Received 28 March 1997/Returned for modification 8 May
1997/Accepted 6 November 1997
 |
INTRODUCTION |
RNA transcribed by RNA polymerase
(pol) II undergoes a number of covalent modifications before being
exported to the cytoplasm as mature mRNA and subsequently translated.
Two such modifications, capping at the 5' end and polyadenylation at
the 3' end of mRNA, are believed to be limited to the RNA pol II
transcriptional machinery. The addition of the unique cap structure to
the 5' end of all mature eukaryotic mRNAs is tightly coupled to RNA pol
II transcription as the cap can be detected when the 5' end of mRNA
emerges from the pol II transcriptional machinery (22, 32,
49). It has been shown that the cap structure is important for
RNA transport, pre-RNA splicing, and mRNA stability (16, 23, 30,
40).
One of the best-understood functions of the cap structure is its role
in translation initiation. According to the ribosomal scanning model
(34), the eukaryotic initiation factor eIF-4F complex is
required for the binding of the ribosomal preinitiation complex to
mRNAs and for unwinding secondary structure in the 5' leader region.
This allows the preinitiation complex to scan for the first downstream
AUG start codon in a 5'-to-3' direction (for reviews, see references
25 and 54). The well-accepted ribosomal scanning model (cap-dependent initiation mechanism) accounts
for most of eukaryotic translation initiation events. However, a number
of mRNAs have been described to be translated by a cap-independent
mechanism of translation. For example, upon poliovirus infection of
mammalian cells, the eIF-4F initiation complex is rendered
nonfunctional as a result of proteolytic cleavage of the p220 subunit.
This results in the shutdown of cap-dependent protein synthesis in host
cells and allows preferential translation of uncapped viral mRNAs,
which occurs by a cap-independent mechanism (reviewed by Sonenberg
[55]). Cap-independent translation initiation has also
been described for cellular mRNAs (38, 45). Previous studies have used in vivo-expressed capless mRNAs in mammalian cells to
investigate the relationship between the cap structure and the
translation efficiency (19, 20). However, these studies differ in conclusion as to whether a cap is needed for translation in
these cells.
The poly(A) tail at the 3' end of eukaryotic mRNAs is another distinct
feature of eukaryotic mRNAs. The polyadenylation step takes place in
the nuclei posttranscriptionally. In short, the AAUAAA- and G/U-rich
elements at the 3' end of mRNA signal transcription termination and
specific cleavage followed by consecutive addition of adenosine
residues (8, 39, 58). McCracken et al. (39) have
reported that the carboxy-terminal domain (CTD) of the pol II large
subunit is required for efficient cleavage at the poly(A) site in vivo
and that the CTD might associate with CPSF (cleavage and
polyadenylation specificity factors) and CstF (cleavage stimulation factors) but not poly(A) polymerase (39), suggesting that
the polyadenylation machinery, in part, associates with the pol II transcriptional apparatus. The synthesized tail is typically
homogeneous in length, ranging from 75 nucleotides (nt) (40)
in yeast cells to 200 nt (3) in mammalian cells. In the
yeast Saccharomyces cerevisiae a general mechanism for mRNA
decay whereby mRNA is first deadenylated down to approximately 10 A
residues, which triggers the decapping of mRNA and subsequent 5'-to-3'
degradation of the message, has been proposed (2, 40). The
5'-to-3' exonuclease that appears responsible for the bulk of mRNA
degradation is encoded by the XRN1 gene.
In addition to degradation of mRNA, poly(A) tails have also been
implicated to be involved in translation. For example, poly(A)-tailed mRNAs are translated more efficiently than their deadenylated counterparts in rabbit reticulocyte lysates (31). In
addition, genetic studies of yeast have implicated a connection between the poly(A) tails and the poly(A) binding protein (PABP) with translation of mRNA. A mutation in the SPB4 gene encoding
one of the 60S ribosomal proteins can suppress the lethality resulting from a deletion of the pab1 gene, which encodes the major
PABP in budding yeast. This finding suggested that PABP might be
involved in translation (50). PABP-poly(A) complex has also
been shown to enhance translation efficiency in vitro by recruiting 40S
subunits to mRNAs, and this enhancement was cap binding protein
(eIF-4E) independent (56). Recent studies have established a
functional relationship between the cap structure at the 5' end of mRNA
and the poly(A) tail of mRNA. The Pab1 protein can copurify and
coimmunoprecipitate with the eIF-4
subunit of the eIF-4F complex in
yeast extracts (57), suggesting that the 3' and 5' ends of
mRNA may be near each other when mRNA is actively translated. Thus, a
complex interplay exists between the cap and the poly(A) tail in both
mRNA stability and translation initiation (6, 56, 57).
In this study, we put the yeast HIS4 gene under the
transcriptional control of the pol I ribosomal DNA (rDNA)
promoter/enhancer region (referred to as the rhis4 gene) and
extensively characterized the transcription of this gene, the 5' and 3'
processing of transcripts, and the translational expression of
rhis4 mRNA in yeast. Our analysis shows that RNA pol I
promotion of HIS4 results in two mRNA species; one is the
same size as the HIS4 mRNA, and the other is 1.3 kb longer
than the HIS4 mRNA and is bicistronic. Surprisingly, both mRNAs appear to be polyadenylated despite transcription by RNA pol I. An xrn1
strain or a genetically isolated suppressor of rhis4, rhis1 (rhs stands for
rhis4 suppressor) which encodes a defective xrn1
gene, results in a 9- to 10-fold increase in the combined levels of
rhis4 mRNAs. This observation suggests that the majority of
the rhis4 mRNAs are transcribed by pol I and degraded rapidly due to the absence of a cap structure. Despite a large increase
in the level of rhis4 mRNAs in an rhs1
(xrn1) mutant strain, the level of His4 protein remains low
relative to a HIS4+ strain. Our data suggest
that in yeast cells, polyadenylation of rhis4 mRNAs is able
to occur independently of RNA pol II transcription. In addition, our
results point to the cap as being an essential element for efficient
translation initiation in yeast cells.
| |
MATERIALS AND METHODS |
Yeast strains and genetic methods.
Strains used in this work
are listed in Table 1. Standard genetic
methods and media have been previously described (52).
For construction of the rhis4 allele, a 2.5-kb
EcoRI restriction fragment containing the enhancer/promoter
region from plasmid pJ10-2 (14), which contains a unit
repeat of the rDNA cistron, was introduced at a unique EcoRI
restriction site at positions 
51 to 50 (A of translational
initiation codon; AUG is the +1 position) in the HIS4 leader
region of the Ura3+ integrating plasmid p51/50
(7). Plasmid p1179 has the EcoRI rDNA fragment in
the orientation that would allow pol I rDNA transcription to initiate
toward the HIS4 coding region as determined by restriction analysis. This plasmid was used to transform yeast strain TD28 to
Ura+. This plasmid when integrated into the HIS4
locus results in a leaky His+ phenotype as a result of an
upstream and out-of-frame AUG codon now present in the HIS4
leader region (see Results). Transformants with a leaky
His+ phenotype were purified by streaking and plated on
5'-fluoro-orotic acid plates to enrich for loss of the vector sequences
(4). Ura3
strains having a leaky
His+ phenotype represented cells containing the
rhis4 allele.
For construction of the rhis4-AGG allele, a 2.2-kb
PvuII-NheI DNA fragment from plasmid p1179
ligated into the phage vector Mp18. The oligonucleotide
5'-AACTGCTTTCGCCTGAAGTACCTCC-3', containing an
A-to-C base change (underlined), was used to perform site-directed mutagenesis. This base change results in the AUG codon, beginning at
the +1 position of the pol I-promoted transcript, being changed to AGG.
A 1.3-kb SphI DNA fragment containing the mutation was isolated and substituted for the wild-type SphI fragment of
plasmid pJ10-2, which contains a unit repeat of rDNA (14),
to yield plasmid p1679. The 2.5-kb EcoRI restriction
fragment containing the rDNA enhancer/promoter region from plasmid
p1679 was subcloned into an EcoRI restriction site of
p51/50 (7), to yield plasmid p1696. This plasmid was
used to construct a yeast strain containing the rhis4-AGG
allele on chromosome III, identically to that described above for the
construction of an rhis4 strain.
Isogenic HIS4 (TD28), rhis4 (TD237), and
rhis4-AGG (HJ291) strains containing an xrn1
mutation were constructed by transformation using a SalI DNA
fragment derived from plasmid pdst2-1 (13), which
contains a dst2 (xrn1)::URA3
deletion/disruption mutation. Deletion or disruption of the
XRN1 gene in these strains was confirmed by Southern blot
analysis. The rhs1 (xrn1) suppressor mutant was identified as a strong His+ revertant of yeast strain
TD237. Genetic analysis identified a suppressor mutant unlinked to the
rhis4 locus that conferred a slow-growth phenotype. The
RHS1 (XRN1) gene was cloned by transformation from a pCT3 wild-type genomic library (kindly provided by Craig Thompson) by complementation of the slow-growth phenotype. Restriction analysis of complementing plasmids showed the DNA insert to have the
same restriction pattern as the XRN1 gene. The
URA3 gene was integrated adjacent to the XRN1
locus of the rhis4 strain HJ429 to generate yeast strain
HH828. Yeast strain HH828 was then crossed to the rhs1 yeast
strain HJ35, and diploids were subjected to tetrad analysis. For each
of the 15 four-spore tetrads analyzed, the two meiotic products with
the rhs1 slow-growth phenotype were Ura,
whereas the other two meiotic products with a wild-type growth phenotype were Ura+, indicating rhs1 to be very
tightly linked to XRN1. Finally, an rhs1 mutant
does not complement the slow-growth phenotype associated with an
xrn1 deletion/disruption strain. These studies taken
together indicate that the rhs1 locus is a mutant allele of
the XRN1 gene.
Isogenic HIS4 (TD28), rhis4 (TD237), and
rhis4-AGG (HJ291) strains containing a upf1
mutation were constructed by transformation using an
EcoRI-BamHI DNA fragment derived from plasmid
pLB65 (kindly provided by Michael Culbertson), which contains a
upf1::URA3 deletion/disruption mutation.
Deletion/disruption of the UPF1 gene in these strains was
confirmed by Southern blot analysis.
Relevant strains containing an rpa135 mutation were
constructed in a two-step process. First, yeast strains TD28
(HIS4+), HJ320 (rhis4), HJ307
(rhis4-AGG), and HJ35 (rhis4 rhs1) were crossed
to strains 1567-32C, 1567-5A, 1566-18B, and HJ322, respectively, to
generate ascospores HJ336 (HIS4+), HJ325
(rhis4), HJ339 (rhis4-AGG), and HJ363
(rhis4 rhs1) that grow well on YEPGal medium. In the second
step, HJ336 was crossed to yeast strain NOY408-1D. The other three
strains were crossed to either HJ343 or HJ350, ascospore derivatives of
NOY408-1A or NOY408-1D, both of which contain an
rpa135::LEU2 mutation and transcribe rDNA from a
GAL7 pol II promoter construct on a plasmid (44).
Ascospores used for our analysis are HJ346
(HIS4+), which has a His+ phenotype
on galactose-containing medium and shows no growth on YEPD medium;
HJ350 (rhis4), which is His on
galactose-containing medium and shows no growth on YEPD medium; HJ354
(rhis4-AGG), which is His on
galactose-containing medium and shows no growth on YEPD medium; and
HJ442 (rhis4 rhs1), which is His on
galactose-containing medium and shows no growth on YEPD medium. The
His phenotype observed in these latter three strains is a
result of the rpa135 mutation abrogating the leaky
His+ phenotype normally associated with rhis4
and rhis4-AGG strains as a result of these alleles no longer
being transcribed by RNA pol I.
To test whether the first 50 nt of leader sequence derived from
rhis4-AGG have any inhibitory effect on translation, two DNA oligonucleotides containing the complementary sequences of this 50-nt
region were hybridized and subcloned into the EcoRI site located at positions 51 to 50 of a HIS4-lacZ fusion
construct (7). Yeast total protein was isolated and
-galactosidase specific activity was assayed as previously described
(10).
RNA methods.
The 5' end of the rhis4 transcripts
was mapped by primer extension as previously described (7).
Northern blot analysis was performed as previously described
(7), with minor modifications. Twenty micrograms of total
RNA was resolved on a 1% agarose gel under denaturing conditions (6%
formaldehyde) and then transferred to a nitrocellulose membrane
(51). The membrane was incubated with 20 ml of
prehybridization buffer containing 50% deionized formamide, 5× SSC
(1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 10× Denhardt's
reagent, and 2 mg of denatured calf thymus DNA. Radioactive probes were
generated by using a random prime kit (Boehringer Mannheim) according
to the manufacturer's protocol, using [
-32P]ATP
(3,000 Ci/mmol; Amersham). HIS4 mRNA levels were quantitated with a PhosphorImager (Molecular Dynamics) using ACT1 mRNA
(actin) levels as an internal control.
The sites of polyadenylation of HIS4 and rhis4
mRNAs were determined by reverse transcription-PCR (RT-PCR) by the
method of Frohman (17) and with some modification by using
the Perkin-Elmer Cetus GeneAmp RNA PCR kit. In the first step, 100 ng
of poly(A)+ RNA from a HIS4 or rhis4
strain was mixed with oligonucleotide QT
[5'-Qo-QI-d(TTTTTTTTTTTTTTTTT)-3'], to generate a cDNA pool by
reverse transcriptase. In the first PCR, oligonucleotides Qo [5'-d(CCAGTGAGCAGAGTGACG)-3'] and HIS2057
[5'-d(CGGTGACTATTCAAGTGG)-3'], corresponding to positions +2157
to +2174 in the HIS4 coding region, were used to amplify
rhis4s, rhis4l, and HIS4 mRNAs. In the
second-round PCR, oligonucleotides QI [5'-d(GAGGACTCGAGCTCAAGC)-3']
and HIS2199 [5'-d(GGTTACGCTAGGCAGTAC)-3'], corresponding to positions
+2200 to +2217 in the HIS4 coding region, were used to
amplify rhis4s and HIS4 mRNAs, and
oligonucleotides QI and HIS3056 [5'-d(CGAGAAGAGATACACACC)-3'] were used to amplify rhis4l mRNA. Oligonucleotide HIS3056
corresponds to positions +318 to +335 in the YCL184 coding
region. The PCR fragments from rhis4s and HIS4
mRNAs were digested with SacI within QI and XbaI
corresponding to position +2328 in the HIS4 coding region,
subcloned into the SacI and XbaI restriction
sites in M13, and analyzed by DNA sequencing. The PCR fragment from
rhis4l mRNA was digested with SacI within QI and
SphI corresponding to position +421 in the YCL184
coding region, subcloned into the SacI and SphI
sites of M13, and analyzed by DNA sequencing.
Nuclear run-on experiments were performed as described by Elion and
Warner (14). Yeast cells were permeabilized and labeled with
[-32P]UTP for 15 min in the absence or presence of 10 or 100 µg of -amanitin per ml. Total 32P-labeled RNA
was then extracted from the cells and used as a probe for Southern
hybridization. Immobilized DNA fragments derived from plasmids
containing the coding regions of the HIS4 gene, the
URA3 gene, and the yeast transposable element Ty served as a
controls for pol II transcription. A plasmid containing the 28S
transcribed region of rDNA served as a control for pol I transcription. The HIS4 plasmid (B115) was restricted with
EcoRI, the Ty plasmid (B80) was restricted with
BglII, and the plasmid (p1241) containing the 28S rDNA was
restricted with EcoRI. The results of these experiments were
quantitated with a PhosphorImager. For each experiment shown in Fig.
4A, the amount of radioactivity detected hybridizing with Ty,
HIS4, or rhis4 DNA was normalized to the amount
of radioactivity hybridizing to rDNA. Each of these values are
expressed in Fig. 4B as a percentage of the respective mRNA/rRNA
species ratio determined in the absence of -amanitin treatment.
Immunoprecipitations with polyclonal anti-m7G antibodies
(42) (kindly provided by R. Parker and E. Lund) were
performed as described by Muhlrad et al. (40). Prior to
immunoprecipitation, total RNA isolated from a HIS4 or
rhis4 rhs1 (xrn1) strain was hybridized to an
oligonucleotide, 5'-d(GGAGAACTGGAGAATCTCTTC)-3', that is
complementary to positions +90 to +111 in the HIS4 coding region. RNA-DNA duplex was cleaved with RNase H, resulting in 157- and
197-nt fragment for HIS4 and rhis4 mRNAs,
respectively. The supernatant and pellets were subjected to
electrophoresis on a 10% polyacrylamide gel with 6 M urea. The
cleavage products of rhis4 and HIS4 mRNAs were
detected by Northern blot analysis using a 32P-labeled
antisense RNA complementary to positions 50 to +97 in the
HIS4 gene. The membrane was exposed in a PhosphorImager screen (Molecular Dynamics) for 3 days and visualized in a
PhosphorImager (Molecular Dynamics). The cleaved and intact
HIS4 and rhis4 were detected and recorded. As a
control for immunoprecipitation, the same membrane was hybridized with
a 32P-labeled DNA probe complementary to the
MFA2 gene, and the intact MFA2 mRNA was
visualized in a PhosphorImager after 1 day of exposure.
Western blot analysis.
Protein extracts were prepared from
yeast and analyzed by Western blots as previously described (11,
29). Rabbit polyclonal antisera directed against either the His4
protein (1:10,000) or the eIF-2 (1:25,000) were used as the primary
probes in an overnight incubation. Peroxidase-conjugated anti-rabbit
immunoglobulin G (Sigma) was used as the secondary probe (1:25,000) in
a 2-h incubation. The antibody-antigen complex was detected by the
Amersham ECL system according to the manufacturer's protocol. To
quantitate the protein levels, the film was scanned by a densitometer
(Molecular Dynamics). For each lane, the density of the His4 band was
compared to the density of the eIF-2 protein band, as an internal
control.
| |
RESULTS |
Construction of rhis4 strains.
The main aim of
this study was to elucidate the possible functions of the cap structure
of mRNA in yeast by generating and characterizing an uncapped cellular
mRNA in vivo. The rhis4 gene was constructed (Fig.
1; also see Fig. 3) such that the
HIS4 gene could be transcribed by a pol I-specific promoter.
The construct consists of the 2.5-kb EcoRI restriction
fragment containing the rDNA enhancer/promoter region (14)
that was introduced upstream at a unique EcoRI restriction
site at positions 51 to 50 (A of translational initiation codon;
AUG is the +1 position) in the HIS4 leader (7).
This promoter fusion construct was then introduced at the
HIS4 locus by the integration-excision method. Transcription
from this construct is predicted to start at the 35S rDNA gene
transcription initiation site, resulting in the rhis4 mRNA
having a 5' untranslated region (UTR) 100 nt in length. The first 50 nt
of the leader region of the rhis4 mRNA will be derived from
the 35S rRNA, and the downstream 50 nt of the 5' UTR of
rhis4 mRNA are predicted to be derived from the
HIS4 mRNA leader.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Northern blot analysis of the rhis4s and
rhisl mRNAs. (A) Schematic representation of the
rhis4 gene. The open bar represents the rDNA
enhancer/promoter region, and the solid bar represents HIS4
sequences. (B) Twenty micrograms of total RNA was isolated from yeast
strains 45-3B (his4), TD237 (rhis4), and TD28
(HIS4+) and analyzed by Northern blotting using
32P-labeled probes complementary to different regions of
the rhis4 construct. Location of the probes are shown in
panel A. Probe 1 is a 1.5-kb RsaI DNA fragment derived from
plasmid pJ10-2 (14) and is complementary to the region
upstream of the predicted 35S transcription initiation site. Probe 2 is
a 2.7-kb EcoRI DNA fragment from plasmid B115
(12) and is complementary to the HIS4 distal
coding region, the 3' UTR of the HIS4 gene, and the 5'
region of the YCL184 gene. The YCL184 gene is
located downstream of the HIS4 gene and is predicted to be
transcribed in the same direction as the HIS4 gene
(48). Probe 3 is an approximately 0.5-kb
HindIII-EcoRI fragment derived from plasmid
B115 which is located downstream of the HIS4 3' UTR. All
filters were coprobed with a 3.0-kb EcoRI-BamHI
DNA fragment containing the entire actin gene. R, RsaI; E,
EcoRI; H, HindIII.
|
|
Characterization of the rhis4 mRNAs.
To
characterize rhis4 expression, we first measured the
steady-state level of the rhis4 transcript by Northern blot
analysis using a 32P-labeled probe which contains sequences
complementary to the downstream coding region of the HIS4
gene. As shown in panel 2 of Fig. 1B, two different-size
rhis4 mRNAs are detected (middle lane); one transcript,
rhis4s, is approximate the same size as the wild-type
HIS4 mRNA, while the other transcript, rhis4l, is approximately 1.3 kb longer than the HIS4 and
rhis4s mRNAs. The combined steady-state level of the
rhis4s and rhis4l mRNAs was quantitated to be
in the range of 50 to 100% of the HIS4 mRNA level, using
actin mRNA levels as an internal control.
To map the 5' and 3' boundaries of the rhis4s and
rhis4l mRNAs, we used 32P-labeled probes from
different regions of the rhis4 gene. Probe 1 (Fig. 1A) was a
1.5-kb RsaI fragment complementary to the region upstream of
the 35S rDNA transcription initiation site. Probe 3 (Fig. 1A) was
derived from the region downstream of the HIS4 locus and
excludes sequences that are complementary to the 3' UTR of
HIS4. As shown in panel 1 of Fig. 1B, neither the
rhis4s nor the rhis4l mRNA is detected with probe
1, suggesting that the transcription initiation site of both species of
rhis4 mRNA is located downstream of probe 1. Probe 3 does
not detect the HIS4 mRNA as expected, nor does it detect the
rhis4s mRNA. Thus, rhis4s mRNA appears to have 5'
and 3' boundaries similar to those of the HIS4 mRNA. In
contrast, probe 3 detects the rhis4l mRNA. Thus,
rhis4l mRNA appears to have a 5' boundary similar to that of
rhis4s mRNA, but rhis4l is longer at the 3' end
than the rhis4s and HIS4 mRNAs.
To determine whether the two species of rhis4 mRNAs have the
same transcription initiation site, the 5' ends of the rhis4 transcripts and the HIS4 mRNA were analyzed by primer
extension analysis using an oligonucleotide complementary to positions
+10 to +31 in the HIS4 coding region. Figure
2 shows that the transcription initiation
site of the HIS4 gene maps to position 60 relative to the
translation initiation codon, as previously described (second lane from
right) (12, 43). In contrast, the transcription start site
of the rhis4 gene is located at position 100 (Fig. 2,
fourth lane from right, indicated by an arrow), which corresponds to
the predicted 35S rDNA transcription initiation site (1, 33). No primer extension product was detected either upstream or
downstream of the pol I transcription start site. This analysis in
combination with the Northern analysis indicates that both species of
rhis4 mRNAs are initiated at the pol I transcription initiation site.
View larger version (59K):
[in this window]
[in a new window]
|
FIG. 2.
Primer extension analysis of the rhis4 and
rhis4-AGG mRNAs. A 50-µg sample of total RNA isolated from
yeast strains TD28 (HIS4+), TD237
(rhis4), HJ291 (rhis4-AGG), and HJ35 (rhis4
rhs1 [xrn1]) was characterized by primer extension
analysis. Five picomoles of the 32P-labeled oligonucleotide
38, 5'd(CATCAATTAACGGTAGAATCGG)3', which is complementary to positions
+10 to +31 in the HIS4 coding region, was used as a primer.
The transcription initiation site of the rhis4 and
rhis4-AGG mRNAs is indicated by an arrow. A DNA sequencing
ladder, GATC, from rhis4 DNA, is presented. wt,
wild type.
|
|
To map the 3' ends of both rhis4 mRNAs, RT-PCRs were
performed and the products were subcloned to an M13 vector for DNA
sequencing. In total, four clones from the HIS4 PCR pool,
four clones from the rhis4s PCR pool, and five clones from
the rhis4l PCR pool were sequenced. Figure
3A summarizes the results, and Fig. 3B shows one of the sequences from each of the mRNA PCR pools. Three different polyadenylation sites were identified among the four clones
from the HIS4 pool. Two clones mapped the polyadenylation site to be 137 nt downstream of the HIS4 translational stop
codon (Fig. 3A, underlined T next to top arrowhead), and the other two clones mapped polyadenylation sites to be either 80 or 84 nt downstream of the HIS4 translational stop codon, respectively (Fig. 3A,
two G's flanking leftmost arrow). All four clones from the
rhis4s pool mapped the polyadenylation site to be 137 nt
downstream of the translational stop codon at HIS4,
identical to what was observed for two of the HIS4 clones.
Four clones from the rhis4l pool mapped the polyadenylation
site to be 102 nt downstream of the translational stop codon of the
YCL184 gene (Fig. 3A, underlined C next to bottom arrowhead), and the remaining clone from the rhis4l pool
mapped a site to be 119 nt downstream of the YCL184 stop
codon (Fig. 3A, underlined C to the right). As for other yeast genes,
polyadenylation starts right before or after an adenosine residue
(24). In addition, there is more than one polyadenylation
site for HIS4 or rhis4l as observed for other
yeast genes. The YCL184 gene was identified as part of the
chromosome III sequencing project and represents the first gene
downstream of HIS4 that is predicted to be transcribed in
the same direction (48). Interestingly, the
rhis4l mRNA appears to be a bicistronic mRNA.
View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
RT-PCR mapping of the site of polyadenylation of
rhis4 mRNA species and analysis of their ability to bind
oligo(dT) cellulose. (A) Schematic summary of RT-PCR mapping of the
rhis4s and rhis4l mRNA polyadenylation sites
relative to the 3' UTR of the HIS4 and YCL184
genes, respectively. The complete sequence of the 3' UTRs from the
HIS4 and YCL184 genes relative to their
respective translation stop codons is not shown. The relevant
nucleotides corresponding to the sites of polyadenylation in different
RT-PCR clones is described in the text. (B) Example of the DNA sequence
of one RT-PCR clone obtained for each mRNA. The corresponding sites of
polyadenylation are indicated by an arrow or arrowhead (left to right)
in panel A. (C) Total RNA isolated from different yeast strains was
passed over an oligo(dT) column. Total RNA (T; 20 µg), flowthrough
fractions (FT; 20 µg), and RNA which bound and was eluted from the
column (E; 5 µg) were then subjected to Northern blot analysis using
a 32P-labeled HIS4 probe (top panel). Filters
were washed and then reprobed with a 32P-labeled probe from
28S rDNA (bottom panel). Lanes: 1, total RNA from the
his4 strain, 45-3B; 2 to 4, total, eluted, and
flowthrough fractions from the HIS4+ strain,
TD28; 5 to 7, total, eluted and flowthrough fractions from the
rhis4 strain, TD237.
|
|
To determine whether the majority of rhis4 mRNAs are
polyadenylated, poly(A)+ RNA was separated from
poly(A) RNAs by oligo(dT)-cellulose chromatography. Total
RNA, RNAs bound to the oligo(dT) column (eluted from column), and RNAs
that did not bind to the oligo(dT) column (flowthrough) were analyzed
by Northern blotting using a probe complementary to the coding region of the HIS4 gene. Blots were then reprobed with a
32P-labeled probe from the 28S transcribed region of rDNA
(Fig. 3C, bottom panel) to determine the efficiency of separation of poly(A)+ RNA from poly(A) RNA. As shown in
Fig. 3C, the amount of HIS4 mRNA that bound to oligo(dT) was
more than that detected in the flowthrough fraction (lanes 4 and 5).
rhis4 mRNAs also bound to the oligo(dT) column (lanes 6 and
7), suggesting that the majority of rhis4s and
rhis4l mRNAs are polyadenylated.
rhis4 is transcribed by pol I.
One way to
distinguish pol I and pol II transcription is to determine whether
transcription is sensitive to the specific pol II inhibitor
-amanitin. Detergent-permeabilized yeast cells were used to
determine the effects of -amanitin on rhis4
transcription. As shown by Elion and Warner (14),
permeabilized cells provide a convenient means to examine run-on
transcription in vivo. Permeabilized cells were labeled with
[-32P]UTP for 15 min in the absence or presence of 10 or 100 µg of -amanitin per ml. Total 32P-labeled RNA
was then extracted from these cells and used as a probe for Southern
hybridization. Immobilized DNA fragments were derived from plasmids
containing the coding region of the HIS4 gene, the
URA3 gene, the yeast transposable Ty element, and the 28S
transcribed region of rDNA. These plasmids allowed us to detect
rhis4 transcripts as well as detect other pol II and pol I
transcripts which served as controls. The HIS4 plasmid was restricted with EcoRI, which yields a fragment expected to
hybridize with the 32P-labeled HIS4 or
rhis4 mRNA as well as a larger, vector fragment that
contains the intact URA3 gene. The Ty plasmid was restricted with BglII. Several BglII sites are contained in
the DNA of the Ty element and should hybridize to the Ty transcript.
The plasmid containing the 28S rDNA was restricted with
EcoRI, which generates one fragment that will hybridize with
rRNA.
As shown in Fig. 4A, cells labeled with
[-32P]UTP in the presence of -amanitin generate
less HIS4, URA3, and Ty mRNAs than cells labeled
with [-32P]UTP in the absence of -amanitin. This
result indicates that these genes are transcribed by pol II, as
expected. In contrast, cells labeled with [-32P]UTP in
the absence or presence of -amanitin produce similar amounts of the
rhis4 mRNA and similar amounts of rRNA. Figure 4B shows the
quantitation of these data whereby the amounts of the HIS4,
rhis4, and Ty mRNAs are normalized to the level of
hybridized rRNA. The relative levels of mRNAs isolated from the cells
incubated in the absence of -amanitin are expressed as 100%.
Approximately 90% of HIS4 and 85% of Ty transcription is
inhibited by 100 µg of -amanitin per ml. In contrast,
rhis4 transcription is not affected by -amanitin. This
results suggests that at least a significant portion of
rhis4 transcription is resistant to -amanitin and
therefore is under the control of the pol I promoter.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Nuclear run-on experiments using permeabilized cells in
the absence or presence of -amanitin. (A) Permeabilized yeast
strains TD28 (HIS4+) and TD237
(rhis4) were incubated with [-32P]UTP in
the absence or presence of 10 or 100 µg of -amanitin per ml. Total
RNA was extracted and used as a probe for Southern hybridization. DNA
fragments immobilized on nitrocellulose correspond to URA3
(top band of U/H), HIS4 (bottom band of U/H), Ty elements
(T), and 28S rRNA (R). (B) The quantitation of the data in panel A. The
levels of Ty, HIS4, and rhis4 mRNAs are
normalized by the levels of hybridized rRNA. The relative level of
mRNAs from cells incubated in the absence of -amanitin is expressed
as 100%.
|
|
The RPA135 gene, which encodes the second-largest subunit of
pol I (60), is essential for the transcription of rDNA. A
deletion of the RPA135 gene causes cell death. However, an
RPA135 deletion strain can be rescued by having an rDNA
cistron transcribed from a pol II promoter which is provided by a unit
repeat of 35S rDNA fused to the GAL7 promoter. Thus, the
rpa135 strain can grow in medium containing galactose,
which activates the GAL7 promoter to transcribe rDNA
(44). We used an rpa135 rhis4
GAL7-rDNA strain to obtain evidence whether pol I is responsible
for the transcription of the majority of rhis4 mRNA. The
rationale was that if some of rhis4 mRNA is transcribed by
pol II, this amount of rhis4 mRNA should not be altered by
the rpa135 mutation. In contrast, if transcription of
rhis4 is under the control of pol I, rhis4 mRNA
should be absent in an rpa135 strain. Total RNA was
isolated from strains containing the rpa135 mutation or
the wild-type RPA135 gene and was analyzed by Northern blot
analysis. Figure 5 shows that
HIS4 transcription is not affected by a deletion of the
RPA135 gene (lanes 1 and 2). In contrast, there is no
rhis4l mRNA detected in the rpa135 strain
(lanes 3 and 4), indicating that rhis4l is promoted by pol
I. There is a significant reduction of rhis4s mRNA detected
in the rpa135 strain (lanes 3 and 4), suggesting that at
least the majority of rhis4s transcription is promoted by
pol I. The remaining rhis4s transcript is most likely a
result of transcription from an overlapping pol II promoter in the rDNA
pol I promoter region as previously reported (9).
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Northern blot analysis of rhis4 transcripts
in an rpa135 genetic background.
RPA135+ and rpa135 strains were
cultured in YEPG (galactose) medium, and then total RNA was isolated
and analyzed by Northern blotting as described in Materials and
Methods. Lanes: 1, HIS4 (HJ332); 2, HIS4
rpa135 (HJ346); 3, rhis4 (HJ322); 4, rhis4
rpa135 (HJ350); 5, rhis4-AGG (HJ399); 6, rhis4-AGG rpa135 (HJ354); 7, rhis4 rhs1
(HJ364); 8, rhis4 rhs1 rpa135 (HJ442). The band observed
in the rpa135 strains that migrates faster than the
HIS4 and rhis4s mRNA is a result of nonspecific
cross-hybridization between an unknown RNA species derived from plasmid
pNOY102 and the actin probe.
|
|
The rate of rhis4 transcription is higher than that of
HIS4.
Pol I transcription of rhis4 is expected to
generate uncapped mRNA. Thus, rhis4 mRNA should represent
the decapped intermediate form of mRNA in the yeast mRNA degradation
process and should be degraded more quickly than pol II-promoted,
capped HIS4 mRNA. Nevertheless, the combined steady-state
level of rhis4s and rhis4l is nearly comparable
to that of HIS4 mRNA. We therefore determined whether the
steady-state level of rhis4 mRNA is an underrepresentation of the rate of transcription at rhis4 by comparing it to the
rate of HIS4 transcription (Fig.
6). Total 32P-labeled RNAs
were isolated from permeabilized cells after being labeled with
[-32P]UTP for 1, 5, or 15 min. For these experiments,
total RNA isolated from the HIS4 strain or the
rhis4 strain was used as a probe in Southern hybridization
to immobilized DNA fragments corresponding to the coding region of the
HIS4 gene, the transcribed region of 5S rDNA (as a pol III
transcription control), and the transcribed region of 28S rDNA (as a
pol I transcription control). The restricted, immobilized DNA used for
the HIS4/rhis4 and 28S analysis is the same as described for
Fig. 4. For the 5S analysis in Fig. 6, a plasmid containing the 2.5-kb
EcoRI rDNA enhancer/promoter region was restricted with
EcoRI and NdeI. The slower-migrating fragment (approximately 2.0 kb) contains the 5S gene free of other encoded rRNA
sequences.
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
Time course of HIS4 and rhis4 mRNA
synthesis by nuclear run-on transcription assay. Yeast strains TD28
(HIS4) and TD237 (rhis4) were permeabilized, and
aliquots of cells were labeled with [-32P]UTP for 1, 5, or 15 min. 32P-labeled total RNA was isolated and used
as probes for Southern hybridization to immobilized HIS4
(H), 5S, and 28S DNA fragments.
|
|
As shown in Fig. 6, the synthesis rates of both 5S rRNA and 28S rRNA
appear quite high, probably as a result of multiple copies of these
genes in the yeast genome. HIS4 mRNA is barely detectable even after 15 min of labeling with [-32P]UTP. In
contrast, rhis4 mRNAs can be easily detected after 5 min of
labeling with [-32P]UTP. This result suggests that the
synthesis rate of the rhis4 mRNA is higher than that of the
HIS4 mRNA despite the near equivalence of the steady-state
levels. These data indicate that the lower level of the
rhis4 mRNA detected on Northern blots does not reflect the
higher transcriptional level, presumably due to rapid decay of uncapped
mRNAs.
Mutations in the XRN1 gene increases the abundance of
rhis4 mRNAs.
It has been reported that XRN1
plays a critical role in mRNA decay after decapping (21, 27,
40). Thus, we reasoned that if the pol I-promoted
rhis4 mRNA is uncapped and rapidly degraded, rhis4 mRNA would be predicted to accumulate in an
xrn1 strain. Total RNA was isolated from strains
containing either an xrn1 mutation or the wild-type
XRN1 gene and analyzed by Northern blots analysis. Figure
7 shows that the relative amount of the
HIS4 mRNA is approximately 50% higher in an
xrn1 strain (lane 6) than in an XRN1 strain
(lane 2). In contrast, the combined levels of the rhis4s and
rhis4l mRNAs are approximately ninefold higher in the
xrn1 strain (8.4-fold for rhis4s mRNA and
9.6-fold for rhis4l mRNA) than in an
XRN1+ strain (compare lanes 3 and 7).
View larger version (81K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of mutations in XRN1 and
UPF1 on HIS4 and rhis4 mRNA levels.
(A) Total RNA was isolated from different yeast strains and subjected
to Northern blot analysis as described in Materials and Methods. Total
RNA was isolated from the following yeast strains: HH879 (which
contains the HIS4+ gene on a high-copy-number
YEp24 vector; lane 1); TD28 (HIS4+; lane 2);
TD237 (rhis4; lane 3); HJ291 (rhis4-AGG; lane 4);
HJ35 (rhis4 rhs1 [xrn1], lane 5); HJ556
(HIS4+ xrn1; lane 6); HJ549
(rhis4 xrn1; lane 7); HJ569 (rhis4-AGG
xrn1; lane 8); HH880 (HIS4+
upf1; lane 9); HH881 (rhis4 upf1; lane 10);
and HH882 (rhis4-AGG upf1; lane 11). wt, wild type. (B)
Bar graph illustrating the quantitation of HIS4 or
rhis4 mRNA to actin mRNA levels for each lane in panel A as
described in Materials and Methods. The ratio of
HIS4+ mRNA to actin mRNA in lane 2 represents
the standard 100% level.
|
|
Several suppressor mutations that enhance the expression of the
rhis4 gene at the level of transcription have been isolated (28). As expected, rhs1 corresponds to a mutation
in the XRN1 gene. Figure 2 shows that the transcription
initiation sites of the rhis4 mRNA in the parent strain and
the rhs1 strain are identical and correspond to the
predicted pol I start site. In addition, an approximate 10-fold
increase in the combined level of rhis4 mRNAs (7.2-fold for
rhis4s mRNA and 12.8-fold for rhis4l mRNA) is
observed in the rhs1 (xrn1) mutant genetic
background (Fig. 7; compare lanes 3 and 5), consistent with that
observed in the xrn1 strain. This increase in
rhis4 mRNA levels is also RPA135 dependent (Fig.
5, lanes 7 and 8). The fact that a mutation in xrn1 has such
a specific and large effect on the level of rhis4 mRNAs
suggests that the pol I promotion of rhis4 transcription leads to production of uncapped mRNA which is rapidly degraded. The
effect of an xrn1 mutation is then to reduce the cellular levels of 5'-to-3' exonuclease activity that results in stabilization of the uncapped rhis4 mRNAs.
rhis4 mRNA that accumulates in an xrn1
strain is not immunoprecipitated with anticap antiserum.
To
directly determine if the rhis4 mRNA that accumulates in the
rhs1 (xrn1) strain is uncapped, we
immunoprecipitated the rhis4 mRNA with antiserum directed
against the cap structure (42). For these experiments, total
RNA was isolated from cells, hybridized to an oligonucleotide that is
complementary to the HIS4 and rhis4 mRNAs, and
digested with RNase H. After immunoprecipitation, RNA was recovered
from the pellets and supernatants and analyzed by Northern blot
analysis using a 32P-labeled probe that is complementary to
positions 50 to +97 in the HIS4 and rhis4
mRNAs. This procedure was used as an attempt to maximize the efficiency
of immunoprecipitation (41). As an internal control for
immunoprecipitation, we also probed for the MFA2 gene.
Prior to immunoprecipitation, we characterized the RNase H cleavage
reaction and cleavage product, using two different oligonucleotides that hybridize to two different region of the HIS4 coding
region. Oligonucleotide 1 is complementary to nt +47 to +66 in the
HIS4 coding region, whereas oligonucleotide 2 is
complementary to nt +90 to +111. As shown in Fig.
8A, oligonucleotide 1 generates a smaller
RNase H cleavage product than oligonucleotide 2 when hybridized with
total RNA from either a HIS4+ or an
rhis4 xrn1 strain. This is expected, as the
former oligonucleotide is complementary to sequences that are located
further upstream in the HIS4 coding region. The RNase H
cleavage products generated from the rhis4
xrn1 strain are also larger than the corresponding RNase
H cleavage products which were generated from the
HIS4+ strain. This is consistent with the
rhis4 leader region being 40 nt longer than the
HIS4 leader (Fig. 2). The slower-migrating material observed
in Fig. 8A presumably represents either the reciprocal HIS4
or rhis4 mRNA, RNase H cleavage product, or full-length mRNA
that did not hybridize with an oligonucleotide.
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
(A) Total RNA from a HIS4 strain and an
rhis4 rhs1 (xrn1) strain were hybridized with
oligonucleotide (oligo) 1 or 2, complementary to the HIS4
coding region from nt +47 to +66 or +90 to +111, respectively. RNA-DNA
hybrids were treated with RNase H followed by electrophoresis in 6%
acrylamide gels containing 8 M urea. Gels were then subjected to
Northern blot analysis using an antisense RNA probe complementary to
positions 50 to +97 in the HIS4 gene. Lanes: 1 and 2, total RNA from a HIS4+ strain hybridized with
oligonucleotide 2 and cleaved with RNase H; 3, total RNA from a
HIS4+ strain hybridized with oligonucleotide 1 and cleaved with RNase H; 4 and 5, total RNA from an rhis4
rhs1 (xrn1) strain hybridized with oligonucleotide 1 and cleaved with RNase H; 6 and 7, total RNA from an rhis4
rhs1 (xrn1) strain hybridized with oligonucleotide 2 and cleaved with RNase H. (B) Immunoprecipitation of HIS4
and rhis4 mRNAs with anticap antiserum. Total RNA isolated
from different strains was hybridized with oligonucleotide 2 (complementary to the HIS4 coding region between positions
+90 and +111), digested with RNase H, and immunoprecipitated with
anticap antiserum as described in Materials and Methods. RNAs recovered
from pellets (P) and supernatants (S) were analyzed by Northern blot
analysis using two different probes, an antisense RNA complementary to
positions 50 to +97 in the HIS4 gene (bottom panels) and a
random-primed probe complementary to the MFA2 gene (top
panels). The first two lanes represent precipitated and unprecipitated
RNAs, respectively, from an rhis4 rhs1 (xrn1)
strain (HJ35). The last two lanes represent precipitated and
unprecipitated RNAs from the HIS4+ wild-type
strain, TD28. The arrows in the bottom panels point to rhis4
and HIS4 mRNA RNase H cleavage products and correspond to
the cleavage products characterized in panel A.
|
|
For the immunoprecipitation reactions presented in Fig. 8B, we used
oligonucleotide 2. The HIS4 cleavage product, which is presumably capped, could be detected in the immunoprecipitate and was
not observed in the supernatant, albeit the detection resolution is
quite low (Fig. 8B). In contrast, the rhis4 cleavage product
is not observed in the immunoprecipitate; rather, the rhis4
cleavage product remained in the supernatant. As a control for these
reactions, we found that the majority of the MFA2 mRNA isolated from an XRN1+ strain was
immunoprecipitated with the anticap antiserum, whereas more
MFA2 mRNA from an rhs1 (xrn1) strain
remained in the supernatant, suggesting that rhs1
(xrn1) stabilizes the decapped form of the MFA2
mRNA, which does not immunoprecipitate. These results are consistent
with the notion that the rhis4 mRNA which accumulates in the
rhs1 (xrn1) strain is uncapped.
Construction of rhis4-AGG allele.
The first three
nucleotides from the pol I start position in rDNA are predicted to
introduce an upstream and out-of-frame AUG codon at the immediate 5'
end of the rhis4 mRNA (33). Thus, rhis4 mRNA may be degraded by the nonsense-mediated decay
pathway, and the rhs1 or xrn1 mutation may
stabilize the nonsense-mediated decay of rhis4 mRNA
(21). Therefore, we mutated the upstream and out-of-frame
AUG to AGG by site-directed mutagenesis (for details, see Materials and
Methods). The reason for choosing to mutate the AUG to AGG is that AGG
has been identified as the first three nucleotides in precursor rRNA
from Drosophila and Xenopus cells (15,
37). Therefore, we reasoned that an AUG-to-AGG change might not
alter the start site for pol I transcription. The presence of this
mutation was confirmed by DNA sequencing (data not shown), and the
corresponding rhis4 allele (rhis4-AGG) was
inserted and replaced for the wild-type HIS4 gene on
chromosome III.
Figure 2 shows that the AGG mutation does not affect the transcription
initiation site of rhis4-AGG mRNAs, as determined by primer
extension analysis. rhis4-AGG also generates two mRNA
species (Fig. 5, lane 5), rhis4-AGGs and
rhis4-AGGl, with the same mobilities as the
rhis4s and rhis4l mRNAs, respectively. In
addition, the amounts of the rhis4-AGG transcripts are
similar to those of the rhis4 messages and are also
sensitive to an rpa135 mutation (Fig. 5). The
xrn1 mutation also results in a comparable increase in the combined level of the rhis4-AGGs and
rhis4-AGGl transcripts (Fig. 7; compare lanes 4 and 8).
Finally, to rule out nonsense-mediated decay as a mechanism for
destabilizing rhis4 mRNA, we measured the levels of
rhis4 and rhis4-AGG transcripts in a
upf1 strain. Figure 7 shows that a upf1
mutation does not result in an increase in rhis4s or
rhis4-AGGs mRNA or rhis4l and
rhis4-AGGl transcripts, which are bicistronic (compare lanes
3 and 4 to lanes 10 and 11, respectively). These data suggest that a
large majority of rhis4 transcription products are unstable,
not as a result of nonsense-mediated decay but due to the absence of a
cap structure at the 5' end of this pol I-promoted message.
Translational expression of rhis4 and
rhis4-AGG strains.
Our analysis indicates that an
rhs1 (xrn1) mutant strain accumulates significant
levels of intact and uncapped rhis4 transcripts. It has been
reported that in a number of eukaryotic organisms, certain mRNAs can be
translated by a cap-independent mechanism of translation initiation
(38, 45). Therefore, an important question to address is
whether yeast cells also have a cap-independent mechanism of
translating mRNA.
We measured the in vivo translational expression of the
rhis4 and rhis4-AGG transcripts in different
genetic backgrounds. The level of His4 protein was quantitated relative
to the level of eIF-2 by Western blot analysis using antibodies
directed against each protein. As shown in Fig.
9, the His4 protein level of the rhis4 strain is approximately 3% that of a
HIS4+ strain (compare lanes 2 and 3). The amount
of His4 protein in the rhis4-AGG strain is approximately
2.5-fold higher than that in the rhis4 strain (compares 3 and 4) but only approximately 7.5% of wild-type levels (compare lanes
2 and 4). When we insert the 50-nt leader sequence derived from the
rRNA portion of rhis4-AGG at positions 51 to 50 of the
HIS4+ leader region, we observe near wild-type
levels of His4 protein (approximately 80 to 90% of wild-type levels),
indicating that this sequence is not inhibitory to translation (data
not shown). The finding that the level of rhis4-AGG mRNAs
represents between 50 and 100% of wild-type HIS4 mRNAs
(Fig. 7) but the level of translation is a fraction of the wild-type
protein level (7 to 8% [Fig. 9]) suggests that rhis4-AGG
mRNAs are not translated efficiently.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 9.
Western blot analysis of the His4 protein produced in
HIS4 and rhis4 strains. (A) Yeast crude extracts
were isolated and analyzed by Western blot analysis using antibodies
directed against His4 protein and antibodies directed against eIF-2.
Crude extracts were prepared from the following yeast strains: HH879
(which contains the HIS4+ gene on a
high-copy-number YEp24 vector; lane 1); TD28
(HIS4+; lane 2); TD237 (rhis4; lane
3); HJ291 (rhis4-AGG; lane 4); HJ35 (rhis4 rhs1
[xrn1]; lane 5); HJ556 (HIS4+
xrn1; lane 6); HJ569 (rhis4-AGG xrn1; lane
7); and HJ549 (rhis4 xrn1; lane 8). (B) Bar graph
illustrating the quantitation of His4 protein levels to eIF-2
protein levels for each lane in panel A as described in Materials and
Methods. The ratio of His4 protein to eIF-2 protein levels in lane 2 represents the standard 100% level. wt, wild type.
|
|
This latter point is established further in Fig. 9. The amount of His4
protein measured from an rhis4-AGG xrn1 strain is approximately fourfold higher than that in the rhis4-AGG
parent strain (compare lanes 4 and 7). However, the level of His4
protein in the rhis4-AGG xrn1 strain is only
approximately 32% of that detected in a HIS4 wild-type
strain (Fig. 9; compare lanes 2 and 7) despite the level of
rhis4-AGG mRNA being approximately 10-fold higher than that
of wild-type HIS4 mRNA (Fig. 7). This is not a result of the
inability of overexpressed HIS4 mRNA to be translated to
high levels. As a control, we expressed the HIS4 wild-type gene on a high-copy-number vector. The level of HIS4 mRNA in
this strain is approximately eightfold higher than the level of
HIS4 mRNA in the wild-type parent strain (Fig. 7; compare
lanes 1 and 2). This increase is comparable to the total level of
rhis4-AGG transcripts in an rhs1
(xrn1) mutant strain. This eightfold increase in
HIS4 transcript levels results in a threefold increase in
the level of intact His4 protein and an assortment of abundant,
cross-reactive, and presumed proteolyzed fragments of His4 protein.
Thus, the level of intact His4 protein in an rhis4-AGG
xrn1 strain is only 10% of the level of intact His4 protein
level (330 versus 32%) when we control for mRNA levels (Fig. 9;
compare lanes 1 and 7). Judging from the abundance of proteolyzed
fragments in lane 1, this 10-fold difference would appear to be grossly
underestimated. Thus, the simplest explanation for the inability to see
abundant His4 protein levels in an rhis4-AGG xrn1 strain
is that these pol I-promoted and capless mRNAs are not efficiently
translated in yeast.
| |
DISCUSSION |
Pol I-promoted uncapped rhis4 mRNA is degraded
rapidly.
We have put the HIS4 gene under the
transcriptional control of pol I to generate a species of mRNA that is
predominately capless in yeast. We have shown that the majority of
rhis4 transcripts is transcribed by pol I and mutations in
the XRN1 gene increases the abundance of the pol I-promoted
rhis4 mRNAs. Our analysis indicates that the
rhis4 gene produces capless mRNA that is rapidly degraded by
the Xrn1, 5'-to-3' exonuclease. Elegant studies in the Parker
laboratory have mapped out the deadenylation-dependent pathway for mRNA
degradation in the cytoplasm (6). The first step in
degradation is deadenylation which leads to decapping and subsequent
5'-to-3' exonucleolytic degradation of mRNA. Furthermore, it has been
shown that mutations in XRN1 lead to an increase in mRNA
degradation intermediates (27). Our observations that
mutations in the xrn1 gene lead to a 9- to 10-fold increase
in the combined steady-state level of rhis4 mRNAs indicates
that at least 90% of the mRNA transcribed at rhis4 is
rapidly degraded by Xrn1.
A second pathway for mRNA degradation exists in yeast commonly referred
to as the nonsense-mediated decay pathway that appears to be conserved
in other eukaryotic organisms (21, 46, 59). This pathway is
deadenylation independent and is believed to trigger mRNA degradation
as a result of a premature nonsense codon in the coding region. The
fact that the level of the rhis4-AGG mRNA is similar to that
of the rhis4 mRNA and the amount of bicistronic rhis4l and rhis4-AGGl mRNA is not increased in a
upf1 mutant argues against the rhis4 mRNA
being degraded by a nonsense-codon mediated decay pathway. The
instability of the rhis4 transcript must be due to the mRNA
lacking a cap structure. This is confirmed by our immunoprecipitation
analysis using anticap antibodies. Thus, our analysis confirms and
extends other studies on mRNA decay in yeast which suggest that removal
of the cap is the crucial step for mRNA decay and that Xrn1 is the
major 5'-to-3' exonuclease involved in decay.
3'-end formation of a pol I-promoted rhis4 mRNA.
Our analysis brings out some interesting observations on the nature of
3'-end formation of mRNA in yeast. Surprisingly, pol I-promoted
HIS4 expression produces mRNA species that terminate at the
3' noncoding region of pol II genes. This would suggest that
termination of transcription at these regions is independent of the RNA
polymerase transcribing the DNA. In addition, the mRNAs produced appear
to be polyadenylated based on oligo(dT) binding and PCR methodology for
mapping the 3' end of the transcript. These observations further
support the notion that transcription termination at the 3' ends of pol
II genes in yeast is dictated not by a polymerase termination sequence
but by polyadenylation signals (5), as the termination
signals for pol I transcription are predicted to be different and
presumably not present in the 3' noncoding regions of pol II genes
(35). Interestingly, the polyadenylation site for the
rhis4s mRNA is the same as one of those for the
HIS4 mRNA (137 nt downstream of translation stop codon of
HIS4). The polyadenylation sites for the rhis4l
mRNA are located at the 3' UTR of the YCL184 gene,
suggesting that it is also possible that the rhis4l and
YCL184 transcripts have the same polyadenylation site(s).
Considerable controversy surrounds the requirement of pol II
transcription for polyadenylation. Grummt and Skinner (19) reported that pol I-promoted chloramphenicol acetyltransferase mRNAs
were polyadenylated in mouse 3T6 cells. In contrast, it has been shown
that pol I-promoted herpes simplex virus tk mRNAs were not
polyadenylated in monkey COS-7 cells (53). This latter observation is more consistent with recent studies which demonstrated that the CTD of the pol II large subunit is required for efficient cleavage at the poly(A) site in vivo (39). It was also shown that the CTD might associate with CPSF and CstF but not poly(A) polymerase (39). However, our data indicate that at least in yeast, the polyadenylation machinery is able to function independently of pol II transcription. Instead, our data indicate that sequences in
the 3' noncoding region of genes, such as HIS4 and
YCL184, support the polyadenylation process regardless of
the RNA polymerase transcribing the DNA.
Another interesting observation made in our analysis is that two
transcripts accumulate as a result of pol I transcription of
HIS4: rhis4s and rhis4l.
rhis4l is bicistronic and presumably is a result of the
inability of pol I to terminate efficiently at the 3' end of the
HIS4 gene. One model for termination of pol II transcription
in yeast is that it is an indirect consequence of nascent transcripts
being polyadenylated through signals located in the 3' noncoding region
(5). Alternatively, as suggested for mammalian RNA
polymerase II termination, a strong termination signal would be the
combination of an efficient polyadenylation site and a strong pause
site (36, 47). There are a number of possibilities as to why
we observe bicistronic rhisl mRNA as a result of pol I
transcription. One possibility is that the polyadenylation signals
present at HIS4 are not designed to promote a rate of polyadenylation coincident with the apparent higher rate of
transcription associated with pol I transcription at HIS4
(Fig. 6). Alternatively, pol I does not pause effectively in this
region, and thus the mRNA structure may not always be conducive to
efficient polyadenylation/termination. Either way, the
rhis4l transcript is produced by default, at the 3' end of
YCL184.
The 5' cap is required for efficient translation initiation in
vivo.
One of the major goals of our analysis was to determine if
yeast has a cap-independent mechanism of translation initiation. The
requirement for a cap in translation initiation is strongly supported
by in vitro studies. Studies which have addressed the requirement for a
cap in in vivo translation initiation have led to conflicting results.
For example, it has been shown that the 5' cap structure,
m7Gppp, of mature eukaryotic mRNA is required for efficient
translation in microinjected oocytes (54). However, the mRNA
injected lacked a poly(A) tail, which has recently been suggested to be
important for translation initiation (reference 56
and references within). Grummt and Skinner (19) have shown
that in mouse (3T6) cells, pol I-promoted chloramphenicol
acetyltransferase mRNAs contained a poly(A) tail and were poorly
expressed. However, it was not established if the mRNA lacked a 5' cap
structure. Studies of HeLa cells have shown that pol III-promoted
transcripts are associated with polysomes and translated even though
these transcripts were neither capped nor polyadenylated
(20), which is at odds with recent models for eukaryotic
translation initiation that suggest synergy between the 5' and 3' ends
of mRNA (18, 57). Our analysis of pol I-promoted
HIS4 expression, especially in an rhs1
(xrn1) or xrn1 genetic background, afforded
the ability to produce a substantial level of predominantly capless
mRNA that was polyadenylated. The ability of a mutation in
XRN1 to stabilize this rhis4 mRNA strongly
suggests that the mRNA is degraded in the cytoplasm, as Xrn1 is
believed to be cytoplasmically located (26). Thus, rhis4 mRNAs presumably are available to the translational
machinery that is cytoplasmically located. Our analysis indicates that
rhis4-AGG mRNA is translated at approximately 7 to 10% of
the level of capped HIS4 mRNA (Fig. 9; compare lanes 4 to 2 and lanes 7 to 1). This level may even be lower as approximately
one-third of this His4 protein is still detected in an
rpa135 strain (data not shown) and presumably results
from translation of pol II promoted rhis4 transcripts that
are present at low level (Fig. 5). Nevertheless, quantitation of the
level of His4 protein as presented here (Fig. 9) strongly indicates
that pol I-promoted, capless mRNAs lack the ability to be efficiently
translated in yeast and therefore suggests that a cap-dependent
mechanism is preferred in yeast for efficient translation.
We thank T. Blumenthal, P. Cherbas, J. Jaehning, and N. Pace for
helpful discussions during the course of this work. We thank J. Warner
for the rDNA promoter/enhancer plasmid, M. Culbertson for the
upf1::URA3 plasmid, C. Dykstra for the
dst2 (xrn1)::URA3 plasmid,
C. Thompson for the pCT3 yeast genomic library, M. Nomura for the
rpa-135 strains, E. Lund and R. Parker for the anticap antiserum, and R. Parker and C. Decker for advice on
immunoprecipitation of mRNA with the anticap antibody.
This work was supported by Public Health Service grant GM32263 from the
National Institutes of Health awarded to T.F.D.
| 1.
|
Bayev, A. A.,
O. I. Georgiev,
A. A. Hadjiolov,
M. B. Kermekchiev,
N. Nikolaev,
K. G. Skryabin, and V. M. Zakharyev.
1980.
The structure of the yeast ribosomal genes. 2. The nucleotide sequence of the initiation site for ribosomal RNA transcription.
Nucleic Acids Res.
8:4919-4926[Abstract/Free Full Text].
|
| 2.
|
Beelman, C. A., and R. Parker.
1995.
Degradation of mRNA in eukaryotes.
Cell
81:179-183[Medline].
|
| 3.
|
Bernstein, P., and J. Ross.
1989.
Poly(A), poly(A) binding protein and the regulation of mRNA stability.
Trends Biochem. Sci.
14:373-377[Medline].
|
| 4.
|
Boeke, J. D.,
F. Lacroute, and G. R. Fink.
1984.
A positive selection of mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[Medline].
|
| 5.
|
Butler, S. J., and T. Platt.
1988.
RNA processing generates the mature 3' end of yeast CYC1 messenger RNA in vitro.
Science
242:1270-1274[Abstract/Free Full Text].
|
| 6.
|
Caponigro, G., and R. Parker.
1995.
Multiple functions for the poly(A)-binding protein in mRNA decapping and deadenylation in yeast.
Genes Dev.
9:2421-2432[Abstract/Free Full Text].
|
| 7.
|
Cigan, A. M.,
E. K. Pabich, and T. F. Donahue.
1988.
Mutational analysis of the HIS4 translational initiator region in Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:2964-2975[Abstract/Free Full Text].
|
| 8.
|
Connelly, S., and J. L. Manley.
1988.
A functional mRNA polyadenylation signal is required for transcription termination by RNA polymerase II.
Genes Dev.
2:440-452[Abstract/Free Full Text].
|
| 9.
|
Conrad-Webb, H., and R. A. Butow.
1995.
A polymerase switch in the synthesis of rRNA in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:2420-2428[Abstract].
|
| 10.
|
Donahue, T. F., and A. M. Cigan.
1988.
Genetic selection for mutations that reduce or abolish ribosomal recognition of the HIS4 translational initiator region.
Mol. Cell. Biol.
8:2955-2963[Abstract/Free Full Text].
|
| 11.
|
Donahue, T. F.,
A. M. Cigan,
E. K. Pabich, and B. Castilho-Valavicius.
1988.
Mutations at a Zn(II) finger motif in the yeast eIF-2b gene alter ribosomal start-site selection during the scanning process.
Cell
54:621-632[Medline].
|
| 12.
|
Donahue, T. F.,
P. J. Farabaugh, and G. R. Fink.
1982.
The nucleotide sequence of the HIS4 region of yeast.
Gene
18:47-59[Medline].
|
| 13.
|
Dykstra, C. C.,
K. Kitada,
A. B. Clark,
R. K. Hamatake, and A. Sugino.
1991.
Cloning and characterization of DST2, the gene for DNA strand transfer protein b from Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:2583-2592[Abstract/Free Full Text].
|
| 14.
|
Elion, E. A., and J. R. Warner.
1986.
An RNA polymerase I enhancer in Saccharomyces cerevisiae.
Mol. Cell. Biol.
6:2089-2097[Abstract/Free Full Text].
|
| 15.
|
Financsek, I.,
K. Mizumoto,
Y. Mishima, and M. Muramatsu.
1982.
Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.
Proc. Na |
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
