distribution
of IN. In this context, WT
sequences in either BR1 or BR2 cannot
compensate for mutations in the
other motif. By using GFP analysis,
nuclear localization was observed
with BR1 alone when BR2 was
deleted. Conversely, BR2 alone was also
sufficient to localize
a GFP-LacZ-IN fragment to the nucleus. However,
in IIF analyses
of ectopically expressed IN or the complete pGTy1
element, missense
mutations in BR1 or BR2 in the complete IN protein
prevented nuclear
localization. These differences in the NLS activity
of BR1 and
BR2 may reflect the method of visualization or the effects
of
a deletion versus a missense mutation. Since the two basic regions
are identical, a mutation that renders one basic region neutral
may be
more severe than a deletion.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
IIF visualization of Ty1 IN. (a to c) Ty1 IN expressed
ectopically; (d and e) Ty1 IN expressed from
pGTy1-H3his3-AI, which expresses the entire Ty1 element. NLS
point mutations and basic regions are indicated. Cells were
counterstained with DAPI.
|
|
Ty1 IN nuclear localization during retrotransposition.
Ty1 IN
was shown to translocate to the nucleus during Ty1 transposition by an
analysis of cells expressing the entire Ty1 element (2) for
IN localization by IIF (Fig. 5d). For this experiment,
pGTy1-H3his3-AI (10) was expressed in strain
DG531, in which VLPs are evenly dispersed throughout the cytoplasm
(20, 55). This property reduces background
immunofluorescence resulting from antibody cross-reaction with
VLP-associated IN. Monoclonal antibody 8B11 (12) was used as
the primary antibody. Unlike ectopically expressed IN, in which
virtually every cell of the population exhibited nuclear accumulation
of IN, pGTy1-H3his3-AI expression resulted in a less uniform
staining pattern of IN. Many cells showed minimal levels of
fluorescence, and of those that demonstrated significant staining,
about half showed IN nuclear localization. The majority of cells
expressing Ty1 with the BR1 double mutation IN-K596,597G showed only
cytoplasmic distribution of IN (Fig. 5e). The number of cells
displaying IN nuclear localization was shown to be statistically
significant in cells expressing WT pGTy1-H3his3-AI compared
with cells expressing the BR1 mutant plasmid by scoring random fields
of cells of each type as either IN localized to nuclei or IN evenly
distributed throughout the cytoplasm. Almost 41% (123 of 303) of the
cells expressing WT pGTy1-H3his3-AI showed IN nuclear
accumulation, whereas 4.3% (13 of 303) of the cells expressing the NLS
mutation showed IN associated with the nucleus. Chi-square analysis
indicated that this result is highly significant (P < 0.001). A defect in nuclear localization was also observed with a BR2
mutation (data not shown).
NLS point mutations reduce Ty1-H3his3-AI
transposition.
Representative point mutations in BR1 and BR2 were
introduced into pGTy1-H3his3-AI to assay transposition. This
element is marked with the his3-AI indicator gene, in which
the HIS3 gene is disrupted by an artificial intron (AI) in
the antisense orientation (10). Upon galactose induction of
a WT element, His+ cells result from a retrotransposition
process requiring precise splicing of the AI and reverse transcription
of the element. If transpositional integration is defective, Ty1 cDNA
may undergo RAD52-dependent homologous recombination with
genomic Ty1 elements to generate His+ prototrophs
(47). WT and NLS mutant elements were expressed in strains
DG1251 (spt3 RAD52) (Table 1)
and DG1286 (spt3 rad52) (Table
2) to distinguish cDNA recombination from
retrotransposition (47). A Ty1 element containing a
five-codon linker insertion that disrupts the catalytic D,D35E region,
in-2600 (12, 39, 47), was included for
comparison. Because the vector carrying the in-2600 mutant
element is slightly different from that containing the NLS mutant, the
cognate WT pGTy1-H3his3-AI plasmid of each mutation was also
assayed for histidine prototrophy. In the RAD52 strain
DG1251 (Table 1), the single point mutation IN-K596G resulted in no
reduction in the frequency of histidine prototrophs, but multiple
mutations in either BR1 or BR2 resulted in a 5- to 10-fold reduction in
the frequency of histidine prototrophs compared with that of the WT.
The in-2600 mutation resulted in a 2.5-fold reduction in
His+ frequency. Thus, the NLS multiple mutations and the
catalytically inactive in-2600 mutation resulted in similar,
though not greatly reduced, His+ frequencies. When
transposition alone was assayed in the spt3 rad52 strain
DG1286 (Table 2), multiple mutations in BR1 and BR2 as well as the
in-2600 mutation resulted in marked decreases in
transposition levels, ranging from 62- to 670-fold. Similar results
were also obtained in a separate experiment using clones from a PCR
fragment that was derived independently. These observations further
support the requirement for and the interdependence of BR1 and BR2 in
Ty1 transposition. The moderate effect of the NLS mutations on combined
cDNA recombination and transposition levels (Table 1), compared to the
drastic reduction in transposition alone (Table 2), indicates that DNA
synthesis during the process of reverse transcription is not the
limiting factor responsible for reduced transposition in the NLS
mutants. If this were the case, the frequencies of cDNA recombination
and transposition should be similar, as has been shown for strains with
mutations in Ty1 PR and RT/RH (47).
NLS mutant VLPs are enzymatically active.
VLPs were purified
from galactose-induced cells expressing WT and NLS mutant pGTy1
plasmids to determine whether NLS mutations affect other steps in
retrotransposition. VLPs were assayed for proteolytic processing and RT
and IN catalytic activity. NLS mutant VLPs displayed RT activity
similar to that of WT VLPs (data not shown). Furthermore, the
IN-K596,597G mutation in BR1 did not reduce Ty1 PR processing, since
comparable levels of processing intermediates and mature IN were
observed with mutant and WT VLPs (Fig.
6a). The NLS mutant IN was as
catalytically active as WT IN in vitro (Fig. 6b). Similar results were
obtained with VLPs containing the IN-K628,629G/R630T mutation in BR2
(Fig. 6c and d). From these experiments, we infer that DNA binding is
unaffected. A frameshift linker insertion at amino acid residue 587, which resulted in translation termination upstream of the IN NLS, has also been shown to retain in vitro IN catalytic activity
(5). A reduction of catalytic activity is therefore not
responsible for the reduction in transposition levels of the NLS
mutants.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro activities of VLPs containing either WT or NLS
mutant IN. Proteolytic processing (a and c) and in vitro catalytic
activity (b and d) of WT and IN-K596,597G VLPs (a and b) and of WT and
IN-K628,629G/R630T VLPs (c and d) are shown. IP, integration
products.
|
|
Intragenic complementation between an IN NLS and a D,D35E
mutation.
Using an intragenic complementation test in which the
in-2600 catalytically inactive mutation and the IN-K596,597G
NLS mutation were coexpressed in the same cell, we determined whether
the catalytic core and NLS region of Ty1 IN are separate domains and
whether Ty1 IN functions as a multimeric protein. For this experiment, the mutations were subcloned into TRP1- and
URA3-based pGTy1-H3his3-AI plasmids, and
various combinations of plasmids were introduced into strain DG1286.
The transformants were analyzed for Ty1 transposition as monitored by
their ability to form His+ colonies in a qualitative patch
test (47). Initial experiments suggested that efficient
intragenic complementation occurred between in-2600 and
IN-K596,597G and that both IN mutations were recessive. Similar results
were obtained regardless of whether the IN mutations or WT sequences
were present on the TRP1- or URA3-based
pGTy1-H3his3-AI plasmids. Whether recombination between
mutant plasmids generated a WT Ty1 element was tested by recovering
TRP1- and URA3-based pGTy1 plasmids from 14 independent His+ colonies from strain
DG1801(in-2600/TRP1, in-K596,597G/URA3) and
analyzing the plasmids by restriction digestion to detect restriction
site polymorphisms in the IN mutations. All 28 plasmids contained the
MluI and TspRI restriction sites that identify
in-2600 or IN-K596,597G mutations, respectively.
Intragenic complementation was quantitated by determining the
level of Ty1 transposition (
10) in strains
DG1798(WT/
TRP1,
WT/
URA-3),
DG1801(
in-2600/TRP1,
in-K596,597G/URA3),
DG1814(
in-2600/TRP1,
in-2600/URA3),
DG1802(
in-K596,597G/TRP1,
in-K596,597G/URA3),
DG1803(
in-K596,597G/TRP1,
WT/
URA3), and
DG1804(
in-2600/TRP1, WT/
URA3) (Table
3). As predicted,
the IN mutant strains
DG1814 and DG1802 were defective for transposition,
showing more than a
100-fold reduction in His
+ formation relative to that of
the WT. Coexpression of the WT
and IN mutant pGTy1 plasmids in strains
DG1803 and DG1804 restored
transposition to the level observed with WT
strain DG1798, indicating
that the IN mutations are recessive.
Coexpression of Ty1 elements
containing
in-2600 and
IN-K596,597G resulted in a transposition
efficiency of 3.2% and a
complementation efficiency of 40%, which
was more than a 50-fold
increase over those values for elements
containing either IN mutation
individually.
 |
DISCUSSION |
Two conclusions can be drawn from our data. First, the C terminus
of Ty1 IN contains a region that functions as an NLS. Substitution of
crucial amino acids in this region severely diminishes nuclear localization when IN is fused to GFP-LacZ, when IN is expressed ectopically in a biochemically active form, and, more relevantly, when
IN is expressed as part of a functional Ty1 element. The IN NLS is
absolutely required for Ty1 retrotransposition, since mutations that
abolish nuclear targeting also reduce transposition to the equivalent
of that of catalytically inactive IN. In addition, since VLP
production, protein processing, reverse transcription, and in vitro IN
activity remain at WT levels when nuclear localization is defective,
the NLS region carries out a specific function during the process of
retrotransposition.
Second, we provide genetic evidence that the Ty1 NLS is a functionally
separate region by showing intragenic complementation between the NLS
(IN-K596,597G) and a D,D35E catalytic core (in-2600) mutation. The C-terminal region of Ty1 IN contains approximately 300 amino acids that have no apparent homology or functional similarity to
the shorter C-terminal regions of retroviral INs. No function has been
definitively assigned to this region of Ty1 IN. Although this region
may have additional functions, the NLS located at the extreme C
terminus of the protein plays a critical role in retrotransposition.
The intragenic complementation between the catalytic and NLS domains
suggests that Ty1 IN probably functions as a multimeric protein in
vivo. Although it is not yet known how many IN molecules are minimally
sufficient for retrotransposition of the Ty1 cDNA element, the
multimerization of several retroviral integrases and Mu transposase has
been well characterized (1, 29, 50, 54). Our results suggest
that a subset of NLS
and IN
proteins
multimerize and form a PIC with a given cDNA molecule. The NLS function
of catalytically inactive IN molecules translocates the PIC to the
nucleus, while the catalytic activity of NLS mutant molecules performs
the integration reaction. Combined in vitro and in vivo analyses of Ty1
IN multimeric interactions and definition of the Ty1 PIC are now
possible. Furthermore, studies on Ty1 IN functional domains will
enhance the biochemical complementation studies performed with
retroviral INs (14, 29, 50, 56).
The Ty1 IN NLS is an unusual bipartite sequence in that the two short
basic motifs are identical, each composed of two lysines followed by an
arginine (Fig. 7) (see also the
accompanying paper [31]). Each of these small basic
regions is atypical for a basic cluster NLS, but the 29-amino-acid
spacer between the two basic regions is greater than usually reported
for other bipartite NLSs (11). The length of this spacer is
somewhat flexible, since a 12-bp in-frame linker insertion introduced
into this region did not reduce transposition (39). Similar
spacer length flexibility has also been reported for nucleoplasmin
(45). The interdependence of the two basic motifs in the
transposition assay and in IIF localization favors the hypothesis that
this domain represents a nucleoplasmin-like bipartite NLS with an
unusually long spacer.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
Structure of Ty1 IN. Positions of the N terminus with
the HHCC motif (N-term), the core domain with the D,D35E motif (Core),
and the C terminus with amino acids comprising the NLS denoted as BR1,
acidic domain, and BR2 (C-term) are illustrated. Single-letter amino
acid abbreviations indicate the sequence between residues 591 and
635.
|
|
The sequence context surrounding an NLS may contribute to the
efficiency or temporal regulation of protein translocation (26, 49). We have shown that a region containing several acidic amino acids between IN residues 600 and 607 (Fig. 7) is necessary for GFP-LacZ-IN nuclear localization. Acidic domains have been shown to be
an important feature of the NLSs of transcription factors (4), c-myc (37), and simian virus 40 large T
antigen (27) since they may contain a casein kinase
recognition site. Casein kinase-mediated phosphorylation of a serine
near the NLS of simian virus 40 large T antigen enhances its nuclear
import (27). Although the GFP-LacZ-IN fragment shown in Fig.
2k, in which both BR1 and the acidic domain are deleted, shows nuclear
localization, a candidate casein kinase recognition site which
approximates the same spacing relative to BR2 as that in wild-type IN
was fortuitously created by this deletion. The significance of the Ty1
NLS sequence context is further supported by the fact that Ty1 IN
contains another SKKR motif at residues 418 to 421, but the IN fragment
containing this region as the only NLS candidate did not show nuclear
localization.
The Ty1 IN NLS suggests a straightforward nuclear targeting pathway for
the Ty1 PIC. Since Ty1 IN contains both an NLS and a catalytic
function, the Ty1 PIC may consist minimally of a cDNA element and an IN
multimer. HIV-1 integration in nondividing cells also requires nuclear
targeting of a PIC. However, the HIV-1 PIC contains the viral proteins
MA, Vpr, and IN, all of which have nuclear targeting potential (6,
18, 25, 52). MA contains a region with basic residues which might
function as an NLS (6, 16), but IN is required to recruit MA
into the virion core (17, 18). The inability of MA mutant
viruses to infect terminally differentiated macrophages can be rescued
by Vpr (25), although this function may not be the primary
role of Vpr during HIV-1 infection (9). Like Ty1 IN,
ectopically expressed HIV-1 IN localizes to the nucleus (18,
30) and has been recently shown to contain a C-terminal bipartite
NLS that is recognized by the importin/karyopherin transport pathway
(18). HIV-1 mediates nuclear transport of the PIC in
monocyte-derived macrophages inoculated with high doses of virus, in
some nondividing epithelial and fibroblast lines, and in neurons.
Redundant viral factors resulting in the nuclear transport of the HIV-1
PIC may be necessary for infection of different types of nondividing
cells. However, data also suggest that the HIV-1 IN NLS has additional
functions, since NLS mutations block replication even in proliferating
cells, and may interfere with IN multimerization. The remarkable
similarity between the karyophilic potentials of HIV-1 and Ty1 INs
suggests that the NLS function was strongly selected for during
retroelement evolution. Other retroviral INs which have been reported
to localize to the nucleus include avian sarcoma virus IN
(32) and murine leukemia virus IN (44). The
degree to which nuclear localization of these INs influences viral
infectivity has not been determined.
In summary, this analysis has elucidated an important and novel aspect
of Ty1 retrotransposition. An essential NLS in Ty1 IN suggests a
working hypothesis to explain how the Ty1 PIC translocates to the
nucleus. The VLP may undergo degradation analogous to viral uncoating
to release the PIC. The PIC, containing IN, Ty1 DNA, and perhaps other
Ty1 and cellular proteins, is then recognized by nuclear transport
factors by the IN NLS. If IN-mediated integration is blocked, however,
the PIC may release Ty1 cDNA that can undergo homologous recombination
with genomic elements. Further biochemical and genetic dissection of
the Ty1 PIC and nuclear transport will elucidate its composition,
release from the VLP, and interaction with the nuclear translocation
apparatus.
 |
ACKNOWLEDGMENTS |
This research was sponsored by the National Cancer Institute
under a contract with A.B.L.
We thank P. Silver and M. Lee for the GFP-LacZ plasmids, D. Trono for
sharing unpublished data, M. Kenna and J. Boeke for providing
monoclonal antibody 8B11 and sharing unpublished data, A. Cheung
and S. Zhang for technical assistance, and E. Frazier for graphic
design.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Gene Regulation
and Chromosome Biology Laboratory, ABL-Basic Research Program,
NCI-Frederick Cancer Research and Development Center, Frederick, MD
21702-1201. Phone: (301) 846-5604. Fax: (301) 846-6911. E-mail:
garfinke{at}ncifcrf.gov.
Present address: Department of Medicine, University of Maryland
School of Medicine, Veterans Administration Medical Center, Baltimore,
Maryland.
 |
REFERENCES |
| 1.
|
Andrake, M. D., and A. M. Skalka.
1995.
Multimerization determinants reside in both the catalytic core and C terminus of avian sarcoma virus integrase.
J. Biol. Chem.
270:29299-29306[Abstract/Free Full Text].
|
| 2.
|
Boeke, J. D.,
D. J. Garfinkel,
C. A. Styles, and G. R. Fink.
1985.
Ty elements transpose through an RNA intermediate.
Cell
40:491-500[Medline].
|
| 3.
|
Boeke, J. D., and S. B. Sandmeyer.
1991.
Yeast transposable elements, p. 193-261. In
J. R. Broach, J. Pringle, and E. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis, and energetics, vol. 1.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 4.
|
Boulikas, T.
1993.
Nuclear localization signals (NLS).
Crit. Rev. Eukaryotic Gene Expression
3:193-227[Medline].
|
| 5.
|
Braiterman, L. T., and J. D. Boeke.
1994.
Ty1 in vitro integration: effects of mutations in cis and in trans.
Mol. Cell. Biol.
14:5731-5740[Abstract/Free Full Text].
|
| 6.
|
Bukrinsky, M.,
S. Haggerty,
M. Dempsey,
N. Sharova,
A. Adzhubel,
L. Spitz,
P. Lewis,
D. Goldfarb,
M. Emerman, and M. Stevenson.
1993.
A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells.
Nature
365:666-669[Medline].
|
| 7.
|
Bukrinsky, M. I.,
N. Sharova,
M. P. Dempsey,
T. L. Stanwick,
A. G. Bukrinskaya,
S. Haggerty, and M. Stevenson.
1992.
Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.
Proc. Natl. Acad. Sci. USA
89:6580-6584[Abstract/Free Full Text].
|
| 8.
|
Byers, B.
1981.
Cytology of the yeast life cycle, p. 59-96. In
J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces: life cycle and inheritance.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 9.
|
Connor, R. I.,
B. K. Chen,
S. Choe, and N. R. Landau.
1995.
Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes.
Virology
206:935-944[Medline].
|
| 10.
|
Curcio, M. J., and D. J. Garfinkel.
1991.
Single-step selection for Ty1 element retrotransposition.
Proc. Natl. Acad. Sci. USA
88:936-940[Abstract/Free Full Text].
|
| 11.
|
Dingwall, C., and R. A. Laskey.
1991.
Nuclear targeting sequences a consensus?
Trends Biochem. Sci.
16:478-481[Medline].
|
| 12.
|
Eichinger, D. J., and J. D. Boeke.
1988.
The DNA intermediate in yeast Ty1 element transposition copurifies with virus-like particles: cell-free transposition.
Cell
54:955-966[Medline].
|
| 13.
|
Eichinger, D. J., and J. D. Boeke.
1990.
A specific terminal structure is required for Ty1 transposition.
Genes Dev.
4:324-330[Abstract/Free Full Text].
|
| 14.
|
Engelman, A.,
F. D. Bushman, and R. Craigie.
1993.
Identification of discrete functional domains of HIV-1 integrase and their organization within an active multimeric complex.
EMBO J.
12:3269-3275[Medline].
|
| 15.
|
Freed, E. O.,
G. Englund, and M. A. Martin.
1995.
Role of the basic domain of human immunodeficiency virus type 1 matrix in macrophage infection.
J. Virol.
69:3949-3954[Abstract].
|
| 16.
|
Freed, E. O.,
G. Englund,
F. Maldarelli, and M. A. Martin.
1997.
Phosphorylation of residue 131 of HIV-1 matrix is not required for macrophage infection.
Cell
88:171-173[Medline].
|
| 17.
|
Gallay, P.,
S. Swingler,
J. Song,
F. Bushman, and D. Trono.
1995.
HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase.
Cell
83:569-576[Medline].
|
| 18.
|
Gallay, P.,
T. Hope,
D. Chin, and D. Trono.
1997.
HIV-1 infection of nondividing cells through the recognition of integrase by the importin/karyopherin pathway.
Proc. Natl. Acad. Sci. USA
94:9825-9830[Abstract/Free Full Text].
|
| 19.
|
Garfinkel, D. J.
1992.
Retroelements in microorganisms, p. 107-157. In
J. A. Levy (ed.), The Retroviridae, vol. 1.
Plenum Press, New York, N.Y.
|
| 20.
|
Garfinkel, D. J.,
J. D. Boeke, and G. R. Fink.
1985.
Ty element transposition: reverse transcriptase and virus-like particles.
Cell
42:507-517[Medline].
|
| 21.
|
Garfinkel, D. J.,
A.-M. Hedge,
S. D. Youngren, and T. D. Copeland.
1991.
Proteolytic processing of pol-TYB proteins from the yeast retrotransposon Ty1.
J. Virol.
65:4573-4581[Abstract/Free Full Text].
|
| 22.
|
Gietz, D.,
A. St. Jean,
R. Woods, and R. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 23.
|
Gorlich, D., and I. Mattaj.
1996.
Nucleocytoplasmic transport.
Science
271:1513-1518[Abstract].
|
| 24.
|
Haase, A. T.
1975.
The slow infection caused by visna virus.
Curr. Top. Microbiol. Immunol.
72:101-156[Medline].
|
| 25.
|
Heinzinger, N. K.,
M. I. Bukrinsky,
S. A. Haggerty,
A. M. Ragland,
V. Kewalramani,
M.-A. Lee,
H. E. Gendelman,
L. Ratner,
M. Stevenson, and M. Emerman.
1994.
The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 26.
|
Jans, D. A.
1995.
The regulation of protein transport to the nucleus by phosphorylation.
Biochem. J.
311:705-716.
|
| 27.
|
Jans, D. A., and P. Jans.
1994.
Negative charge at the casein kinase II site flanking the nuclear localization signal of the SV40 large T-antigen is mechanistically important for enhanced nuclear import.
Oncogene
9:2961-2968[Medline].
|
| 28.
|
Johnson, A. W., and R. D. Kolodner.
1991.
Strand exchange protein 1 from Saccharomyces cerevisiae.
J. Biol. Chem.
266:14046-14054[Abstract/Free Full Text].
|
| 29.
|
Jones, K. S.,
J. Coleman,
G. W. Merkel,
T. M. Lane, and A. M. Skalka.
1992.
Retroviral integrase functions as a multimer and can turn over catalytically.
J. Biol. Chem.
267:16037-16040[Abstract/Free Full Text].
|
| 30.
|
Jones, K. S.,
J. Kulkosky, and A. M. Skalka.
1991.
Analyses of HIV integration components, p. 21-26. In
A. Kumar (ed.), Advances in molecular biology and targeted treatment for AIDS.
Plenum Press, New York, N.Y.
|
| 31.
|
Kenna, M. A.,
C. B. Brachmann,
S. E. Devine, and J. D. Boeke.
1998.
Invading the yeast nucleus: a nuclear localization signal at the C terminus of Ty1 integrase is required for transposition in vivo.
Mol. Cell. Biol.
18:1115-1124[Abstract/Free Full Text].
|
| 32.
|
Kukolj, G.,
K. S. Jones, and A. M. Skalka.
1997.
Subcellular localization of avian sarcoma virus and human immunodeficiency virus type 1 integrase.
J. Virol.
71:843-847[Abstract].
|
| 33.
|
Kulkosky, J.,
K. S. Jones,
R. A. Katz,
J. P. G. Mack, and A. M. Skalka.
1992.
Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviral/retrotransposon integrases and bacterial insertion sequence transposases.
Mol. Cell. Biol.
12:2331-2338[Abstract/Free Full Text].
|
| 34.
|
Lewis, P.,
M. Hensel, and M. Emerman.
1992.
Human immunodeficiency virus infection of cells arrested in the cell cycle.
EMBO J.
11:3053-3058[Medline].
|
| 35.
|
Lewis, P. F., and M. Emerman.
1994.
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.
J. Virol.
68:510-516[Abstract/Free Full Text].
|
| 36.
|
Lu, Y. L.,
P. Spearman, and L. Ratner.
1993.
Human immunodeficiency virus type 1 viral protein R localizes in infected cells and virions.
J. Virol.
67:6542-6550[Abstract/Free Full Text].
|
| 37.
|
Makkerh, J. P. S.,
C. Dingwall, and R. A. Laskey.
1996.
Comparative mutagenesis of nuclear localization signals reveals the importance of neutral and acidic amino acids.
Curr. Biol.
6:1025-1027[Medline].
|
| 38.
|
Mellor, J.,
M. H. Malim,
K. Gull,
M. F. Tuite,
S. M. McCready,
T. Dibbayawan,
S. M. Kingsman, and A. J. Kingsman.
1985.
Reverse transcriptase activity and Ty RNA are associated with virus-like particles in yeast.
Nature
318:583-586[Medline].
|
| 39.
|
Monokian, G. M.,
L. T. Braiterman, and J. D. Boeke.
1994.
In-frame linker insertion mutagenesis of yeast transposon Ty1: mutations, transposition and dominance.
Gene
139:9-18[Medline].
|
| 40.
|
Moore, S. P., and D. J. Garfinkel.
1994.
Expression and partial purification of enzymatically active recombinant Ty1 integrase in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:1843-1847[Abstract/Free Full Text].
|
| 41.
|
Mullis, K.,
F. Faloona,
S. Scharf,
R. Saiki,
G. Horn, and H. Erlich.
1986.
Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.
Cold Spring Harbor Symp. Quant. Biol.
51:263-273.
|
| 42.
|
Narayan, O., and J. E. Clements.
1990.
Lentiviruses, p. 1571-1589. In
B. N. Fields, and D. M. Knipe (ed.), Virology.
Raven Press, New York, N.Y.
|
| 43.
|
Pringle, J. R.,
A. E. M. Adams,
D. G. Drubin, and B. K. Haarer.
1991.
Immunofluorescence methods for yeast.
Methods Enzymol.
194:565-602[Medline].
|
| 44.
|
Riscoe, C.,
L. Menendez-Arias,
T. D. Copeland,
P. Pinto da Silva, and S. Oroszlan.
1995.
Intracellular transport of the murine leukemia virus during acute infection of NIH3T3 cells: nuclear import of nucleocapsid protein and integrase.
J. Cell Sci.
108:3039-3050[Abstract].
|
| 45.
|
Robbins, J.,
S. M. Dilworth,
R. A. Laskey, and C. Dingwall.
1991.
Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence.
Cell
64:615-623[Medline].
|
| 46.
|
Roe, T.,
T. C. Reynolds,
G. Yu, and P. O. Brown.
1993.
Integration of murine leukemia virus DNA depends on mitosis.
EMBO J.
12:2099-2108[Medline].
|
| 47.
|
Sharon, G.,
T. J. Burkett, and D. J. Garfinkel.
1994.
Efficient homologous recombination of Ty1 element cDNA when integration is blocked.
Mol. Cell. Biol.
14:6540-6551[Abstract/Free Full Text].
|
| 48.
|
Sherman, F.,
G. R. Fink, and C. Laurence.
1979.
.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 49.
|
Silver, P.
1991.
How proteins enter the nucleus.
Cell
64:489-497[Medline].
|
| 50.
|
vanGent, D. C.,
C. Vink,
A. A. M. Oude-Groeneger, and R. H. A. Plasterk.
1993.
Complementation between HIV integrase proteins mutated in different domains.
EMBO J.
12:3261-3267[Medline].
|
| 51.
|
von Schwedler, U.,
R. S. Kornbluth, and D. Trono.
1994.
The nuclear localization signal of the matrix protein of human immunodeficiency virus type 1 allows the establishment of infection in macrophages and quiescent T lymphocytes.
Proc. Natl. Acad. Sci. USA
91:6992-6996[Abstract/Free Full Text].
|
| 52.
|
Weinberg, J.,
T. J. Matthews,
B. R. Cullen, and M. H. Malim.
1991.
Productive human immunodeficiency virus type 1 (HIV-1) infection of nonproliferating human monocytes.
J. Exp. Med.
174:1477-1482[Abstract/Free Full Text].
|
| 53.
|
Winston, F.,
K. J. Durbin, and G. R. Fink.
1984.
The SPT3 gene is required for normal transcription of Ty elements in S. cerevisiae.
Cell
39:675-682[Medline].
|
| 54.
|
Yang, J.-Y.,
H. Jayaram, and R. M. Harshey.
1996.
Positional information within the Mu transposase tetramer: catalytic contributions of individual monomers.
Cell
85:447-455[Medline].
|
| 55.
|
Youngren, S. D.,
J. D. Boeke,
N. J. Sanders, and D. J. Garfinkel.
1988.
Functional organization of the retrotransposon Ty from Saccharomyces cerevisiae: Ty protease is required for transposition.
Mol. Cell. Biol.
8:1421-1431[Abstract/Free Full Text].
|
| 56.
|
Zheng, R.,
T. M. Jenkins, and R. Craigie.
1996.
Zinc folds the N-terminal domain of HIV-1 integrase, promotes multimerization and enhances catalytic activity.
Proc. Natl. Acad. Sci. USA
93:13659-13664[Abstract/Free Full Text].
|
Mol Cell Biol, February 1998, p. 1105-1114, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Beliakova-Bethell, N., Terry, L. J., Bilanchone, V., DaSilva, R., Nagashima, K., Wente, S. R., Sandmeyer, S.
(2009). Ty3 Nuclear Entry Is Initiated by Viruslike Particle Docking on GLFG Nucleoporins. J. Virol.
83: 11914-11925
[Abstract]
[Full Text]
-
Moore, S. P., Garfinkel, D. J.
(2009). Functional Analysis of N-Terminal Residues of Ty1 Integrase. J. Virol.
83: 9502-9511
[Abstract]
[Full Text]
-
Malagon, F., Jensen, T. H.
(2008). The T Body, a New Cytoplasmic RNA Granule in Saccharomyces cerevisiae. Mol. Cell. Biol.
28: 6022-6032
[Abstract]
[Full Text]
-
McLane, L. M., Pulliam, K. F., Devine, S. E., Corbett, A. H.
(2008). The Ty1 integrase protein can exploit the classical nuclear protein import machinery for entry into the nucleus. Nucleic Acids Res
36: 4317-4326
[Abstract]
[Full Text]
-
Garfinkel, D. J., Stefanisko, K. M., Nyswaner, K. M., Moore, S. P., Oh, J., Hughes, S. H.
(2006). Retrotransposon Suicide: Formation of Ty1 Circles and Autointegration via a Central DNA Flap. J. Virol.
80: 11920-11934
[Abstract]
[Full Text]
-
Wilhelm, M., Wilhelm, F.-X.
(2006). Cooperation between Reverse Transcriptase and Integrase during Reverse Transcription and Formation of the Preintegrative Complex of Ty1.. Eukaryot Cell
5: 1760-1769
[Abstract]
[Full Text]
-
Wilhelm, M., Wilhelm, F.-X.
(2005). Role of Integrase in Reverse Transcription of the Saccharomyces cerevisiae Retrotransposon Ty1. Eukaryot Cell
4: 1057-1065
[Abstract]
[Full Text]
-
Garfinkel, D. J., Nyswaner, K. M., Stefanisko, K. M., Chang, C., Moore, S. P.
(2005). Ty1 Copy Number Dynamics in Saccharomyces. Genetics
169: 1845-1857
[Abstract]
[Full Text]
-
Aye, M., Irwin, B., Beliakova-Bethell, N., Chen, E., Garrus, J., Sandmeyer, S.
(2004). Host Factors That Affect Ty3 Retrotransposition in Saccharomyces cerevisiae. Genetics
168: 1159-1176
[Abstract]
[Full Text]
-
Llano, M., Vanegas, M., Fregoso, O., Saenz, D., Chung, S., Peretz, M., Poeschla, E. M.
(2004). LEDGF/p75 Determines Cellular Trafficking of Diverse Lentiviral but Not Murine Oncoretroviral Integrase Proteins and Is a Component of Functional Lentiviral Preintegration Complexes. J. Virol.
78: 9524-9537
[Abstract]
[Full Text]
-
Radford, S. J., Boyle, M. L., Sheely, C. J., Graham, J., Haeusser, D. P., Zimmerman, L., Keeney, J. B.
(2004). Increase in Ty1 cDNA Recombination in Yeast sir4 Mutant Strains at High Temperature. Genetics
168: 89-101
[Abstract]
[Full Text]
-
Griffith, J. L., Coleman, L. E., Raymond, A. S., Goodson, S. G., Pittard, W. S., Tsui, C., Devine, S. E.
(2003). Functional Genomics Reveals Relationships Between the Retrovirus-Like Ty1 Element and Its Host Saccharomyces cerevisiae. Genetics
164: 867-879
[Abstract]
[Full Text]
-
Peterson-Burch, B. D., Voytas, D. F.
(2002). Genes of the Pseudoviridae (Ty1/copia Retrotransposons). Mol Biol Evol
19: 1832-1845
[Abstract]
[Full Text]
-
Lin, S. S., Nymark-McMahon, M. H., Yieh, L., Sandmeyer, S. B.
(2001). Integrase Mediates Nuclear Localization of Ty3. Mol. Cell. Biol.
21: 7826-7838
[Abstract]
[Full Text]
-
Xie, W., Gai, X., Zhu, Y., Zappulla, D. C., Sternglanz, R., Voytas, D. F.
(2001). Targeting of the Yeast Ty5 Retrotransposon to Silent Chromatin Is Mediated by Interactions between Integrase and Sir4p. Mol. Cell. Biol.
21: 6606-6614
[Abstract]
[Full Text]
-
Bryk, M., Banerjee, M., Conte, D. Jr., Curcio, M. J.
(2001). The Sgs1 Helicase of Saccharomyces cerevisiae Inhibits Retrotransposition of Ty1 Multimeric Arrays. Mol. Cell. Biol.
21: 5374-5388
[Abstract]
[Full Text]
-
Lawler, J. F. Jr., Merkulov, G. V., Boeke, J. D.
(2001). Frameshift Signal Transplantation and the Unambiguous Analysis of Mutations in the Yeast Retrotransposon Ty1 Gag-Pol Overlap Region. J. Virol.
75: 6769-6775
[Abstract]
[Full Text]
-
Merkulov, G. V., Lawler, J. F. Jr., Eby, Y., Boeke, J. D.
(2001). Ty1 Proteolytic Cleavage Sites Are Required for Transposition: All Sites Are Not Created Equal. J. Virol.
75: 638-644
[Abstract]
[Full Text]
-
Lee, B.-S., Bi, L., Garfinkel, D. J., Bailis, A. M.
(2000). Nucleotide Excision Repair/TFIIH Helicases Rad3 and Ssl2 Inhibit Short-Sequence Recombination and Ty1 Retrotransposition by Similar Mechanisms. Mol. Cell. Biol.
20: 2436-2445
[Abstract]
[Full Text]
-
Balasundaram, D., Benedik, M. J., Morphew, M., Dang, V.-D., Levin, H. L.
(1999). Nup124p Is a Nuclear Pore Factor of Schizosaccharomyces pombe That Is Important for Nuclear Import and Activity of Retrotransposon Tf1. Mol. Cell. Biol.
19: 5768-5784
[Abstract]
[Full Text]
-
Dang, V. D., Benedik, M. J., Ekwall, K., Choi, J., Allshire, R. C., Levin, H. L.
(1999). A New Member of the Sin3 Family of Corepressors Is Essential for Cell Viability and Required for Retroelement Propagation in Fission Yeast. Mol. Cell. Biol.
19: 2351-2365
[Abstract]
[Full Text]
-
Nymark-McMahon, M. H., Sandmeyer, S. B.
(1999). Mutations in Nonconserved Domains of Ty3 Integrase Affect Multiple Stages of the Ty3 Life Cycle. J. Virol.
73: 453-465
[Abstract]
[Full Text]
-
Kenna, M. A., Brachmann, C. B., Devine, S. E., Boeke, J. D.
(1998). Invading the Yeast Nucleus: a Nuclear Localization Signal at the C Terminus of Ty1 Integrase Is Required for Transposition In Vivo. Mol. Cell. Biol.
18: 1115-1124
[Abstract]
[Full Text]