Mol Cell Biol, February 1998, p. 859-871, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Regulation of Interferon-Induced Protein Kinase
PKR: Modulation of P58IPK Inhibitory Function by a Novel
Protein, P52rIPK
Michael
Gale Jr.,1
Collin M.
Blakely,1
Deborah A.
Hopkins,2
Mark W.
Melville,1
Marlene
Wambach,2
Patrick R.
Romano,3 and
Michael
G.
Katze1,2,*
Department of Microbiology, School of
Medicine,1 and
Regional Primate Research
Center,2 University of Washington, Seattle,
Washington 98195, and
Laboratory of Eukaryotic Gene Regulation,
National Institute of Child Health and Human Development, National
Institutes of Health, Bethesda, Maryland 208923
Received 15 August 1997/Returned for modification 14 October
1997/Accepted 4 November 1997
 |
ABSTRACT |
The cellular response to environmental signals is largely dependent
upon the induction of responsive protein kinase signaling pathways.
Within these pathways, distinct protein-protein interactions play a
role in determining the specificity of the response through regulation
of kinase function. The interferon-induced serine/threonine protein
kinase, PKR, is activated in response to various environmental stimuli.
Like many protein kinases, PKR is regulated through direct interactions
with activator and inhibitory molecules, including P58IPK,
a cellular PKR inhibitor. P58IPK functions to represses
PKR-mediated phosphorylation of the eukaryotic initiation factor 2
subunit (eIF-2
) through a direct interaction, thereby relieving the
PKR-imposed block on mRNA translation and cell growth. To further
define the molecular mechanism underlying regulation of PKR, we have
utilized an interaction cloning strategy to identify a novel cDNA
encoding a P58IPK-interacting protein. This protein,
designated P52rIPK, possesses limited homology to the
charged domain of Hsp90 and is expressed in a wide range of cell lines.
P52rIPK and P58IPK interacted in a yeast
two-hybrid assay and were recovered as a complex from mammalian cell
extracts. When coexpressed with PKR in yeast, P58IPK
repressed PKR-mediated eIF-2
phosphorylation, inhibiting the normally toxic and growth-suppressive effects associated with PKR
function. Conversely, introduction of P52rIPK into these
strains resulted in restoration of both PKR activity and eIF-2
phosphorylation, concomitant with growth suppression due to inhibition
of P58IPK function. Furthermore, P52rIPK
inhibited P58IPK function in a reconstituted in vitro
PKR-regulatory assay. Our results demonstrate that P58IPK
is inhibited through a direct interaction with P52rIPK
which, in turn, results in upregulation of PKR activity. Taken together, our data describe a novel protein kinase-regulatory system
which encompasses an intersection of interferon-, stress-, and
growth-regulatory pathways.
 |
INTRODUCTION |
In eukaryotes, the cellular response
to changing physiological and environmental conditions includes the
induction of signaling and regulatory pathways which function to
modulate gene expression and cell cycle control. The ability to rapidly
respond to these changing conditions is often dependent upon cellular
regulatory pathways defined by the many protein kinase signaling
cascades which respond to environmental signals (70).
Examples include specific stress-responsive protein kinases such as the
mammalian Sek1 (62), Jnk/Sapk (77), and p38-Map
(73) protein kinases. These enzymes and the components of
their respective regulatory pathways provide rapid and sensitive
mechanisms that allow the cell to initiate specific stress response
programs. Similar to other stress-responsive kinases, the PKR protein
kinase (59) is regulated in response to specific
environmental stimuli (72). PKR is an interferon
(IFN)-induced gene product which is activated by binding to
double-stranded RNA or other polyanions (34, 45).
As a pivotal component of the IFN-induced cellular antiviral and
antiproliferative states (78), PKR is the target of virally encoded inhibitors (reviewed in references 42 and
43), making it unique among protein kinases. In
addition to its role in the IFN response, PKR is involved in cell
growth control and has been identified as a tumor suppressor gene
product (2, 48, 60). Activated PKR phosphorylates serine 51 within the alpha subunit of eukaryotic initiation factor 2 (eIF-2
),
leading to inhibition of protein synthesis and concomitant growth
suppression (reviewed in references 15 and
38). In addition to regulating protein synthesis,
PKR has been identified as a pivotal component of
double-stranded-RNA-mediated signaling events which lead to activation
of nuclear factor kappa B (NF-
B) and IFN regulatory factor
1-dependent gene transcription (51, 90), and it is a
mediator of stress-induced apoptosis (20, 91). Moreover, PKR
is activated in response to such environmental challenges as viral
infection (42), oxidative stresses, and possibly heat shock
(7, 71). Each of these events lead to acute phosphorylation
of eIF-2
and an immediate reduction in protein synthesis, thereby
limiting potential proteotoxic and/or cytotoxic outcomes
attributed to stress exposure. It is relevant that PKR is a member of a
family of functionally related eIF-2
kinases, including
reticulocyte-expressed HRI (12) and Saccharomyces cerevisiae GCN2 enzymes (23). Like PKR, GCN2 and HRI
are regulated in response to cellular stress, where they play an
important role in modulating gene expression in response to
environmental stimuli (reviewed in reference 38).
The molecular mechanisms which regulate PKR function in normally
dividing cells are largely unknown. However, we have previously identified P58IPK as a cellular inhibitor of PKR which is
recruited by influenza virus to inhibit PKR function during viral
infection (54-56). We hypothesized that P58IPK
resides within the cell in specific complexes with its own inhibitory proteins. Formation of a P58IPK-PKR complex results in
inhibition of kinase function and concomitant stimulation of mRNA
translation (69, 86). In response to activating stimuli,
which include viral infection, possibly other cellular stresses, and
signal transduction processes, P58IPK is released from its
inhibitor, enabling it to physically interact with PKR (31,
55). Overexpression of P58IPK in mammalian cells
results in malignant transformation as a result of the ability of
P58IPK to inhibit PKR (1). These studies
indicate that P58IPK possesses growth-regulatory and
oncogenic properties, possibly through inhibition of the PKR tumor
suppressor phenotype. Containing nine tandemly arranged
tetratricopeptide repeat (TPR) motifs (35) and a C-terminal
DnaJ homology region (19), P58IPK has structural
similarity to several members of the eukaryotic stress response protein
family, including the heat shock protein (Hsp)-interacting TPR proteins
Hip (39), Hop (81), FKBP52 (68), and
CyP-40 (92) (reviewed in reference 28) as
well as the eukaryotic DnaJ homologs Ydj-1 (10) and Hsp40
(64). The structural homology of P58IPK and
stress response proteins putatively identifies P58IPK as a
member of this protein family and suggests that P58IPK may
play a role in the cellular response to stress. In support of this, we
have recently identified Hsp40 as an inhibitor of P58IPK
function (58).
In an effort to further delineate the regulatory mechanisms and
upstream signals which function within the PKR-P58IPK
pathway, we have undertaken interaction cloning to identify cellular proteins which bind to and regulate P58IPK function. Here
we describe a novel P58IPK-regulatory protein, termed
P52rIPK, which has homology to the charged domain of Hsp90.
P52rIPK inhibits P58IPK through a direct
protein-protein interaction. These events lead to an upregulation of
PKR function, a resultant increase in eIF-2
phosphorylation, and
cell growth suppression. Our results suggest that P52rIPK
is a new member of the PKR-regulatory pathway. A model describing this
increasingly complex protein kinase-regulatory pathway is presented.
 |
MATERIALS AND METHODS |
Yeast two-hybrid assays and library screen for
P58IPK-interacting proteins.
The yeast two-hybrid
system (5) was used to isolate the
P52rIPK cDNA and to assess protein interactions
in vivo. To screen for cDNAs encoding P58IPK-interacting
proteins, S. cerevisiae Hf7c (MATa ura3-52 his3-200 lys2-801 ade2-101 trp1-901 leu2-3,112 gal4-542 gal80-538 LYS2::GAL1-HIS3 URA3 [GAL4
17-mers]3-CYC1-lacZ; Clontech) was transformed
with the bait plasmid pBD-P58IPK, encoding
P58IPK fused to the GAL4 DNA binding domain (BD)
(5). After confirming expression of the
BD-P58IPK fusion protein in transformed yeast, a library of
HeLa cell cDNAs fused to the GAL4 activation domain (AD) in pGADGH
(Clontech) was introduced by large-scale transformation, after which
the yeast cells were plated onto selective medium lacking histidine. To
increase the stringency of the two-hybrid library screen, we included
30 mM 3-aminotriazole, a competitive inhibitor of histidine biosynthesis (46), in the selective medium. Plates were
incubated at 30°C for 8 days, and resultant yeast colonies were
streaked onto medium lacking histidine in the presence of 30 mM
3-aminotriazole. To segregate the AD library plasmids from
pBD-P58IPK, yeast two-hybrid library clones were cultured
for 40 h in tryptophan-deficient liquid medium and replica plated
onto medium lacking leucine or lacking both tryptophan and leucine.
Segregated pGADGH library plasmids were isolated from yeast colonies
which failed to grow in the absence of tryptophan, transformed into
Escherichia coli, and purified. Specificity of the yeast
two-hybrid protein interaction was determined by introducing the
recovered library plasmids into S. cerevisiae Hf7c harboring
pBD-P58IPK or control plasmids encoding the BD vector alone
(pGBT9; Clontech), BD-simian virus 40 (SV40) T antigen (pTD1), or
BD-lamin (pLAM5') (31). BD-P58IPK interaction
specificity was confirmed by introducing pBD-P58IPK into
Hf7c harboring the AD plasmid pGAD425 or control plasmids encoding
AD-PKR K296R (pAD-PKR K296R), AD-SV40 T antigen (pTD2) (31),
or the AD library plasmid pGADGH. Only those library plasmids encoding
proteins which exhibited specific interaction with
BD-P58IPK were selected for further analyses. Of the
1.2 × 106 CFU screened, we recovered two identical
clones that met this criterion, each harboring the
P52rIPK cDNA.
Yeast two-hybrid assays were conducted to test the specific induction
of the individual His and LacZ reporter genes due
to protein interaction in yeast strain Hf7c. Analysis of His
reporter induction was conducted as described previously
(31). Briefly, yeast strains cotransformed with plasmids
encoding AD and BD fusion proteins were streaked onto
histidine-containing medium. After growth on histidine-containing
medium colonies were restreaked onto medium lacking histidine and
incubated at 30°C for 3 to 5 days to allow depletion of residual
histidine stores. Histidine-depleted colonies were streaked onto medium
lacking histidine and assessed for growth after 3 to 5 days of
incubation at 30°C. Strains that exhibited growth on medium lacking
histidine were subsequently scored as positive for a two-hybrid protein
interaction. For determination of lacZ induction, Hf7c
cotransformants were plated as patches onto histidine-containing medium
and incubated for 3 days at 30°C. Patches were then replica printed
onto histidine-containing medium containing 70 mM phosphate buffer (pH
7.0) and 200 µg of the
-galactosidase substrate
5-bromo-4-chloro-3-indoyl-
-D-galactopyranoside per ml.
After 3 to 5 days of growth at 30°C, patches were visually assessed
for the development of blue color, which is indicative of
LacZ induction and a two-hybrid protein interaction. In both the His and LacZ reporter assays, strains
harboring pCL1 (27), encoding wild-type GAL4, were employed
as a positive control.
Plasmid construction.
The yeast two-hybrid bait plasmid
pBD-P58IPK encodes BD-fused full length human
P58IPK (49), as described previously
(31). Plasmid pAD-P52 harbors the
P52rIPK cDNA in the yeast two-hybrid library
plasmid pGADGH. To facilitate P52rIPK cDNA probe
production and in vitro transcription reactions, the 1.5-kb
P52rIPK cDNA insert was excised from pAD-P52 as
an EcoRI fragment and cloned into the EcoRI site
of pBSK (Stratagene) to yield pBSK-P52. pCDNA1neo-P58IPK
and pGex2T-P58IPK encode full-length P58IPK
alone or as a glutathione S-transferase (GST) fusion
protein, respectively (54). pGST-P52 encodes full-length
P52rIPK fused to the C-terminus of GST and was constructed
by inserting the 1.5-kb EcoRI fragment from pAD-P52 into the
EcoRI site of pGex4T-3 (Pharmacia). The yeast expression
plasmid pYex-P58IPK was produced by inserting the
EcoRV/XbaI fragment from
pCDNA1neo-P58IPK into the galactose-inducible
URA3 2µm yeast expression plasmid pEMBLYex4
(11). pYex-PKR
295-300 encodes a PKR deletion mutant lacking amino acids (aa) 295 to 300 cloned into pEMBLYex4
(74). For expression of P52rIPK in yeast, the
P52rIPK coding region was amplified from pAD-P52
by PCR with the oligonucleotide primer pair
5'TTAGAATTCATGCCGAACTTCTGCGCTG (sense primer;
the EcoRI site is underlined) and
5'GCGCCCGGGATTTCATTTTTAAGAACAACA (antisense
primer; the SmaI site is underlined), encoding
P52rIPK nucleotides (nt) 1 to 19 and 1479 to
1500, respectively. PCR products were cleaved with EcoRI and
SmaI and cloned into the corresponding restriction sites of
the galactose-inducible TRP1 2µm yeast expression plasmid
pYX233 (Novagen) to yield pYX-P52.
Recombinant protein expression and generation of antiserum to
P52rIPK.
For production of GST or GST fusion proteins,
overnight 50-ml cultures of bacteria harboring pGex2T (80),
pGex2T-P58IPK (54), or pGST-P52 were split to an
optical density at 600 nm of 0.1 and grown for 1 h at 37°C.
After the addition of 1 mM isopropylthiogalactopyranoside, cultures
were grown for a further 3 h at 30°C and harvested by centrifugation. Production of protein extracts and purification of GST
or GST fusion proteins were carried out essentially as described
previously (80).
The generation of polyclonal antiserum to P52rIPK was
carried out by immunizing New Zealand White rabbits with purified
GST-P52rIPK as described previously (29).
Rabbits were immunized once with 100 µg of GST-P52rIPK in
5.0 ml of incomplete Freund's adjuvant containing 100 µg of N-acetylmuramyl-L-alanyl-D-isoglutamine.
Subsequent boosts of 100 µg of GST-P52rIPK in incomplete
Freund's adjuvant were administered at monthly intervals.
Anti-P52rIPK (
-P52rIPK) serum is specific to
P52rIPK as determined by immunoblot and immunoprecipitation
analyses.
Analysis of RNA.
For determination of mRNA expression, RNA
was extracted by the guanidinium isothiocyanate method (13)
from HeLa cells cultured overnight in the presence or absence of 1,000 U of human alpha IFN per ml. After poly(A) selection, RNA was
fractionated by electrophoresis in agarose-formaldehyde gels and
blotted to nylon membranes. 32P-labeled cDNA probe
production and Northern (RNA) blot hybridizations were performed as
described previously (30).
To determine if the P52rIPK cDNA isolated from
our yeast two-hybrid library screen encoded the intact 5' end of the
corresponding mRNA, we carried out anchor PCR analysis of
oligo(dT)-primed cDNA synthesized from subconfluent HeLa cells and
containing the 30-nt 5' anchor sequence
5'GATCCACTAGTTCTAGAGCGGCCGCCACCG3'. HeLa and control cDNAs
were amplified by PCR with the Stratagene SK primer (5'CGCTCTAGAACTAGTGGATC3'; anchor primer) and the
P52rIPK-specific primer
5'CTCACAGATCTCTAGCATCT3' (52rIPK nt
725 to 744). PCR products from HeLa cDNA and pBSK-P52 (control) comigrated when resolved by agarose gel electrophoresis. By this method
we determined that the P52rIPK cDNA clone
isolated in our two-hybrid library screen encoded the intact 5' end of
the corresponding P52rIPK mRNA (data not shown)
and that the size difference between the P52rIPK
mRNA and cDNA clone was due to the presence of a 3' untranslated region
(UTR) within the mRNA not present in the cloned cDNA.
In vitro translation, protein labeling, and immunoprecipitation
analysis.
P58IPK and P52rIPK were
transcribed from the T7 promoter of pCDNA1neo-P58IPK and
pBSK-P52, respectively, and translated in vitro by using the TNT
reaction system (Promega). For the production of labeled proteins,
translation reactions were carried out in the presence of
[35S]methionine and radiolabel incorporation was
quantitated by scintillation counting of the trichloroacetic
acid-precipitable reaction products. For in vivo protein labeling, HeLa
cells were incubated in methionine-deficient medium in the presence of
[35S]methionine for 16 h and harvested for
immunoprecipitation analysis as described previously (30).
Immunoprecipitation reactions were carried out with a 1:100 dilution of
rabbit preimmune or
-P52rIPK serum or a 1:500 dilution
of
-P58IPK monoclonal antibody 9F10 ascites fluid
(1). For immunoprecipitation of in vitro translation
products, reticulocyte extracts containing 105 counts of
[35S]methionine-labeled translation products were
incubated with the indicated antibody in the presence of
immunoprecipitation buffer I (50 mM KCl, 400 mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol [DTT], 20% glycerol, 1% Triton X-100, 100 U of
aprotinin per ml, 0.2 mM phenylmethylsulfonyl fluoride [PMSF], 20 mM
Tris, pH 7.5) as described previously (30). For
coimmunoprecipitation analysis with
-P52rIPK serum,
reticulocyte extracts containing 105 counts of labeled
P58IPK were mixed with extracts containing unlabeled in
vitro-translated P52rIPK. Similarly, for
-P58IPK coimmunoprecipitation analysis, reticulocyte
extracts containing 105 counts of labeled
P52rIPK were mixed with extracts containing unlabeled
P58IPK. Mixtures were incubated for 1 h at 4°C,
followed by the addition of the proper antibodies. For all
immunoprecipitation reactions, immunocomplexes were recovered by
centrifugation after the addition of protein G-agarose beads to the
reaction mixture. Beads were washed extensively with ice-cold buffer I
followed by three washes with ice-cold buffer II (100 mM KCl, 0.1 mM
EDTA, 20% glycerol, 100 U of aprotinin per ml, 0.2 mM PMSF, 10 mM
Tris, pH 7.5), resuspended in sodium dodecyl sulfate (SDS) sample
buffer, and incubated at 100°C for 5 min. Immunoprecipitation
products were resolved by electrophoresis on 12.5% acrylamide-SDS
gels, followed by autoradiography of the dried gel.
Immunoblot analysis.
All immunoblot analyses were conducted
essentially as described previously (30, 31). HeLa cell
extracts were prepared by resuspending cells (2 × 107/ml) in lysis buffer (50 mM KCl, 1 mM DTT, 2 mM MgCl,
1% Triton X-100, 10 mM Tris, pH 7.5) supplemented with 0.2 mM PMSF and
100 U of aprotinin per ml. Yeast cell extracts were prepared by
collecting cells from 20-ml liquid cultures, washing once with water,
and resuspending in lysis buffer. Yeast cells were lysed by the glass bead method with a bead homogenizer (21). All extracts were clarified by centrifugation at 12,000 × g, and
supernatants were collected and stored frozen at
80°C until use.
Cell extract protein concentrations were determined by using a protein
assay reagent system as described by the manufacturer (Bio-Rad).
Protein (25 to 50 µg) was separated by SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes.
After a 1-h blocking step, membranes were incubated with the indicated antibodies for an additional 1 h, washed, and probed with a
horseradish peroxidase-conjugated secondary antibody. Bound antibodies
were detected by enhanced chemiluminescence. P52rIPK,
P58IPK, and PKR expression was determined with polyclonal
-P52rIPK serum or monoclonal 9F10
-P58IPK
(1) or
-PKR (53) primary antibodies,
respectively. To control for potential errors in protein concentrations
or gel loading, a monoclonal antibody to human actin was included as a
probe on all blots.
In vitro assay for P52rIPK function.
Determination of P52rIPK function in vitro was carried out
by using purified components essentially as described by Melville et al. (58). Increasing concentrations of purified GST or
GST-P52rIPK were mixed with 2 pmol of
GST-P58IPK and incubated at 30°C for 10 min. Following
the incubation, PKR (2 pmol; purified from IFN-treated Daudi cells
[30]), poly(I · C) (100-ng/ml final
concentration), and 5 µCi of [
-32P]ATP were added,
and the mixture was incubated for a further 10 min at 30°C. Histone
HIIA substrate (from calf thymus; Sigma) and 10 µCi of
[
-32P]ATP were added and left for an additional 20 min
at 30°C, bringing the reaction volume to 30 µl in a final buffer of
17 mM Tris-HCl, 57 mM KCl, 40 mM NaCl, 2 mM MgCl2, 2 mM
MnCl2, 1 mg of bovine serum albumin per ml, 1 mM DTT, 100 U
of aprotinin per ml, 20 µM PMSF, 50 µM EDTA, 6.6% glycerol, 2 mM
ATP, and 2 mM HEPES, pH 7.5. Reactions were terminated by the addition
of 2× SDS-PAGE sample buffer, and the mixtures were incubated at
100°C for 5 min and subjected to SDS-PAGE analysis on 12.5%
acrylamide gels. Histone substrate phosphorylation was visualized by
autoradiography of the dried gel and quantitated by scanning laser
densitometry. Previous studies from our laboratory have demonstrated a
perfect correlation between the abilities of PKR to phosphorylate
histone HIIA and eIF-2
(45).
For each assay, we carried out control experiments to eliminate the
possibility that our recombinant protein preparations possessed
P58IPK-specific protease or histone- and/or PKR-specific
protein kinase activity (data not shown). Kinase assays in the presence
of only GST-P52rIPK revealed that these recombinant protein
preparations possessed no histone- or PKR-phosphorylating activities.
Similarly, we conducted immunoblot analyses of the kinase assay
reactants which were separated from 32P-labeled histones by
SDS-PAGE. Using this approach, we determined that the input
P58IPK remained intact and was not degraded during the
assay.
Yeast growth assay for in vivo determination of
P58IPK and P52rIPK function.
To examine
the in vivo PKR-regulatory properties of P58IPK and
P52rIPK, we utilized S. cerevisiae RY1-1
(MATa ura3-52 leu2-3 leu2-112 gcn2
trp1-
63
LEU2::[GAL-CYC1-PKR]2)
(74) or the isogenic control strain J110 (MATa
ura3-52 leu2-3 leu2-112 gcn2
trp1-
63 LEU2)
(47). Both strains lack the gene encoding the yeast eIF-2
kinase GCN2 (23). However, RY1-1 carries two copies of human
PKR integrated into the LEU2 locus, under control of the
galactose-inducible GAL1-CYC1 promoter (74).
Strains grown on dextrose will repress gene expression from the
GAL1-CYC1 promoter, while conversely, high levels of
GAL1-CYC1-dependent gene expression are achieved upon
exposure of yeast strains to galactose. When grown on galactose medium,
the RY1-1 strain exhibits a growth-suppressed phenotype due to the
PKR-mediated phosphorylation of yeast eIF-2
(74). Strain
J110 (a gift from Thomas Dever) is identical to RY1-1 except that it
harbors a single LEU2-integrated expression vector devoid of
insert DNA (47). For analysis of P58IPK
function, strains were transformed with the galactose-inducible expression plasmid pEMBLYex4, pYex-P58IPK, or pYex-PKR
295-300 and streaked onto uracil-deficient dextrose medium (SD).
After 3 days, individual colonies were replica streaked onto
uracil-deficient SD medium or synthetic medium containing galactose as
the sole carbon source (SGAL) and placed in a 30°C incubator. Strains
were assessed for the ability to grow on SGAL medium, which is
indicative of PKR repression by the plasmid-borne allele. For analysis
of P52rIPK function, RY1-1 strains were cotransformed with
the galactose-inducible expression plasmid combinations of
pEMBLYex4-pYX233, pEMBLYex4-pYX-P52, pYex-P58IPK-pYX233,
and pYex-P58IPK-pYX-P52 and plated onto SD medium lacking
uracil and tryptophan. After colony growth (approximately 3 to 4 days),
strains were replica streaked onto uracil- and tryptophan-deficient SD
and SGAL media, incubated for 7 to 10 days at 30°C, and analyzed for growth. Protein expression from the transformation construct(s) was
confirmed by immunoblot analysis of extracts prepared from yeast cells
grown for 4 to 9 h in freshly diluted cultures of liquid SGAL
selective medium. To ensure that all yeast expression plasmids had no
growth-altering properties, either alone or in cotransfection
combinations, all experiments included a parallel analysis of strain
J110 transfected with the indicated plasmid(s). By this method we
determined that both P58IPK and P52rIPK lacked
growth-regulatory properties when expressed in the absence of PKR (data
not shown).
eIF-2
phosphorylation analysis.
For isoelectric focusing
of eIF-2
, yeast strains were grown for 16 h in selective SD
medium, diluted to an optical density at 600 nm of 0.4 in selective
SGAL medium, and grown for an additional 4 to 9 h at 30°C. Yeast
extracts were prepared as described for immunoblot analysis, except
that cells were lysed in buffer containing 50 mM PIPES
[piperazine-N,N'-bis(2-ethanesulfonic acid)]
(pH 6.2), 150 mM NaCl, 15 mM EDTA, 1 mM PMSF, 1 mM DTT, 50 mM NaF, 35 mM
-glycerolphosphate, and 10 mM 2-aminopurine. Proteins (16 µg) were separated by vertical isoelectric focusing (21, 23) and blotted to nitrocellulose membranes. eIF-2
was detected by
immunoblot analysis with a rabbit polyclonal antiserum specific to
yeast eIF-2
(a gift from Thomas Dever). In these experiments, an
increase in the level of the less acidic, hypophosphorylated form of
eIF-2
indicates a concomitant decrease in the level of
hyperphosphorylated eIF-2
, which is phosphorylated by PKR on serine
51 (21, 22). The levels of hypophosphorylated eIF-2
relative to total eIF-2
were quantitated by scanning laser
densitometry and are presented as a percentage of total eIF-2
for
each sample.
DNA sequencing and computer analysis.
Both strands of the
P52rIPK cDNA were sequenced by the dye
termination method with an Applied Biosystems automated DNA sequencer and oligonucleotide primers designed to yield overlapping contigs of
DNA sequence. Cloned PCR products were sequenced in their entirety to
confirm that no mutations occurred during the amplification and cloning
processes. Sequence contigs were assembled by using the Genetics
Computer Group (GCG) Fragment Assembly System software package.
Sequence alignments were conducted with the GCG Bestfit program.
Searches of the nucleotide and protein databases were facilitated by
using the BLAST program included in the GCG software package licensed
to the University of Washington. We identified the Hsp90 homology
domain of P52rIPK by preparing peptide sequences
corresponding to contiguous 100-aa blocks of the deduced
P52rIPK amino acid sequence. Each P52rIPK
peptide sequence was used independently to search the protein databases
for homologous sequences. By this method we identified a region of
P52rIPK (aa 86 to 114) which has limited but significant
amino acid sequence homology (P = 0.0005) to the
charged domain of human Hsp90 (37).
Nucleotide sequence accession number.
The GenBank accession
number for the P52rIPK cDNA is AF007393.
 |
RESULTS |
Identification and characterization of the
P52rIPK cDNA.
Previous studies from our
laboratory have determined that the PKR-inhibitory activity of
P58IPK is regulated, at least in part, through direct
P58IPK-protein interactions (31, 69). To
determine the molecular mechanisms of P58IPK regulation and
to identify P58IPK-dependent pathways which regulate PKR,
we executed a search for cDNAs encoding regulators of
P58IPK function. We used P58IPK fused to the
GAL4 DNA BD (BD-P58IPK) as bait to screen a GAL4
transcription AD-fused HeLa cell cDNA library. To select for those
BD-P58IPK-AD-protein interactions of the highest
specificity, we increased the stringency of the two-hybrid library
screen by the addition of 30 mM 3-aminotriazol, a competitive inhibitor
of histidine biosynthesis (46), to the culture medium. Using
this approach, we isolated two identical 1.5-kb cDNAs encoding a
deduced protein of 492 aa (Fig. 1) which
exhibited a strong and specific interaction with BD-P58IPK
(see Fig. 3). Based upon the functional characterization described below, we have named this cDNA and its deduced 52-kDa protein P52rIPK (for 52-kDa repressor of the inhibitor of protein
kinase).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1.
P52rIPK possesses homology to the charged
domain of Hsp90. (A) Nucleotide and deduced amino acid sequences of the
5' UTR and open reading frame in the P52rIPK
cDNA. Nucleotide and amino acid positions are indicated at the left.
Position 1 denotes the initiator methionine codon (boxed); the asterisk
denotes the site of translation termination. (B) Structural
representation of P52rIPK and comparison with Hsp90. The
Hsp90 homology domain of P52rIPK (aa 86 to 200) and the
homologous charged domain of human Hsp90 (aa 170 to 300 [37]) are indicated in black (top) and are shown in an
amino acid sequence alignment (bottom). Identical residues are
indicated by a vertical line; double and single dots indicate
conservative and less conservative amino acid replacements,
respectively. Homology scores show 24% amino acid identity with 48%
amino acid similarity over the region shown. (C) Hydropathy profile of
the P52rIPK amino acid sequence. Positive (hydrophobic)
amino acid sequences are represented by peaks extending above the
neutral plane (dashed line). The bar indicates the Hsp90 homology
domain.
|
|
Examination of the P52rIPK cDNA revealed a
potential translation start codon 17 nt from the 5' terminus, followed
by a translation termination codon at nt 1479 (Fig. 1A). Using anchor
PCR to amplify the 5' terminus of the P52rIPK
mRNA from HeLa cells, we confirmed that the cloned cDNA included the
intact 5' end of the mRNA (data not shown). Thus, we identified the
first ATG (Fig. 1A) as the translation start codon. However, this cDNA
possessed a short 3' UTR lacking a poly(A) tail (data not shown),
indicating that this P52rIPK clone lacked the 3'
UTR of the native mRNA. A search of the nucleotide sequence database
identified several expressed sequence tags having sequence identity
with overlapping regions of the P52rIPK cDNA.
However, no significant nucleotide sequence homologies to any known
cDNAs were found. These results indicate that the P52rIPK clone represents a novel human cDNA. We
similarly compared the deduced amino acid sequence of the
P52rIPK open reading frame with known protein
sequences in the GenBank database. We identified a region of 114 aa
having limited homology (48% similarity, 24% identity) to the charged
domain of mammalian isoforms of Hsp90 (human Hsp90
[37], aa 170 to 300) (Fig. 1B). As shown in Fig. 1C,
this region of P52rIPK, termed the Hsp90 homology domain,
is similarly rich with charged amino acid residues which would be
expected to form a lobe structure protruding from an otherwise
hydrophobic protein core (84). The homologous region of
human Hsp90 has been implicated in mediating regulatory interactions
with the glucocorticoid receptor (8, 9), suggesting that the
P52rIPK Hsp90 homology domain may similarly mediate protein
interactions. Taken together, these results show that the
P52rIPK cDNA encodes a novel Hsp90-related
protein having limited homology with this member of the stress response
protein family.
Determination of P52rIPK mRNA and protein
expression in human cells.
To determine the expression pattern(s)
of P52rIPK mRNA, we carried out Northern blot
analyses, using the P52rIPK cDNA as a probe. As
shown in Fig. 2A, the
P52rIPK mRNA was expressed as a single 4.2-kb
species in HeLa cells, indicating that the
P52rIPK cDNA clone, which possessed a complete
open reading frame, lacks approximately 2.7 kb of the 3' UTR. Exposure
to IFN had no effect upon the steady-state level of
P52rIPK mRNA (compare lanes 1 and 2 in Fig. 2A),
indicating that P52rIPK is likely not an
IFN-regulated gene. We similarly identified a single 4.2-kb
P52rIPK transcript in various human cell lines,
including 293 embryonal kidney cells, MT4 T cells, HL-60 myeloid cells,
and Daudi B cells (data not shown). Thus, similar to
P58IPK (49), the
P52rIPK transcript is expressed in a range of
cell types.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of P52rIPK in
mammalian cells. (A) Northern blot analysis of
P52rIPK mRNA expression in HeLa cells cultured
in the presence (lane 1) or absence (lane 2) of IFN. The 4.2-kb
P52rIPK mRNA is indicated by the arrow at the
right. Each lane contains 5 µg of poly(A)+ RNA. Gel
loading was confirmed by sequentially hybridizing the same blot to
probes specific for actin and glyceraldehyde dehydrogenase (gapdh)
mRNAs. To confirm the induction of gene expression due to IFN
treatment, the same blot was probed with 32P-labeled
PKR cDNA. Positions of RNA size standards are indicated in
kilobases. (B) Immunoblot analysis. Fifty micrograms of HeLa cell
extract was separated by SDS-PAGE, blotted to membranes, and incubated
with preimmune (Pre) rabbit serum (lane 1) or -P52rIPK
immune serum (lane 2). The arrow indicates the position of
P52rIPK. The faint lower band in lane 2 corresponds to a
background band recognized by rabbit serum. Positions of protein
standards are shown. (C) Immunoprecipitation (IP) analysis.
Reticulocyte lysate (retic) in vitro translation reaction mixtures
containing [35S]methionine-labeled P52rIPK
(lanes 1 and 2) or extracts from 106 HeLa cells
metabolically labeled with [35S]-methionine (lanes 3 and
4) were immunoprecipitated with preimmune rabbit serum (P) (lanes 2 and
4) or -P52rIPK immune serum (I) (lanes 1 and 3). Shown
is an autoradiogram of immunoprecipitates separated by SDS-PAGE. The
arrow indicates the position of P52rIPK.
|
|
To verify protein expression in mammalian cells and to facilitate
additional biochemical studies, we prepared a rabbit polyclonal antiserum (
-P52) against recombinant P52rIPK expressed
as a GST fusion protein. With
-P52 serum, immunoblot analysis
revealed the expression of a 52-kDa protein in HeLa cells (Fig. 2B).
Likewise, a 52-kDa protein was specifically isolated by
-P52
immunoprecipitation from HeLa cell extracts (Fig. 2C, lane 3).
Interestingly, the HeLa
-P52 immunoprecipitation product showed the
presence of a broad 52-kDa band possibly representing P52rIPK degradation products, coimmunoprecipitating
proteins, or posttranslationally modified P52rIPK isoforms.
We consider it unlikely that this broad band represents degraded
P52rIPK, as the major product of this immunoprecipitation
comigrated with full-length in vitro-translated P52rIPK
immunoprecipitated from reticulocyte lysates (compare lanes 1 and 3 in
Fig. 2C). The latter two possibilities are supported by the observation
that P52rIPK and P58IPK form a stable complex
in mammalian cell extracts (see Fig. 8) and by the identification of
several potential protein kinase phosphorylation sites within the
deduced P52rIPK amino acid sequence (data not shown),
respectively. These results indicate that the
P52rIPK cDNA encodes the entire native protein,
which, importantly, is expressed and can be specifically detected with
-P52 serum.
Interaction of P58IPK with P52rIPK.
The P52rIPK cDNA was cloned based on the ability
of the encoded protein to interact with P58IPK in a yeast
two-hybrid system. To confirm and extend the results of our two-hybrid
library screen, we conducted a more thorough analysis of
P52rIPK-P58IPK interaction specificity. Using
two independent reporter assays, we tested the ability of
P52rIPK to interact with P58IPK or various
control constructs in yeast strain Hf7c, employing the yeast two-hybrid
assay. In this system, induction of the independent His and
LacZ reporter genes is indicative of a two-hybrid protein interaction (5). As shown in Fig.
3A, coexpression of
AD-P52rIPK and BD-P58IPK resulted in the
specific induction of the His reporter, as determined by
growth of this strain on histidine-deficient medium. Importantly, while
all yeast two-hybrid strains grew on medium containing histidine, only
those strains harboring wild-type GAL4 (GAL4/BD-V) or AD-PKR and
BD-P58IPK (AD-PKR/BD-P58IPK) were capable of
growth on medium lacking histidine, supporting our previous results
(31). A similar examination of lacZ reporter gene
expression independently verified the two-hybrid interaction between
P52rIPK and P58IPK by the induction of
-galactosidase activity (Fig. 3B). Interaction specificity was
demonstrated by the lack of detectable
-galactosidase activity in
strains expressing AD-P52rIPK with BD-lamin, BD-P53, or the
BD vector. With the yeast two-hybrid system, these results demonstrate
that P52rIPK forms a specific complex with
P58IPK in vivo.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
P52rIPK interacts with P58IPK in
vivo. (A) Histidine reporter assay of yeast two-hybrid strains. Hf7c
yeast strains harboring GAL4 AD and DNA BD plasmids expressing AD-PKR
and BD-P58IPK (controls; position 1), AD-vector (AD-V)
(control) and BD-P58IPK (position 2),
AD-P52rIPK and BD-P58IPK (position 3),
AD-P52rIPK and BD-vector (control; position 4), AD-GAL4
wild type (control) and BD-vector (position 5), and AD-vector and
BD-vector (control; position 6) were replica plated in the presence (+ His) or absence ( His) of histidine, incubated for 5 days, and scored
for growth. Growth on medium lacking histidine is indicative of a
two-hybrid protein interaction. (B) Analysis of -galactosidase
activity. Strain Hf7c was cotransformed with expression plasmids
encoding the indicated combination of AD and BD fusion proteins and
patch-plated onto medium containing histidine in the presence of
-galactosidase substrate. After 3 days of growth, patches were
scored for color development. Induction of the LacZ reporter
(dark patch) is indicative of -galactosidase activity and a
two-hybrid protein interaction. The top row shows strains expressing
AD-P52rIPK and (from left to right) BD-vector, BD-SV40 T
antigen (BD-T ag); BD-lamin, and BD-P58IPK. The bottom row,
left, shows strains expressing BD-P58IPK with AD-vector or
AD-SV40 T antigen. The bottom row, right, shows strain Hf7c expressing
the wild-type (wt) GAL4 protein. In this analysis and that shown in
panel A, AD and BD fusion protein expression was confirmed by
immunoblot analysis (data not shown).
|
|
Analysis of P52rIPK function in vitro.
Previous
results from our laboratory indicate that PKR function is inhibited
through a direct interaction with P58IPK, which itself is
regulated in large part through direct associations with specific
regulatory proteins (31, 55, 69). We therefore reasoned
that, through its ability to form a stable complex with P58IPK, P52rIPK may possess
P58IPK-regulatory properties, thereby coupling
P52rIPK to PKR regulation. To examine the function of
P52rIPK, we expressed P52rIPK as a GST fusion
protein (GST-P52rIPK) in E. coli and tested the
ability of the purified recombinant protein to regulate
P58IPK function and PKR activity in vitro. In these
experiments, we utilized histone HIIA as a substrate, having previously
demonstrated a perfect correlation between the phosphorylation of
histones and eIF-2
by PKR (45). As determined previously
(58) and seen in Fig. 4
(compare lanes 1 and 2), the high level of histone phosphorylation
activity of PKR was repressed by GST-P58IPK, demonstrating
the PKR-inhibitory activity of recombinant GST-P58IPK.
Conversely, preincubation of GST-P58IPK with increasing
concentrations of GST-P52rIPK resulted in a titratable
inhibition of P58IPK function and concomitant retention of
PKR activity (Fig. 4, lanes 6 to 8). We determined that the
GST-P52rIPK-dependent restoration of kinase function was
not due to the activity of contaminating kinase or
P58IPK-specific protease activities (data not shown).
Importantly, preincubation of PKR with P58IPK resulted in
inhibition of PKR activity which could not be restored by the
subsequent addition of P52rIPK to the reaction (data not
shown). Preincubation of GST-P58IPK with low concentrations
of GST had no effect on the ability of GST-P58IPK to
repress PKR, while a high concentration of GST actually increased the
level of PKR inhibition (Fig. 4, lanes 3 to 5). These results demonstrate that P52rIPK can specifically repress
P58IPK function in vitro. Since inhibition of
P58IPK function required preincubation with
P52rIPK, P52rIPK may sequester
P58IPK in an inactive complex rather than functioning to
disrupt the PKR-P58IPK interaction.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
P52rIPK inhibits P58IPK in
vitro. Purified PKR (2 pmol) was mixed with buffer alone (lane 1) or
buffer containing 2 pmol of GST-P58IPK either alone (lane
2) or preincubated with increasing amounts of GST (0.1, 2.0, or 5.0 pmol [lanes 3 to 5, respectively]) or GST-P52rIPK (0.1, 2.0, or 5.0 pmol [lanes 6 to 8, respectively]). To assess PKR
activity, protein kinase assays were carried out in the presence of a
histone HIIA substrate and [ -32P]ATP.
PKR-phosphorylated histones (arrow) were separated by SDS-PAGE and
visualized by autoradiography. The level of PKR activity (histone
phosphorylation) was quantitated by scanning laser densitometry and is
presented below each lane as percent activity relative to that of the
input control (lane 1).
|
|
Regulation of PKR function by P58IPK and
P52rIPK in vivo.
To determine the functional
characteristics of P52rIPK in vivo and its relevance to the
regulation of P58IPK and PKR, we took advantage of
the growth-suppressive properties of PKR in S. cerevisiae (14, 74). It was first necessary to determine if P58IPK could inhibit PKR function when
coexpressed in yeast. To facilitate these studies, we used the
gcn2
S. cerevisiae strain RY1-1, which lacks
GCN2 but harbors two copies of wild-type human
PKR integrated in the LEU2 locus under control of
a galactose-inducible promoter (74). When plated on
galactose-containing medium, this strain expresses high levels of PKR,
which phosphorylates the endogenous eIF-2
on serine 51 (22), leading to inhibition of protein synthesis and growth
suppression. Coexpression of dominant-negative PKR mutants
(74) or virally encoded PKR inhibitors (33, 47) in RY1-1 results in repression of PKR function and restoration of cell
growth. We therefore transformed RY1-1 with the dominant-negative PKR
mutant PKR
295-300 (74) (positive control),
P58IPK, or the vector alone (negative control), each under
control of a galactose-inducible promoter. Examination of the growth
properties of the resulting strains revealed that while they grew
on noninducing SD medium (Fig. 5A, upper
plate), only those coexpressing P58IPK or the PKR
295-300 dominant-negative mutant with PKR retained the ability to
grow on inducing SGAL medium (Fig. 5A, lower plate). Importantly, the isogenic gcn2
control strain, J110
(which lacks endogenous PKR) (47), grew equally well under
both conditions, demonstrating that the galactose-inducible RY1-1
growth-suppressive phenotype was PKR specific. These results
demonstrate that P58IPK can reverse the growth-suppressive
effects of PKR in yeast. We verified that both the P58IPK
and PKR
295-300 constructs were efficiently expressed yeast transformants (Fig. 5B). Previous studies have demonstrated that PKR
autoregulates its own translation in mammalian cells and yeast by
repressing de novo PKR synthesis (3, 47, 74). Importantly, RY1-1 strains coexpressing P58IPK with PKR exhibited an
increase in PKR levels (Fig. 5B), consistent with a
P58IPK-mediated inhibition of PKR autoregulation and
stimulation of protein synthesis (86). Together with our
previous results demonstrating in vivo complex formation between
P58IPK and PKR (31), these results indicate that
P58IPK, through a direct interaction with PKR, can repress
kinase function and restore cell growth. Further, by reconstituting the
PKR-regulatory pathway in yeast, we have established an in vivo assay
for P58IPK function which is amenable to genetic analyses.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
P58IPK represses PKR function in vivo. (A)
Yeast growth analysis. Yeast strain RY1-1 was transformed with the
2µm expression plasmid pEMBLYex4 (vector; position 3), pYex-PKR
295-300 (PKR 295-300; position 2), or pYex-P58IPK
(P58IPK; position 4) and streaked onto uracil-deficient
medium containing 2% dextrose (SD) or 10% galactose (SGAL). To
control for the specificity of growth effects due to PKR or
P58IPK expression, the gcn2 isogenic control
strain, J110, harboring vector alone (position 1) was included in all
analyses. (B) Protein expression. Lanes 1 to 3 contain extracts from
the RY1-1 strains shown in panel A harboring pYex-P58IPK
(lane 1), pEMBLYex4 alone (lane 2), or pYex-PKR 295-300 (lane 3).
An extract from the J110 parental control strain harboring pEMBLYex4 is
shown in lane 4. Strains were grown for 5 h in
galactose-containing liquid medium, and extracts were prepared as
described in Materials and Methods. Proteins (25 µg) were separated
by SDS-PAGE and subjected to immunoblot analysis. Panels show the same
blot probed sequentially with antibodies specific to PKR,
P58IPK, or actin.
|
|
To determine the role of P52rIPK in this regulatory
pathway, we introduced P52rIPK into RY1-1 harboring
P58IPK. We predicted that in this strain
P52rIPK, as an inhibitor of P58IPK, may itself
possess growth-regulatory properties through restoration of PKR
function. A comparison of the growth properties of the RY1-1 strains
shown in Fig. 6A revealed that while all
strains grew equally well on noninducing SD medium, only the strain
coexpressing P58IPK alone with PKR
(P58IPK/vector) exhibited growth on inducing SGAL medium,
consistent with a P58IPK-mediated repression of PKR.
Conversely, no growth was observed in RY1-1 coexpressing
P52rIPK with P58IPK and PKR
(P52rIPK/P58IPK) (Fig. 6A), indicating that
P52rIPK could indeed block the PKR-inhibitory function of
P58IPK. Importantly, we found that no toxic effects were
associated with high levels of P52rIPK expression in the
isogenic control strain J110 (data not shown). Similar to the RY1-1
strain expressing PKR alone (vector/vector) (Fig. 6A), those strains
coexpressing PKR and P52rIPK in the absence of
P58IPK (vector/P52rIPK) failed to grow on SGAL
medium. Thus, both P58IPK and PKR are required for
P52rIPK-mediated growth regulation in yeast. Collectively,
these results confirm our in vitro data (Fig. 4) indicating that
P52rIPK can repress the PKR-inhibitory function of
P58IPK, resulting in restoration of kinase activity and
suppression of cell growth. We found that coexpression of
P52rIPK with P58IPK and PKR did not alter
P58IPK levels in these strains (Fig. 6B). The differential
effects on cell growth due to P58IPK and
P52rIPK expression in cotransformed RY1-1 strains did not
correlate with significant alterations in PKR levels (Fig. 6B),
suggesting that PKR autoregulation may not be significantly affected in
these strains. This seemingly disparate relationship between growth and
PKR autoregulatory properties is likely due to the added complexity and
competition for transcription and/or translation factors imposed by a
dual plasmid system, or it may simply reflect limitations in our
immunodetection methods.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
P52rIPK inhibits P58IPK to
restore PKR function in vivo. (A) Yeast growth analysis. RY1-1
harboring the indicated Ura and Trp 2µm
expression plasmids was plated onto uracil- and tryptophan-deficient
dextrose medium (SD) or inducing galactose medium (SGAL) and incubated
at 30°C for 7 days. Plasmid combinations for each strain:
pYex-P58IPK-pYX233 (P58IPK/v; position 1),
pYex-pYX233 (v/v; position 2), pYex-pYX-P52 (v/P52rIPK;
position 3), and pYex-P58IPK-pYX-P52
(P58IPK/P52rIPK; position 4). (B) Protein
expression. Extracts were prepared from the yeast strains shown in
panel A, which were grown for 7 h in galactose-containing liquid
medium. Twenty-five micrograms of protein was separated by SDS-PAGE and
subjected to immunoblot analysis. Shown is a single blot probed with
antibodies specific to PKR, P58IPK, P52rIPK, or
actin. Lanes represent extracts from RY1-1 harboring the plasmid
combinations pYex-P58IPK-pYX233 (P58IPK/v;
lane 1), pYex-pYX233 (v/v; lane 2), pYex-P58IPK-pYX-P52
(P58IPK/P52rIPK; lane 3), and
pEMBLYex4-pYX-P52 (v/P52rIPK; lane 4). The arrow indicates
the position of P52rIPK, which migrates above a background
band found in all lanes.
|
|
To determine if P58IPK- and P52rIPK-mediated
growth effects were due to alterations in eIF-2
phosphorylation, we
used an isoelectric focusing technique to directly measure the
phosphorylation state of endogenous eIF-2
in the yeast strains shown
in Fig. 5 and 6. In this procedure, hyperphosphorylated eIF-2
,
phosphorylated by PKR on serine 51, can be discriminated from the
hypophosphorylated form of eIF-2
due to a phosphate-induced
alteration in the protein isoelectric point (22, 23). This
is demonstrated in Fig. 7B, in which all
of the eIF-2
within the J110 control strain, which is devoid of PKR
and serine 51 phosphorylation (47), is separated from the
more acidic serine 51-phosphorylated form of eIF-2
found in RY1-1
expressing PKR (compare lanes 1 and 2). As seen in Fig. 7A, lane 1, virtually all of the eIF-2
in RY1-1 harboring the vector alone was
phosphorylated on serine 51. In contrast, expression of
P58IPK with PKR decreased the level of serine
51-phosphorylated eIF-2
, resulting in a 12-fold increase in the
level of the hypophosphorylated form (Fig. 7A, lane 2). Similar results
were obtained with an RY1-1 control strain expressing the
dominant-negative PKR
295-300 mutant (Fig. 7A, compare lanes 2 and
3, respectively), consistent with inhibition of PKR function and
restoration of cell growth (Fig. 5A) (74). Taken together,
these results demonstrate that P58IPK can repress the
function of PKR in vivo, resulting in a net decrease in the level of
serine 51-phosphorylated eIF-2
and a concomitant restoration of cell
growth.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
P52rIPK and P58IPK regulate
PKR-mediated eIF-2 phosphorylation. Protein extracts (16 µg) from
yeast strains cultured in galactose-containing selective liquid medium
for 9 h (A) or 5 h (B), were subjected to vertical gel
isoelectric focusing and anti-eIF-2 immunoblot analysis. For each
panel, the lower arrow indicates the position of hypophosphorylated
eIF-2 . The upper arrow denotes the position of hyperphosphorylated
eIF-2 , which is phosphorylated on serine 51 by PKR (22).
The percentage of hypophosphorylated eIF-2 is presented beneath each
lane. (A) Analysis of RY1-1 strains shown in Fig. 5, harboring
pEMBLYex4 (vector; lane 1), pYex-P58IPK (lane 2), or
pYex-PKR 295-300 (lane 3). (B) Analysis of the isogenic control
strain J110 harboring pEMBLYex4 (lane 1) and the RY1-1 strains shown in
Fig. 6, which harbor the plasmid combinations of pEMBLYex4-pYX233 (v/v;
lane 2), pEMBLYex4-pYX-P52 (v/P52rIPK; lane 3),
pYex-P58IPK-pYX233 (P58IPK/v; lane 4), and
pYex-P58IPK-pYX-P52 (P58/P52; lane 5).
|
|
We then proceeded to examine eIF-2
phosphorylation within extracts
prepared from the RY1-1 strains shown in Fig. 6. As seen in Fig. 7B,
lane 2, expression of PKR in a strain cotransformed with vectors alone
resulted in a high level of serine 51-phosphorylated eIF-2
,
consistent with the growth-suppressed phenotype (Fig. 6). As
demonstrated earlier, coexpression of PKR with P58IPK
lowered the proportion of serine 51-phosphorylated eIF-2
and was
reflected as a significant increase in the level of the
hypophosphorylated species (Fig. 7B, lane 4). This
P58IPK-mediated decrease in serine 51 eIF-2
phosphorylation was blocked by P52rIPK, as coexpression of
P52rIPK with P58IPK and PKR (Fig. 7B, lane 5)
restored the level of serine 51-phosphorylated eIF-2
to one
comparable to that of the control strain expressing PKR alone (compare
lanes 2, 4, and 5 in Fig. 7B). Coexpression of P52rIPK with
PKR (Fig. 7B, lane 3) had no significant effect on eIF-2
phosphorylation levels, which again were similar to those of RY1-1 expressing PKR alone. Taken together with the growth data presented in
Fig. 6, these results indicate that P52rIPK regulates PKR
activity through inhibition of P58IPK function.
P52rIPK inhibition of P58rIPK results in
restoration of PKR-mediated eIF-2
phosphorylation and concomitant
cell growth suppression. Moreover, and in support of previous studies
(33, 47), our data demonstrates that small alterations in
the levels of serine 51-phosphorylated eIF-2
can have dramatic
effects on cell growth.
P52rIPK/P58IPK interaction in mammalian
cell extracts.
P52rIPK specifically interacted with
P58IPK in a yeast two-hybrid system (Fig. 3), demonstrating
that the two proteins interact in vivo. However, it was essential to
verify that P52rIPK could similarly bind to
P58IPK within mammalian cell extracts. We therefore carried
out a detailed immunoprecipitation analysis, assaying for
P52rIPK-P58IPK complexes expressed within
reticulocyte lysates. By using a rabbit reticulocyte translation
system, cDNAs encoding wild-type P52rIPK and
P58IPK were independently translated, and extracts were
mixed together and subjected to immunoprecipitation analysis with
P58IPK- or P52rIPK-specific antibodies. As
shown in Fig. 8, analysis of
immunoprecipitations from mixed translation reactions revealed that
P52rIPK and P58IPK formed a complex in vitro;
each was recovered in an immunoprecipitation with the reciprocal
antibody. Importantly, coimmunoprecipitation of P58IPK with
-P52 serum was dependent on the presence of P52rIPK in
the reaction mixture (Fig. 8, compare lanes 4 and 5).
Likewise, recovery of P52rIPK from
-P58IPK
immunoprecipitations was similarly dependent upon the presence of
P58IPK in the reaction mixture (Fig. 8, compare lanes 6 and
8).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
P58IPK and P52rIPK form a
complex in mammalian cell extracts. P58IPK and
P52rIPK were translated in vitro in the presence (hot) or
absence (cold) of [35S]methionine by using a rabbit
reticulocyte lysate translation system. Hot translation reactions were
immunoprecipitated from reticulocyte extracts individually (lanes 1 to
4, 6, and 7) or as a mixture with the reciprocal cold translation
extract (lanes 5 and 8), boiled in reducing sample buffer, and
separated by SDS-PAGE. By this method, coimmunoprecipitating proteins
will migrate through the gel independently based upon protein mass. The
relative positions of labeled proteins after electrophoresis were
determined by autoradiography of the dried gel. Lanes 1 and 2, preimmune serum (Pre) immunoprecipitations (IP) of hot
P52rIPK and P58IPK, respectively; lanes 3 to 5, -P52rIPK immunoprecipitations of hot P52rIPK
(lane 3) and of hot P58IPK alone or in the presence of cold
P52rIPK (lanes 4 and 5, respectively); lanes 6 to 8, -P58IPK immunoprecipitations of hot P58IPK
(lane 7) and of hot P52rIPK alone or mixed with lysates
containing cold P58IPK (lanes 6 and 8, respectively).
Arrows indicate the positions of P58IPK and
P52rIPK.
|
|
 |
DISCUSSION |
P52rIPK defines a novel PKR-regulatory pathway.
Our current model of the PKR-regulatory pathway is shown in Fig.
9. Serine 51 of eIF-2
is
phosphorylated by PKR (22), the activity of which may be
dependent on the formation of PKR dimers (Fig. 9, bottom) (67,
74). PKR-mediated phosphorylation of eIF-2
results in a block
in protein synthesis initiation and concomitant growth suppression
(14, 22, 74). P58IPK, which binds to PKR
(31, 69), represses kinase function by disrupting active PKR
dimers (85), resulting in a decrease in the level of serine
51-phosphorylated eIF-2
(1), stimulation of protein
synthesis (86), and restoration of cell growth. In this
model, P58IPK functions as a central element in the control
of PKR, undergoing regulatory interactions with a complex set of
proteins which define specific pathways for the control of PKR
function. Earlier work from our laboratory has identified Hsp40 as a
regulator of P58IPK (58). In the current study,
we have identified P52rIPK as an additional and independent
(Fig. 4) regulator of P58IPK and an upstream regulator of
PKR. After either virus infection (44) or other stimuli,
Hsp40 or P52rIPK dissociates from P58IPK.
P58IPK then binds to PKR, resulting in repression of kinase
function (31, 69). We have not yet identified the signal(s)
which induces dissociation of the
P52rIPK-P58IPK inhibitory complex. However, in
an analogous system in mast cells, signaling processes lead to
dissociation of the c-Cbl proto-oncogene product from an
inactive protein complex, whereby it binds to and represses the
function of the Syk protein kinase (65). The P52rIPK-dependent signal transduction process may similarly
lead to activation of P58IPK and inhibition of PKR
function. Further, Shim et al. (79) have determined that the
p21WAF1/CIP1/Sdi1 DNA damage-inducible cell cycle inhibitor
can bind to and repress the activity of the stress-activated protein
kinase group of Map kinases. Thus, the p21WAF1/CIP1/Sdi1
and P58IPK protein kinase inhibitors define specific
intersections between cellular stress response pathways and cell growth
control. The PKR-dependent cellular IFN response defines yet a third
intersecting pathway regulated in part by P58IPK. It is
tempting to speculate that in addition to being involved in PKR
regulation, P52rIPK, Hsp40, and P58IPK may also
participate in PKR-independent regulatory events in which
P58IPK regulation may lead to modulation of
P52rIPK and/or Hsp40 function (Fig. 9, top). Such a pathway
could have profound effects on molecular chaperone activities and
signal transduction cascades which require Hsp40 (17, 61) or
P52rIPK. Determination of the upstream signals which
regulate P52rIPK function will allow us to more clearly
define the extent of the biological role(s) played by this protein and
its contributions within cellular regulatory processes.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 9.
Regulation of PKR. Two distinct cellular pathways of PKR
regulation are defined by P52rIPK and Hsp40, both of which
converge upon P58IPK to modulate PKR function.
P58IPK is regulated through the formation of independent
inhibitory complexes with P52rIPK and Hsp40
(58). Cellular stress, including virus infection (55,
56), may induce dissociation of the P58IPK-Hsp40
inhibitory complex. Possibly representing a protein signaling motif,
the Hsp90 homology domain of P52rIPK may participate in
signal transduction processes induced by exposure to environmental
stress or mediated through specific signaling cascades which result in
dissociation of the P58IPK-P52rIPK complex.
Once released from its inhibitor, P58IPK forms a dimer or
higher-ordered homotypic complex (31) competent to bind and
disrupt active PKR dimers (lower) (85). Inhibition of PKR
results in a block in PKR-mediated eIF-2 phosphorylation,
stimulation of protein synthesis, and concomitant repression of PKR
tumor suppressor function (lower middle and lower right) (1, 74,
86). P58IPK-mediated inhibition of PKR may also
confer alterations in PKR-mediated signal transduction processes
(50, 51, 89). Finally, P52rIPK and Hsp40 may
interact with P58IPK as regulatory components of
PKR-independent processes which lead to alterations in Hsp40 and/or
P52rIPK function (upper). Other stress response proteins
which regulate Hsp40, including heat shock proteins and molecular
chaperones (19), could participate in both PKR-dependent and
-independent regulatory pathways.
|
|
Stress response, molecular chaperones, and protein kinase
regulation.
Interaction with elements of the stress response
protein family and molecular chaperones is becoming a widely recognized
mechanism of protein kinase regulation. In many cases, molecular
chaperones have been identified as critical components of the
maturation, subcellular localization, and subunit interactions of a
wide variety of protein kinases (reviewed by Hunter
[40]). A relevant example is the interaction between
Hsp90 and the reticulocyte-expressed eIF-2
kinase HRI
(57). Uma et al. (87) have recently demonstrated that HRI is conformationally maintained in an inactive, heme-responsive state by interaction with Hsp90 and that disruption of the HRI-Hsp90 complex results in loss of heme-regulated kinase function. Similarly, the interaction between PKR and P58IPK may induce
conformational changes in the kinase which could lead to inhibition of
catalytic function. Furthermore, the structural features of TPR protein
P58IPK are consistent with the functions of related members
within the stress response protein family, which participate in protein
folding and signaling reactions. For example, the TPR proteins Hip and Hop interact with Hsc70 as cofactors in protein-folding, maturation, and signaling processes (28). Moreover, we have identified
P58IPK TPR domain 6 as the PKR binding motif
(31), and recent results indicate that interaction with
P52rIPK is mediated by P58IPK TPR domain 7 (32). The C-terminal DnaJ domain of P58IPK may
impart DnaJ-related chaperone and signaling functions (19) to P58IPK, possibly mediated through interaction with Hsp40
(58). It is relevant that the DnaJ region is essential for
P58IPK function in vivo (86). Thus, through TPR
motif- and DnaJ-dependent events, P58IPK participates in a
protein kinase regulation, effecting PKR function through specific
protein interactions.
The deduced structure of P52rIPK revealed that aa 86 to 200 have limited but significant homology to the charged domain, aa 170 to
300, of Hsp90 (Fig. 1) (37). Based on the three-dimensional structure of an Hsp90-geldanamycin complex (84), this domain is expected to be exposed to solvent and thereby available for molecular interactions. Previous studies have determined that the Hsp90
charged domain was necessary for steroid hormone signal transduction
(8), where it may mediate a direct interaction with the
glucocorticoid receptor (9). Recently, a genetic analysis of
the Drosophila Hsp90 homolog, Hsp83, and its association
with the Raf protein kinase has identified independent mutations which cluster near the charged domain of the Hsp83 gene product,
resulting in reduced Raf binding and a decrease in Raf activity
(88). Cutforth and Rubin (18) previously
determined that a subset of these Hsp83 mutations abrogated
signal transduction through the sevenless receptor tyrosine kinase in
Drosophila. Together these results suggest that the charged
domain of the Drosophila Hsp90 homolog may participate in
protein kinase regulation and signal transduction processes. The
limited homology between P52rIPK and Hsp90 indicates that
P52rIPK is unlikely to be a functional Hsp90 homolog but
rather suggests that the Hsp90 homology domain may similarly mediate
heterotypic protein interactions and signal transduction processes.
Indeed, preliminary results from our laboratory suggest that the Hsp90 homology region of P52rIPK may mediate interaction with
P58IPK and is required for PKR regulation (32).
Moreover, Owens-Grillo et al. (66) have demonstrated that
Hsp90 binds to several different TPR proteins in a manner indicative of
a universal TPR domain binding region within Hsp90. Thus, the Hsp90
homology region may function as a TPR domain-interactive site,
mediating interaction with one or more TPR domains of
P58IPK or other, yet-unidentified TPR proteins. Consistent
with its role in Hsp90-dependent glucocorticoid and protein kinase
signaling, we propose that the Hsp90 homology domain may represent a
novel signaling motif, functioning through direct protein interactions to mediate signal transduction processes, including
P52rIPK-dependent regulation of the PKR protein kinase.
PKR regulation, translational control, and cell growth.
The
control of mRNA translation, through PKR-dependent and -independent
processes, may provide checkpoint mechanisms regulating the expression
of genes which are critical to cellular growth control (41,
82). Our results support the growing field of evidence that
regulation of PKR can have profound effects on cell growth. Abrogation
of eIF-2
function through the altered expression of PKR-regulatory
components (1, 6, 48) or through eIF-2
mutation
(24) leads to malignant transformation of mammalian cells.
Several studies have demonstrated that in a pathway independent of PKR,
deregulated eIF-4E expression can induce malignant transformation in
murine fibroblasts (reviewed by Sonenberg [83]).
Moreover, mutations in the S. cerevisiae TOR locus which
abrogate eIF-4E function result in a block in mRNA translation
initiation and a G1 cell cycle arrest, linking the mRNA
translation initiation process to cell cycle control (4). In
support of this, recent studies have identified translational control
as a regulatory component of specific gene products involved in cell
cycle regulation (reviewed in reference 82). These
include, for example, the cyclin-dependent kinase inhibitor
p27Kip1 (36), cyclin D1 (75, 76), the
p53 tumor suppressor (25), and CDK4 (26). As a
candidate tumor suppressor itself, PKR and its upstream regulatory
components may play a role in the translational regulation of these
gene products and possibly gene products involved in cell growth
control. Indeed, both the oncogenic potential of P58IPK
(1) and the tumor suppressor properties of PKR
(16) are potential targets for regulation by
P52rIPK. By functioning as a positive regulator of PKR,
P52rIPK may itself represent a candidate tumor suppressor
gene product. Loss of P52rIPK function could conceivably
unmask the oncogenic potential of P58IPK, while hyperactive
P52rIPK may potentiate PKR function. We have preliminarily
mapped the P52rIPK locus to q13.5 of human
chromosome 11 (32), a known tumor suppressor region which is
deleted in various malignancies (52, 63). A clear definition
of the roles played by P52rIPK and the PKR-regulatory
pathway in cell cycle progression and cell growth control will allow us
to determine the potential roles and contributions of this pathway in
human malignancies.
 |
ACKNOWLEDGMENTS |
We thank Pat Mcgiffort and University of Washington photography
for data photos. We are grateful to Thomas Dever for advice on
isoelectric focusing analyses, as well as for providing the J110 yeast
strain and antibody to yeast eIF-2
. We also thank Marcus Korth and
Gary Geiss for critical review of the manuscript. We are grateful to
Seng-Lai Tan for sharing results prior to publication.
This work was supported by National Institutes of Health grants AI22646
and RR00166 to M.G.K. C.M.B. was supported in part by an
undergraduate research fellowship award from the Howard Hughes Medical
Institute and by a University of Washington Mary Gates research
fellowship. M.W.M. was supported by a Public Health Service grant,
National Research Service Award 32 GM07270, from the National Institute
of General Medical Sciences. M.G. was supported by a fellowship from
the Helen Hay Whitney Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, School of Medicine, University of Washington, Box 357242, Seattle, WA 98195-7242. Phone: (206) 543-8837. Fax: (206) 685-0305. E-mail: honey{at}u.washington.edu.
 |
REFERENCES |
| 1.
|
Barber, G. N.,
S. Thompson,
T. G. Lee,
T. Strom,
R. Jagus,
A. Darveau, and M. G. Katze.
1994.
The 58-kilodalton inhibitor of the interferon-induced double-stranded RNA-activated protein kinase is a tetratricopeptide repeat protein with oncogenic properties.
Proc. Natl. Acad. Sci. USA
91:4278-4282 |