Previous Article | Next Article 
Mol Cell Biol, February 1998, p. 732-741, Vol. 18, No. 2
Dana-Farber Cancer Institute1 and
Brigham and Women's Hospital, Harvard Medical
School,2 Boston, Massachusetts 02115;
Program in Molecular and Cell
Biology3 and
Howard Hughes Medical
Institute,4 Oklahoma Medical Research
Foundation, Oklahoma City, Oklahoma 73104; and
Department
of Biochemistry and Molecular Biology, University of Oklahoma
Health Sciences Center, Oklahoma City, Oklahoma
731905
Received 15 September 1997/Accepted 9 November 1997
The von Hippel-Lindau tumor suppressor protein (pVHL) binds to
elongins B and C and posttranscriptionally regulates the
accumulation of hypoxia-inducible mRNAs under normoxic (21%
O2) conditions. Here we report that pVHL binds, via elongin
C, to the human homolog of the Caenorhabditis elegans Cul2
protein. Coimmunoprecipitation and chromatographic copurification data
suggest that pVHL-Cul2 complexes exist in native cells. pVHL mutants
that were unable to bind to complexes containing elongin C and Cul2
were likewise unable to inhibit the accumulation of hypoxia-inducible
mRNAs. A model for the regulation of hypoxia-inducible mRNAs by pVHL is
presented based on the apparent similarity of elongin C and Cul2 to
Skp1 and Cdc53, respectively. These latter proteins form complexes that
target specific proteins for ubiquitin-dependent proteolysis.
von Hippel-Lindau (VHL) disease, a
hereditary cancer syndrome characterized by the development of renal
carcinomas, pheochromocytomas, and vascular tumors of the central
nervous system and retina, is caused by germ line mutations in the VHL
tumor suppressor gene (9, 17, 27, 35). Tumor development in
this setting is due to somatic loss or mutation of the remaining
wild-type VHL allele (9, 17).
Functional inactivation of both VHL alleles has also occurred in the
majority of sporadic renal cell carcinomas and cerebellar hemangioblastomas examined to date (7, 10, 14, 21, 40, 45).
Loss of heterozygosity at the VHL gene locus has been described for
premalignant lesions of the kidney, such as atypical cysts (32,
49), suggesting that inactivation of the VHL gene is an early
event in renal carcinogenesis. Furthermore, reintroduction of a
wild-type but not mutant VHL cDNA into VHL ( The VHL gene product, pVHL, binds to elongins B and C (6, 22, 24,
44). These two proteins, when bound to elongin A, generate a
transcriptional elongation complex called elongin or SIII
(1). pVHL competes with elongin A, at least in vitro, for
binding to elongins B and C and thereby inhibits elongin activity (6). The majority of inherited pVHL mutants are known (or
can be predicted) to be defective for binding to elongins B and C (22, 24, 48). Thus, inhibition of elongin (SIII) activity may contribute to tumor suppression by pVHL.
VHL-associated neoplasms are typically hypervascular and overproduce
angiogenic peptides, such as vascular endothelial growth factor (VEGF)
(3, 39, 43, 47). Several groups have shown that pVHL is a
negative regulator of hypoxia-inducible mRNAs, such as the VEGF and
Glut1 glucose transporter mRNAs, under normoxic conditions
(11, 16, 37, 41). Surprisingly, this effect of pVHL appears
to be largely at the level of mRNA stability rather than at the
level of transcript elongation (11, 16). Thus, there is
currently no direct evidence that pVHL regulates transcriptional elongation in vivo. Furthermore, pVHL appears to reside primarily but not exclusively in the cytoplasm, again raising the possibility that pVHL performs a function(s) unrelated to transcriptional elongation (5, 18, 28, 31).
Cullins are a recently identified family of proteins that exhibit
significant sequence similarity to the yeast Cdc53 protein and hence
are suspected of functioning to target certain proteins for
ubiquitin-dependent proteolysis (15, 19, 23). Here we show
that a cullin, Cul2 (23), binds specifically to pVHL-elongin complexes and that the formation of these complexes is linked to
the regulation of hypoxia-inducible mRNAs by pVHL. A model for the regulation of hypoxia-inducible mRNAs by pVHL is proposed based on the apparent similarity of elongins C, B, and A to Skp1, ubiquitin, and F-box proteins, respectively (2, 8).
Cell culture.
786-O and A498 renal carcinoma cells,
obtained from the American Type Culture Collection (Rockville, Md.),
were grown in Dulbecco's modified Eagle's medium containing 10%
defined and supplemented bovine calf serum (Hyclone) at 37°C in a
humidified, 10% CO2-containing atmosphere. 786-O subclones
stably transfected with pRc/CMV, pRc/CMV-VHL(wt), and pRc/CMV(1-115)
were described previously and were maintained in the presence of G418
(500 µg/ml) (18). The 786-O and A498 subclones described
in this article were generated and propagated in the same manner.
Radioisotopic labelling was performed by methionine starvation for
1 h, followed by growth in methionine-free Dulbecco's modified
Eagle's medium supplemented with [35S]methionine
(0.5 mCi/ml of medium; EXPRE35S35S protein labelling mix [New England
Nuclear Corp.]) and 2% dialyzed fetal bovine serum for 4 h. Cell
were lysed in 50 mM Tris (pH 8.0)-120 mM NaCl-0.5% Nonidet P-40
(NP-40) unless otherwise indicated.
Primer sets.
The primer sets used for plasmid construction
were as follows: A, 5'-CAGAGGATCCGCCACCATGGATGGGCTTCTGGTTAAC-3'
and 5'-AGCCGAATTCAGTCTTTCTGCACATTTGG-3'; B,
5'-CAGAGGATCCGCCACCATGGATGGGCTTCTGGTTAAC-3' and
5'-CGTTGAATTCAAATGCGATCCTGTGTCAG-3'; C,
5'-AGGTGGATCCTGGCTCTTCAGAGATGCCA-3' and
5'-CTGTCTAGAATTCAATCTTCGTAGAGCGACCTGACG-3'; D,
5'-AGGTGGATCCTGGCTCTTCAGAGATGCCA-3' and
5'-CTGTCTAGAATTCACCGGACAACCTGGAGGCATCG-3'; E,
5'-GCGCGGATCCGCCACCATGTCCCAGGTCATCTTCTGC-3' and
5'-CTGTGAATTCAAGGCTTGACTAGGCTCCG-3'; F,
5'-GCGCGGATCCGCCACCATGGAGCCGCAGCCCTACCCA-3' and
5'-CTGTGAATTCAAGGCTTGACTAGGCTCCG-3'; G,
5'-GCGCGGATCCAACAATTTTATCAAAAACCAAGAC-3' and
5'-CTACTTATGTCGATGCAGCGCACTTAAGCGCG-3'; H,
5'-GCGCAAGCTTGCC ACCATGGCTAGCATGACTGGTGGACAGCAAATGGGATCCATGGAT GGAGAGGAGAAAACC-3'
and 5'-GCGCAATTGGAGACCTTAACAATCTAAGAAGTTCGC-3'; and I,
5'-GCGCAAGCTTGGATCCGCCACCATGGACGTGTTTCTCATG-3' and
5'-GCGCGAATTCACTGCACAGCTTGTTC-3'.
Plasmids.
pRc/CMV was obtained from Invitrogen.
pcDNAI-HA-VHL, pRc/CMV-VHL(wt), and pRc/CMV-VHL(1-115), each of which
introduces an N-terminal hemagglutinin (HA) epitope tag, were described
previously (18). To make pRc/CMV-VHL(1-197) and
pRc/CMV-VHL(1-206), a human VHL cDNA was PCR amplified with primer sets
A and B, respectively. The PCR products were restricted with
Bst1107 and EcoRI and used to replace the
corresponding cDNA fragment in pcDNAI-HA-VHL. The resulting HA-VHL
cDNAs were then excised as HindIII-XbaI
fragments and cloned into pRc/CMV that had been linearized with these
two enzymes.
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Regulation of Hypoxia-Inducible mRNAs by the von Hippel-Lindau
Tumor Suppressor Protein Requires Binding to Complexes Containing
Elongins B/C and Cul2
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
/) renal carcinoma cells suppresses their ability to form tumors in nude mouse xenograft assays (11, 18).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
ZAP library (18). Positive clones were isolated, and
plasmids were rescued by in vivo excision according to the
manufacturer's instructions. Multiple independent, overlapping cDNA
clones were sequenced along both DNA strands and used to assemble a
consensus Cul2 cDNA sequence. Clone 16-1 contained the entire open
reading frame for human Cul2.
To make pGEX2TK-Cul2(491-745), a human Cul2 cDNA was PCR amplified with
primer set G. The PCR product was restricted with BamHI and
EcoRI and subcloned into pGEX2TK (Pharmacia PL) that had
been linearized with these two enzymes.
To make pcDNAIII-T7-elongin C, a human elongin C cDNA was PCR amplified
with primer set H. The PCR product, encoding a T7 epitope tag fused to
the N terminus of elongin C, was restricted with HindIII
and BsaI and subcloned into pcDNAIII (Invitrogen) that had
been linearized with HindIII and EcoRI.
To make the pGEX2TK-elongin C plasmids, a human elongin C cDNA was PCR
amplified with sense primers containing BamHI sites and
antisense primers containing either EcoRI sites or, for
fragments containing internal EcoRI sites, BsaAI
sites that had been designed to generate overhangs that were compatible
with EcoRI cohesive ends. The products were digested and
ligated into pGEX2TK that had been linearized with BamHI and
EcoRI.
To make pSP72-elongin B, a human elongin B cDNA was PCR amplified with
primer set I. The product was digested with BamHI and EcoRI and ligated into pSP72 (Promega) that had been cut
with these two enzymes.
All PCRs were performed with Pfu DNA polymerase
(Stratagene), and the regions of the final cDNAs generated by PCR were
confirmed by DNA sequence analysis. Site-directed VHL gene mutations
were confirmed by DNA sequence analysis.
Immunoprecipitation and immunoblotting. Immunoprecipitation and immunoblotting were performed as described previously (22). Immunoprecipitation was performed with approximately 1 µg of monoclonal antibody, and immunoprecipitates were washed five times with 20 mM Tris (pH 8.0)-900 mM NaCl-1 mM EDTA-0.5% NP-40 unless otherwise indicated prior to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis. Anti-Cul2 immunoblotting was performed with crude anti-Cul2 rabbit sera at a 1:100 dilution. Protein concentrations of whole-cell extracts were determined by the Bradford method and were used to normalize protein loading in whole-cell immunoblot assays.
Antibodies. Monoclonal anti-HA and anti-T7 antibodies were obtained from Boehringer Mannheim and Novagen, respectively. The polyclonal anti-Glut1 antibody GT-11A was obtained from Alpha Diagnostic. The monoclonal anti-VHL antibody IG32 and polyclonal anti-elongin B sera were described previously (8, 22). The anti-T-antigen monoclonal antibody pAB419 was used as a control (12). To generate polyclonal anti-Cul2 sera, GST-Cul2(491-745) was expressed in Escherichia coli, purified by preparative SDS-polyacrylamide gel electrophoresis, and injected into New Zealand White rabbits as previously described (18).
Peptide microsequence analysis. Isolation of p70 by preparative SDS-polyacrylamide gel electrophoresis, digestion with trypsin, and sequencing of tryptic peptides were performed as described previously (22).
In vitro translation. Coupled in vitro transcription and translation were performed with TNT reticulocyte lysate (Promega) according to the manufacturer's instructions.
Partial proteolytic peptide mapping. Partial proteolytic peptide mapping of radiolabelled Cul2 was performed precisely as described elsewhere (13).
Purification of pVHL complexes from rat liver. A postlysosomal supernatant was prepared from the livers of 360 male Sprague-Dawley rats and fractionated by (NH4)2SO4 precipitation as described previously (4). The 0 to 38% (NH4)2SO4 fraction was resuspended in buffer A (20 mM HEPES-NaOH [pH 7.9], 0.5 mM EDTA, 1 mM dithiothreitol [DTT], 10% [vol/vol] glycerol) containing 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 10 mg of antipain per ml, and 10 mg of leupeptin per ml and was brought to a conductivity equivalent to that of buffer A containing 100 mM KCl by a combination of 3 h of dialysis against buffer A containing 0.5 mM PMSF and of dilution with the same buffer. Following centrifugation for 30 min at 28,000 × g, the resulting supernatant was mixed with 800 ml of phosphocellulose (P11; Whatman) preequilibrated in buffer A containing 100 mM KCl and 0.5 mM PMSF. After 45 min, the slurry was filtered at 500 ml/h in a 10.5-cm-diameter column. The phosphocellulose flowthrough fraction was mixed with 250 ml of Toyopearl DEAE-650M (TosoHaas) preequilibrated in buffer C (40 mM Tris-HCl [pH 7.9], 0.5 mM EDTA, 1 mM DTT, 10% [vol/vol] glycerol) containing 80 mM KCl. After 45 min, the slurry was filtered at 150 ml/h in a 5.0-cm-diameter column and then was washed at the same flow rate with buffer C containing 80 mM KCl. The column contents were eluted stepwise at 250 ml/h with buffer A containing 220 mM KCl, and 50-ml fractions were collected. Fractions containing pVHL were concentrated by 0.3 mg/ml (NH4)2SO4 precipitation, resuspended in 10 ml of buffer A containing 10 mg of antipain per ml and 10 mg of leupeptin per ml, and dialyzed against buffer A containing 300 mM KCl to a conductivity equivalent to that of buffer A containing 500 mM (NH4)2SO4. Following centrifugation for 15 min at 12,000 × g, the resulting supernatant was applied at 20 ml/h to a 500-ml, 2.6-cm-diameter Ultrogel AcA34 gel filtration column (IBF Biotechnics) preequilibrated with buffer A containing 400 mM KCl. The column contents were eluted at 20 ml/h, and 10-ml fractions were collected. Fractions containing pVHL, which eluted with an apparent native molecular mass of between 330 and 200 kDa, were diluted with an equal volume of buffer E (40 mM HEPES-NaOH [pH 7.9], 0.1 mM EDTA, 1 mM DTT, 10% [vol/vol] glycerol) containing 2.0 M (NH4)2SO4. Following centrifugation for 20 min at 60,000 × g, the resulting supernatant was applied to a Spherogel TSK phenyl 5-PW column (21.5 by 150 mm; Beckman Instruments) preequilibrated with buffer E containing 1.0 M (NH4)2SO4.
The column contents were eluted at 5 ml/min with a linear gradient of 250 ml of 1.0 M (NH4)2SO4 in buffer E to no (NH4)2SO4 in buffer E, and 5-ml fractions were collected. Fractions containing pVHL, which eluted at between 170 and 80 mM (NH4)2SO4, were pooled and dialyzed against buffer C to a conductivity equivalent to that of buffer C containing 60 mM KCl. Following centrifugation for 20 min at 60,000 × g, the resulting supernatant was applied to a Bio-Gel SEC DEAE 5-PW column (7.5 by 75 mm; Bio-Rad) preequilibrated with buffer C containing 60 mM KCl. The column contents were eluted at 0.8 ml/min with a 40-ml linear gradient of 60 to 250 mM KCl in buffer C, and 0.7-ml fractions were collected. Fractions containing pVHL, which eluted at between 120 and 140 mM KCl, were pooled and brought to 5 mM potassium phosphate. Following centrifugation for 20 min at 60,000 × g, the resulting supernatant was applied to a crystalline hydroxylapatite Bio-Scale CHT-I column (7 by 52 mm; Bio-Rad) preequilibrated with buffer P (5 mM potassium phosphate [pH 7.6], 0.1 mM EDTA, 1 mM DTT, 10% [vol/vol] glycerol). The column contents were eluted at 0.6 ml/min with a 24-ml linear gradient of 50 to 400 mM potassium phosphate (pH 7.6) in buffer P, and 0.3-ml fractions were collected. Fractions containing pVHL, which eluted at between 50 and 80 mM potassium phosphate, were pooled and diluted with buffer C containing 50 mM KCl to a conductivity equivalent to that of buffer C containing 80 mM KCl. Following centrifugation for 20 min at 60,000 × g, the resulting supernatant was applied to a Mono Q column (5 by 50 mm; Pharmacia) preequilibrated with buffer C containing 80 mM KCl. The column contents were eluted at 0.4 ml/min with a 12-ml linear gradient of 80 to 300 mM KCl in buffer C, and 0.2-ml fractions were collected. Fractions containing pVHL eluted at between 180 and 200 mM KCl.GST pull-down assay. Approximately 1 µg of glutathione S-transferase (GST)-elongin C fusion protein, as determined by Coomassie blue staining, and 5 µl of elongin B in vitro translate were incubated in 500 µl of NETN (20 mM Tris-HCl [pH 8.0], 120 mM NaCl, 1 mM EDTA, 0.5% NP-40) for 1 h at 4°C with rocking. Twenty-five microliters of glutathione-Sepharose (1:1 in NETN supplemented with 0.5% milk) was then added. After 30 min of incubation, the glutathione-Sepharose was washed five times with NETN. Bound proteins were eluted by boiling in SDS-containing sample buffer, resolved by electrophoresis in SDS-15% polyacrylamide gels, and detected by fluorography.
Northern blot analysis. RNA was extracted from nearly confluent monolayer cultures in RNAzol B (Tel-Test, Inc.) according to the manufacturer's protocol. Ten micrograms of total RNA was denatured in a solution containing 20 mM MOPS [3-(N-morpholino)propanesulfonic acid], 6.3% formaldehyde, and 48% formamide, resolved in a 1% agarose-2.2 mM formaldehyde gel in 20 mM MOPS-5 mM sodium acetate-1 mM EDTA (pH 8) (in the presence of ethidium bromide), and transferred to a Zeta-Probe GT nylon membrane (Bio-Rad) in 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). To detect the Glut1 mRNA, the membrane was hybridized with a radiolabelled oligonucleotide complementary to a region encoding the intracellular C-terminal domain of the Glut1 protein (5'-GCTCCTCGGGTGTCTTATCACTTTG-3') in a solution containing 0.655 M NaCl, 50 mM Na2HPO4 (pH 7.2), 7% SDS, 10 mg of bovine serum albumin per ml, and 25 mg of polyadenylic acid per ml. The membrane was washed in 2× SSC-1% SDS at 50°C twice for 30 min each time, followed by a wash with 0.5× SSC-0.1% SDS at 50°C for 2 min. To detect the VEGF mRNAs, the membrane was hybridized with a radiolabelled VEGF121 cDNA (a gift from Mark Goldberg) in a solution containing 50 mM Tris (pH 7.5), 1 M NaCl, 1% SDS, 10% dextran sulfate, 50% formamide, and 100 mg of herring sperm DNA per ml. The membrane was washed twice in 2× SSC-0.2% SDS at 25°C for 30 min each time, twice in 1× SSC-0.2% SDS at 25°C for 15 min each time, and finally in 0.5× SSC-0.2% SDS at 65°C for 15 min.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
To look for pVHL-binding proteins, 786-O [VHL (/)], renal
carcinoma cells that were stably transfected with a plasmid encoding HA-tagged pVHL (Fig.
1A, lanes 3 and 4) or
the backbone expression plasmid (Fig. 1A, lanes 1 and 2) were
metabolically labelled with [35S]methionine, lysed,
and immunoprecipitated with an anti-HA antibody (Fig. 1A, lanes 2 and
4) or a control antibody (Fig. 1A, lanes 1 and 3) under stringent
conditions. Bound proteins were detected by autoradiography (Fig. 1A)
or immunoblot analysis (Fig. 1C). pVHL coimmunoprecipitated with
cellular proteins with molecular masses of ~200, 70, 18, and 15 kDa
(compare Fig. 1A, lane 4, to lanes 2 and 3). These proteins were also
detected in monoclonal and polyclonal anti-VHL immunoprecipitates but
not in isotype-matched control immunoprecipitates (data not shown). The
18- and 15-kDa proteins were shown previously to be elongins B and C,
respectively (6, 22, 24). The characterization of p200 will
be described elsewhere.
|
p70 was purified by preparative anti-HA immunoelectrophoresis and
subjected to microsequence analysis following tryptic digestion. Three
peptide sequences that were present in the conceptual open reading
frame of the human Cul2 gene were obtained (23).
A full-length human Cul2 cDNA clone was isolated by screening a cDNA
library with the available partial human Cul2 cDNA clone and was
translated in vitro. The major Cul2 in vitro translation product
comigrated with p70 (Fig. 1A, compare lanes 4 and 5), and the partial
proteolytic peptide maps of these two proteins generated with
-chymotrypsin (Fig. 1B) and Staphylococcus aureus V8
protease (data not shown) were identical. In some experiments,
translation of Cul2, whether in vitro or in vivo, also gave rise to a
second band that migrated more slowly in SDS-polyacrylamide gels (see,
for example, Fig. 1C and 4). The nature of this second band is
currently under investigation. Finally, both p70 and the Cul2 in vitro
translation product were specifically recognized by a polyclonal
anti-Cul2 antibody in Western blot assays (Fig. 1C). Thus, pVHL, at
least when overproduced, can bind to human Cul2. While these
experiments were in progress, the same conclusion was reported by Pause
and coworkers (38).
To ask whether pVHL and Cul2 might associate under physiological conditions, 293 human embryonic kidney cells containing endogenous, wild-type pVHL (18, 22) were immunoprecipitated with anti-VHL antibody or a control antibody (Fig. 2A). The stable transfectants described above were analyzed in parallel. As expected, anti-VHL but not control 293 cell immunoprecipitates contained wild-type pVHL, as determined by anti-VHL immunoblot analysis (Fig. 2A, compare lanes 5 and 6). Two species of pVHL (pVHL30 and pVHL19) were detected in these and other cells (data not shown). pVHL19 results from translation initiation at an internal methionine codon (17a). In addition, anti-Cul2 immunoblot analysis confirmed the presence of Cul2 specifically in the anti-VHL immunoprecipitate (compare Fig. 2A, lane 5, to lanes 4 and 6). The available anti-Cul2 sera do not immunoprecipitate Cul2 efficiently from mammalian cell extracts (data not shown). Thus, the reciprocal experiment, in which an anti-Cul2 immunoprecipitate would be analyzed for the presence of pVHL, cannot yet be performed.
|
In addition, a stable multiprotein complex containing endogenous pVHL, Cul2, and elongins B and C could be extensively purified from rat liver cytosolic extracts according to the procedure outlined in Fig. 2B. Analysis of column fractions from the final two steps in the purification of this complex revealed close cochromatographic elution of pVHL with Cul2 and elongin B (Fig. 2C and D) as well as elongin C (data not shown). The coimmunoprecipitation and chromatographic data, taken together, suggest that pVHL-Cul2 complexes exist naturally in cells.
The minimal region of pVHL capable of binding to elongins B and C, at least in vitro, corresponds to residues 157 to 172 (22, 24). To map the region of pVHL required for binding to Cul2, 786-O subclones that stably produced N-terminal HA epitope-tagged pVHL mutants were metabolically labelled with [35S]methionine, lysed, and immunoprecipitated with an anti-HA antibody under stringent conditions (Fig. 3A). Comparable recovery of each of the pVHL mutants was confirmed by anti-HA immunoblot analysis (Fig. 3A, middle panel). Elongins B and C were detected by autoradiography (lower panel), and Cul2 was detected by anti-Cul2 immunoblot analysis (upper panel). In keeping with the earlier in vitro mapping studies, pVHL(1-197) and pVHL(94-213) retained the ability to bind to elongins B and C, whereas pVHL(1-167) did not. pVHL(1-187), surprisingly, did not stably associate with elongins B and C, suggesting that residues C terminal to pVHL residue 172 contribute to elongin B and C binding in vivo. The ability of pVHL to bind to Cul2 mirrored its ability to bind to elongins B and C in these assays (compare upper and lower panels in Fig. 3A).
|
pVHL(157-172), a synthetic peptide, blocks the binding of pVHL to elongins B and C in vitro (22). Scanning mutagenesis of this peptide, in which single amino acid residues were converted to either alanine or a residue corresponding to a tumor-derived mutation, suggested that T157, L158, and C162 were likely to form critical contacts between pVHL and the elongins (4a). We therefore generated stable 786-O renal carcinoma subclones that ectopically produced HA-tagged versions of pVHL(L158S), pVHL(C162F), or pVHL(157-162NAAIRS). The former two correspond to naturally occuring VHL gene mutations (48). The latter replaces pVHL residues 157 to 162 with the sequence NAAIRS, which is believed to be highly flexible based on its appearance in both alpha-helical and beta-sheet structures (34, 46). These three mutants were, as expected, unable to bind to elongins B and C (Fig. 3B and data not shown). In addition, none of these mutants bound to Cul2.
pVHL binding to elongins B and C appeared, based on these studies, to be necessary and sufficient for binding to Cul2, raising the possibility that Cul2 can bind to elongins B and C in the absence of pVHL. To test this hypothesis, 786-O cells that stably produced a T7 epitope-tagged version of elongin C were immunoprecipitated with an anti-T7 antibody or a control antibody (Fig. 4). In parallel, 786-O cells that stably produced HA-pVHL were immunoprecipitated with an anti-HA antibody or a control antibody. Bound proteins were detected by anti-Cul2 (Fig. 4, upper panel), anti-HA (middle panel), or anti-T7 (lower panel) immunoblot analysis. Cul2 coimmunoprecipitated with elongin C (compare Fig. 4, lane 5, to lanes 4 and 6). As 786-O cells lack endogenous, wild-type pVHL, this result suggests that elongin C can, at least indirectly, bind to Cul2 in the absence of pVHL.
|
Cul2 and elongin C share significant sequence similarity with Saccharomyces cerevisiae proteins Cdc53 and Skp1, respectively (Fig. 5 and 6) (see Discussion) (2, 38). The potential significance of the elongin C similarity to Skp1 is underscored by the following observation. A peptide containing elongin C residues 18 to 50, produced as either a GST fusion protein (Fig. 6) or a synthetic peptide (data not shown), was sufficient to bind to elongin B. An earlier study had shown that elongin C residues 21 to 30 were necessary for binding to elongin B (42). Thus, the region of highest similarity between elongin C and Skp1, corresponding to elongin C residues 18 to 50, is a functional domain.
|
|
pVHL plays a critical role in the degradation of hypoxia-inducible mRNAs (11, 16). Consequently, cells lacking pVHL overproduce proteins such as VEGF and the Glut1 glucose transporter, which are both encoded by hypoxia-inducible mRNAs (11, 16, 37, 41). To determine whether this activity might be linked to the ability of pVHL to bind to elongins and Cul2, 786-O subclones producing the various pVHL mutants described above were tested for Glut1 protein production by steady-state anti-Glut1 immunoblot analysis (Fig. 7). Three or more independent clones were tested for each pVHL mutant. In parallel, total RNA was harvested from representative clones and analyzed for Glut1 and VEGF mRNA abundance by Northern blot analysis (Fig. 8). It was shown previously that the inhibition of VEGF mRNA accumulation by pVHL leads to a commensurate decrease in VEGF protein production (11, 16, 41).
|
|
Wild-type pVHL, as expected, inhibited Glut1 and VEGF expression,
whereas pVHL(1-167) did not (Fig. 7 and 8). Similar results were
obtained following the reintroduction of wild-type pVHL and pVHL(1-167)
into A498 VHL (/) renal carcinoma cells (data not shown).
pVHL(1-197), which did not bind to p200 (data not shown) but which
retained the ability to bind to elongins B and C and Cul2 (Fig. 3A),
also inhibited Glut1 and VEGF expression (Fig. 7 and 8). These results
suggested that the binding of pVHL to elongins and Cul2 might be linked
to its ability to regulate Glut1 and VEGF. In keeping with this view,
all of the missense mutants that were unable to bind to elongins and
Cul2 were likewise unable to inhibit Glut1 and VEGF mRNA
accumulation. Some, but not all, clones producing pVHL(72-213) produced
levels of Glut1 comparable to those produced by cells producing
wild-type pVHL. The reason for this clonal variation is unclear (shown
in Fig. 7 and 8 are data for clones in which Glut1 production was
inhibited). Finally, pVHL(94-213), although able to bind to elongins
and Cul2, was unable to inhibit Glut1 and VEGF expression (Fig. 7 and
8). The simplest interpretation of these data, summarized in Fig.
9, is that binding to elongins and Cul2
is necessary but not sufficient for pVHL to regulate hypoxia-inducible
genes.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
We found that pVHL, when overproduced in cells, forms complexes that contain elongin B, elongin C, and Cul2. While the manuscript was in preparation, similar conclusions were reached by Pause and coworkers (38). Our work confirms and extends these observations by providing evidence that these complexes form under native conditions and, more importantly, by linking the formation of these complexes to a biological activity, namely, the previously described ability of pVHL to regulate hypoxia-inducible mRNAs.
Furthermore, we provide evidence that Cul2 can bind, at least indirectly, to elongin C in the absence of pVHL. This observation can account for the earlier observation that Cul2 does not bind to pVHL in the absence of elongin C in vitro (38). Specifically, in the simplest model, Cul2 binds to elongin C which, in turn, binds directly to pVHL (6). Importantly, the pVHL elongin-binding domain is a hot spot for naturally occurring mutations in VHL kindreds, and ~70% of the VHL-associated mutations characterized to date would be predicted to abrogate elongin binding (22, 24, 48). Thus, the available genetics suggest that binding to elongin-Cul2 complexes contributes to the ability of pVHL to suppress tumor growth in vivo. Conceivably, this property is due, at least in part, to the ability of pVHL, when bound to elongins and Cul2, to suppress hypoxia-inducible mRNAs.
How might binding to elongins and Cul2 contribute to the regulation of hypoxia-inducible mRNA stability by pVHL? One clue may come from a careful inspection of the primary sequences of Cul2 and the elongins. Targeted proteolysis of proteins by ubiquitin requires the concerted action of an E1 ubiquitin-activating enzyme, an E2 ubiquitin-conjugating enzyme and, at least in some cases, an E3 ubiquitin ligase (15, 19). Cdc53, a putative E3 protein, forms complexes which contain Skp1, Cdc34 (an E2 protein), and an F-box protein (so called because of apparent homology to cyclin F), such as Grr1 or Cdc4 (Fig. 10). These complexes target proteins such as G1 cyclins (or Clns) as well as cyclin-dependent kinase inhibitors, such as Sic1, for ubiquitin-mediated proteolysis (15, 19).
|
Cul2 appears to be a homolog of Cdc53 (Fig. 5) and is a member of a family of putative E3-like ubiquitin ligases (23, 38). Likewise, elongin C, as first reported by Bai and coworkers, contains a region that is homologous to Skp1 (Fig. 6), and elongin A is an F-box protein (2). Finally, elongin B, although not a recognizable E2 protein, contains a region which, as first reported by Garrett and coworkers (8), is similar to ubiquitin. The potential significance of these homologies is underscored by the observation that the minimal region of elongin C capable of binding to elongin B (elongin C residues 18 to 50) corresponds to the region of greatest similarity between elongin C and Skp1 (Fig. 6) (2).
Thus, one model, which remains to be tested, is that complexes containing Cul2 and elongins B and C target certain proteins for ubiquitin-dependent proteolysis. A more speculative model, given that elongin B contains a ubiquitin-like domain, is that elongin B itself becomes covalently linked to certain proteins, such as has been observed for the ubiquitinlike protein named either GMP1, SUMO-1, or Sentrin (20, 33). In either case, pVHL competes with elongin A in vitro for binding to elongins B and C (6). Furthermore, we have thus far been unable to detect complexes containing elongin A and Cul2 in native cell extracts (data not shown). Therefore, one might hypothesize that the function of elongins B and C, when bound to pVHL and Cul2, is different from their function when they are bound to elongin A (Fig. 10). As a corollary, these data raise the possibility that the previously described ability of pVHL to inhibit transcriptional elongation by elongin A in vitro is not responsible for its ability to suppress tumor growth in vivo.
What proteins are the likely downstream targets of Cul2? Levy and
coworkers identified RNA-binding proteins that interact specifically
with the 3' untranslated regions of hypoxia-inducible mRNAs
(29, 30). Significantly, these proteins appear to stabilize these mRNAs. In VHL (+/+) cells, these proteins are detectable with
RNA gel shift assays under hypoxic conditions but not normoxic conditions. In contrast, these proteins are detectable in VHL (/) cells under both hypoxic and normoxic conditions, perhaps accounting for the failure of VHL (/) cells to properly degrade the
mRNAs under normoxic conditions (29). Thus, Cul2 may,
directly or indirectly, affect the stability or function of these
mRNA-binding proteins. There is precedence for complexes containing
Cdc53 and Cdc34 playing a role in nutritional or environmental
adaptation. For example, under nutritionally replete conditions, Cdc34
is required for the ubiquitin-dependent proteolysis of the
transcription factor Gcn4, which is required for amino acid
biosynthesis (25). Under conditions of nutritional
starvation, however, Gcn4 becomes stabilized (25).
A loss of cul1 in Caenorhabditis elegans leads to
hyperplasia in certain cell lineages, perhaps due to a failure to exit
the cell cycle (23). To our knowledge, the phenotype of
cul2 / C. elegans has not been reported.
Given the apparent role of Cdc53 in the regulation of Cln2 and Sic1,
one might speculate that cul2 also plays a role in cell
cycle control (15, 19). pVHL does not grossly affect the
cell cycle control of renal carcinoma cells in vitro (11,
18). Whether it might do so under certain experimental conditions, however, remains to be determined. In any event, control of
the cell cycle and responses to environmental stress clearly need not
be mutually exclusive activities.
pVHL inhibits both the stability of hypoxia-inducible mRNAs and tumor cell growth in vivo. For the first time, we have now linked the former to a biochemical activity, namely, the ability to form complexes which contain elongin B, elongin C, and Cul2. Clearly, determining the degree to which tumor suppression likewise relies upon this activity is an important question for the future. Similarly, it will be important to determine if Cul2, as suspected, acts as an E3 protein. If so, it will be essential to identify its downstream targets and to ascertain how its behavior is modulated by complex formation with pVHL.
| |
ACKNOWLEDGMENTS |
|---|
We thank Stephen Elledge, Sushant Kuman, and Pengbo Zhou for critical reading of the manuscript and for useful discussions and Edward Kipreos for the human Cul2 partial cDNA. In particular, we thank Stephen Elledge for bringing the similarity of Skp1 to elongin C and the presence of an F box in elongin A to our attention. We thank our colleagues in the Kaelin laboratory for many helpful comments.
This work was supported by grants from the National Institutes of Health (to W.G.K. and J.W.C.), the Oklahoma Medical Research Foundation (to J.W.C.), the MRC of Canada (to M.O.), the VHL Family Alliance and the Murray Foundation (to O.I.), the H. A. and Mary K. Chapman Trust (to J.W.C.), and Novartis Pharmaceuticals (to W.G.K.). J.W.C. is an Associate Investigator of the Howard Hughes Medical Institute.
Kim M. Lonergan and Othon Iliopoulos contributed equally to this work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Dana-Farber Cancer Institute and Brigham and Women's Hospital, Harvard Medical School, 44 Binney St., Mayer 657, Boston, MA 02115. Phone: (617) 632-3975. Fax: (617) 632-4381. E-mail: william_kaelin{at}dfci.harvard.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Aso, T., D. Haque, R. Barstead, R. Conaway, and J. Conaway. 1996. The inducible elongin A elongation activation domain: structure, function and interaction with elongin BC complex. EMBO J. 15:101-110. |
| 2. | Bai, C., P. Sen, K. Hofmann, L. Ma, M. Goebl, J. W. Harper, and S. J. Elledge. 1996. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86:263-274[Medline]. |
| 3. | Berse, B., L. Brown, V. Livingston, H. Dvorak, and D. Senger. 1992. Vascular permeability factor (vascular endothelial growth factor) gene is expressed differentially in normal tissues, macrophages, and tumors. Mol. Biol. Cell 3:211-220[Abstract]. |
| 4. | Conaway, R., D. Reines, K. Garrett, W. Powell, and J. Conaway. 1996. Purification of RNA polymerase II general transcription factors from rat liver. Methods Enzymol. 273:194-207[Medline]. |
| 4a. | Conaway, R. C., J. W. Conaway, and W. G. Kaelin, Jr. Unpublished data. |
| 5. | Corless, C. L., A. Kibel, O. Iliopoulos, and W. G. Kaelin. 1997. Immunostaining of the von Hippel-Lindau gene product (pVHL) in normal and neoplastic human tissues. Hum. Pathol. 28:459-464[Medline]. |
| 6. |
Duan, D. R.,
A. Pause,
W. Burgress,
T. Aso,
D. Y. T. Chen,
K. P. Garrett,
R. C. Conaway,
J. W. Conaway,
W. M. Linehan, and R. D. Klausner.
1995.
Inhibition of transcriptional elongation by the VHL tumor suppressor protein.
Science
269:1402-1406 |
| 7. |
Foster, K.,
A. Prowse,
A. van den Berg,
S. Fleming,
M. M. F. Hulsbeek,
P. A. Crossey,
F. M. Richards,
P. Cairns,
N. A. Affara,
M. A. Ferguson-Smith,
C. H. C. M. Buys, and E. R. Maher.
1994.
Somatic mutations of the von Hippel-Lindau disease tumor suppressor gene in non-familial clear cell renal carcinoma.
Hum. Mol. Genet.
3:2169-2173 |
| 8. |
Garrett, K.,
T. Aso,
J. Bradsher,
S. Foundling,
W. Lane,
R. Conaway, and J. Conaway.
1995.
Positive regulation of general transcription factor SIII by a tailed ubiquitin homolog.
Proc. Natl. Acad. Sci. USA
92:7172-7176 |
| 9. | Gnarra, J. R., D. R. Duan, Y. Weng, J. S. Humphrey, D. Y. T. Chen, S. Lee, A. Pause, C. F. Dudley, F. Latif, I. Kuzmin, L. Schmidt, F.-M. Duh, T. Stackhouse, F. Chen, T. Kishida, M. H. Wei, M. I. Lerman, B. Zbar, R. D. Klausner, and W. M. Linehan. 1996. Molecular cloning of the von Hippel-Lindau tumor suppressor gene and its role in renal cell carcinoma (review). Biochim. Biophys. Acta 1242:201-210[Medline]. |
| 10. | Gnarra, J. R., K. Tory, Y. Weng, L. Schmidt, M. H. Wei, H. Li, F. Latif, S. Liu, F. Chen, F.-M. Duh, I. Lubensky, D. R. Duan, C. Florence, R. Pozzatti, M. M. Walther, N. H. Bander, H. B. Grossman, H. Brauch, S. Pomer, J. D. Brooks, W. B. Isaacs, M. I. Lerman, B. Zbar, and W. M. Linehan. 1994. Mutations of the VHL tumour suppressor gene in renal carcinoma. Nature Genet. 7:85-90[Medline]. |
| 11. |
Gnarra, J. R.,
S. Zhou,
M. J. Merrill,
J. Wagner,
A. Krumm,
E. Papavassiliou,
E. H. Oldfield,
R. D. Klausner, and W. M. Linehan.
1996.
Post-transcriptional regulation of vascular endothelial growth factor mRNA by the VHL tumor suppressor gene product.
Proc. Natl. Acad. Sci. USA
93:10589-10594 |
| 12. |
Harlow, E.,
L. V. Crawford,
D. C. Pim, and N. M. Williamson.
1981.
Monoclonal antibodies specific for simian virus 40 tumor antigens.
J. Virol.
39:861-869 |
| 13. |
Harlow, E., and D. Lane.
1988.
.
Antibodies a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 14. |
Herman, J. G.,
F. Latif,
Y. Weng,
M. I. Lerman,
B. Zbar,
S. Liu,
D. Samid,
D.-S. R. Duan,
J. R. Gnarra,
W. M. Linehan, and S. B. Baylin.
1994.
Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma.
Proc. Natl. Acad. Sci. USA
91:9700-9704 |
| 15. | Hopkin, K. 1997. Regulating cellular processes: the power of protein degradation. J. NIH Res. 9:36-42. |
| 16. |
Iliopoulos, O.,
C. Jiang,
A. P. Levy,
W. G. Kaelin, and M. A. Goldberg.
1996.
Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein.
Proc. Natl. Acad. Sci. USA
93:10595-10599 |
| 17. | Iliopoulos, O., and W. G. Kaelin. 1997. The molecular basis of von Hippel-Lindau disease. Mol. Med. 3:289-293[Medline]. |
| 17a. | Iliopoulos, O., and W. G. Kaelin, Jr. Unpublished data. |
| 18. | Iliopoulos, O., A. Kibel, S. Gray, and W. G. Kaelin. 1995. Tumor suppression by the human von Hippel-Lindau gene product. Nature Med. 1:822-826[Medline]. |
| 19. | Jackson, P. K. 1996. Cell cycle: cull and destroy. Curr. Biol. 6:1209-1212[Medline]. |
| 20. |
Kamitani, T.,
H. P. Nguyen, and E. T. H. Yeh.
1997.
Preferential modification of nuclear proteins by a novel ubiquitin-like molecule.
J. Biol. Chem.
272:14001-14004 |
| 21. |
Kanno, H.,
K. Kondo,
S. Ito,
I. Yamamoto,
S. Fujii,
S. Torigoe,
N. Sakai,
M. Hosaka,
T. Shuin, and M. Yao.
1994.
Somatic mutations of the von Hippel-Lindau tumor suppressor gene in sporadic central nervous system hemangioblastomas.
Cancer Res.
54:4845-4847 |
| 22. |
Kibel, A.,
O. Iliopoulos,
J. D. DeCaprio, and W. G. Kaelin.
1995.
Binding of the von Hippel-Lindau tumor suppressor protein to elongin B and C.
Science
269:1444-1446 |
| 23. | Kipreos, E. T., L. E. Lander, J. P. Wing, W. W. He, and E. M. Hedgecock. 1996. cul-1 is required for cell cycle exit in C. elegans and identifies a novel gene family. Cell 85:829-839[Medline]. |
| 24. |
Kishida, T.,
T. M. Stackhouse,
F. Chen,
M. I. Lerman, and B. Zbar.
1995.
Cellular proteins that bind the von Hippel-Lindau disease gene product: mapping of binding domains and the effect of missense mutations.
Cancer Res.
55:4544-4548 |
| 25. | Kornitzer, D., B. Raboy, R. G. Kulka, and G. R. Fink. 1994. Regulated degradation of the transcription factor Gcn4. EMBO J. 13:6021-6030[Medline]. |
| 26. |
Koura, A. N.,
W. Liu,
Y. Kitadai,
R. K. Singh,
R. Radinsky, and L. M. Ellis.
1996.
Regulation of vascular endothelial growth factor expression in human colon carcinoma cells by cell density.
Cancer Res.
56:3891-3894 |
| 27. |
Latif, F.,
K. Tory,
J. Gnarra,
M. Yao,
F.-M. Duh,
M. L. Orcutt,
T. Stackhouse,
I. Kuzmin,
W. Modi,
L. Geil,
L. Schmidt,
F. Zhou,
H. Li,
M. H. Wei,
F. Chen,
G. Glenn,
P. Choyke,
M. M. Walther,
Y. Weng,
D.-S. R. Duan,
M. Dean,
D. Glavac,
F. M. Richards,
P. A. Crossey,
M. A. Ferguson-Smith,
D. L. Pasiler,
I. Chumakov,
D. Cohen,
A. C. Chinault,
E. R. Maher,
W. M. Linehan,
B. Zbar, and M. I. Lerman.
1993.
Identification of the von Hippel-Lindau disease tumor suppressor gene.
Science
260:1317-1320 |
| 28. |
Lee, S.,
D. Y. T. Chen,
J. S. Humphrey,
J. R. Gnarra,
W. M. Linehan, and R. D. Klausner.
1996.
Nuclear/cytoplasmic localization of the von Hippel-Lindau tumor suppressor gene product is determined by cell density.
Proc. Natl. Acad. Sci. USA
93:1770-1775 |
| 29. |
Levy, A. P.,
N. S. Levy, and M. A. Goldberg.
1996.
Hypoxia-inducible protein binding to vascular endothelial growth factor mRNA and its modulation by the von Hippel-Lindau protein.
J. Biol. Chem.
271:25492-25497 |
| 30. | Levy, A. P., N. S. Levy, O. Iliopoulos, C. Jiang, W. G. Kaelin, and M. A. Goldberg. 1997. Regulation of vascular endothelial growth factor by hypoxia and its modulation by the von Hippel-Lindau tumor suppressor gene. Kidney Int. 51:575-578[Medline]. |
| 31. | Los, M., G. H. Jansen, W. G. Kaelin, C. J. M. Lips, G. H. Blijham, and E. E. Voest. 1996. Expression pattern of the von Hippel-Lindau protein in human tissues. Lab. Invest. 75:231-238[Medline]. |
| 32. | Lubensky, I. A., J. R. Gnarra, P. Bertheau, M. M. Walther, W. M. Linehan, and Z. Zhuang. 1996. Allelic deletions of the VHL gene detected in multiple microscopic clear cell renal lesions in von Hippel-Lindau disease patients. Am. J. Pathol. 149:2089-2094[Abstract]. |
| 33. | Mahajan, R., C. Delphin, T. Guan, L. Gerace, and F. Melchior. 1997. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88:97-107[Medline]. |
| 34. |
Marsilio, E.,
S. H. Cheng,
B. Schaffhausen,
E. Paucha, and D. M. Livingston.
1991.
The T/t common region of simian virus 40 large T antigen contains a distinct transformation-governing sequence.
J. Virol.
65:5647-5652 |
| 35. | McKusick, V. A. 1992. . Mendelian inheritance in man. The Johns Hopkins University Press, Baltimore, Md. |
| 36. | Morii, K., R. Tanaka, K. Washiyama, T. Kumanishi, and R. Kuwano. 1993. Expression of vascular endothelial growth factor in capillary hemangioblastoma. Biochem. Biophys. Res. Commun. 194:749-755[Medline]. |
| 37. | Mukhopadhyay, D., B. Knebelmann, H. Cohen, S. Ananth, and V. Sukhatme. 1997. The von Hippel-Lindau tumor suppressor gene product interacts with Sp1 to repress vascular endothelial growth factor promoter activity. Mol. Cell. Biol. 17:5629-5639[Abstract]. |
| 38. |
Pause, A.,
S. Lee,
R. A. Worrell,
D. Y. T. Chen,
W. H. Burgess,
W. M. Linehan, and R. D. Klausner.
1997.
The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins.
Proc. Natl. Acad. Sci. USA
94:2156-2161 |
| 39. | Sato, K., K. Terada, T. Sugiyama, S. Takahashi, M. Saito, M. Moriyama, H. Kakinuma, Y. Suzuki, M. Kato, and T. Kato. 1994. Frequent overexpression of vascular endothelial growth factor gene in human renal cell carcinoma. Tohoku J. Exp. Med. 173:355-360[Medline]. |
| 40. |
Shuin, T.,
K. Kondo,
S. Torigoe,
T. Kishida,
Y. Kubota,
M. Hosaka,
Y. Nagashima,
H. Kitamura,
F. Latif,
B. Zbar,
M. I. Lerman, and M. Yao.
1994.
Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas.
Cancer Res.
54:2852-2855 |
| 41. |
Siemeister, G.,
K. Weindel,
K. Mohrs,
B. Barleon,
G. Martiny-Baron, and D. Marme.
1996.
Reversion of deregulated expression of vascular endothelial growth factor in human renal carcinoma cells by von Hippel-Lindau tumor suppressor protein.
Cancer Res.
56:2299-2301 |
| 42. |
Takagi, Y.,
R. Conaway, and J. Conaway.
1996.
Characterization of elongin C functional domain required for interaction with elongin B and activation of elongin A.
J. Biol. Chem.
271:1-7 |
| 43. |
Takahashi, A.,
H. Sasaki,
S. Kim,
K. Tobisu,
T. Kakizoe,
T. Tsukamoto,
Y. Kumamoto,
T. Sugimura, and M. Terada.
1994.
Markedly increased amounts of messenger RNAs for vascular endothelial growth factor and placenta growth factor in renal cell carcinoma associated with angiogenesis.
Cancer Res.
54:4233-4237 |
| 44. |
Tsuchiya, H.,
T. Iseda, and O. Hino.
1996.
Identification of a novel protein (VBP-1) binding to the von Hippel-Lindau (VHL) tumor suppressor gene product.
Cancer Res.
56:2881-2885 |
| 45. | Whaley, J. M., J. Naglich, L. Gelbert, Y. E. Hsia, J. M. Lamiell, J. S. Green, D. Collins, H. P. H. Neumann, J. Laidlaw, F. P. Li, A. J. P. Klein-Szanto, B. R. Seizinger, and N. Kley. 1994. Germ-line mutations in the von Hippel-Lindau tumor suppressor gene are similar to somatic von Hippel-Lindau aberrations in sporadic renal cell carcinoma. Am. J. Hum. Genet. 55:1092-1102[Medline]. |
| 46. |
Wilson, I. A.,
D. H. Haft,
E. D. Getzoff,
J. A. Tainer,
R. A. Lerner, and S. Brenner.
1985.
Identical short peptide sequences in unrelated proteins can have different conformations: a testing ground for theories of immune recognition.
Proc. Natl. Acad. Sci. USA
82:5255-5259 |
| 47. |
Wizigmann-Voos, S.,
G. Breier,
W. Risau, and K. Plate.
1995.
Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.
Cancer Res.
55:1358-1364 |
| 48. | Zbar, B., T. Kishida, F. Chen, L. Schmidt, E. R. Maher, F. M. Richards, P. A. Crossey, A. R. Webster, N. A. Affara, M. A. Ferguson-Smith, H. Brauch, D. Glavac, H. P. H. Neumann, S. Tisherman, J. J. Mulvihill, D. Gross, T. Shuin, J. Whaley, B. Seizinger, N. Kley, S. Olschwang, C. Boisson, S. Richard, C. H. M. Lips, M. W. Linehan, and M. Lerman. 1996. Germline mutations in the von Hippel-Lindau (VHL) gene in families from North America, Europe, and Japan. Hum. Mutat. 8:348-357[Medline]. |
| 49. | Zhuang, Z., P. Bertheau, M. Emmert-Buck, L. Liotta, J. Gnarra, W. Linehan, and I. Lubensky. 1995. A microscopic dissection technique for archival DNA analysis of specific cell populations in lesions < 1mm in size. Am. J Pathol. 146:620-625[Abstract]. |
Mol Cell Biol, February 1998, p. 732-741, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gergics, P., Patocs, A., Toth, M., Igaz, P., Szucs, N., Liko, I., Fazakas, F., Szabo, I., Kovacs, B., Glaz, E., Racz, K.
(2009). Germline VHL gene mutations in Hungarian families with von Hippel-Lindau disease and patients with apparently sporadic unilateral pheochromocytomas. Eur J Endocrinol
161: 495-502
[Abstract] [Full Text] -
Xiao, W., Ai, J., Habermacher, G., Volpert, O., Yang, X., Zhang, A.-y., Hahn, J., Cai, X., Wang, Z.
(2009). U19/Eaf2 Binds to and Stabilizes von Hippel-Lindau Protein. Cancer Res.
69: 2599-2606
[Abstract] [Full Text] -
Piessevaux, J., De Ceuninck, L., Catteeuw, D., Peelman, F., Tavernier, J.
(2008). Elongin B/C Recruitment Regulates Substrate Binding by CIS. J. Biol. Chem.
283: 21334-21346
[Abstract] [Full Text] -
Maeda, Y., Suzuki, T., Pan, X., Chen, G., Pan, S., Bartman, T., Whitsett, J. A.
(2008). CUL2 Is Required for the Activity of Hypoxia-inducible Factor and Vasculogenesis. J. Biol. Chem.
283: 16084-16092
[Abstract] [Full Text] -
Mahrour, N., Redwine, W. B., Florens, L., Swanson, S. K., Martin-Brown, S., Bradford, W. D., Staehling-Hampton, K., Washburn, M. P., Conaway, R. C., Conaway, J. W.
(2008). Characterization of Cullin-box Sequences That Direct Recruitment of Cul2-Rbx1 and Cul5-Rbx2 Modules to Elongin BC-based Ubiquitin Ligases. J. Biol. Chem.
283: 8005-8013
[Abstract] [Full Text] -
Khacho, M., Mekhail, K., Pilon-Larose, K., Payette, J., Lee, S.
(2008). Cancer-Causing Mutations in a Novel Transcription-Dependent Nuclear Export Motif of VHL Abrogate Oxygen-Dependent Degradation of Hypoxia-Inducible Factor. Mol. Cell. Biol.
28: 302-314
[Abstract] [Full Text] -
Turcotte, S., Giaccia, A. J.
(2008). Targeted Therapy for the Loss of the Tumor Suppressor Gene von Hippel-Lindau through Synthetic Lethality. Am Soc Clin Oncol Ed Book
2008: e15-e18
[Abstract] [Full Text] -
Wu, K. L., Miao, H., Khan, S.
(2007). JAK kinases promote invasiveness in VHL-mediated renal cell carcinoma by a suppressor of cytokine signaling-regulated, HIF-independent mechanism. Am. J. Physiol. Renal Physiol.
293: F1836-F1846
[Abstract] [Full Text] -
Li, L., Zhang, L., Zhang, X., Yan, Q., Minamishima, Y. A., Olumi, A. F., Mao, M., Bartz, S., Kaelin, W. G. Jr.
(2007). Hypoxia-Inducible Factor Linked to Differential Kidney Cancer Risk Seen with Type 2A and Type 2B VHL Mutations. Mol. Cell. Biol.
27: 5381-5392
[Abstract] [Full Text] -
Luo, K., Ehrlich, E., Xiao, Z., Zhang, W., Ketner, G., Yu, X.-F.
(2007). Adenovirus E4orf6 assembles with Cullin5-ElonginB-ElonginC E3 ubiquitin ligase through an HIV/SIV Vif-like BC-box to regulate p53. FASEB J.
21: 1742-1750
[Abstract] [Full Text] -
Fu, J., Menzies, K., Freeman, R. S., Taubman, M. B.
(2007). EGLN3 Prolyl Hydroxylase Regulates Skeletal Muscle Differentiation and Myogenin Protein Stability. J. Biol. Chem.
282: 12410-12418
[Abstract] [Full Text] -
Evans, A. J., Russell, R. C., Roche, O., Burry, T. N., Fish, J. E., Chow, V. W. K., Kim, W. Y., Saravanan, A., Maynard, M. A., Gervais, M. L., Sufan, R. I., Roberts, A. M., Wilson, L. A., Betten, M., Vandewalle, C., Berx, G., Marsden, P. A., Irwin, M. S., Teh, B. T., Jewett, M. A. S., Ohh, M.
(2007). VHL Promotes E2 Box-Dependent E-Cadherin Transcription by HIF-Mediated Regulation of SIP1 and Snail. Mol. Cell. Biol.
27: 157-169
[Abstract] [Full Text] -
Iliopoulos, O.
(2006). Molecular Biology of Renal Cell Cancer and the Identification of Therapeutic Targets. JCO
24: 5593-5600
[Abstract] [Full Text] -
Pollard, P. J., El-Bahrawy, M., Poulsom, R., Elia, G., Killick, P., Kelly, G., Hunt, T., Jeffery, R., Seedhar, P., Barwell, J., Latif, F., Gleeson, M. J., Hodgson, S. V., Stamp, G. W., Tomlinson, I. P. M., Maher, E. R.
(2006). Expression of HIF-1{alpha}, HIF-2{alpha} (EPAS1), and Their Target Genes in Paraganglioma and Pheochromocytoma with VHL and SDH Mutations. J. Clin. Endocrinol. Metab.
91: 4593-4598
[Abstract] [Full Text] -
Mosher, R. A., Durrant, W. E., Wang, D., Song, J., Dong, X.
(2006). A Comprehensive Structure-Function Analysis of Arabidopsis SNI1 Defines Essential Regions and Transcriptional Repressor Activity. Plant Cell
18: 1750-1765
[Abstract] [Full Text] -
Woodward, E. R, Maher, E. R
(2006). Von Hippel-Lindau disease and endocrine tumour susceptibility.. Endocr Relat Cancer
13: 415-425
[Abstract] [Full Text] -
Ribar, B., Prakash, L., Prakash, S.
(2006). Requirement of ELC1 for RNA Polymerase II Polyubiquitylation and Degradation in Response to DNA Damage in Saccharomyces cerevisiae.. Mol. Cell. Biol.
26: 3999-4005
[Abstract] [Full Text] -
Maher, E. R.
(2006). Genetics of phaeochromocytoma. Br Med Bull
79-80: 141-151
[Abstract] [Full Text] -
Nakaigawa, N., Yao, M., Baba, M., Kato, S., Kishida, T., Hattori, K., Nagashima, Y., Kubota, Y.
(2006). Inactivation of von Hippel-Lindau Gene Induces Constitutive Phosphorylation of MET Protein in Clear Cell Renal Carcinoma.. Cancer Res.
66: 3699-3705
[Abstract] [Full Text] -
Hopfer, U., Hopfer, H., Jablonski, K., Stahl, R. A. K., Wolf, G.
(2006). The Novel WD-repeat Protein Morg1 Acts as a Molecular Scaffold for Hypoxia-inducible Factor Prolyl Hydroxylase 3 (PHD3). J. Biol. Chem.
281: 8645-8655
[Abstract] [Full Text] -
Nakamura, E., Abreu-e-Lima, P., Awakura, Y., Inoue, T., Kamoto, T., Ogawa, O., Kotani, H., Manabe, T., Zhang, G.-J., Kondo, K., Nose, V., Kaelin, W. G. Jr
(2006). Clusterin Is a Secreted Marker for a Hypoxia-Inducible Factor-Independent Function of the von Hippel-Lindau Tumor Suppressor Protein. Am. J. Pathol.
168: 574-584
[Abstract] [Full Text] -
Bindra, R. S., Gibson, S. L., Meng, A., Westermark, U., Jasin, M., Pierce, A. J., Bristow, R. G., Classon, M. K., Glazer, P. M.
(2005). Hypoxia-Induced Down-regulation of BRCA1 Expression by E2Fs. Cancer Res.
65: 11597-11604
[Abstract] [Full Text] -
Cohen, H. T., McGovern, F. J.
(2005). Renal-Cell Carcinoma. NEJM
353: 2477-2490
[Full Text] -
Lolkema, M. P., Gervais, M. L., Snijckers, C. M., Hill, R. P., Giles, R. H., Voest, E. E., Ohh, M.
(2005). Tumor Suppression by the von Hippel-Lindau Protein Requires Phosphorylation of the Acidic Domain. J. Biol. Chem.
280: 22205-22211
[Abstract] [Full Text] -
KAELIN, W.G. JR.
(2005). The von Hippel-Lindau Tumor Suppressor Protein: Roles in Cancer and Oxygen Sensing. Cold Spring Harb Symp Quant Biol
70: 159-166
[Abstract] -
Kim, W. Y., Kaelin, W. G.
(2004). Role of VHL Gene Mutation in Human Cancer. JCO
22: 4991-5004
[Abstract] [Full Text] -
Bindra, R. S., Schaffer, P. J., Meng, A., Woo, J., Maseide, K., Roth, M. E., Lizardi, P., Hedley, D. W., Bristow, R. G., Glazer, P. M.
(2004). Down-Regulation of Rad51 and Decreased Homologous Recombination in Hypoxic Cancer Cells. Mol. Cell. Biol.
24: 8504-8518
[Abstract] [Full Text] -
Ferrara, N.
(2004). Vascular Endothelial Growth Factor: Basic Science and Clinical Progress. Endocr. Rev.
25: 581-611
[Abstract] [Full Text] -
Sufan, R. I., Jewett, M. A. S., Ohh, M.
(2004). The role of von Hippel-Lindau tumor suppressor protein and hypoxia in renal clear cell carcinoma. Am. J. Physiol. Renal Physiol.
287: F1-F6
[Abstract] [Full Text] -
Stickle, N. H., Chung, J., Klco, J. M., Hill, R. P., Kaelin, W. G. Jr., Ohh, M.
(2004). pVHL Modification by NEDD8 Is Required for Fibronectin Matrix Assembly and Suppression of Tumor Development. Mol. Cell. Biol.
24: 3251-3261
[Abstract] [Full Text] -
Turcotte, S., Desrosiers, R. R., Beliveau, R.
(2004). Hypoxia upregulates von Hippel-Lindau tumor-suppressor protein through RhoA-dependent activity in renal cell carcinoma. Am. J. Physiol. Renal Physiol.
286: F338-F348
[Abstract] [Full Text] -
Massfelder, T., Lang, H., Schordan, E., Lindner, V., Rothhut, S., Welsch, S., Simon-Assmann, P., Barthelmebs, M., Jacqmin, D., Helwig, J.-J.
(2004). Parathyroid Hormone-Related Protein Is an Essential Growth Factor for Human Clear Cell Renal Carcinoma and a Target for the von Hippel-Lindau Tumor Suppressor Gene. Cancer Res.
64: 180-188
[Abstract] [Full Text] -
Van Dort, C., Zhao, P., Parmelee, K., Capps, B., Poel, A., Listenberger, L., Kossoris, J., Wasilevich, B., Murrey, D., Clare, P., Burnatowska-Hledin, M.
(2003). VACM-1, a cul-5 gene, inhibits cellular growth by a mechanism that involves MAPK and p53 signaling pathways. Am. J. Physiol. Cell Physiol.
285: C1386-C1396
[Abstract] [Full Text] -
Kaelin, W. G. Jr.
(2003). The von Hippel-Lindau Gene, Kidney Cancer, and Oxygen Sensing. J. Am. Soc. Nephrol.
14: 2703-2711
[Abstract] [Full Text] -
Ma, W., Tessarollo, L., Hong, S.-B., Baba, M., Southon, E., Back, T. C., Spence, S., Lobe, C. G., Sharma, N., Maher, G. W., Pack, S., Vortmeyer, A. O., Guo, C., Zbar, B., Schmidt, L. S.
(2003). Hepatic Vascular Tumors, Angiectasis in Multiple Organs, and Impaired Spermatogenesis in Mice with Conditional Inactivation of the VHL Gene. Cancer Res.
63: 5320-5328
[Abstract] [Full Text] -
Michel, J. J., McCarville, J. F., Xiong, Y.
(2003). A Role for Saccharomyces cerevisiae Cul8 Ubiquitin Ligase in Proper Anaphase Progression. J. Biol. Chem.
278: 22828-22837
[Abstract] [Full Text] -
Maynard, M. A., Qi, H., Chung, J., Lee, E. H. L., Kondo, Y., Hara, S., Conaway, R. C., Conaway, J. W., Ohh, M.
(2003). Multiple Splice Variants of the Human HIF-3alpha Locus Are Targets of the von Hippel-Lindau E3 Ubiquitin Ligase Complex. J. Biol. Chem.
278: 11032-11040
[Abstract] [Full Text] -
Rui, L., Yuan, M., Frantz, D., Shoelson, S., White, M. F.
(2002). SOCS-1 and SOCS-3 Block Insulin Signaling by Ubiquitin-mediated Degradation of IRS1 and IRS2. J. Biol. Chem.
277: 42394-42398
[Abstract] [Full Text] -
Bodmer, D., van den Hurk, W., van Groningen, J. J. M., Eleveld, M. J., Martens, G. J. M., Weterman, M. A. J., Geurts van Kessel, A.
(2002). Understanding familial and non-familial renal cell cancer. Hum Mol Genet
11: 2489-2498
[Abstract] [Full Text] -
Dollfus, H., Massin, P., Taupin, P., Nemeth, C., Amara, S., Giraud, S., Beroud, C., Dureau, P., Gaudric, A., Landais, P., Richard, S.
(2002). Retinal Hemangioblastoma in von Hippel-Lindau Disease: A Clinical and Molecular Study. IOVS
43: 3067-3074
[Abstract] [Full Text] -
Brower, C. S., Sato, S., Tomomori-Sato, C., Kamura, T., Pause, A., Stearman, R., Klausner, R. D., Malik, S., Lane, W. S., Sorokina, I., Roeder, R. G., Conaway, J. W., Conaway, R. C.
(2002). Mammalian mediator subunit mMED8 is an Elongin BC-interacting protein that can assemble with Cul2 and Rbx1 to reconstitute a ubiquitin ligase. Proc. Natl. Acad. Sci. USA
99: 10353-10358
[Abstract] [Full Text] -
Groulx, I., Lee, S.
(2002). Oxygen-Dependent Ubiquitination and Degradation of Hypoxia-Inducible Factor Requires Nuclear-Cytoplasmic Trafficking of the von Hippel-Lindau Tumor Suppressor Protein. Mol. Cell. Biol.
22: 5319-5336
[Abstract] [Full Text] -
Li, B., Ruiz, J. C., Chun, K. T.
(2002). CUL-4A Is Critical for Early Embryonic Development. Mol. Cell. Biol.
22: 4997-5005
[Abstract] [Full Text] -
Fedele, A. O., Whitelaw, M. L., Peet, D. J.
(2002). Regulation of Gene Expression by the Hypoxia-Inducible Factors. Mol. Interv.
2: 229-243
[Abstract] [Full Text] -
Zatyka, M., da Silva, N. F., Clifford, S. C., Morris, M. R., Wiesener, M. S., Eckardt, K.-U., Houlston, R. S., Richards, F. M., Latif, F., Maher, E. R.
(2002). Identification of Cyclin D1 and Other Novel Targets for the von Hippel-Lindau Tumor Suppressor Gene by Expression Array Analysis and Investigation of Cyclin D1 Genotype as a Modifier in von Hippel-Lindau Disease. Cancer Res.
62: 3803-3811
[Abstract] [Full Text] -
Zatyka, M, Morrissey, C, Kuzmin, I, Lerman, M I, Latif, F, Richards, F M, Maher, E R
(2002). Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter. J. Med. Genet.
39: 463-472
[Abstract] [Full Text] -
Bindra, R. S., Vasselli, J. R., Stearman, R., Linehan, W. M., Klausner, R. D.
(2002). VHL-mediated Hypoxia Regulation of Cyclin D1 in Renal Carcinoma Cells. Cancer Res.
62: 3014-3019
[Abstract] [Full Text] -
Hansen, W. J., Ohh, M., Moslehi, J., Kondo, K., Kaelin, W. G., Welch, W. J.
(2002). Diverse Effects of Mutations in Exon II of the von Hippel-Lindau (VHL) Tumor Suppressor Gene on the Interaction of pVHL with the Cytosolic Chaperonin and pVHL-Dependent Ubiquitin Ligase Activity. Mol. Cell. Biol.
22: 1947-1960
[Abstract] [Full Text] -
Bauer, A. L., Paulding, W. R., Striet, J. B., Schnell, P. O., Czyzyk-Krzeska, M. F.
(2002). Endogenous von Hippel-Lindau Tumor Suppressor Protein Regulates Catecholaminergic Phenotype in PC12 Cells. Cancer Res.
62: 1682-1687
[Abstract] [Full Text] -
Pioli, P. A., Rigby, W. F. C.
(2001). The Von Hippel-Lindau Protein Interacts with Heteronuclear Ribonucleoprotein A2 and Regulates Its Expression. J. Biol. Chem.
276: 40346-40352
[Abstract] [Full Text] -
Yang, H., Kaelin, W. G. Jr.
(2001). Molecular Pathogenesis of the Von Hippel-Lindau Hereditary Cancer Syndrome: Implications for Oxygen Sensing. Cell Growth Differ.
12: 447-455
[Full Text] -
Hoffman, M. A., Ohh, M., Yang, H., Klco, J. M., Ivan, M., Kaelin, W. G. Jr
(2001). von Hippel-Lindau protein mutants linked to type 2C VHL disease preserve the ability to downregulate HIF. Hum Mol Genet
10: 1019-1027
[Abstract] [Full Text] -
Clifford, S. C., Cockman, M. E., Smallwood, A. C., Mole, D. R., Woodward, E. R., Maxwell, P. H., Ratcliffe, P. J., Maher, E. R.
(2001). Contrasting effects on HIF-1{{alpha}} regulation by disease-causing pVHL mutations correlate with patterns of tumourigenesis in von Hippel-Lindau disease. Hum Mol Genet
10: 1029-1038
[Abstract] [Full Text] -
Yu, F., White, S. B., Zhao, Q., Lee, F. S.
(2001). Dynamic, Site-specific Interaction of Hypoxia-inducible Factor-1{{alpha}} with the von Hippel-Lindau Tumor Suppressor Protein. Cancer Res.
61: 4136-4142
[Abstract] [Full Text] -
KARUMANCHI, S. A., JIANG, L., KNEBELMANN, B., STUART-TILLEY, A. K., ALPER, S. L., SUKHATME, V. P.
(2001). VHL tumor suppressor regulates Cl-/HCO3- exchange and Na+/H+ exchange activities in renal carcinoma cells. Physiol. Genomics
5: 119-128
[Abstract] [Full Text] -
Hockel, M., Vaupel, P.
(2001). Tumor Hypoxia: Definitions and Current Clinical, Biologic, and Molecular Aspects. JNCI J Natl Cancer Inst
93: 266-276
[Abstract] [Full Text] -
Davidowitz, E. J., Schoenfeld, A. R., Burk, R. D.
(2001). VHL Induces Renal Cell Differentiation and Growth Arrest through Integration of Cell-Cell and Cell-Extracellular Matrix Signaling. Mol. Cell. Biol.
21: 865-874
[Abstract] [Full Text] -
Kamura, T., Sato, S., Iwai, K., Czyzyk-Krzeska, M., Conaway, R. C., Conaway, J. W.
(2000). Activation of HIF1alpha ubiquitination by a reconstituted von Hippel-Lindau (VHL) tumor suppressor complex. Proc. Natl. Acad. Sci. USA
10.1073/pnas.190332597v1
[Abstract] [Full Text] -
Schoenfeld, A. R., Davidowitz, E. J., Burk, R. D.
(2000). Elongin BC complex prevents degradation of von Hippel-Lindau tumor suppressor gene products. Proc. Natl. Acad. Sci. USA
97: 8507-8512
[Abstract] [Full Text] -
Martinez, A, Fullwood, P, Kondo, K, Kishida, T, Yao, M, Maher, E R, Latif, F
(2000). Role of chromosome 3p12-p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis. Mol. Pathol.
53: 137-144
[Abstract] [Full Text] -
Woodward, E. R, Clifford, S. C, Astuti, D., Affara, N. A, Maher, E. R
(2000). Familial clear cell renal cell carcinoma (FCRC): clinical features and mutation analysis of the VHL, MET, and CUL2 candidate genes. J. Med. Genet.
37: 348-353
[Abstract] [Full Text] -
Koth, C. M., Botuyan, M. V., Moreland, R. J., Jansma, D. B., Conaway, J. W., Conaway, R. C., Chazin, W. J., Friesen, J. D., Arrowsmith, C. H., Edwards, A. M.
(2000). Elongin from Saccharomyces cerevisiae. J. Biol. Chem.
275: 11174-11180
[Abstract] [Full Text] -
Groulx, I., Bonicalzi, M.-E., Lee, S.
(2000). Ran-mediated Nuclear Export of the von Hippel-Lindau Tumor Suppressor Protein Occurs Independently of Its Assembly with Cullin-2. J. Biol. Chem.
275: 8991-9000
[Abstract] [Full Text] -
Lopez de Heredia, M., Izquierdo, J. M., Cuezva, J. M.
(2000). A Conserved Mechanism for Controlling the Translation of beta -F1-ATPase mRNA between the Fetal Liver and Cancer Cells. J. Biol. Chem.
275: 7430-7437
[Abstract] [Full Text] -
Wu, K., Fuchs, S. Y., Chen, A., Tan, P., Gomez, C., Ronai, Z.'e., Pan, Z.-Q.
(2000). The SCFHOS/beta -TRCP-ROC1 E3 Ubiquitin Ligase Utilizes Two Distinct Domains within CUL1 for Substrate Targeting and Ubiquitin Ligation. Mol. Cell. Biol.
20: 1382-1393
[Abstract] [Full Text] -
Wada, H., Yeh, E. T. H., Kamitani, T.
(1999). The von Hippel-Lindau Tumor Suppressor Gene Product Promotes, but Is Not Essential for, NEDD8 Conjugation to Cullin-2. J. Biol. Chem.
274: 36025-36029
[Abstract] [Full Text] -
Wilkinson, K. D.
(1999). Ubiquitin-Dependent Signaling: The Role of Ubiquitination in the Response of Cells to Their Environment.. J. Nutr.
129: 1933-1936
[Abstract] [Full Text] -
Iwai, K., Yamanaka, K., Kamura, T., Minato, N., Conaway, R. C., Conaway, J. W., Klausner, R. D., Pause, A.
(1999). Identification of the von Hippel-Lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc. Natl. Acad. Sci. USA
96: 12436-12441
[Abstract] [Full Text] -
Kroll, S. L., Paulding, W. R., Schnell, P. O., Barton, M. C., Conaway, J.W., Conaway, R. C., Czyzyk-Krzeska, M. F.
(1999). von Hippel-Lindau Protein Induces Hypoxia-regulated Arrest of Tyrosine Hydroxylase Transcript Elongation in Pheochromocytoma Cells. J. Biol. Chem.
274: 30109-30114
[Abstract] [Full Text] -
Koochekpour, S., Jeffers, M., Wang, P. H., Gong, C., Taylor, G. A., Roessler, L. M., Stearman, R., Vasselli, J. R., Stetler-Stevenson, W. G., Kaelin, W. G. Jr., Linehan, W. M., Klausner, R. D., Gnarra, J. R., Vande Woude, G. F.
(1999). The von Hippel-Lindau Tumor Suppressor Gene Inhibits Hepatocyte Growth Factor/Scatter Factor-Induced Invasion and Branching Morphogenesis in Renal Carcinoma Cells. Mol. Cell. Biol.
19: 5902-5912
[Abstract] [Full Text] -
Duerr, E.-M., Gimm, O., Neuberg, D. S., Kum, J. B., Clifford, S. C., Toledo, S. P. A., Maher, E. R., Dahia, P. L. M., Eng, C.
(1999). Differences in Allelic Distribution of Two Polymorphisms in the VHL-Associated Gene CUL2 in Pheochromocytoma Patients without Somatic CUL2 Mutations. J. Clin. Endocrinol. Metab.
84: 3207-3211
[Abstract] [Full Text] -
Pause, A., Peterson, B., Schaffar, G., Stearman, R., Klausner, R. D.
(1999). Studying interactions of four proteins in the yeast two-hybrid system: Structural resemblance of the pVHL/elongin BC/hCUL-2 complex with the ubiquitin ligase complex SKP1/cullin/F-box protein. Proc. Natl. Acad. Sci. USA
96: 9533-9538
[Abstract] [Full Text] -
Lisztwan, J., Imbert, G., Wirbelauer, C., Gstaiger, M., Krek, W.
(1999). The von Hippel-Lindau tumor suppressor protein is a component of an E3 ubiquitin-protein ligase activity. Genes Dev.
13: 1822-1833
[Abstract] [Full Text] -
Liakopoulos, D., Busgen, T., Brychzy, A., Jentsch, S., Pause, A.
(1999). Conjugation of the ubiquitin-like protein NEDD8 to cullin-2 is linked to von Hippel-Lindau tumor suppressor function. Proc. Natl. Acad. Sci. USA
96: 5510-5515
[Abstract] [Full Text] -
Brower, C. S., Shilatifard, A., Mather, T., Kamura, T., Takagi, Y., Haque, D., Treharne, A., Foundling, S. I., Conaway, J. W., Conaway, R. C.
(1999). The Elongin B Ubiquitin Homology Domain. IDENTIFICATION OF ELONGIN B SEQUENCES IMPORTANT FOR INTERACTION WITH ELONGIN C. J. Biol. Chem.
274: 13629-13636
[Abstract] [Full Text] -
Ananth, S., Knebelmann, B., Gruning, W., Dhanabal, M., Walz, G., Stillman, I. E., Sukhatme, V. P.
(1999). Transforming Growth Factor {beta}1 Is a Target for the von Hippel-Lindau Tumor Suppressor and a Critical Growth Factor for Clear Cell Renal Carcinoma. Cancer Res.
59: 2210-2216
[Abstract] [Full Text] -
Kamura, T., Koepp, D. M., Conrad, M. N., Skowyra, D., Moreland, R. J., Iliopoulos, O., Lane, W. S., Kaelin Jr., W. G., Elledge, S. J., Conaway, R. C., Harper, J. W., Conaway, J. W.
(1999). Rbx1, a Component of the VHL Tumor Suppressor Complex and SCF Ubiquitin Ligase. Science
284: 657-661
[Abstract] [Full Text] -
Zhang, J.-G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, B. J., Kent, S. B. H., Alexander, W. S., Metcalf, D., Hilton, D. J., Nicola, N. A., Baca, M.
(1999). The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation. Proc. Natl. Acad. Sci. USA
96: 2071-2076
[Abstract] [Full Text] -
Gorospe, M., Egan, J. M., Zbar, B., Lerman, M., Geil, L., Kuzmin, I., Holbrook, N. J.
(1999). Protective Function of von Hippel-Lindau Protein against Impaired Protein Processing in Renal Carcinoma Cells. Mol. Cell. Biol.
19: 1289-1300
[Abstract] [Full Text] -
Lee, S., Neumann, M., Stearman, R., Stauber, R., Pause, A., Pavlakis, G. N., Klausner, R. D.
(1999). Transcription-Dependent Nuclear-Cytoplasmic Trafficking Is Required for the Function of the von Hippel-Lindau Tumor Suppressor Protein. Mol. Cell. Biol.
19: 1486-1497
[Abstract] [Full Text] -
Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin Jr., W. G., Conaway, R. C., Conaway, J. W.
(1998). The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev.
12: 3872-3881
[Abstract] [Full Text] -
Shilatifard, A.
(1998). Factors regulating the transcriptional elongation activity of RNA polymerase II. FASEB J.
12: 1437-1446
[Abstract] [Full Text] -
Iliopoulos, O., Ohh, M., Kaelin, W. G. Jr.
(1998). pVHL19 is a biologically active product of the von Hippel-Lindau gene arising from internal translation initiation. Proc. Natl. Acad. Sci. USA
95: 11661-11666
[Abstract] [Full Text] -
Du, M., Sansores-Garcia, L., Zu, Z., Wu, K. K.-y.
(1998). Cloning and Expression Analysis of a Novel Salicylate Suppressible Gene, Hs-CUL-3, a Member of Cullin/Cdc53 Family. J. Biol. Chem.
273: 24289-24292
[Abstract] [Full Text] -
Schoenfeld, A., Davidowitz, E. J., Burk, R. D.
(1998). A second major native von Hippel-Lindau gene product, initiated from an internal translation start site, functions as a tumor suppressor. Proc. Natl. Acad. Sci. USA
95: 8817-8822
[Abstract] [Full Text] -
Teng-umnuay, P., Morris, H. R., Dell, A., Panico, M., Paxton, T., West, C. M.
(1998). The Cytoplasmic F-box Binding Protein SKP1 Contains a Novel Pentasaccharide Linked to Hydroxyproline in Dictyostelium. J. Biol. Chem.
273: 18242-18249
[Abstract] [Full Text] -
Lyapina, S. A., Correll, C. C., Kipreos, E. T., Deshaies, R. J.
(1998). Human CUL1 forms an evolutionarily conserved ubiquitin ligase complex (SCF) with SKP1 and an F-box protein. Proc. Natl. Acad. Sci. USA
95: 7451-7456
[Abstract] [Full Text] -
Cockman, M. E., Masson, N., Mole, D. R., Jaakkola, P., Chang, G.-W., Clifford, S. C., Maher, E. R., Pugh, C. W., Ratcliffe, P. J., Maxwell, P. H.
(2000). Hypoxia Inducible Factor-alpha Binding and Ubiquitylation by the von Hippel-Lindau Tumor Suppressor Protein. J. Biol. Chem.
275: 25733-25741
[Abstract] [Full Text] -
Bonicalzi, M.-E., Groulx, I., de Paulsen, N., Lee, S.
(2001). Role of Exon 2-encoded beta -Domain of the von Hippel-Lindau Tumor Suppressor Protein. J. Biol. Chem.
276: 1407-1416
[Abstract] [Full Text] -
Chen, A., Wu, K., Fuchs, S. Y., Tan, P., Gomez, C., Pan, Z.-Q.
(2000). The Conserved RING-H2 Finger of ROC1 Is Required for Ubiquitin Ligation. J. Biol. Chem.
275: 15432-15439
[Abstract] [Full Text] -
Kamura, T., Sato, S., Iwai, K., Czyzyk-Krzeska, M., Conaway, R. C., Conaway, J. W.
(2000). Activation of HIF1alpha ubiquitination by a reconstituted von Hippel-Lindau (VHL) tumor suppressor complex. Proc. Natl. Acad. Sci. USA
97: 10430-10435
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»