Previous Article | Next Article 
Mol Cell Biol, February 1998, p. 846-858, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The AML1-MTG8 Leukemic Fusion Protein Forms a Complex with a
Novel Member of the MTG8(ETO/CDR) Family, MTGR1
Issay
Kitabayashi,1,*
Kohmei
Ida,1
Fumiko
Morohoshi,1
Akihiko
Yokoyama,1
Naoko
Mitsuhashi,1
Kimiko
Shimizu,1
Nobuo
Nomura,2
Yasuhide
Hayashi,3 and
Misao
Ohki1
Radiobiology Division, National Cancer Center
Research Institute, Chuo-ku, Tokyo 104,1
Kazusa DNA Research Institute, Kisarazu, Chiba
292,2 and
Department of Pediatrics,
Faculty of Medicine, University of Tokyo, Bunkyo-ku, Tokyo
113,3 Japan
Received 18 August 1997/Returned for modification 6 October
1997/Accepted 9 November 1997
 |
ABSTRACT |
The AML1-CBF
transcription factor complex is essential for the
definitive hematopoiesis of all lineages and is the most frequent target of chromosomal rearrangements in human leukemia. In the t(8;21)
translocation associated with acute myeloid leukemia (AML), the
AML1(CBFA2/PEBP2
B) gene is juxtaposed to the
MTG8(ETO/CDR) gene. We show here that the
resultant AML1-MTG8 gene product specifically and strongly interacts
with an 85-kDa phosphoprotein. Molecular cloning of cDNA indicated that
the AML1-MTG8-binding protein (MTGR1) is highly related to MTG8 and
similar to Drosophila Nervy. Comparison of amino acid
sequences among MTGR1, MTG8, and Nervy revealed four evolutionarily
conserved regions (NHR1 to NHR4). Ectopic expression of AML1-MTG8 in
L-G murine myeloid progenitor cells inhibits differentiation to mature
neutrophils and induces cell proliferation in response to granulocyte
colony-stimulating factor (G-CSF). Analysis with C-terminal deletion
mutants of AML1-MTG8 indicated that the region of 51 residues (488 to
538), which contains NHR2, is essential for the induction of
G-CSF-dependent cell proliferation. Immunoprecipitation analysis
indicates that this region is required for AML1-MTG8 to form a stable
complex with MTGR1. Overexpression of MTGR1 stimulates AML1-MTG8 to
induce G-CSF-dependent proliferation of L-G cells and to interfere with
AML1-dependent transcription. These results suggest that AML1-MTG8
could function as a complex with MTGR1 and that the complex might be
important in promoting leukemogenesis.
 |
INTRODUCTION |
Chromosome translocations associated
with human leukemia frequently involve genes that code for a variety of
transcriptional factors implicated in the regulation of normal
hematopoiesis (44). The AML1-CBF
transcription factor
complex is the most frequent target of these translocations. The
AML1 gene (on chromosome 21) was identified through its
involvement in t(8;21) translocation, which occurs in ~40% of cases
of acute myeloid leukemia with the M2 French-American-British subtype
(28). In this translocation, the AML1 gene is
juxtaposed to the gene which encodes a zinc finger-containing protein
MTG8 (also known as ETO and CDR), resulting in the expression of the
AML1-MTG8 chimeric protein (4, 19, 29, 32). In addition, the
AML1 gene is fused with the TEL gene, which
encodes a member of the Ets family of transcription factors, to form a TEL-AML1 chimeric product by t(12;21) translocation. The resultant chimeric transcripts are detected in pediatric B-cell progenitor acute
lymphoblastic leukemia, the most common leukemia seen in children
(10, 46). Furthermore, AML1-containing fusion products are
formed by t(3;21) translocation, which occurs in myelodysplastic syndrome and the blast crisis phase of chronic myelogenous leukemia (27, 35, 36). Moreover, CBF
, which forms a heterodimer with AML1, is also the target of leukemia-associated chromosomal rearrangement and makes a fusion protein with smooth muscle myosin heavy chain (MYH11) in inv(16), which is often observed in
AML-M4Eo (22).
The AML1 family of transcription factors (AML1, AML2, and AML3
[21]) forms heterodimeric complexes with CBF
(also
known as PEBP2
) and regulates the transcription of target genes by binding to the DNA sequence TGT/cGGT (37, 38, 55). A
128-amino-acid region that is highly homologous to the
Drosophila segmentation gene Runt (14)
is required for heterodimerization with CBF
/PEBP2
as well as for
DNA binding and has been called the runt homology domain (rhd) (2,
13, 24). At least three forms of AML1 protein are produced by
alternative splicing (30). The AML1b isoform (453 amino
acids) and the AML1c isoform (480 amino acids) contain the rhd and a
C-terminal transcriptional activation domain, whereas the AML1a isoform
(250 amino acids) contains the rhd but not the transcriptional
activation domain. Possible transcriptional targets include the genes
encoding the T-cell antigen receptors (TCRs) (43, 45, 55),
the colony-stimulating factor 1 (CSF1/M-CSF) receptor (57),
myeloperoxidase, neutrophil elastase (34), interleukin-3
(IL-3) (49), granulocyte-macrophage CSF (8, 50),
and granzyme B (56). The targeted disruption demonstrated that both AML1 and CBF
/PEBP2
are essential for all lineages of
definitive hematopoiesis in mouse fetal liver (31, 39, 47, 53,
54).
The MTG8 (ETO) gene encodes a protein with two
putative zinc fingers and several proline-rich regions, which is
presumed to function as a transcription factor (29). Since
the AML1-MTG8 chimeric protein contains the rhd of AML1, it retains the
abilities to form a complex with CBF
/PEBP2
and to bind to the
specific DNA sequence. However, AML1-MTG8 lacks the transcriptional
activation domain which is present in AML1b/AML1c. AML1-MTG8 has been
shown to repress AML1-dependent transcription of the TCR
enhancer
(25) and the granulocyte-macrophage CSF promoter
(8). However, the molecular mechanism by which AML1-MTG8
exerts its leukemogenic potential is unclear. In this study we found
that AML1-MTG8 forms a stable complex with an MTG8-related protein,
MTGR1. In addition, AML1-MTG8 induces granulocyte-CSF (G-CSF)-dependent
proliferation of murine hematopoietic cells. We show here that the
complex formation between AML1-MTG8 and MTGR1 may be responsible for
the repression of AML1-dependent transcription, for the induction of
G-CSF-dependent cell growth, and possibly for leukemogenesis.
 |
MATERIALS AND METHODS |
Cells and retroviruses.
L-G cells (16) were
cultured in RPMI 1640 medium supplemented with 10% fetal calf serum,
recombinant mouse IL-3 (0.1 ng/ml) (a generous gift from Kirin
Brewery), and 50 µM
-mercaptoethanol. BOSC23 (42) and
F19 cells were cultured in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal calf serum. LNSX and LXSH retrovirus
vectors (26) were generously provided by D. Miller. For
production of retroviruses, BOSC23 cells were transfected with LNSX- or
LXSH-derived retrovirus vectors by calcium phosphate precipitation
methods and culture supernatants were saved 48 h after
transfection. L-G cells were incubated in the culture supernatant of
BOSC23 transfectants for 24 h and then selected with G418 (1 mg/ml) or hygromycin B (2.5 mg/ml). When L-G cells were exposed to
G-CSF, the cells maintained in the presence of IL-3 were washed twice
with IL-3-free medium and incubated in medium containing human
recombinant G-CSF (2 ng/ml) (a generous gift from Chugai Pharmaceutical
Co.). Viable cells were counted with a Coulter Counter (Coulter
Electronics Ltd.). For cell morphology, cells were stained with May
Gruenwald's solution and Giemsa's solution (Merck).
cDNA library screening and 5' rapid amplification of cDNA
ends.
A search of the GenBank expressed sequence tag (EST)
sequences with the amino acid sequence of human MTG8b showed that
several ESTs appeared to encode proteins similar to MTG8. Two ESTs
(R85823 and H83692) and three other ESTs (F07076, Z42798 and T04880)
could be aligned with the N-terminal and C-terminal regions of MTG8,
respectively. A PCR product corresponding to the first two ESTs (about
280 bp) was made with Pr1 and Pr2 as primers (Pr1,
GTGAAGATACAGTCCAGATCCTCA; Pr2,
CCCAAACTGTTGCCAGAGTGGTAAG), and another PCR product
corresponding to the last three ESTs (about 390 bp) was made with Pr3
and Pr4 as primers (Pr3, GGAGGCTATCAAGATGAGTTGGTAGA; Pr4,
TCTGTACTTCTGACATGGCCTGAAT). The third PCR product was made with a set of primers (Pr5 and Pr6) from R85823 (Pr5,
TTCTTACCACTCTGGCAACAGTTTG) and F07076 (Pr6,
TCTACCAACTCATCTTGATAGCCTCC), respectively. Human brain
quick-clone cDNA (Clontech) was used as the PCR template. The amino
acid sequence deduced from the DNA sequence of this third PCR product
could be aligned with that of the middle region of MTG8. A mixture of
these three PCR products was used as a probe for the screening of the
size-fractionated cDNA library made in pBluescript from poly(A) RNA of
human KG-1 cells (33). Since the transcripts of this
MTG8-like gene were about 7.5 kb, we screened filters on
which pools of plasmids harboring inserts longer than 4.8 kb were
blotted. The 5' end of the MTGR1 cDNA was determined with Marathon Race
Ready cDNA from human K562 cells (Clontech) as a template. The first
PCR was carried out with Pr2 (described above) and Adaptor Primer 1, included in the kit, as primers. The second PCR was carried out with
Pr7 (CAGGATTTATTGGTGGGAGGGGTG) and Adaptor Primer 2, included in the kit, as primers and the diluted (1/100) reaction
mixture of the first PCR as a template. PCR products were cloned into
pGEM-T vector (Promega), and the sequences of the inserts were
determined.
DNA sequencing and protein structural analysis.
Sequencing
reactions were carried out with the Prism dye-terminator
cycle-sequencing kit (ABI), and the products were applied to an ABI
373S DNA sequencer. Primers made from vector sequences and synthetic
oligonucleotides were used as sequencing primers. DNA sequences were
analyzed and joined with MacVector (Kodak) and Assembly LIGN (Kodak).
The structures of the proteins were analyzed with protein analysis
programs in Mac Vector and DNASIS (Hitachi).
Plasmid construction.
The amino-terminal HA tag was fused to
the AML1-MTG8 cDNA with the oligonucleotide
5'-CCTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCCGTATCCCCGTAGATGCC-3' as the upstream primer and the oligonucleotide
5'-AGACAGTGATGGTCAGAGTG-3' as the downstream primer in a
PCR. The PCR product was digested with StuI and
HindIII and ligated to the HindIII site
near the amino terminus of AML1-MTG8. The C-terminal deletion mutant
582 was generated by digestion with StuI and ligation of
the ClaI linker.
538,
487, and
398 were generated
by ligation of the MfeI-ClaI-digested PCR
fragments with the following primers to the MfeI site of the
C terminus of AML1-MTG8: 5'-ACCCTCGTTCTGGGACTAGTGAACTCCACT-3' as the common upstream primer, and
5'-GCCGGATCGATTAATTCAATTCTTCCCGGT-3' for
538,
5'-TGATCAATCGATTCTTCTTGACGTGTGCCA-3' for
487, or
5'-GTCAAATCGATTTTCTTTCCTTCTGTCTGG-3' for
398 as the
downstream primer. The FLAG-tagged MTGR1 was generated by ligation of
the NotI-EcoRI-digested fragment of the PCR
products to the EcoRI site of the MTGR1 cDNA sequence with
5'-GGATAAGCATGCGGCCGCACCATGGCAGACTACAAGGACGACGATGACAAGTCCGCTAAAGAATCTGGAATAAGCTTGAAA-3' as the upstream primer and 5'-AGTGGAATTCCTCAATTGTCACTGTT-3'
as the downstream primer. The sequences of the above constructs
were checked by sequencing.
Immunoprecipitations.
Immunoprecipitations were performed as
described previously (18). Cells were metabolically labeled
for 4 h with [35S]methionine (50 µCi/ml; Amersham)
in methionine-free DMEM or 32Pi (300 µCi/ml;
Amersham) in phosphorus-free DMEM. The cells were lysed by incubation
at 4°C for 30 min in lysis buffer (20 mM sodium phosphate [pH 7.0],
250 mM NaCl, 30 mM sodium pyrophosphate, 0.1% Nonidet P-40, 5 mM EDTA,
10 mM NaF, 0.1 mM Na3VO4, 1 mM
phenylmethylsulfonyl fluoride) supplemented with 1 µg of leupeptin
per ml, 1 µg of pepstatin per ml, and 1 µg of aprotinin per ml. The
lysates were cleared by centrifugation at 30,000 × g
for 30 min at 4°C, and the supernatants were saved and stored at
80°C. The cell lysates were incubated with anti-HA monoclonal
antibody 12CA5 (Boehringer Mannheim), anti-FLAG monoclonal antibody M2
(Eastman Kodak), anti-AML1 polyclonal antibody, anti-MTGR1 polyclonal
antibodies, or anti-MTG8 polyclonal antibody on ice for 1 h,
followed by addition of protein G-Sepharose beads (Pharmacia) and
shaking on a rotary shaker at 4°C for 2 h. The beads were washed
with 1 ml of lysis buffer five times. The proteins were separated on
sodium dodecyl sulfate (SDS)-polyacrylamide gels and visualized with an
imaging analyzer (BAS2000; Fuji). The anti-AML1 antibody, anti-MTG8
antibody, and anti-MTGR1 antibodies were generated by immunizing
rabbits with a peptide corresponding to residues 8 to 24 of human
AML1a, glutathione S-transferase (GST)-MTG8 (residues 78 to
187 of human MTG8b), and GST-MTGR1 (residues 295 to 335 and 538 to 604 of human MTGR1), respectively, and affinity purified on
antigen-conjugated columns.
Western blotting.
Cell lysates or immunoprecipitates were
fractionated on SDS-polyacrylamide gels and transferred to membrane
filters (Hybond-C ECL; Amersham) by electroblotting. The filters were
blocked in 5% low-fat milk and dissolved in phosphate-buffered saline
plus 0.1% Tween-20 (PBST) at room temperature for 2 h or at 4°C
overnight. After extensive washing in PBST, the filters were incubated
for 1 h at room temperature with anti-MTG8 antibody or anti-MTGR1 polyclonal antibodies. After further washes in PBST, the filters were
incubated with horseradish peroxidase-conjugated second antibodies and
then washed extensively in PBST. The immune complexes were visualized
by an enhanced chemiluminescence detection system (Amersham).
CAT assay.
The cells were harvested by centrifugation at
4°C at 3,000 × g for 5 min. The cell pellet was
washed in PBS and resuspended in 0.25 M Tris-Cl (pH 7.5). The cells
were disintegrated by four freeze-thaw cycles. After centrifugation at
15,000 × g for 10 min at 4°C, aliquots of the clear
supernatant were used for the chloramphenicol acetyltransferase (CAT)
assay. Cell lysates (30 µl) were incubated in 0.11 M Tris-Cl (pH
7.8)-2.3 mM chloramphenicol-129 µM (1 µCi/ml)
[14C]acetyl coenzyme A for 1 h at 37°C and then
for 10 min at 65°C. Acetylated chloramphenicol was extracted with
ice-cold ethyl acetate, and its radioactivity was measured by liquid
scintillation counting.
Northern blotting.
Northern blotting was performed as
described previously (17). Poly(A)+ RNA was
denatured and fractionated on a 1.0% agarose gel containing 2.2 M
formaldehyde, 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS) (pH 7.0), 8 mM sodium acetate, and 1 mM EDTA. The RNAs were
transferred to nylon membranes (Amersham) in 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Hybridization was performed at
42°C for 20 h in 50% formamide-5× SSC-0.1% SDS-5× Denhardt's solution-50 mM EDTA-100 µg of denatured salmon sperm DNA per ml. The filters were washed several times at 65°C in 0.2× SSC-0.1% SDS, and the hybridized transcripts were visualized with an
imaging analyzer (BAS2000; Fuji).
Nucleotide sequence accession number.
The sequence data
reported here have been submitted to the DDBJ/EMBL/GenBank databases
under accession no. AF013970.
 |
RESULTS |
AML1-MTG8 specifically interacts with a cellular
phosphoprotein.
The murine L-G cell line is an IL-3-dependent
myeloid precursor cell line and can be induced to differentiate into
mature neutrophils in response to G-CSF (16). To clarify the
effect of expression of the AML1 protein and the leukemia-associated AML1-MTG8 protein on the differentiation of myeloid cells, L-G cells
were infected with recombinant retroviruses which encoded either
HA-tagged AML1-MTG8, AML1b, or AML1a proteins (Fig.
1A). Neomycin phosphotransferase was used
as a selectable marker, and cells were selected with G418. A total of
10 to 30% of cells acquired resistance to G418, and these were further
characterized. These infected cells were labeled with
[35S]methionine or with
[32P]orthophosphate. Then immunoprecipitation was
performed with anti-HA monoclonal antibody 12CA5. The AML1-MTG8, AML1b,
and AML1a proteins were efficiently expressed in each infected-cell
line, and they coprecipitated CBF
/PEBP2
proteins (Fig. 1B). When
the infected cells were labeled with [32P]orthophosphate,
an 85-kDa protein (p85) and a 35-kDa protein were precipitated with
AML1-MTG8 and AML1b, respectively (Fig. 1C). These proteins were not
precipitated with AML1a, suggesting that specific interactions of
AML1-MTG8 and AML1b with the cellular proteins took place.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of AML1-MTG8 induces G-CSF-dependent
proliferation of L-G cells and inhibits their differentiation to mature
neutrophils. (A) Structures of AML1-MTG8, AML1b, and AML1a. AML1-MTG8
retains the runt homology domain (Runt) of AML1 and almost all of the
region of MTG8. AML1-MTG8 and AML1a lack the C-terminal transactivation
domain (PST) which is present in AML1b. (B and C) Immunoprecipitation
of AML1-MTG8, AML1b, and AML1a. L-G cells which expressed HA-AML1-MTG8,
HA-AML1b, and HA-AML1a were labeled with [35S]methionine
(B) or [32P]orthophosphate (C), and immunoprecipitations
were performed with the anti-HA monoclonal antibody 12CA5. The
immunoprecipitates were subjected to electrophoresis on SDS-10%
polyacrylamide gels. The proteins were visualized with a BAS2000
phosphorimager (Fuji). The positions of bands of AML1a, AML1b,
AML1-MTG8, CBF , p85, and p35 are indicated on the right. (D and E)
Growth curve of the infected L-G cells in response to IL-3 (D) or G-CSF
(E). The growing cells which express AML1a, AML1b or AML1-MTG8 were
washed twice and cultured in the presence of 2 ng of G-CSF per ml (D)
or 0.1 ng of IL-3 per ml (E). The relative numbers of viable cells are
indicated. (F and G) Morphology of the cells. The vector-control (F) or
AML1-MTG8-expressing cells (G) were exposed to G-CSF for 7 days and
stained with May-Gruenwald's and Giemsa's solutions.
|
|
AML1-MTG8 inhibits G-CSF-dependent differentiation of L-G
cells.
The cells which expressed AML1a and AML1b proliferated, as
did control cells, in the presence of IL-3. However,
AML1-MTG8-expressing cells showed slight growth retardation (Fig. 1D).
In the presence of G-CSF, the control and AML1b-expressing cells did
not proliferate (Fig. 1E) but underwent terminal differentiation to
mature neutrophils (Fig. 1F). In contrast, cells which expressed
AML1-MTG8 proliferated exponentially in response to G-CSF (Fig. 1E)
without differentiating to mature granulocytes, as measured by changes
in morphology (Fig. 1G). Expression of AML1a slightly stimulated cell
proliferation in response to G-CSF. All of the infectants died within 2 days when deprived of both IL-3 and G-CSF (data not shown). Thus,
expression of AML1-MTG8 inhibited differentiation of L-G cells to
mature granulocytes and stimulated cell proliferation in response to G-CSF.
AML1-MTG8 sequences that are responsible for stimulation of
G-CSF-dependent proliferation of L-G cells and for interaction with
p85.
To identify the domain of MTG8 which is required for the
induction of G-CSF-dependent proliferation of L-G cells, a series of
C-terminal deletion mutants of AML1-MTG8 (Fig.
2A) were constructed and introduced into
L-G cells by infection with retroviruses as described above.
Immunoblotting analysis with anti-MTG8 polyclonal antibody indicated
that each infected-cell line expressed the expected size of mutants of
AML1-MTG8, as well as a protein which may be intrinsic MTG8 or its
related proteins (Fig. 2B). Each infected-cell line was then tested for
its ability to proliferate in the presence of G-CSF. The C-terminal
deletion mutants
582 and
538, as well as wild-type AML1-MTG8,
strongly stimulated G-CSF-dependent cell proliferation (Fig. 2C).
However, further deletion to residue 487 eliminated this activity.
These results indicate that the region of residues 488 to 538 (corresponding to residues 340 to 390 of MTG8b) is essential for the
stimulation of G-CSF-dependent proliferation of L-G cells. This region
contains the Nervy homology region 2 (NHR2) (see Fig. 6).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of the region of AML1-MTG8 required for
induction of G-CSF-dependent cell proliferation. (A) Schematic
representation of the structure of AML1-MTG8 deletion mutants. The runt
homology domain (Runt), the proline-rich regions (P), and the Nervy
homology regions (numbered 1 through 4) are indicated. The numbers
above the top bar indicate the positions of amino acid residues. (B)
Immunoblot analysis of lysate of infected L-G cells which express
either wild-type (WT) or mutant AML1-MTG8 with anti-MTG8 polyclonal
antibody. The asterisk indicates the position of intrinsic MTG8 or
MTG8-like proteins. (C) Growth curve of the L-G cells in response to
G-CSF. The growing cells which express wild-type (WT) or mutant
AML1-MTG8 were washed twice and cultured in the presence of 2 ng of
G-CSF per ml. (D) Repression of AML1-dependent transcriptional
activation. P19 cells were cotransfected with 1.0 µg of
TCR -TK-CAT, 1.0 µg of either pLNSX vector ( ) or pLNSX-AML1b (+),
1.0 µg of either wild-type (WT) or mutant pLNSX-AML1-MTG8, and 0.5 µg of TK-luciferase in a 6-cm-diameter plate. The results represent
the mean of relative CAT activity from three experiments which were
normalized with luciferase expressed from thymidine kinase-luciferase
as an internal control.
|
|
AML1-MTG8 can interfere with AML1-mediated activation of a reporter
gene containing the consensus AML1-binding site (
25).
To
identify the region that is required for repression of transcription,
deletion mutants of AML1-MTG8 were transfected together with AML1b
and
tested for the activity of AML1-dependent transcription of
the TCR

enhancer.

582 and

538, as well as wild-type AML1-MTG8,
inhibited
transactivation by AML1b, but

487 and

398 did not
(Fig.
2D).
These results are consistent with those in a previous
report
(
20), which demonstrated that residues 470 to 540 are
required for transrepression by AML1-MTG8.
To determine the domain of AML1-MTG8 which is responsible for
interaction with p85, the cells which expressed deletion mutants
of the
HA-tagged AML1-MTG8 were labeled with [
32P]orthophosphate
and the proteins were immunoprecipitated with
anti-HA antibody. As
shown in Fig.
3A, serial deletion of the
C terminus to residue 538 did not affect the coprecipitation of
p85.
However, the coprecipitation was abolished by further deletion
to
residue 487. Thus, the region of residues 488 to 538 is required
for
interaction with p85. This region is also responsible for
AML1-MTG8-mediated stimulation of G-CSF-dependent proliferation
of L-G
cells and repression of AML1-dependent transcription.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
p85, which interacts with AML1-MTG8, is recognized by
anti-MTG8 antibody. (A) Immunoprecipitation of AML1-MTG8. Infected L-G
cells which express either wild-type (WT) or mutant HA-AML1-MTG8 were
labeled with [32P]orthophosphate, and
immunoprecipitations were performed with the anti-HA monoclonal
antibody 12CA5. The immunoprecipitates were subjected to
electrophoresis on SDS-10% polyacrylamide gels. The proteins were
visualized with a BAS2000 phosphorimager. The position of the p85 band
is indicated on the right. (B) Immunoblot of AML1-MTG8 complexes with
anti-MTG8 antibody. The immunoprecipitates with the HA antibody, using
lysates of cells which express wild-type (WT) or mutant HA-AML1-MTG8,
were separated on SDS-polyacrylamide gels and analyzed by
immunoblotting with anti-MTG8 polyclonal antibody. The position of the
p85 band is indicated on the right.
|
|
p85 is recognized by anti-MTG8 antibody.
To analyze the
AML1-MTG8 protein complex, immunoprecipitation was performed with
anti-HA antibody by using cell lysates from the L-G cells which
expressed the HA-tagged AML1-MTG8 protein. The immunoprecipitates were
then analyzed by immunoblotting with anti-MTG8 polyclonal antibody.
Surprisingly, the band which corresponds to p85, as well as that
corresponding to AML1-MTG8, was detected (Fig. 3B). This band was also
observed in immunoprecipitates with C-terminal deletions to residue 538 but not in those with further deletions. These results indicate that
p85 is recognized by the anti-MTG8 polyclonal antibody.
Cross-reactivity of anti-MTG8 antibody suggests that p85, which
coprecipitated with AML1-MTG8, may be an intrinsic MTG8 protein.
However, no MTG8 transcript was detected in L-G cells (Fig.
4A),
suggesting that p85 is unlikely to
be the intrinsic MTG8. Moreover,
p85 is not a degradation product of
AML1-MTG8 because (i) p85
is coprecipitated with deletion mutants
(

582 and

538) which
migrated faster than p85 (Fig.
3) and (ii)
the protein which corresponds
to p85 is expressed in L-G cells without
expression of AML1-MTG8
(Fig.
2B). From these observations, we
considered that p85 might
be an MTG8-like protein rather than the MTG8
protein itself and
that there might be another member of the MTG8
family which could
interact with AML1-MTG8 and could be recognized by
the anti-MTG8
antibody.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of MTG8 and MTGR1 transcripts in L-G and
Kasumi-1 cells. Poly(A)+ RNAs were prepared from L-G cells,
L-G cells infected with LNSX-HA-AML1-MTG8, and Kasumi-1 cells which
have the t(8;21) translocation and express AML1-MTG8 chimeric
transcripts. A 2-µg sample of poly(A)+ RNAs was analyzed
by Northern blotting with human MTG8 (A) or human MTGR1 (B) cDNAs as
probes. Note that the human MTGR1 transcript (7.5 kb) in Kasumi-1 cells
is longer than the mouse MTGR1 transcript (6.7 kb) in L-G cells.
|
|
Cloning of a cDNA encoding a new member of the MTG8 family,
MTGR1.
To isolate cDNAs encoding MTG8-related proteins as
candidates for AML1-MTG8-binding proteins, we initially compared the
human MTG8 protein sequence with sequences from various databases. This search revealed significant similarities to randomly sequenced human
cDNAs (ESTs). Using these sequences as probes, a size-fractionated cDNA
library of human KG-1 cells was screened (see Materials and Methods).
From many positive clones, we selected nine clones whose inserts were
longer than 6 kb. By combining the sequences of these clones and the
sequence obtained by 5' rapid amplification of cDNA ends, we determined
the 6,406-bp cDNA sequence (Fig. 5). Because of the similarity to MTG8, we named it MTGR1 (myeloid translocation gene-related protein 1). The coding sequence started at
the first in-frame ATG at nucleotide 11, which was preceded by the
termination codon TGA, and terminated at nucleotide 1822. The poly(A)
addition signal started from nucleotide 6387 of the cDNA.
Alu consensus sequences were found from nucleotides 3207 to
3236 and from nucleotides 3690 to 3960 of cDNA. RNA blotting indicates
that transcripts detected by MTGR1 cDNA are ubiquitously expressed in
various human tissues and in all the cell lines tested, including L-G
cells and Kasumi-1 cells, which have the t(8;21) translocation (Fig.
4B) (30a).

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 5.
Nucleotide sequence of the MTGR1 cDNA and the
deduced amino acid sequence of the MTGR1 protein. The 3'-noncoding
region (nucleotide 1921 to the 3' end) is not shown.
|
|
The predicted protein product of the cDNA, which consists of 604 amino
acids, is highly related to MTG8 (61% identity) and
is similar to
Nervy (25% identity), a putative
Drosophila homolog
of MTG8
(
7) (Fig.
6A). Comparison of
amino acid sequences among
MTGR1, MTG8, and Nervy
revealed that there are four evolutionarily
conserved regions (Fig.
6B). We termed them NHR1 (Nervy homology
region) (amino acids 113 to
209 of MTGR1), NHR2 (amino acids 346
to 372), NHR3 (amino acids 436 to
484), and NHR4 (amino acids
507 to 544). While sequence similarity
between MTGR1 and MTG8
extended over the entire sequences, similarity
between MTGR1/MTG8
and Nervy was restricted to these regions. NHR1
corresponded to
the region which shows homology with TAFs (TATA-binding
protein-associated
factors) (Fig.
6C) (
5,
7). NHR2 is found
in the domain of
MTG8 which is required for interaction with p85.
Analysis of the
secondary structure suggests that NHR2 is a helical
domain with
amphipathic characteristics (Fig.
6D). NHR4 corresponded to
two
zinc finger motifs (-C-x-x-C-7x-C-x-x-C-;
-C-x-x-x-C-7x-H-x-x-x-C-).
Three Pro-rich regions (amino acids 39 to
116, 257 to 297, and
564 to 603 of MTG8b) found in MTG8 (
29)
were also present in
MTGR1 at the corresponding regions.

View larger version (70K):
[in this window]
[in a new window]

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Structure of MTGR1. (A) Comparison of the amino acid
sequences of MTGR1, MTG8, and Drosophila Nervy proteins.
Residues identical among two or more proteins are shaded. The conserved
regions (NHR1 to NHR4) are indicated above the sequence. Cysteine
residues of zinc finger motifs are marked underneath the sequence.
Epitopes for anti-MTG8 and anti-MTGR1 antibodies are underlined. (B)
Schematic representation of the structures of human MTGR1, human MTG8b,
and Drosophila Nervy. The conserved regions (NHR1 to NHR4)
among these proteins are indicated by shaded boxes. The percentages
represent identity to MTGR1. Numbers above bars indicate the positions
of amino acid residues. (C) Alignments of TAF homology regions of
MTGR1, MTG8, Drosophila Nervy, and human and
Drosophila TAFs. Residues identical among four or more
proteins are shaded. (D) A helical wheel of the NHR2 of MTG8. The
numbers indicate the positions of amino acid residues, where the first
residue of the NHR2 is position 1. The wheel of positions 3 to 22 is
shown. Hydrophobic and hydrophilic amino acids are indicated by gray
and black, respectively. The hydrophobic and hydrophilic sides of the
helix are indicated.
|
|
AML1-MTG8 specifically interacts with MTGR1.
To analyze the
MTGR1 protein, L-G cells were infected with a retrovirus encoding the
Flag-tagged human MTGR1 protein (Flag-hMTGR1). Immunoprecipitation
analysis with anti-Flag monoclonal antibody M2 indicated that
Flag-hMTGR1 is a phosphoprotein and comigrates with p85 (Fig.
7A). MTGR1-specific antibodies were
prepared with the specific regions 295 to 335 and 539 to 604 of MTGR1,
which were expressed in Escherichia coli as glutathione
S-transferase fusion proteins. To determine if MTGR1 forms a
complex with AML1-MTG8, infected L-G cells expressing the HA-tagged
AML1-MTG8 protein (HA-AML1-MTG8) as described above were further
infected with a retrovirus encoding the Flag-hMTGR1 and the hygromycin
phosphotransferase selectable marker and then selected with hygromycin
B. Cell lysates were prepared, and HA-AML1-MTG8 was immunoprecipitated
with anti-HA antibody. Immunoblotting with the anti-MTGR1 antibodies
indicated that intrinsic mouse MTGR1 (Fig. 7B, lane 2) and recombinant
Flag-hMTGR1 (lane 4) were coprecipitated with the HA-AML1-MTG8. The
electrophoretic mobility of Flag-hMTGR1 was very close to but slightly
slower than that of the intrinsic mouse MTGR1 protein. This is probably due to additional sequences containing the Flag epitope (10 amino acids) and/or to the difference between mouse and human gene-derived proteins. Immunoprecipitation of the Flag-MTGR1 proteins followed by
immunoblotting with anti-MTG8 indicated that MTGR1 coprecipitated with
AML1-MTG8 (Fig. 7B, lane 12). This coprecipitation was not detected in
lysates from cells which expressed either Flag-hMTGR1 (lane 11) or
HA-AML1-MTG8 (lane 10), indicating that there was a specific
interaction between MTGR1 and AML1-MTG8. The recombinant Flag-hMTGR1
was recognized by the anti-MTG8 antibody (lanes 11 and 12). Taken
together, these results indicate that AML1-MTG8 could form a stable
complex with MTGR1.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 7.
Characterization of MTGR1. (A) MTGR1 is an 85-kDa
phosphoprotein. L-G cells were infected with LNSX vector,
LNSX-HA-AML1-MTG8, or LNSX-Flag-MTGR1, selected with G418. The infected
cells were labeled with [32P]orthophosphate, and
immunoprecipitations were performed with the anti-HA monoclonal
antibody or the anti-Flag monoclonal antibody. The immunoprecipitates
were subjected to electrophoresis on SDS-10% polyacrylamide gels. The
proteins were visualized with a BAS2000 phosphorimager. The positions
of bands of AML1-MTG8 and MTGR1 are indicated on the right. (B)
Interaction between AML1-MTG8 and MTGR1. Cell lysates were prepared
from infected L-G cells which express the HA-tagged AML1-MTG8 and/or
the Flag-tagged MTGR1. Immunoprecipitations were performed with anti-HA
monoclonal antibody (lanes 1 to 8) or anti-Flag monoclonal antibody
(lanes 9 to 12). The immunoprecipitates were separated on SDS-10%
polyacrylamide gels and analyzed by immunoblotting with anti-MTGR1
polyclonal antibody (lanes 1 to 4) or anti-MTG8 polyclonal antibody
(lanes 5 to 12).
|
|
To determine the region of AML1-MTG8 responsible for interaction with
MTGR1, the deletion mutants above were expressed together
with MTGR1.
Immunoprecipitation-immunoblotting analyses indicated
that when
Flag-hMTGR1 was precipitated with anti-Flag antibody,
the

582 and

538 mutants but not the

487 or

398 mutants were
coprecipitated
with MTGR1 (Fig.
8B). When each deletion
mutant
of HA-AML1-MTG8 was precipitated with anti-HA antibody, MTGR1
was coprecipitated with

582 and

538 but was not precipitated
with

487 or

398 (Fig.
8D). These results indicate that the region
of
residues 488 to 538 of AML1-MTG8 is required for interaction
with
MTGR1, as in the case of interaction with p85 (Fig.
2). From
these and
the above results, we conclude that MTGR1 is the p85
protein.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
Determination of the region of AML1-MTG8 which is
required for interaction with MTGR1. L-G cells were infected with
LXSH-Flag-MTGR1 and LNSX-retrovirus, which encodes either wild-type or
mutant HA-tagged AML1-MTG8. Control cells (vector) expressed only the
Flag-tagged MTGR1. Immunoprecipitations were performed with anti-HA
monoclonal antibody (C and D) or anti-Flag monoclonal antibody (B). The
immunoprecipitates and total-cell lysates (A) were separated on
SDS-10% polyacrylamide gels and analyzed by immunoblotting with
anti-MTGR1 polyclonal antibody (D) or anti-MTG8 polyclonal antibody (A
to C).
|
|
AML1-MTG8 forms complexes with MTGR1 proteins in t(8;21)-containing
leukemic cells.
We examined the interaction between AML1-MTG8 and
MTGR1 in Kasumi-1, which is an AML cell line with the t(8;21)
translocation. Immunoblot analysis with anti-MTG8 antibody indicated
that in addition to AML1-MTG8, three protein bands were detected in
lysates of Kasumi-1 cells (Fig. 9, lane
2). Since these proteins were also recognized by both of the two
MTGR1-specific antibodies (lanes 4, 5, and 8), we consider that they
are MTGR1 proteins. We do not know the exact reason for the difference
in their electrophoretic mobilities, but they may be isoforms generated
by alternative splicing and/or differential modifications such as
phosphorylation (Fig. 7A).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 9.
Interaction of AML1-MTG8 and MTGR1 in Kasumi-1 cells.
Cell lysates were prepared from L-G cells which were infected with
LNSX-HA-AML1-MTG8 (lane 1) and Kasumi-1 cells (lanes 2 to 9).
Immunoprecipitations were performed with anti-HA monoclonal antibody
(lane 1), anti-AML1 antibody (lanes 3 and 8), anti-MTGR1 middle region
antibody ( -MTGR1M; lane 4), anti-MTGR1 C-terminal region antibody
( -MTGR1C; lane 5), anti-MTG8 antibody (lane 6), and rabbit
immunoglobulin G (IgG) (lanes 7 and 9). The immunoprecipitates were
separated on SDS-7.5% polyacrylamide gels and analyzed by
immunoblotting with anti-MTG8 antibody (lanes 1 to 7) or anti-MTGR1M
antibody (lanes 8 and 9).
|
|
Immunoprecipitation analysis with anti-AML1 antibody indicated that all
of the three MTGR1 proteins in Kasumi-1 cells were
coprecipitated with
AML1-MTG8 (Fig.
9, lane 3). In addition, AML1-MTG8
was coprecipitated
with MTGR1 when either of the two MTGR1-specific
antibodies was used
(lanes 4 and 5). These results indicated that
AML1-MTG8 forms complexes
with MTGR1 proteins in Kasumi-1 cells
with the t(8;21) translocation.
AML1-MTG8 forms heterocomplexes with MTGR1 in preference to
homocomplexes.
Complex formation of AML1-MTG8 and MTGR1 suggests
that AML1-MTG8 may form a homocomplex through the regions of MTG8
because MTGR1 is very similar to MTG8. To test this possibility,
HA-tagged wild-type AML1-MTG8 and
582 mutant without the HA-tag were
expressed together in L-G cells. As shown in Fig.
10, immunoblotting analysis with
anti-MTG8 antibody indicated that both wild-type and mutant proteins
were efficiently expressed as well as endogenous MTGR1 (p85).
Immunoprecipitation with anti-HA antibody followed by immunoblotting with anti-MTG8 antibody revealed that coprecipitation of endogenous MTGR1 was detected, but no band or only a very faint band corresponding to
582 was observed. These results suggest that AML1-MTG8 forms a
heterocomplex with MTGR1 in preference to a homocomplex in the presence
of MTGR1.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 10.
No detectable homocomplex of AML1-MTG8 in L-G cells.
Cell lysates were prepared from L-G cells which were infected with
LNSX-HA-AML1-MTG8 and/or LXSH-D582 without any tag.
Immunoprecipitations were performed with anti-HA monoclonal antibody.
The immunoprecipitates were separated on SDS-10% polyacrylamide gels
and analyzed by immunoblotting with anti-MTG8 polyclonal antibody.
|
|
Overexpression of MTGR1 stimulates G-CSF-dependent cell
proliferation and represses AML1-dependent transactivation in concert
with AML1-MTG8.
To test the effects of overexpression of MTGR1 on
the function of AML1-MTG8, L-G cells, which ectopically expressed
AML1-MTG8 and/or MTGR1, were cultured in the presence of G-CSF or
IL-3. In the presence of G-CSF, the MTGR1-expressing cells did not
proliferate as well as the control L-G cells (Fig.
11A). On the other hand, cells which
expressed AML1-MTG8 proliferated exponentially in response to G-CSF, as
shown in Fig. 1. Overexpression of MTGR1 together with AML1-MTG8
further stimulated cell proliferation. Overexpression of MTGR1 did not
affect the growth response to IL-3 (Fig. 11B).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 11.
MTGR1 enhances the activities of AML1-MTG8. (A and B)
Growth curve of the infected L-G cells in response to G-CSF (A) or IL-3
(B). The growing cells, which were infected with LNSX-AML1-MTG8 and/or
LXSH-MTGR1, were washed twice and cultured in the presence of 2 ng of
G-CSF per ml (A) or 0.1 ng of IL-3 per ml (B). Relative numbers of
viable cells are indicated. (C) Repression of AML1-dependent
transcriptional activation. P19 cells were cotransfected with 1.0 µg
of TCR -TK-CAT, 1.0 µg of either pLNSX vector or pLNSX-AML1b, the
indicated amounts (in micrograms) of pLNSX-AML1-MTG8 and pLNSX-MTGR1,
and 0.5 µg of thymidine kinase-luciferase in a 6-cm-diameter plate.
Results represent the mean relative CAT activity from three experiments
which were normalized with luciferase expressed from thymidine
kinase-luciferase as an internal control.
|
|
To determine if MTGR1 affects the activity of AML1-MTG8, MTGR1 was
cotransfected with AML1-MTG8 and the activity of AML1-dependent
transcription from the TCR

enhancer was tested. As shown in Fig.
11C, expression of AML1-MTG8 repressed transcriptional activation
by
AML1b in a dose-dependent manner. Expression of MTGR1 had no
effect on
AML1b-dependent transcriptional activation. However,
cotransfection of
MTGR1 with AML1-MTG8 further repressed AML1b-dependent
transcriptional
activation. These results indicate that MTGR1
stimulates AML1-MTG8 to
induce G-CSF-dependent cell growth and
to repress AML1-dependent
transcription.
 |
DISCUSSION |
The present results indicate that ectopic expression of the
AML1-MTG8 gene in L-G mouse myeloid precursor cells induces
G-CSF-dependent cell proliferation and inhibits differentiation to
mature neutrophils. Analysis with deletion mutants indicates that the
MTG8 sequence is required for the fusion protein to stimulate
G-CSF-dependent proliferation of myeloid cells. In addition, AML1a,
which lacks the C-terminal transactivation domain, does not stimulate
G-CSF-dependent cell proliferation under our conditions, although it
could stimulate the proliferation of 32Dcl3 cells when expressed at
high levels (51). These results support the hypothesis that
a simple truncation of the transactivation domain of AML1 is not
sufficient to promote leukemia and that the MTG8 sequence is also
required.
In an attempt to clarify the mechanism by which AML1-MTG8 promotes
leukemogenesis, we investigated proteins which interact with AML1-MTG8
and found that a cellular phosphoprotein, p85, specifically interacts
with the region of MTG8 which is essential for the induction of
G-CSF-dependent cell proliferation. Since p85 is recognized by
anti-MTG8 antibody, we considered p85 to be an the MTG8-related protein
and isolated cDNA encoding a new member of the MTG8 family, MTGR1.
Three lines of evidence support our conclusion that MTGR1 is at least
one of the proteins which are referred to as p85. First, MTGR1 and p85
are phosphoproteins with almost the same mobility on SDS-polyacrylamide
gels and are recognized by anti-MTG8 antibody. Second, they
specifically interact with the same region of AML1-MTG8. Third, p85 is
recognized by two anti-MTGR1 antibodies. These antibodies are prepared
with MTGR1-specific sequences as antigens (Fig. 6A) and are highly specific for MTGR1; they did not react with MTG8 (Fig. 7). From these
results, we concluded that MTGR1 is one of the components of the
AML1-MTG8 complex. However, we do not rule out the possibility of the
presence of other factors which interact with AML1-MTG8, as does MTGR1.
Based on the good correlation between activity of AML1-MTG8 and its
interaction with MTGR1, AML1-MTG8 is most likely to function as a
complex with MTGR1. C-terminal deletion of AML1-MTG8 to residue 538 affects neither its interaction with MTGR1 nor its functions such as
stimulation of G-CSF-dependent cell proliferation and repression of
AML1b-dependent transcription. Further deletion to residue 487 eliminates its interaction with MTGR1 and its functions. Overexpression
of MTGR1 enhances AML1-MTG8-mediated induction of cell proliferation
and repression of transcription. Since MTGR1 is highly related to MTG8,
we assumed that AML1-MTG8 might also form a homomeric complex through
MTG8 sequences. However, coimmunoprecipitation analysis indicated that
the homomeric complex of AML1-MTG8 was not obvious, in contrast to the
heteromeric complex of AML1-MTG8 and MTGR1. The yeast two-hybrid system
indicates that MTGR1 can interact with MTGR1 and MTG8 by using the
minimum sequences for protein interaction (30a). These
results suggest that AML1-MTG8 forms a heteromeric complex with MTGR1
in preference to a homomeric complex when enough MTGR1 is present and
that MTGR1 can form both homomeric and heteromeric complexes with MTG8.
Differential interaction profiles have been identified in several
transcription factor complexes. In the case of Jun and Fos family
proteins, Jun forms both a homocomplex and a heterocomplex with Fos but
Fos is unlikely to form a homocomplex. Jun-Fos and Jun-Jun complexes
recognize the same DNA sequence, but Jun-Fos is a strong activator of
transcription compared with Jun-Jun (reviewed in reference
15). In the case of the retinoic acid receptor (RAR)
and the retinoid X receptor (RXR), RAR forms a heterocomplex with RXR
in preference to the homocomplex but RXR also functions as a
homocomplex. RAR-RXR and RXR-RXR bind the different DNA sequences and
probably regulate the transcription of different genes (reviewed in
reference 23). Thus, MTG8-MTGR1 might have a
different functional activity from the MTGR1 homocomplex.
Comparison of amino acid sequences of MTGR1, MTG8, and
Drosophila Nervy reveals that there are four evolutionarily
conserved sequence motifs (NHR1 to NHR4) (Fig. 6A), suggesting that
they have important functions. NHR1 also shows similarity to sequences of a central 80-amino-acid region of human TAF105, human TAF130, and
Drosophila TAF110 (3, 5, 7, 12, 52) (Fig. 6C). The locations of hydrophobic amino acids within this region are highly
conserved among MTGR1, MTG8, Nervy, and the three TAFs. The NHR2 is in
the region which is essential for interaction between MTG8 family
members. By using the Chou-Fasman algorithm (1) and the
Robson algorithm (9), the region containing the NHR2 is
predicted to present an
-helix. Analysis of helical wheels by the
method of Schiffer and Edmundson (48) suggests that the NHR2
is a helical domain with amphipathic characteristics (Fig. 6D). The
hydrophobic residues which appear in the hydrophobic side of the helix
are conserved among MTG8, MTGR1, and Nervy. This suggests that the
hydrophobic sides of the NHR2
-helices face each other to mediate
protein interactions between MTG8 family members. Since hydrophobic
residues are located in a 3-4-3-4 spacing (from amino acid 348 of MTGR1
and from amino acid 354 of MTG8: W - - L - - -L - - I - - - V - - T - - - M/L - - L - -),
this region of both proteins may form a coiled-coil structure that is
frequently observed in oligomerization domains (41). A
helical structure is also predicted in the NHR3 by the Chou-Fasman and Robson algorithms. The NHR4 regions correspond to the two zinc finger
motifs (Fig. 6A). These regions are the most highly conserved regions
among the three proteins. The zinc finger motifs also showed homology
to those of programmed cell death-induced RP-8 protein of rat, mouse,
and Caenorhabditis elegans (40) and to that of
Drosophila DEAF-1 protein, also known as Deformed response element-binding protein (11). Although many of the zinc
finger motifs serve as DNA-binding domains, it is not known if zinc
finger motifs of MTGR1 and MTG8 are involved in DNA binding. The normal function of MTG8 and MTGR1 is unclear, but these structural
characteristics, as well as their localization in the nucleus
(6), suggest that they are likely to function as
transcriptional regulators.
The molecular mechanism for AML1-MTG8 to promote leukemia has not yet
been fully clarified, but two hypotheses are possible. First, AML1-MTG8
may affect the normal function of AML1. Analysis with deletion mutants
indicates that repression of AML1-dependent transcription by AML1-MTG8
is closely linked to G-CSF-dependent cell proliferation. Cotransfection
of MTGR1 further represses the AML1-dependent transcription. Since
AML1-MTG8 retains the rhd, it binds to CBF
/PEBP2
(Fig. 1B) as
well as to the specific DNA sequence for AML1 (25). Thus,
AML1-MTG8 is likely to repress transcription as a heterotrimer with
MTGR1 and CBF
/PEBP2
by binding to the AML1-binding site (Fig.
12). It is possible to speculate that
the AML1-MTG8/CBF
/MTGR1 complex may inhibit the formation of a
transcriptional initiation complex because of its abnormal structure
and/or other functions. Second, AML1-MTG8 may titrate out MTGR1 and/or
affect the normal function of MTGR1 by forming the AML1-MTG8/MTGR1
complex. If this hypothesis is true, the AML1-MTG8-mediated induction
of cell proliferation should be reversed by overexpression of MTGR1.
However, our results indicate that overexpression of MTGR1 stimulates
the action of AML1-MTG8. On the other hand, we have found that
overexpression of AML1b could reverse the AML1-MTG8-induced cell
proliferation (18a). Therefore, we prefer the former
hypothesis that AML1-MTG8 might repress AML1-dependent transcription by
binding to the DNA sequence for AML1 as the heterotrimer with MTGR1 and CBF
.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 12.
Model for the action of AML1-MTG8 on repression of
transcription. AML1-MTG8 forms a heterotrimer complex with MTGR1 and
CBF /PEBP2 through the regions containing the NHR2 and the rhd,
respectively. The complex binds to the DNA sequence for AML1 and
represses transcription from the adjacent target genes.
|
|
 |
ACKNOWLEDGMENTS |
I.K., K.I., and F.M. contributed equally to this work.
We thank T. Honjyo for L-G cells, A. D. Miller for retrovirus
vectors, David Baltimore for BOSC23 cells, Y. Ito for TCR
-CAT plasmid, and T. Kitamura for suggestions about retrovirus infection. We
also thank H. Ichikawa for helpful discussions, N. Munakata for
suggestions about protein structure, and M. Mori and C. Hatanaka for
technical assistance. We thank Kazusa DNA Research Institute for help
in screening the KG1 cDNA library.
This work was supported in part by a Grant-in-Aid for Scientific
Research on Priority Areas from the Ministry of Education, Science and
Culture; by a grant from the Special Coordination Funds for the
Promotion of Science and Technology from the Science and Technology
Agency; by a Grant-in-Aid for the Comprehensive 10-Year Strategy for
Cancer Control and the Grant for Research on Aging and Health from the
Ministry of Health and Welfare; and by the Program for Promotion of
Fundamental Studies in Health Sciences of the Organization for Drug ADR
Relief, R&D Promotion and Product Review of Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Radiobiology
Division, National Cancer Center Research Institute, 5-1-1 Tsukiji,
Chuo-ku, Tokyo 104, Japan. Phone: 81-3-3542-2511, ext. 4751. Fax:
81-3-3542-0688. E-mail: ikitabay{at}ncc.go.jp.
 |
REFERENCES |
| 1.
|
Chou, P. Y., and G. D. Fasman.
1978.
Prediction of the secondary structure of proteins from their amino acid sequence.
Adv. Enzymol. Relat. Areas Mol. Biol.
47:45-148[Medline].
|
| 2.
|
Daga, A.,
J. E. Tighe, and F. Calabi.
1992.
Leukaemia/Drosophila homology.
Nature
356:484[Medline].
|
| 3.
|
Dickstein, R.,
Z. Sharleen, and R. Tjian.
1996.
Human TAFII105 is a cell type specific TFIID subunit related to hTAF130.
Cell
87:137-146[Medline].
|
| 4.
|
Erickson, P.,
J. Gao,
K. S. Chang,
T. Look,
E. Whisenant,
S. Raimondi,
R. Lasher,
J. Trujilo,
J. Rowley, and H. Drabkin.
1992.
Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt.
Blood
80:1825-1831[Abstract/Free Full Text].
|
| 5.
|
Erickson, P. F.,
M. Robinson,
G. Owens, and H. A. Drabkin.
1994.
The ETO portion of acute myeloid leukemia t(8;21) fusion transcript encodes a highly evolutionarily conserved, putative transcription factor.
Cancer Res.
54:1782-1786[Abstract/Free Full Text].
|
| 6.
|
Erickson, P. F.,
G. Dessev,
R. S. Lasher,
G. Philips,
M. Robinson, and H. A. Drabkin.
1996.
ETO and AML1 phosphoproteins are expressed in CD34+ hematopoietic progenitors: implications for t(8;21) leukemogenesis and monitoring residual disease.
Blood
88:1813-1823[Abstract/Free Full Text].
|
| 7.
|
Feinstein, P. G.,
K. Kornfeld,
D. S. Hogness, and R. S. Mann.
1995.
Identification of homeotic target genes in Drosophila melanogaster including nervy, a proto-oncogene homologue.
Genetics
140:573-586[Abstract].
|
| 8.
|
Frank, R.,
J. Zhang,
S. Meyers,
S. W. Hiebert, and S. D. Nimer.
1995.
The AML1/ETO fusion protein blocks transactivation of the GM-CSF promoter by AML1B.
Oncogene
11:2667-2674[Medline].
|
| 9.
|
Garnier, J.,
D. J. Osguthorpe, and B. Robson.
1978.
Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular mproteins.
J. Mol. Biol.
120:97-120[Medline].
|
| 10.
|
Golub, T. R.,
G. F. Barker,
S. K. Bohlander,
S. W. Hiebert,
D. C. Ward,
P. Brayward,
E. Morgan,
S. C. Raimondi,
J. D. Rowley, and D. G. Gilliland.
1995.
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc. Natl. Acad. Sci. USA
92:4917-4921[Abstract/Free Full Text].
|
| 11.
|
Gross, C. T., and W. McGinnis.
1996.
DEAF-1, a novel protein that binds an essential region in a Deformed response element.
EMBO J.
15:1961-1970[Medline].
|
| 12.
|
Hoey, T.,
R. O. J. Weinzieri,
G. Gill,
J.-L. Chen,
B. D. Dynlacht, and R. Tjian.
1993.
Molecular cloning and functional analysis of Drosophila TAF110 reveal properties expected of coactivators.
Cell
72:247-260[Medline].
|
| 13.
|
Kagoshima, H.,
K. Shigesada,
M. Satake,
Y. Ito,
H. Miyoshi,
M. Ohki,
M. Pepling, and J. P. Gergen.
1993.
The runt domain identifies a new family of heteromeric transcriptional regulators.
Trends Genet.
9:338-341[Medline].
|
| 14.
|
Kania, M. A.,
A. S. Bonner,
J. B. Duffy, and J. P. Gergen.
1990.
The Drosophila segmentation gene runt encodes a novel nuclear regulatory protein that is also expressed in the developing nervous system.
Genes Dev.
4:1701-1713[Abstract/Free Full Text].
|
| 15.
|
Karin, M.,
Z. Liu, and E. Zandi.
1997.
AP-1 function and regulation.
Curr. Opin. Cell Biol.
9:240-246[Medline].
|
| 16.
|
Kinashi, T.,
H. L. Kwang,
M. Ogawa,
K. Tohyama,
K. Tashiro,
R. Fukunaga,
S. Nagata, and T. Honjo.
1991.
Premature expression of the macrophage-colony stimulating factor receptor on a multipotential stem cell line does not alter differentiation lineages controlled by stromal cells used for coculture.
J. Exp. Med.
173:1267-1279[Abstract/Free Full Text].
|
| 17.
|
Kitabayashi, I.,
Z. Kawakami,
R. Chiu,
K. Ozawa,
T. Matsuoka,
S. Toyoshima,
T. Umesono,
R. M. Evans,
G. Gachelin, and K. Yokoyama.
1992.
Transcriptional regulation of the c-jun gene by retinoic acid and E1A during differentiation of F9 cells.
EMBO J.
11:167-175[Medline].
|
| 18.
|
Kitabayashi, I.,
R. Eckner,
Z. Arany,
R. Chiu,
G. Gachelin,
D. M. Livingstone, and K. Yokoyama.
1995.
Phosphorylation of the adenovirus E1A-associated 300 kDa protein in response to retinoic acid and E1A during the differentiation of F9 cells.
EMBO J.
14:3496-3509[Medline].
|
| 18a.
| Kitabayashi, I., et al. Unpublished data.
|
| 19.
|
Kozu, T.,
H. Miyoshi,
K. Shimizu,
N. Maseki,
Y. Kaneko,
H. Asou,
N. Kamada, and M. Ohki.
1993.
Junctions of AML1/MTG8(ETO) fusion are constant in t(8;21) acute myeloid leukemia detected by reverse transcription polymerase chain reaction.
Blood
82:1270-1276[Abstract/Free Full Text].
|
| 20.
|
Lenny, N.,
S. Meyers, and S. W. Hiebert.
1995.
Functional domains of the t(8;21) fusion protein, AML1/ETO.
Oncogene
11:1761-1769[Medline].
|
| 21.
|
Levanon, D.,
V. Negreanu,
Y. Bernstein,
I. Bar-Am,
L. Avivi, and Y. Groner.
1994.
AML1, AML2 and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization.
Genomics
23:425-432[Medline].
|
| 22.
|
Liu, P.,
S. A. Tarle,
A. Hajra,
D. F. Claxton,
P. Marlton,
M. Freedman,
M. J. Siciliano, and F. S. Collins.
1993.
Fusion between transcription factor CBF /PEBP2 and a myosin heavy chain in acute myeloid leukemia.
Science
261:1041-1044[Abstract/Free Full Text].
|
| 23.
|
Mangelsdorf, D. J.,
C. Thummel,
M. Beato,
P. Herrlich,
G. Schutz,
K. Umesono,
B. Blumberg,
P. Kastner,
M. Mark,
P. Chambon, and R. M. Evans.
1995.
The nuclear receptor superfamily: the second decade.
Cell
83:835-839[Medline].
|
| 24.
|
Meyers, S.,
J. R. Dowing, and S. W. Hiebert.
1993.
Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions.
Mol. Cell. Biol.
13:6336-6345[Abstract/Free Full Text].
|
| 25.
|
Meyers, S.,
N. Lenny, and S. W. Hiebert.
1995.
The t(8;21) fusion protein interferes with AML 1B-dependent transcriptional activation.
Mol. Cell. Biol.
15:1974-1982[Abstract].
|
| 26.
|
Miller, A. D.,
D. G. Miller,
J. V. Garcia, and C. M. Lynch.
1993.
Use of retroviral vectors for gene transfer and expression.
Methods Enzymol.
217:581-599[Medline].
|
| 27.
|
Mitani, K.,
S. Ogawa,
T. Tanaka,
H. Miyoshi,
M. Kurokawa,
H. Mano,
Y. Yazaki,
M. Ohki, and H. Hirai.
1994.
Generation of the AML1-Evi-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia.
EMBO J.
13:504-510[Medline].
|
| 28.
|
Miyoshi, H.,
K. Shimizu,
T. Kozu,
N. Maseki,
Y. Kaneko, and M. Ohki.
1991.
t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1.
Proc. Natl. Acad. Sci. USA
88:10431-10434[Abstract/Free Full Text].
|
| 29.
|
Miyoshi, H.,
T. Kozu,
K. Shimizu,
K. Enomoto,
N. Maseki,
Y. Kaneko,
N. Kamada, and M. Ohki.
1993.
The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript.
EMBO J.
12:2715-2721[Medline].
|
| 30.
|
Miyoshi, H.,
M. Ohira,
K. Shimizu,
K. Mitani,
H. Hirai,
T. Imai,
K. Yokoyama,
E. Soeda, and M. Ohki.
1995.
Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia.
Nucleic Acids Res.
23:2762-2769[Abstract/Free Full Text].
|
| 30a.
| Morohoshi, F., et al. Unpublished data.
|
| 31.
|
Niki, M.,
H. Okada,
H. Takano,
J. Kuno,
K. Tani,
H. Hibino,
S. Asano,
Y. Ito,
M. Satake, and T. Noda.
1997.
Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor.
Proc. Natl. Acad. Sci. USA
94:5697-5702[Abstract/Free Full Text].
|
| 32.
|
Nisson, P. E.,
P. C. Watkins, and N. Sacchi.
1992.
Transcriptionally active chimeric gene derived from the fusion of the AML1 gene and a novel gene on chromosome 8 in t(8;21) leukemic cells.
Cancer Genet. Cytogenet.
63:81-88[Medline].
|
| 33.
|
Nomura, N.,
N. Miyajima,
T. Sazuka,
A. Tanaka,
Y. Kawarabayashi,
S. Sato,
T. Nagase,
N. Seki,
K. Ishikawa, and S. Tabata.
1994.
Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1.
DNA Res.
1:27-35[Abstract/Free Full Text].
|
| 34.
|
Nuchprayoon, I.,
S. Meyers,
L. M. Scott,
J. Suzow,
S. Hiebert, and A. D. Friedman.
1994.
PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2 /CBF proto-oncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes in immature myeloid cells.
Mol. Cell. Biol.
14:5558-5568[Abstract/Free Full Text].
|
| 35.
|
Nucifora, G.,
C. R. Begy,
P. Erickson,
H. A. Drabkin, and J. D. Rowley.
1993.
The 3;21 translocation in myelodysplasia results in a fusion transcript, the AML1 gene and the gene for EAP, a highly conserved protein associated with Epstein-Barr virus small RNA EBER 1.
Proc. Natl. Acad. Sci. USA
90:7784-7788[Abstract/Free Full Text].
|
| 36.
|
Nucifora, G.,
C. R. Begy,
H. Kobayashi,
D. Roulston,
D. Claxton,
J. Pedersen-Bjergaad,
E. Parganas,
J. N. Ihle, and J. D. Rowley.
1994.
Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations.
Proc. Natl. Acad. Sci. USA
91:4004-4008[Abstract/Free Full Text].
|
| 37.
|
Ogawa, E.,
M. Inuzuka,
M. Maruyama,
M. Satake,
M. Naito-Fujimoto,
Y. Ito, and K. Shigesada.
1993.
Molecular cloning and characterization of PEBP2 , the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2.
Virology
194:314-331[Medline].
|
| 38.
|
Ogawa, E.,
M. Maruyama,
H. Kagoshima,
M. Inuzuka,
J. Lu,
M. Satake,
K. Shigesada, and Y. Ito.
1993.
PEBP2/PEA2 represents a family of transcription factors homologous to the Drosophila runt gene and the human AML1 gene.
Proc. Natl. Acad. Sci. USA
90:6859-6863[Abstract/Free Full Text].
|
| 39.
|
Okuda, T.,
J. van Deusen,
S. W. Hiebert,
G. Grosveld, and J. R. Downing.
1996.
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321-330[Medline].
|
| 40.
|
Owens, G. P.,
W. E. Hahn, and J. J. Cohen.
1991.
Identification of mRNAs associated with programmed cell death in immature thymocytes.
Mol. Cell. Biol.
11:4177-4188[Abstract/Free Full Text].
|
| 41.
|
Parry, D. A. D.
1982.
Coiled-coils in -helix containing proteins: analysis of the residue types within the heptad repeat and the use of these data in the prediction of coiled-coils in other proteins.
Biosci. Rep.
2:1017-1024[Medline].
|
| 42.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 43.
|
Prosser, H. M.,
D. Wotton,
A. Gegonne,
J. Ghysdael,
S. Wang,
N. A. Speck, and M. J. Owen.
1992.
A phorbol ester response element within the human T-cell receptor -chain enhancer.
Proc. Natl. Acad. Sci. USA
89:9934-9938[Abstract/Free Full Text].
|
| 44.
|
Rabbitts, T. H.
1994.
Chromosomal translocations in human cancer.
Nature
372:143-149[Medline].
|
| 45.
|
Redondo, J. M.,
J. L. Pfohl,
C. Hernandez-Munain,
S. Wang,
N. A. Speck, and M. S. Krangel.
1992.
Indistinguishable nuclear factor binding to functional core sites of the T-cell receptor and murine leukemia virus enhancers.
Mol. Cell. Biol.
12:4817-4823[Abstract/Free Full Text].
|
| 46.
|
Romana, S. P.,
M. Mauchauffe,
M. Le Coniat,
I. Chumakov,
D. Le Paslier,
R. Berger, and O. A. Bernard.
1995.
The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion.
Blood
85:3662-3670[Abstract/Free Full Text].
|
| 47.
|
Sasaki, K.,
H. Yagi,
R. T. Bronson,
K. Tominaga,
T. Matsunashi,
K. Deguchi,
Y. Tani,
T. Kishimoto, and T. Komori.
1996.
Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta.
Proc. Natl. Acad. Sci. USA
93:12359-12363[Abstract/Free Full Text].
|
| 48.
|
Schiffer, M., and A. B. Edmundson.
1967.
Use of helical wheels to present the structures of proteins and to identify segments with helical potential.
Biophys. J.
7:121-135.
|
| 49.
|
Shoemaker, S. G.,
R. Hromas, and K. Kaushansky.
1990.
Transcriptional regulation of interleukin 3 gene expression in T lymphocytes.
Proc. Natl. Acad. Sci. USA
87:9650-9654[Abstract/Free Full Text].
|
| 50.
|
Takahashi, A.,
M. Satake,
Y. Yamaguchi-Iwai,
S. C. Bae,
J. Lu,
M. Maruyama,
Y. M. Zhang,
H. Oka,
N. Arai,
K. Arai, and Y. Ito.
1995.
Positive and negative regulation of granulocyte macrophage colony-stimulating factor promoter activity by AML1-related transcription factor, PEBP2.
Blood
86:607-616[Abstract/Free Full Text].
|
| 51.
|
Tanaka, T.,
K. Tanaka,
S. Ogawa,
M. Kurokawa,
K. Mitani,
J. Nishida,
J. Shibata,
Y. Yazaki, and H. Hirai.
1995.
An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms.
EMBO J.
14:341-350[Medline].
|
| 52.
|
Tanese, N.,
D. Saluja,
M. F. Vassallo,
J.-L. Chen, and A. Admon.
1996.
Molecular cloning and analysis of two subunits of the human TFIID complex: hTAFII130 and hTAFII100.
Proc. Natl. Acad. Sci. USA
93:13611-13616[Abstract/Free Full Text].
|
| 53.
|
Wang, Q.,
T. Stacy,
M. Binder,
M. Marin-Padilla,
A. H. Sharpe, and N. A. Speck.
1996.
Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis.
Proc. Natl. Acad. Sci. USA
93:3444-3449[Abstract/Free Full Text].
|
| 54.
|
Wang, Q.,
T. Stacy,
J. D. Miller,
A. F. Lewis,
T. L. Gu,
X. Huang,
J. H. Bushweller,
J. C. Bories,
F. W. Alt,
G. Ryan,
P. P. Liu,
A. Wynshaw-Boris,
M. Binder,
M. Marin-Padilla,
A. H. Sharpe, and N. A. Speck.
1996.
The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo.
Cell
87:697-708[Medline].
|
| 55.
|
Wang, S.,
Q. Wang,
B. E. Crute,
I. N. Melnikova,
S. R. Keller, and N. A. Speck.
1993.
Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor.
Mol. Cell. Biol.
13:3324-3339[Abstract/Free Full Text].
|
| 56.
|
Wargnier, A.,
S. Legros-Maida,
R. Bosselut,
J. F. Bourge,
C. Lafaurie,
C. J. Ghysdael,
M. Sasportes, and P. Paul.
1995.
Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation.
Proc. Natl. Acad. Sci. USA
92:6930-6934[Abstract/Free Full Text].
|
| 57.
|
Zhang, D. E.,
K. Fujioka,
C. J. Hetherington,
L. H. Shapiro,
H. M. Chen,
A. T. Look, and D. G. Tenen.
1994.
Identification of a region which directs the monocytic activity of the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF (AML1).
Mol. Cell. Biol.
14:8085-8095[Abstract/Free Full Text].
|
Mol Cell Biol, February 1998, p. 846-858, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
DE BRAEKELEER, E., FEREC, C., DE BRAEKELEER, M.
(2009). RUNX1 Translocations in Malignant Hemopathies. Anticancer Res
29: 1031-1037
[Abstract]
[Full Text]
-
Roudaia, L., Cheney, M. D., Manuylova, E., Chen, W., Morrow, M., Park, S., Lee, C.-T., Kaur, P., Williams, O., Bushweller, J. H., Speck, N. A.
(2009). CBF{beta} is critical for AML1-ETO and TEL-AML1 activity. Blood
113: 3070-3079
[Abstract]
[Full Text]
-
Chyla, B. J., Moreno-Miralles, I., Steapleton, M. A., Thompson, M. A., Bhaskara, S., Engel, M., Hiebert, S. W.
(2008). Deletion of Mtg16, a Target of t(16;21), Alters Hematopoietic Progenitor Cell Proliferation and Lineage Allocation. Mol. Cell. Biol.
28: 6234-6247
[Abstract]
[Full Text]
-
Kumar, R., Cheney, K. M., McKirdy, R., Neilsen, P. M., Schulz, R. B., Lee, J., Cohen, J., Booker, G. W., Callen, D. F.
(2008). CBFA2T3-ZNF652 Corepressor Complex Regulates Transcription of the E-box Gene HEB. J. Biol. Chem.
283: 19026-19038
[Abstract]
[Full Text]
-
Moore, A. C., Amann, J. M., Williams, C. S., Tahinci, E., Farmer, T. E., Martinez, J. A., Yang, G., Luce, K. S., Lee, E., Hiebert, S. W.
(2008). Myeloid Translocation Gene Family Members Associate with T-Cell Factors (TCFs) and Influence TCF-Dependent Transcription. Mol. Cell. Biol.
28: 977-987
[Abstract]
[Full Text]
-
Kumar, R., Manning, J., Spendlove, H. E., Kremmidiotis, G., McKirdy, R., Lee, J., Millband, D. N., Cheney, K. M., Stampfer, M. R., Dwivedi, P. P., Morris, H. A., Callen, D. F.
(2006). ZNF652, A Novel Zinc Finger Protein, Interacts with the Putative Breast Tumor Suppressor CBFA2T3 to Repress Transcription. Mol Cancer Res
4: 655-665
[Abstract]
[Full Text]
-
Amann, J. M., Chyla, B. J. I., Ellis, T. C., Martinez, A., Moore, A. C., Franklin, J. L., McGhee, L., Meyers, S., Ohm, J. E., Luce, K. S., Ouelette, A. J., Washington, M. K., Thompson, M. A., King, D., Gautam, S., Coffey, R. J., Whitehead, R. H., Hiebert, S. W.
(2005). Mtgr1 Is a Transcriptional Corepressor That Is Required for Maintenance of the Secretory Cell Lineage in the Small Intestine. Mol. Cell. Biol.
25: 9576-9585
[Abstract]
[Full Text]
-
Frohling, S., Scholl, C., Gilliland, D. G., Levine, R. L.
(2005). Genetics of Myeloid Malignancies: Pathogenetic and Clinical Implications. JCO
23: 6285-6295
[Abstract]
[Full Text]
-
Sledz, C. A., Williams, B. R. G.
(2005). RNA interference in biology and disease. Blood
106: 787-794
[Abstract]
[Full Text]
-
Liu, S., Shen, T., Huynh, L., Klisovic, M. I., Rush, L. J., Ford, J. L., Yu, J., Becknell, B., Li, Y., Liu, C., Vukosavljevic, T., Whitman, S. P., Chang, K.-S., Byrd, J. C., Perrotti, D., Plass, C., Marcucci, G.
(2005). Interplay of RUNX1/MTG8 and DNA Methyltransferase 1 in Acute Myeloid Leukemia. Cancer Res.
65: 1277-1284
[Abstract]
[Full Text]
-
Nguyen, L. A., Pandolfi, P. P., Aikawa, Y., Tagata, Y., Ohki, M., Kitabayashi, I.
(2005). Physical and functional link of the leukemia-associated factors AML1 and PML. Blood
105: 292-300
[Abstract]
[Full Text]
-
Yan, M., Burel, S. A., Peterson, L. F., Kanbe, E., Iwasaki, H., Boyapati, A., Hines, R., Akashi, K., Zhang, D.-E.
(2004). From the Cover: Deletion of an AML1-ETO C-terminal NcoR/SMRT-interacting region strongly induces leukemia development. Proc. Natl. Acad. Sci. USA
101: 17186-17191
[Abstract]
[Full Text]
-
Lausen, J., Cho, S., Liu, S., Werner, M. H.
(2004). The Nuclear Receptor Co-repressor (N-CoR) Utilizes Repression Domains I and III for Interaction and Co-repression with ETO. J. Biol. Chem.
279: 49281-49288
[Abstract]
[Full Text]
-
Zhang, J., Kalkum, M., Yamamura, S., Chait, B. T., Roeder, R. G.
(2004). E Protein Silencing by the Leukemogenic AML1-ETO Fusion Protein. Science
305: 1286-1289
[Abstract]
[Full Text]
-
Ibanez, V., Sharma, A., Buonamici, S., Verma, A., Kalakonda, S., Wang, J., Kadkol, S., Saunthararajah, Y.
(2004). AML1-ETO Decreases ETO-2 (MTG16) Interactions with Nuclear Receptor Corepressor, an Effect That Impairs Granulocyte Differentiation. Cancer Res.
64: 4547-4554
[Abstract]
[Full Text]
-
Chevallier, N., Corcoran, C. M., Lennon, C., Hyjek, E., Chadburn, A., Bardwell, V. J., Licht, J. D., Melnick, A.
(2004). ETO protein of t(8;21) AML is a corepressor for Bcl-6 B-cell lymphoma oncoprotein. Blood
103: 1454-1463
[Abstract]
[Full Text]
-
Mulloy, J. C., Cammenga, J., Berguido, F. J., Wu, K., Zhou, P., Comenzo, R. L., Jhanwar, S., Moore, M. A. S., Nimer, S. D.
(2003). Maintaining the self-renewal and differentiation potential of human CD34+ hematopoietic cells using a single genetic element. Blood
102: 4369-4376
[Abstract]
[Full Text]
-
Barseguian, K., Lutterbach, B., Hiebert, S. W., Nickerson, J., Lian, J. B., Stein, J. L., van Wijnen, A. J., Stein, G. S.
(2002). Multiple subnuclear targeting signals of the leukemia-related AML1/ETO and ETO repressor proteins. Proc. Natl. Acad. Sci. USA
99: 15434-15439
[Abstract]
[Full Text]
-
Yokoyama, A., Kitabayashi, I., Ayton, P. M., Cleary, M. L., Ohki, M.
(2002). Leukemia proto-oncoprotein MLL is proteolytically processed into 2 fragments with opposite transcriptional properties. Blood
100: 3710-3718
[Abstract]
[Full Text]
-
Schwieger, M., Lohler, J., Friel, J., Scheller, M., Horak, I., Stocking, C.
(2002). AML1-ETO Inhibits Maturation of Multiple Lymphohematopoietic Lineages and Induces Myeloblast Transformation in Synergy with ICSBP Deficiency. JEM
196: 1227-1240
[Abstract]
[Full Text]
-
Hug, B. A., Lee, S. Y. D., Kinsler, E. L., Zhang, J., Lazar, M. A.
(2002). Cooperative Function of Aml1-ETO Corepressor Recruitment Domains in the Expansion of Primary Bone Marrow Cells. Cancer Res.
62: 2906-2912
[Abstract]
[Full Text]
-
Schillace, R. V., Andrews, S. F., Liberty, G. A., Davey, M. P., Carr, D. W.
(2002). Identification and Characterization of Myeloid Translocation Gene 16b as a Novel A Kinase Anchoring Protein in T Lymphocytes. J. Immunol.
168: 1590-1599
[Abstract]
[Full Text]
-
Michaud, J., Wu, F., Osato, M., Cottles, G. M., Yanagida, M., Asou, N., Shigesada, K., Ito, Y., Benson, K. F., Raskind, W. H., Rossier, C., Antonarakis, S. E., Israels, S., McNicol, A., Weiss, H., Horwitz, M., Scott, H. S.
(2002). In vitro analyses of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: implications for mechanisms of pathogenesis. Blood
99: 1364-1372
[Abstract]
[Full Text]
-
Mulloy, J. C., Cammenga, J., MacKenzie, K. L., Berguido, F. J., Moore, M. A. S., Nimer, S. D.
(2002). The AML1-ETO fusion protein promotes the expansion of human hematopoietic stem cells. Blood
99: 15-23
[Abstract]
[Full Text]
-
Amann, J. M., Nip, J., Strom, D. K., Lutterbach, B., Harada, H., Lenny, N., Downing, J. R., Meyers, S., Hiebert, S. W.
(2001). ETO, a Target of t(8;21) in Acute Leukemia, Makes Distinct Contacts with Multiple Histone Deacetylases and Binds mSin3A through Its Oligomerization Domain. Mol. Cell. Biol.
21: 6470-6483
[Abstract]
[Full Text]
-
Burel, S. A., Harakawa, N., Zhou, L., Pabst, T., Tenen, D. G., Zhang, D.-E.
(2001). Dichotomy of AML1-ETO Functions: Growth Arrest versus Block of Differentiation. Mol. Cell. Biol.
21: 5577-5590
[Abstract]
[Full Text]
-
Calabi, F., Pannell, R., Pavloska, G.
(2001). Gene Targeting Reveals a Crucial Role for MTG8 in the Gut. Mol. Cell. Biol.
21: 5658-5666
[Abstract]
[Full Text]
-
Zhang, J., Hug, B. A., Huang, E. Y., Chen, C. W., Gelmetti, V., Maccarana, M., Minucci, S., Pelicci, P. G., Lazar, M. A.
(2001). Oligomerization of ETO Is Obligatory for Corepressor Interaction. Mol. Cell. Biol.
21: 156-163
[Abstract]
[Full Text]
-
Bruserud, O., Gjertsen, B. T., Huang, T.-s.
(2000). Induction of Differentiation and Apoptosis-- A Possible Strategy in the Treatment of Adult Acute Myelogenous Leukemia. The Oncologist
5: 454-462
[Abstract]
[Full Text]
-
Wood, J. D., Nucifora, F. C. , Jr., Duan, K., Zhang, C., Wang, J., Kim, Y., Schilling, G., Sacchi, N., Liu, J. M., Ross, C. A.
(2000). Atrophin-1, the Dentato-rubral and Pallido-luysian Atrophy Gene Product, Interacts with ETO/MTG8 in the Nuclear Matrix and Represses Transcription. JCB
150: 939-948
[Abstract]
[Full Text]
-
Shimada, H., Ichikawa, H., Nakamura, S., Katsu, R., Iwasa, M., Kitabayashi, I., Ohki, M.
(2000). Analysis of genes under the downstream control of the t(8;21) fusion protein AML1-MTG8: overexpression of the TIS11b (ERF-1, cMG1) gene induces myeloid cell proliferation in response to G-CSF. Blood
96: 655-663
[Abstract]
[Full Text]
-
Shimizu, K., Kitabayashi, I., Kamada, N., Abe, T., Maseki, N., Suzukawa, K., Ohki, M.
(2000). AML1-MTG8 leukemic protein induces the expression of granulocyte colony-stimulating factor (G-CSF) receptor through the up-regulation of CCAAT/enhancer binding protein epsilon. Blood
96: 288-296
[Abstract]
[Full Text]
-
Melnick, A. M., Westendorf, J. J., Polinger, A., Carlile, G. W., Arai, S., Ball, H. J., Lutterbach, B., Hiebert, S. W., Licht, J. D.
(2000). The ETO Protein Disrupted in t(8;21)-Associated Acute Myeloid Leukemia Is a Corepressor for the Promyelocytic Leukemia Zinc Finger Protein. Mol. Cell. Biol.
20: 2075-2086
[Abstract]
[Full Text]
-
McNeil, S., Zeng, C., Harrington, K. S., Hiebert, S., Lian, J. B., Stein, J. L., van Wijnen, A. J., Stein, G. S.
(1999). The t(8;21) chromosomal translocation in acute myelogenous leukemia modifies intranuclear targeting of the AML1/CBFalpha 2 transcription factor. Proc. Natl. Acad. Sci. USA
96: 14882-14887
[Abstract]
[Full Text]
-
Ichikawa, H., Shimizu, K., Katsu, R., Ohki, M.
(1999). Dual Transforming Activities of the FUS (TLS)-ERG Leukemia Fusion Protein Conferred by Two N-Terminal Domains of FUS (TLS). Mol. Cell. Biol.
19: 7639-7650
[Abstract]
[Full Text]
-
Michelson, R. J., Collard, M. W., Ziemba, A. J., Persinger, J., Bartholomew, B., Huggenvik, J. I.
(1999). Nuclear DEAF-1-related (NUDR) Protein Contains a Novel DNA Binding Domain and Represses Transcription of the Heterogeneous Nuclear Ribonucleoprotein A2/B1 Promoter. J. Biol. Chem.
274: 30510-30519
[Abstract]
[Full Text]
-
Kasper, L. H., Brindle, P. K., Schnabel, C. A., Pritchard, C. E. J., Cleary, M. L., van Deursen, J. M. A.
(1999). CREB Binding Protein Interacts with Nucleoporin-Specific FG Repeats That Activate Transcription and Mediate NUP98-HOXA9 Oncogenicity. Mol. Cell. Biol.
19: 764-776
[Abstract]
[Full Text]
-
Lutterbach, B., Westendorf, J. J., Linggi, B., Patten, A., Moniwa, M., Davie, J. R., Huynh, K. D., Bardwell, V. J., Lavinsky, R. M., Rosenfeld, M. G., Glass, C., Seto, E., Hiebert, S. W.
(1998). ETO, a Target of t(8;21) in Acute Leukemia, Interacts with the N-CoR and mSin3 Corepressors. Mol. Cell. Biol.
18: 7176-7184
[Abstract]
[Full Text]
-
Gelmetti, V., Zhang, J., Fanelli, M., Minucci, S., Pelicci, P. G., Lazar, M. A.
(1998). Aberrant Recruitment of the Nuclear Receptor Corepressor-Histone Deacetylase Complex by the Acute Myeloid Leukemia Fusion Partner ETO. Mol. Cell. Biol.
18: 7185-7191
[Abstract]
[Full Text]
-
Fracchiolla, N. S., Colombo, G., Finelli, P., Maiolo, A. T., Neri, A.
(1998). EHT, a New Member of the MTG8/ETO Gene Family, Maps on 20q11 Region and Is Deleted in Acute Myeloid Leukemias. Blood
92: 3481-3484
[Full Text]
-
Lutterbach, B., Sun, D., Schuetz, J., Hiebert, S. W.
(1998). The MYND Motif Is Required for Repression of Basal Transcription from the Multidrug Resistance 1 Promoter by the t(8;21) Fusion Protein. Mol. Cell. Biol.
18: 3604-3611
[Abstract]
[Full Text]
-
Gamou, T., Kitamura, E., Hosoda, F., Shimizu, K., Shinohara, K., Hayashi, Y., Nagase, T., Yokoyama, Y., Ohki, M.
(1998). The Partner Gene of AML1 in t(16;21) Myeloid Malignancies Is a Novel Member of the MTG8(ETO) Family. Blood
91: 4028-4037
[Abstract]
[Full Text]
-
Jakubowiak, A., Pouponnot, C., Berguido, F., Frank, R., Mao, S., Massague, J., Nimer, S. D.
(2000). Inhibition of the Transforming Growth Factor beta 1 Signaling Pathway by the AML1/ETO Leukemia-associated Fusion Protein. J. Biol. Chem.
275: 40282-40287
[Abstract]
[Full Text]
-
Hildebrand, D., Tiefenbach, J., Heinzel, T., Grez, M., Maurer, A. B.
(2001). Multiple Regions of ETO Cooperate in Transcriptional Repression. J. Biol. Chem.
276: 9889-9895
[Abstract]
[Full Text]