Previous Article | Next Article 
Mol Cell Biol, February 1998, p. 872-879, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Novel, Multifunctional c-Cbl Binding Protein in
Insulin Receptor Signaling in 3T3-L1 Adipocytes
Vered
Ribon,1,2
John A.
Printen,1,2
Noah G.
Hoffman,3
Brian K.
Kay,4 and
Alan R.
Saltiel1,2,*
Department of Physiology, University of
Michigan School of Medicine, Ann Arbor, Michigan
481091;
Department of Cell Biology,
Parke-Davis Pharmaceutical Research Division, Warner Lambert Company,
Ann Arbor, Michigan 481052;
Department
of Biology, University of North Carolina, Chapel Hill, North Carolina
275993; and
Department of
Pharmacology, University of Wisconsin
Madison, Madison, Wisconsin
537064
Received 9 September 1997/Returned for modification 28 October
1997/Accepted 17 November 1997
 |
ABSTRACT |
The protein product of the c-Cbl proto-oncogene is prominently
tyrosine phosphorylated in response to insulin in 3T3-L1 adipocytes and
not in 3T3-L1 fibroblasts. After insulin-dependent tyrosine phosphorylation, c-Cbl specifically associates with endogenous c-Crk
and Fyn. These results suggest a role for tyrosine-phosphorylated c-Cbl
in 3T3-L1 adipocyte activation by insulin. A yeast two-hybrid cDNA
library prepared from fully differentiated 3T3-L1 adipocytes was
screened with full-length c-Cbl as the target protein in an attempt to
identify adipose-specific signaling proteins that interact with c-Cbl
and potentially are involved in its tyrosine phosphorylation in 3T3-L1
adipocytes. Here we describe the isolation and the characterization of
a novel protein that we termed CAP for c-Cbl-associated protein. CAP
contains a unique structure with three adjacent Src homology 3 (SH3)
domains in the C terminus and a region showing significant sequence
similarity with the peptide hormone sorbin. Both CAP mRNA and proteins
are expressed predominately in 3T3-L1 adipocytes and not in 3T3-L1
fibroblasts. CAP associates with c-Cbl in 3T3-L1 adipocytes
independently of insulin stimulation in vivo and in vitro in an
SH3-domain-mediated manner. Furthermore, we detected the association of
CAP with the insulin receptor. Insulin stimulation resulted in the
dissociation of CAP from the insulin receptor. Taken together, these
data suggest that CAP represents a novel c-Cbl binding protein in
3T3-L1 adipocytes likely to participate in insulin signaling.
 |
INTRODUCTION |
The mitogenic and metabolic effects
of insulin are initiated by the tyrosine kinase activity of its
receptor. Upon insulin binding, the insulin receptor undergoes
autophosphorylation on tyrosine residues, resulting in increased kinase
activity that leads to tyrosine phosphorylation of intracellular
substrates (34, 45). Since the tyrosine-phosphorylated
insulin receptor does not associate strongly with downstream Src
homology 2 (SH2) domain-containing proteins, docking proteins are
essential for insulin signaling. The tyrosine phosphorylation of these
proteins, which include the insulin receptor substrates 1 and 2 (IRS-1
and IRS-2), the Shc proto-oncogene product, and the Grb2-associated protein GAB1, induces their association with proteins containing SH2
domains, resulting in activation of various signaling cascades (2,
7, 16, 24, 39, 40). Both IRS-1 and Shc have been implicated in
regulating the Ras signaling pathways and the downstream mitogenic
actions of insulin (27, 32, 35, 36). Binding of
phosphatidylinositol 3'-kinase (PI 3'-K) to phosphorylated IRS-1 and
IRS-2 leads to activation of the lipid kinase in response to insulin
(3, 7, 40). Although activation of these known pathways are
clearly important in insulin signal transduction, recent studies have
indicated that stimulation of the mitogen-activated protein (MAP)
kinase pathway and PI 3'-K may not be sufficient for the stimulation of
glucose transport, lipid synthesis, or glycogen synthesis by insulin in
3T3-L1 adipocytes (19, 43, 46). These studies suggest that
additional signaling pathways may exist that are initiated by the
tyrosine phosphorylation of other substrates by the insulin receptor.
c-Cbl is the 120-kDa cellular homolog of the transforming v-Cbl
oncogene. The primary structure of c-Cbl resembles that of DNA binding
transcription factors, with a nuclear localization sequence, a zinc
finger-like motif, and a leucine zipper (5, 6). However, it
is localized predominately in the cytoplasm, while the truncated
protein encoded by v-cbl is localized in both the cytoplasm
and the nucleus, where it can bind DNA (6). c-Cbl becomes
tyrosine phosphorylated in response to activation of a variety of
tyrosine kinases including v-Abl and Bcr-Abl (1, 28);
stimulation of the T- and B-cell antigen receptors (8, 11,
18), granulocyte-macrophage colony-stimulating factor erythropoietin, Fc gamma receptors (21, 41), and the
epidermal growth factor (EGF) receptor (13, 15, 20); and
during integrin-mediated cell adhesion (22). These findings
suggest that c-Cbl may be an important component of signal transduction
downstream of tyrosine kinases. c-Cbl contains a long proline-rich
region in the COOH terminus that constitutively binds the SH3 domains
of the adapters Grb2 and Nck and the Fyn and Lck tyrosine kinases
independent of cell activation (8, 11, 14, 21, 31). Upon
cell activation, tyrosine-phosphorylated c-Cbl binds the SH2 domains of
Fyn, Lck, the p85 subunit of PI 3'-K, and c-Crk (8, 11, 13, 14, 18, 28, 37). Moreover, the association of c-Crk with
tyrosine-phosphorylated c-Cbl correlates well with cellular
transformation in Bcr-Abl or mutant, oncogenic c-Cbl (70Z)-expressing
cells (28).
We reported recently that insulin markedly stimulated the tyrosine
phosphorylation of c-Cbl in 3T3-L1 adipocytes, inducing its association
with the adapter protein c-Crk and the Src family kinase Fyn.
Interestingly, insulin did not stimulate c-Cbl tyrosine phosphorylation
in 3T3-L1 fibroblasts or in any other cell lines expressing high levels
of functional insulin receptors and c-Cbl (30). These
results suggest a physiological function for c-Cbl in insulin action in
the metabolically responsive 3T3-L1 adipocytes. However, we did not
detect the direct association of c-Cbl with the insulin receptor,
suggesting that a protein present in 3T3-L1 adipocytes but not in
fibroblasts plays a critical role in the tyrosine phosphorylation of
c-Cbl by the insulin receptor. We report here the isolation and the
characterization of a novel signaling protein that we termed CAP for
c-Cbl-associated protein. Both CAP mRNA and proteins are expressed
predominately in 3T3-L1 adipocytes and not in 3T3-L1 fibroblasts. CAP
interacts with both c-Cbl and the insulin receptor in 3T3-L1 adipocytes
and may have an important function in the specificity of tyrosine
phosphorylation events under the regulation of insulin.
 |
MATERIALS AND METHODS |
Yeast two-hybrid system.
Full-length c-Cbl fused to the C
terminus of the GAL4 DNA binding domain in the yeast expression vector
pGBT9 (Clontech) was constructed from full-length human c-Cbl in the
pGEM4Z vector (kindly provided by L. E. Samelson). A 3T3-L1
adipocyte cDNA library was synthesized with a cDNA synthesis kit
(Stratagene) and constructed in the pGAD-GH GAL4 vector (Clontech). The
yeast strain Y190 was first transformed to tryptophan prototrophy with
the GAL4-c-Cbl protein and then with the 3T3-L1 adipocyte cDNA library.
The resulting transformants were plated on selection medium lacking
tryptophan, leucine, and histidine and containing 25 mM 3-aminotriazole
and were incubated at 30°C for 4 to 5 days. His+ colonies
were plated onto M63GV-Trp-Leu-His medium containing 5-bromo-4-chloro-3-indolylphosphate-
-D-galactopyranoside
(X-Gal) (26) and were analyzed for
-galactosidase
activity. Library-derived plasmids were rescued from positive clones
and were transformed into Escherichia coli HB101 for DNA
sequencing. Nucleotide and amino acid sequence alignments were
performed by screening GenBank and EMBL databases with the BLAST
program.
Cell culture and activation.
3T3-L1 fibroblasts were
maintained in Dulbecco's modified Eagle's medium (4,500 g of
glucose/liter) supplemented with 10% fetal bovine serum and 1%
penicillin-streptomycin. Differentiation to adipocytes was induced as
previously described (33). The cells were then cultured in
Dulbecco's modified Eagle's medium containing 10% fetal bovine serum
for 2 to 8 days. Before hormonal treatment, the cells, grown in
10-cm-diameter dishes, were serum deprived for 12 to 18 h. Unless
otherwise indicated, 100 nM insulin (Sigma) was added directly to the
medium and the incubation was continued for the indicated times at
37°C. Chinese hamster ovary (CHO) cells were cultured in minimal
Eagle's medium containing nucleotides, 10% fetal bovine serum, and
1% penicillin-streptomycin.
Northern blot analysis.
Total cellular RNA was isolated from
3T3-L1 fibroblasts and adipocytes by the acid guanidinium thiocyanate
method (9). RNA samples (20 µg) were fractionated in 1.2%
agarose-2.2 M formaldehyde and transferred to a Hybond-N membrane
(Amersham). Hybridizations were performed at 65°C for 20 h first
with a purified EcoRI fragment from clone 2.1 (Fig.
1A) and then with a
-actin probe
labeled with [
-32P]dCTP (Amersham) by the
random-primer extension method. A mouse multiple-tissue Northern blot
analysis (Clontech) was performed with a clone 2.1 probe by following
the manufacturer's instructions.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Primary structure of CAP and mRNA expression. (A) 3T3-L1
adipocyte cDNA clones isolated from the yeast two-hybrid screen with
c-Cbl as bait are shown (black lines) aligned below a schematic of the
domain organization of the CAP protein. Numbers in parentheses refer to
the number of times each clone was isolated from the yeast two-hybrid
screen. The letters A, B, and C indicate the presence of alternative
spliced inserts. (B) Total RNA (20 µg) isolated from 3T3-L1
adipocytes or fibroblasts was hybridized to a probe prepared from the
DNA insert of clone 2.1 labeled with [ -32P]dCTP by
random-primer extension (upper). The filter was then stripped and
rehybridized with a -actin probe to estimate the relative amount of
RNA in each lane (lower). The migration positions of RNA size markers
(in kilobases) are on the left.
|
|
Antibodies.
For the production of anti-CAP antibodies, CAP
clone 2.1 (Fig. 1A) was subcloned from the pGAD-GH plasmid into the
EcoRI site of pGEX-5X-3 vector (Pharmacia Biotechnology) to
facilitate expression as a glutathione S-transferase (GST)
fusion protein. The GST-CAP-SH3 fusion protein was purified from
bacterial cell lysates with glutathione-Sepharose beads and injected
into New Zealand rabbits according to standard procedure. To affinity
purify the resulting antiserum, GST-CAP-SH3 fusion protein adsorbed on
the glutathione-Sepharose beads was cleaved by incubation with Factor
Xa (New England BioLabs) in a buffer containing 20 mM HEPES (pH 8), 100 mM NaCl, and 2 mM CaCl2 for 12 h at room temperature.
After centrifugation to remove the beads, the supernatant was incubated
with benzamidine-Agarose (Sigma) for 15 min at room temperature. The
CAP-SH3 protein in the supernatant was then coupled to an AminoLink
column (Pierce, Rockford, Ill.) by following the instructions in the
manufacturer's manual. The affinity-purified anti-CAP antibodies were
subjected to buffer exchange with Tris-buffered saline (10 mM Tris-HCl
[pH 7.4], 150 mM NaCl), quantitated, and stored at
70°C.
Anti-c-Cbl and anti-ERK2 antibodies were purchased from Santa Cruz
Inc., anti-insulin receptor antibodies and protein G- and protein
A-Agarose were purchased from Oncogene Science, and anti-c-Crk-II
antibody and the antiphosphotyrosine antibody RC20H were purchased from Transduction Laboratories. Anti-Flag antibodies were purchased from
Kodak, New Haven, Conn. Horseradish peroxidase-linked secondary antibodies were from Amersham.
Expression vector construct and transfection of CHO cells.
A
Flag epitope-tagged full-length CAP in a eukaryotic expression vector
was constructed as follows. The cDNA of the amino-terminal region of
CAP was amplified by PCR with CAP cDNA in pEXlox as the template
(38). The primer
5'-CGCGGATCCGCCGCCACCATGGAC TACAAGGACGACGATGACAAGAG T TC TGAATGTGAT-3'
was designed to have a BamHI restriction site followed
by a coding sequence for a Flag epitope in frame with amino acid 2. The
primer 5'-AATGTCTGGAGTCGG-3' corresponds to amino acids 345 to 350. The amplified DNA fragment was digested with BamHI
and SacI (present in the CAP gene) and ligated
into CAP cDNA clone 2.5 (Fig. 1A) in the pGAD-GH vector digested with BamHI and SacI. The Flag-tagged full-length CAP
cDNA was then liberated by digestion with SpeI and
EcoRI and ligated into the PCI expression vector (Promega)
at the NheI and EcoRI sites. The sequence of the
Flag-tagged CAP cDNA (Flag-CAP) in this vector was confirmed by DNA
sequencing.
CHO cells were transiently transfected with 10 µg of either Flag-CAP
or the vector alone with the Lipofectamine reagent (Gibco-BRL) for
4 h at 37°C. The transfected cells were then washed twice with
phosphate-buffered saline, and complete medium was added. Forty-eight
hours after transfection, the cells were washed and lysed for further
analysis.
Immunoprecipitations and immunoblotting.
Cells (0.5 × 107 to 1 × 107) were washed twice with
ice-cold phosphate-buffered saline and lysed with buffer containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% Triton X-100, 1 mM EDTA, 10 mM
sodium pyrophosphate, 1 mM sodium orthovanadate, 100 mM NaF, 10 µg of
aprotinin/ml, 10 µg of leupeptin/ml, and 1 mM phenylmethylsulfonyl fluoride on ice for 15 min. After centrifugation at 10,000 × g for 15 min at 4°C, the clarified supernatants were
incubated with the indicated antibodies for 3 h at 4°C. The
immune complexes were precipitated with protein G- or protein A-Agarose
for 2 h and were washed extensively with lysis buffer before
solubilization in Laemmli sample buffer. Bound proteins were separated
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. Individual proteins were
detected with the specified antibodies and visualized by blotting with
horseradish peroxidase-linked secondary antibodies. To reprobe
immunoblots, the nitrocellulose membranes were incubated for 30 min at
60°C with 62.5 mM Tris-HCl (pH 6.8)-2% SDS-0.7% 2-mercaptoethanol, and then were washed extensively with 10 mM Tris-HCl
(pH 8)-150 mM NaCl.
In vitro binding assays.
The DNA fragments encoding the
individual SH3 domains of CAP were generated by PCR with the following
oligonucleotides (which contain BamHI and EcoRI
restriction sites): 5'-CTGTGCGGATCCGGATTAGAGA-3' and
5'-CTGTGCGAATTCCTCAGCTGGAGGAAGAAGCTC-3' for SH3A,
5'-CTGTGCGGATCCGAATATGGAGAAGCCATTGCA-3' and
5'-CTGTGCGAATTCAAGCACATCTACATAGGT-3' for SH3B, and
5'-CTGTGCGGGATCCGATTTGTGTAGCTACCAAGCG-3' and
5'-CTGTGCGAATTCTTCTTATAGATATAAAGG-3' for SH3C. The
amplification products were digested with BamHI and
EcoRI and inserted in frame between the homologous sites of
the GST expression vector pGEX-2T (Pharmacia). All constructs were
verified by DNA sequencing through the entire portion obtained by PCR.
GST fusion proteins containing the SH2 and SH3 domains of Crk were the
generous gift of R. B. Birge and H. Hanafusa (4, 12).
In vitro association experiments were performed with an equal amount (5 µg) of the immobilized GST-fusion proteins or GST alone as described
previously (29). The bound proteins were analyzed as
described above for immunoprecipitates.
Cellular fractionation.
3T3-L1 adipocytes, treated with or
without insulin (100 nM) for 5 min, were washed twice with ice-cold
phosphate-buffered saline and scraped into 1 ml of homogenization
buffer containing 50 mM HEPES (pH 7.2), 2 mM EDTA, 2 mg of glycogen/ml,
0.2% 2-mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride, 1 mM
benzamidine, 10 µg of aprotinin, and 10 µg of leupeptin/ml. Cells
were sonicated and centrifuged at 2,500 × g to remove
nuclei and unlysed cells. The postnuclear supernatant was removed and
centrifuged for 15 min at 10,000 × g to pellet the
plasma membranes. The supernatant was recentrifuged for 1 h at
100,000 × g. The final supernatant was called cytosol.
The plasma membrane pellets were resuspended in homogenization buffer
by 10 passes through a 23-gauge needle and recentrifuged. The final
pellet was resuspended as described above. Proteins (25 µg) were
separated by SDS-PAGE and identified by immunoblotting with specific
antibodies.
 |
RESULTS |
Isolation of a c-Cbl-binding protein with the yeast two-hybrid
system.
To elucidate the signaling pathways in which c-Cbl is
involved in 3T3-L1 adipocytes, we searched for adipocyte-specific
c-Cbl-interacting proteins. Towards this goal, full-length c-Cbl fused
to the DNA binding domain of GAL4 (GAL4-c-Cbl) was used as bait to
screen a 3T3-L1 adipocyte cDNA expression library fused to the GAL4
transcriptional activation domain in the yeast two-hybrid interaction
system. Of 5 × 105 total transformants, 13 colonies
were subsequently positive for
-galactosidase activity when they
were plated on X-Gal-containing medium. The recovered library-derived
plasmids induced
-galactosidase activity only when they were
coexpressed with GAL4-c-Cbl fusion protein and not with an unrelated
GAL4 fusion protein containing the catalytic domain of protein
phosphatase 1.
DNA sequences from the GAL4 fusion junctions of all the plasmid inserts
revealed that they all encoded five independent novel protein fragments
overlapping at the COOH terminus (Fig. 1A, clones 2.1, 2.2, 2.3, 2.4, and 2.5). We designated this protein CAP for c-Cbl-associated protein.
The open reading frame of these cDNA inserts is followed by a stop
codon and 250 bp of 3' untranslated region. A computer-assisted
sequence homology search of GenBank revealed that the COOH-terminal
region of CAP contains three adjacent SH3 domains. A stretch of ~120
amino acids of CAP (Fig. 1A, clones 2.4 and 2.5) has significant
sequence similarity with the porcine peptide hormone sorbin (32%
identity at the amino acid level [42]) and was termed
the sorbin domain.
The cDNAs that encompass the complete coding region of CAP have been
isolated from a mouse embryo cDNA expression library by using a
functional screen with a defined SH3 ligand peptide (38).
The open reading frames of these cDNAs contained insertions of a
different sequence (types A to C) in the middle of CAP, presumably due
to alternative splicing (Fig. 1A). Analysis of the coding sequences
predicted proteins with molecular masses of 77 to 90 kDa. The CAP
clones isolated by the two-hybrid screen had both the B and C type
insertions missing (Fig. 1A). The structure and the predicted amino
acid sequence of CAP suggest that it represents a family of novel
signaling molecules that may function as multi-domain binding proteins.
Since CAP cDNA was isolated from a cDNA library prepared from 3T3-L1
adipocytes, we determined the expression pattern of the CAP
gene in 3T3-L1 cells. Northern blot analysis of RNA isolated from both
3T3-L1 fibroblasts and fully differentiated adipocytes was performed
with the cDNA insert of clone 2.1. As shown in Fig. 1B, transcripts
corresponding to a major, broad band of 7 kb and a minor band of 8 kb
were detected in 3T3-L1 adipocytes. Interestingly, no mRNA was detected
in 3T3-L1 fibroblasts. CAP transcripts with the same sizes were also
detected in RNA isolated from rat adipocytes (not shown).
Expression of CAP proteins during 3T3-L1 cell differentiation.
In order to characterize the proteins encoded by CAP, polyclonal
antibodies were raised against the purified C-terminal domain of CAP
present in clone 2.1 (Fig. 1A), expressed as a GST fusion protein. For
the expression of CAP in CHO cells, CAP clone 2.5, isolated by the
two-hybrid screen, was fused in frame to the N-terminal region of CAP
obtained from the mouse embryo library. A plasmid containing this
full-length form of CAP, with a Flag epitope tagged onto the N terminus
(Flag-CAP), or the vector alone (PCI) was transiently transfected into
CHO cells. Lysates prepared from the transfected cells were
immunoprecipitated with antibodies to Flag (Anti-Flag) or with anti-CAP
antibodies. The immunoprecipitates were separated by SDS-PAGE followed
by immunoblotting with anti-Flag antibodies. As shown in Fig.
2A, The N-terminal Flag-tagged CAP was
recognized by both the anti-Flag antibodies and the anti-CAP serum
elicited against the C terminus of CAP. The protein encoded by this
cDNA migrated as a single band with an apparent molecular mass of 85 kDa on an SDS-PAGE gel. Similar results were obtained following
immunoblotting of the immunoprecipitates with the anti-CAP serum (data
not shown). Both antibodies detected CAP only in cell lysates prepared
from the CAP-transfected CHO cells and not in cells transfected with
the vector alone. CHO cells express no detectable endogenous proteins
recognized by the anti-CAP antibodies. These results indicate that our
antibodies specifically recognize the protein product of the
cap gene.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of the CAP gene product(s). (A) CHO cells
were transiently transfected with an expression vector containing
full-length CAP with a Flag epitope tagged onto the N terminus
(Flag-CAP) or the vector alone (PCI). Cell lysates were then
immunoprecipitated (IP) with anti-Flag or anti-CAP antibodies.
Whole-cell lysates (WCL) containing 20 µg of protein and the
immunoprecipitates were subjected to SDS-PAGE and immunoblotted with
anti-Flag antibodies. (B) Cell lysates prepared from 3T3-L1 adipocytes
or CHO cells transfected with Flag-CAP were directly analyzed by
immunoblotting with anti-CAP antibodies. (C) Total cellular lysates
prepared from confluent 3T3-L1 fibroblasts (Conf) and at various times
during differentiation into adipocytes as previously described
(33) (30 µg per lane) were separated by SDS-PAGE followed
by immunoblotting with anti-CAP antibodies. Molecular mass markers (in
kilodaltons) are on the left. Diffe. Mix, differentiation mixture; FBS,
fetal bovine serum.
|
|
We next examined the expression of CAP proteins in 3T3-L1 adipocytes
(Fig. 2B). Interestingly, while in CHO cells the anti-CAP antibodies
detected only the product of the Flag-tagged CAP cDNA, with similar
results obtained with Flag-tagged CAP-transfected NIH 3T3 cells (data
not shown), the anti-CAP antibodies detected several proteins in 3T3-L1
adipocyte cell lysates. An adipocyte protein with a molecular mass of
88 to 90 kDa migrated similarly to the CAP protein expressed in
transfected CHO cells. The slower mobility of this adipocyte protein
might reflect posttranslational modifications that do not occur in CHO
cells. In addition to the 88-kDa protein product, the anti-CAP
antibodies also detected proteins with molecular masses of 125, 75, 53, and 45 kDa with different levels of expression in 3T3-L1 adipocyte
lysates. These proteins may represent different isoforms or
alternatively spliced variants of CAP expressed in 3T3-L1 adipocytes,
consistent with the identification of various cDNA splice forms and
mRNA transcripts. It is possible that the anti-CAP antibodies were able
to recognize multiple isoforms of CAP in 3T3-L1 adipocytes common in
their C-terminal portion used for antibody production. However, whether each of these proteins is a distinct CAP isoform remains uncertain.
Since CAP mRNA was detected only in 3T3-L1 adipocytes (Fig. 1B), we
were interested to examine the expression pattern of CAP at different
stages during the conversion of 3T3-L1 fibroblasts into adipocytes.
Equivalent amounts of protein, prepared from confluent 3T3-L1
preadipocytes and at various times during differentiation into
adipocytes, were separated by SDS-PAGE followed by immunoblotting with
anti-CAP antibodies (Fig. 2C). The 88-kDa CAP was undetectable in
confluent preadipocytes, while a low level of expression of the 125-kDa
protein was detected in the preadipocytes that increased during
differentiation. The 88-kDa CAP was detected only 6 days after the
initiation of differentiation (2 days FBS), when lipid accumulation was
just starting with an increase to maximal expression after extensive
differentiation. Additionally, the proteins of 75, 53, and 45 kDa were
detected with anti-CAP antibodies only in fully differentiated 3T3-L1
cells. These results demonstrate that both CAP mRNA and protein
expression are largely restricted to 3T3-L1 adipocytes.
Tissue distribution of CAP.
To determine the tissue
distribution of CAP mRNA, a mouse multiple-tissue Northern blot was
hybridized with a probe prepared from the DNA insert of clone 2.1 (Fig.
3). Several size classes of CAP mRNA
transcripts were detected with tissue-specific variation in their
relative abundance. CAP mRNA expression was highest in heart, liver,
skeletal muscle and kidney. Lesser amounts were detected in brain and
lung, while we could not detect CAP mRNA in spleen and testis, even
after long exposure. The three most prominent CAP transcripts were
approximately 6.5, 7.4, and 8 kb. Similar results were obtained when a
rat multiple-tissue Northern blot was hybridized with the same probe
(data not shown). These results are consistent with the isolation of
multiple CAP cDNA variants. These may be expressed in a tissue-specific
manner with distinct physiological functions. The specific expression
of CAP in adipose tissue as well as liver and muscle makes CAP a
candidate for a physiologically relevant effector protein in insulin
signaling.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
Tissue distribution of CAP mRNA. A Northern blot
containing mouse poly(A+) RNA (2 µg per lane) from the
indicated tissues was hybridized with the cDNA insert of clone 2.1 probe. The positions of RNA size markers in kilobases are shown on the
left.
|
|
Interactions of CAP SH3 domains.
All of the activation
domain-fused CAP clones isolated by the yeast two-hybrid screen
contained all three SH3 domains, and one CAP clone (2.1 [Fig. 1A])
contained exclusively the three SH3 domains. This result suggested that
the interaction of CAP with c-Cbl is primarily mediated by the SH3
domains binding to the proline-rich motifs in c-Cbl. To confirm that
the SH3 domains of CAP interact with native c-Cbl, and to address the
effect of insulin on this association, a GST fusion protein was
generated with the clone 2.1 coding region (CAP-SH3). We have recently
demonstrated that c-Cbl is rapidly tyrosine phosphorylated in response
to insulin 3T3-L1 adipocytes. On phosphorylation, c-Cbl forms an
insulin-dependent association with the SH2 domain of Crk
(30). Lysates prepared from 3T3-L1 adipocytes treated with
or without insulin were incubated with the GST fusion proteins
containing Crk-SH2, CAP-SH3, or GST alone immobilized on
glutathione-Sepharose beads. The bound proteins were separated by
SDS-PAGE and were detected by immunoblotting with anti-c-Cbl antibodies
(Fig. 4A). GST-CAP-SH3 fusion protein bound c-Cbl in lysates of unstimulated cells. Treatment of cells with
insulin had no effect on the amount of c-Cbl associated with the
GST-CAP-SH3 fusion protein, while such treatment induced the association of c-Cbl with GST-Crk-SH2. Thus, CAP and c-Cbl form a
constitutive complex in 3T3-L1 adipocytes independent of insulin stimulation. The tyrosine phosphorylation of c-Cbl in response to
insulin does not regulate its interaction with CAP. These data are in
agreement with the two-hybrid experiments and emphasize the role of
CAP-SH3 domains in the interaction with c-Cbl.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
c-Cbl binds to the carboxyl-terminal SH3 domain of CAP
independent of insulin stimulation. (A) 3T3-L1 adipocytes were serum
starved for 18 h and then stimulated with insulin (100 nM) for 5 min or left untreated. The cell lysates were incubated with the GST
fusion proteins containing Crk-SH2, the three CAP SH3 domains
(CAP-SH3), or GST alone immobilized on glutathione-Sepharose beads for
90 min at 4°C. The bound proteins were eluted, resolved by SDS-PAGE,
and immunoblotted with anti-c-Cbl antibodies. (B) 3T3-L1 adipocytes
were stimulated with insulin (100 nM) for 5 min or left untreated. The
cell lysates were then incubated with GST fusion proteins containing
the first SH3 domain (SH3A, closest to the N terminus), the middle SH3
domain (SH3B), the carboxyl-terminal SH3 domain of CAP (SH3C), and the
Crk-SH3 domain. The resulting precipitated proteins were separated by
SDS-PAGE and immunoblotted with anti-c-Cbl or anti-Sos antibodies.
Molecular mass markers (in kilodaltons) are on the left.
|
|
To define the interaction between CAP and c-Cbl in more detail, each of
the SH3 domains of CAP was expressed as a GST fusion protein. Lysates
prepared from 3T3-L1 adipocytes stimulated with insulin or left
untreated were incubated with GST fusion protein containing the
individual SH3 domains of CAP and the Crk-SH3 domain as a control. The
bound proteins were immunoblotted with anti-c-Cbl or anti-Sos
antibodies. As shown in Fig. 4B (anti-c-Cbl blot), the
carboxyl-terminal SH3 domain of CAP (SH3C) was able to bind c-Cbl in
unstimulated 3T3-L1 adipocytes. As described above, insulin had no
effect on the association state of the CAP-SH3C-c-Cbl complex. Immunoblotting the above-described bound proteins with anti-Sos antibodies (Fig. 4B, anti-Sos blot) indicated that the
carboxyl-terminal SH3 domain of CAP (SH3C) may bind Sos in lysates of
unstimulated cells. Interestingly, similar to the ability of insulin to
induce the phosphorylation-dependent dissociation of Grb2-Sos and to a
lesser extent Crk-Sos complexes (23, 44), there was an
insulin-dependent dissociation of the CAP-SH3C-Sos complex. The first
SH3 domain (SH3A, closest to the N terminus) and the middle SH3 domain
(SH3B) did not independently associate with either c-Cbl or Sos.
However, using a phage-displayed library, we identified peptide ligands to each of the isolated SH3 domains of CAP, demonstrating that these
are functional SH3 domains (data not shown).
Association of CAP with c-Cbl and Sos in intact cells.
The
association of CAP and c-Cbl were examined in CHO cells transfected
with Flag-CAP or the vector alone (PCI). Lysates prepared from
transfected CHO cells were immunoprecipitated with anti-CAP or
anti-Flag antibodies followed by immunoblotting with anti-c-Cbl antibodies (CHO cells express endogenous c-Cbl). c-Cbl was
coimmunoprecipitated with anti-CAP or anti-Flag antibodies from
Flag-CAP-transfected CHO cell lysates but not from cells transfected
with the vector alone (Fig. 5A).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
In vivo association of CAP with c-Cbl and Sos. (A) CHO
cells transfected with Flag-CAP or the vector alone (PCI) were lysed
and immunoprecipitated with anti-CAP or anti-Flag antibodies. Following
SDS-PAGE, the immunoprecipitates (IP) were immunoblotted with
anti-c-Cbl antibodies. (B) CHO cells transfected with Flag-CAP were
lysed and immunoprecipitated with anti-Sos antibodies. The
immunoprecipitates were separated by SDS-PAGE and immunoblotted with
anti-CAP antibodies. WCL, whole-cell lysates. Molecular mass markers
(in kilodaltons) are on the left.
|
|
As the SH3 domain of CAP could also bind Sos in vitro, we tested
whether this association also occurs in cells. CHO cells transfected
with Flag-CAP were lysed followed by immunoprecipitation with anti-Sos
antibodies. As shown in Fig. 5B, CAP was immunoprecipitated with
anti-Sos antibodies from the transfected cells. These experiments indicated that CAP interacts with c-Cbl and Sos to form stable complexes in intact cells through binding of the CAP carboxy-terminal SH3 domain.
Endogenous CAP associates with c-Cbl in 3T3-L1 adipocytes.
To
gain further insight regarding the functional importance of the
c-Cbl-CAP association, we analyzed the association of endogenous CAP
and c-Cbl in intact 3T3-L1 adipocytes and the effect of insulin stimulation on the in vivo interaction. Lysates of unstimulated or
insulin-stimulated 3T3-L1 adipocytes were immunoprecipitated with
anti-CAP or anti-c-Crk-II antibodies as a control. The resulting immunocomplexes were blotted with anti-c-Cbl antibodies. As shown in
Fig. 6 (anti-c-Cbl blot), c-Cbl
coimmunoprecipitated with the endogenous CAP in quiescent, unstimulated
3T3-L1 adipocytes. Insulin treatment did not affect this association.
In the control experiment, and as we have recently shown
(30), after insulin-dependent tyrosine phosphorylation,
c-Cbl forms complexes with endogenous c-Crk. The anti-CAP
immunoblotting of the above-described immunoprecipitates revealed that
CAP proteins detected in 3T3-L1 adipocyte cell lysates (Fig. 2B) were
also immunoprecipitated by the anti-CAP antibodies (Fig. 6, anti-CAP
blot). Equal amounts of these proteins were immunoprecipitated from
unstimulated or insulin-stimulated 3T3-L1 adipocytes. These results
show that endogenous c-Cbl and CAP interact in vivo in a constitutive
manner in 3T3-L1 adipocytes. We could not detect any tyrosine
phosphorylation of CAP proteins in unstimulated or insulin-stimulated
3T3-L1 adipocytes (data not shown).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
CAP associates with c-Cbl in intact 3T3-L1 adipocytes.
3T3-L1 adipocytes were serum starved for 18 h and then stimulated
with insulin (100 nM) for 5 min or left untreated. The cell lysates
were immunoprecipitated with anti- c-Crk or anti-CAP antibodies. The
resulting immunoprecipitates (IP) were separated by SDS-PAGE and
subjected to immunoblotting with anti-c-Cbl antibodies. The blot was
then stripped of the anti-c-Cbl antibodies and reprobed with anti-CAP
antibodies. WCL, whole-cell lysates. Molecular mass markers (in
kilodaltons) are on the left.
|
|
Association of CAP with the insulin receptor in 3T3-L1
adipocytes.
Given the predominant expression of CAP in
differentiated versus undifferentiated 3T3-L1 cells, we examined
whether endogenous CAP could form a complex with the insulin receptor.
3T3-L1 adipocytes were stimulated with and without insulin for the
indicated times, and the cell lysates were incubated with anti-insulin
receptor antibodies. The resulting immunoprecipitates were separated by SDS-PAGE and were analyzed by immunoblotting with anti-CAP antibodies. As shown in Fig. 7A (anti-CAP blot), one
major CAP isoform coimmunoprecipitated with the insulin receptor in
unstimulated 3T3-L1 adipocytes. Interestingly, addition of insulin
caused a time-dependent dissociation of the CAP-insulin receptor
complex. After 5 min of insulin stimulation, only a fraction of CAP was
detected in the anti-insulin receptor immunoprecipitate. To ensure that
the dissociation of CAP from the insulin receptor is due to insulin
stimulation, 3T3-L1 adipocytes were treated with EGF. EGF stimulation
had no effect on the association state of CAP with the insulin
receptor, and the same levels of CAP were detected in the anti-insulin
receptor immunoprecipitates from unstimulated and EGF-stimulated 3T3-L1
adipocytes. The blot was completely stripped of the anti-CAP antibodies
and reprobed with anti-insulin receptor antibodies (Fig. 7A, anti-IR
blot). The insulin receptors were precipitated equally from all
samples. Antiphosphotyrosine immunoblotting of the whole-cell lysate
samples used in these experiments confirmed that insulin and EGF
stimulated the tyrosine autophosphorylation of the insulin receptor
-subunit and the EGF receptor, respectively (Fig. 7B, anti-pY blot).
The dissociation of CAP from the insulin receptor was not due to
dephosphorylation of the receptor, as it remains tyrosine
phosphorylated during this time. The finding that in 3T3-L1 adipocytes
predominantly one form of CAP associates with the insulin receptor, and
that this interaction decreased following insulin receptor activation, raises the possibility that CAP may link c-Cbl to the insulin receptor.
The functional domains within CAP and the insulin receptor that mediate
these interactions remain to be determined.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Association of CAP with the insulin receptor in 3T3-L1
adipocytes. (A) Cell lysates prepared from serum-starved 3T3-L1
adipocytes treated with insulin (100 nM) for the indicated times or
with EGF (100 ng/ml) for 5 min were immunoprecipitated with
anti-insulin receptor (Anti-IR) antibodies. The immunoprecipitates (IP)
were subjected to SDS-PAGE and immunoblotted with anti-CAP antibodies.
The blot was then stripped of the anti-CAP antibodies and reprobed with
anti-IR antibodies. (B) Equal protein amounts (30 µg per lane) of the
cell lysates used in panel A were directly analyzed by immunoblotting
with antiphosphotyrosine antibodies (anti-pY). The positions of the EGF
receptor (EGFR) and the insulin receptor (IR) are indicated by arrows.
WCL, whole-cell lysates. Molecular mass markers (in kilodaltons) are on
the left.
|
|
Localization of CAP in 3T3-L1 adipocytes.
We next analyzed the
subcellular localization of CAP proteins. Differentiated 3T3-L1 cells
were treated with or without insulin and then fractionated into
cytosolic and membrane fractions. Immunoblotting of the fractions with
the anti-CAP antibodies showed both that CAP proteins are present in
the cytosolic and membrane fractions of unstimulated 3T3-L1 adipocytes
and that insulin stimulation did not significantly alter the
subcellular distribution of CAP (Fig. 8,
anti-CAP blot). The purity of the fractions was analyzed with the
anti-insulin receptor antibodies that detected the insulin receptor
exclusively in the membrane fraction (Fig. 8, anti-IR blot), while
anti-ERK2 antibodies were used to detect ERK2 in the cytosolic fraction
(Fig. 8, anti-ERK2 blot). The multiple SH3 domains of CAP may direct
the localization of some CAP to the membrane fraction of the cells, as
this motif is often found in cytoskeleton-associated proteins
(25).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
Subcellular localization of CAP proteins in 3T3-L1
adipocytes. Serum-starved differentiated 3T3-L1 cells were stimulated
with and without insulin (100 nM) for 5 min. Subcellular fractionation
was obtained as described in Materials and Methods, and fractions are
identified as C (cytosolic fraction) and M (membrane fraction). Equal
amounts of protein (25 µg per lane) were analyzed by immunoblotting
with anti-CAP, anti-insulin receptor, and anti-ERK2 antibodies.
Molecular mass markers (in kilodaltons) are on the left.
|
|
 |
DISCUSSION |
Protein tyrosine phosphorylation is an early event in
insulin-initiated intracellular signaling cascades (34, 45).
Recently, we have demonstrated that insulin stimulates the tyrosine
phosphorylation of the c-Cbl proto-oncogene product, and this
phosphorylation shows specificity for the differentiated adipocyte
phenotype. Following insulin stimulation, the tyrosine-phosphorylated
c-Cbl specifically associates with the adapter c-Crk and the Fyn
tyrosine kinase in vivo and in vitro (30). Because we could
not detect c-Cbl tyrosine phosphorylation in response to insulin in a
variety of other cell types expressing functional insulin receptor
(30), we suspected that 3T3-L1 adipocytes might express a
specific adapter protein that may be involved in the tyrosine
phosphorylation of c-Cbl.
To search for such novel proteins we used the full-length c-Cbl as a
target protein to screen a 3T3-L1 adipocyte cDNA library in the yeast
two-hybrid system. Multiple, independent c-DNA inserts, which encoded
different fragments of the same protein were cloned from this library
and designated CAP for c-Cbl-associated protein. These interactions
were then verified in several experiments by using GST fusion proteins
and coimmunoprecipitation. Analysis of the predicted amino acid
sequences of these clones revealed three adjacent SH3 domains at the
carboxyl terminus and a novel putative sorbin homology domain at the N
terminus. The structure of CAP suggests that it may participate in
multiple signaling cascades. cDNA sequencing and Northern blot analysis
indicated that there are multiple splice variants of CAP that may
result in a family of different isoforms. Interestingly, both CAP mRNA and proteins are expressed predominately in 3T3-L1 adipocytes and not
in 3T3-L1 fibroblasts, implying a restricted signaling role for CAP in
these cells.
The three SH3 domains of CAP were cloned as a fragment from the yeast
two-hybrid library, suggesting that the association of CAP with c-Cbl
was SH3 mediated. This was further suggested by an examination of the
proline-rich regions of c-Cbl, revealing multiple potential SH3 binding
motifs (6). In vitro binding assays with GST fusion proteins
containing the individual SH3 domains of CAP confirmed that the
functional association of CAP with c-Cbl is mediated primarily by the
carboxyl-terminal SH3 domain of CAP. Interestingly, in 3T3-L1
adipocytes, which normally express both CAP and c-Cbl, CAP and c-Cbl
associate in a constitutive manner independent of insulin stimulation.
The specific tyrosine phosphorylation of c-Cbl and CAP expression in
the differentiated adipocytes suggest that the CAP-c-Cbl complex may
have a specialized signaling function in insulin action in these cells.
The observation that one major CAP isoform associated with the insulin
receptor suggests that at least one role of CAP might be to facilitate the interaction of c-Cbl with the insulin receptor, allowing for the
phosphorylation of c-Cbl and its association with c-Crk and Fyn.
Indeed, c-Cbl tyrosine phosphorylation is observed only in 3T3-L1
adipocytes, which uniquely express CAP. Moreover, receptor activation
leads to rapid dissociation of the insulin receptor-CAP complex. The
kinetics of the insulin receptor-CAP dissociation parallels the time
course of insulin-stimulated tyrosine phosphorylation of c-Cbl in these
cells (30). The structural requirements for this interaction
remain to be determined.
The c-cbl gene was cloned as the cellular homolog of the
v-cbl oncogene, which is transforming in early B-lineage and
myeloid cells (5, 6). However, overexpression of c-Cbl does
not induce cellular transformation, and the function of the
proto-oncogene product remains unclear. The potential signaling
function of c-Cbl downstream of tyrosine kinases depends on the
association of its proline-rich region with SH3 domain-containing
signaling proteins such as Grb2 and Nck (8, 11, 14, 21, 31)
and the tyrosine phosphorylation sites with SH2 domain-containing
proteins (8, 11, 13, 14, 18, 28, 37). Since Grb2 and Nck are
ubiquitous in their expression, CAP with its specific expression in
3T3-L1 adipocytes may represent a specialized component in the signal transduction role of c-Cbl in these cells. Thus, different pools of
c-Cbl may associate with different proteins forming various signaling
complexes, each with distinct cellular function.
The ability of insulin to stimulate glucose uptake and storage of
glucose as glycogen and lipids is significantly increased after 3T3-L1
differentiation. The expression of many fat cell-specific genes
critical to insulin action is increased during adipocyte differentiation, such as GLUT4 (10, 17). Thus, changes in the level of CAP expression and c-Cbl tyrosine phosphorylation might
contribute to increased insulin responsiveness observed in
differentiated 3T3-L1 adipocytes. CAP was also found to associate with
the nucleotide exchange protein Sos. Insulin treatment of 3T3-L1
adipocytes induces a dissociation of the CAP-SH3 domain from Sos
similar to the dissociation of the Grb2/Sos complex (44). CAP, CAP/c-Cbl, and CAP/Sos may represent specific endogenous regulators in insulin-activated signal transduction pathways in 3T3-L1
adipocytes.
 |
ACKNOWLEDGMENT |
We thank Roman Herrera for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Parke-Davis
Pharmaceutical Research Division, Warner Lambert Company, 2800 Plymouth Rd., Ann Arbor, MI 48105. Phone: (313) 996-3960. Fax: (313) 996-5668. E-mail: saltiea{at}aa.wl.com.
 |
REFERENCES |
| 1.
|
Andoniou, C. E.,
C. B. F. Thien, and W. Y. Langdon.
1994.
Tumour induction by activated abl involves tyrosine phosphorylation of the product of the cbl oncogene.
EMBO J.
13:4515-4523[Medline].
|
| 2.
|
Araki, E.,
M. A. Lipes,
M. E. Patti,
J. C. Bruning,
B. Haag,
R. S. Johnson, and R. C. Kahn.
1994.
Alternative pathway of insulin signaling in mice with targeted disruption of the IRS-1 gene.
Nature (London)
372:186-190[Medline].
|
| 3.
|
Backer, J. M.,
M. G. Mayers, Jr.,
S. E. Shoelson,
D. J. Chin,
X.-J. Sun,
M. Miralpeix,
H. Patrick,
B. Margolis,
E. Y. Skolnik,
J. Schlessinger, and M. F. White.
1992.
Phosphatidylinositol 3'-kinase is activated by association with IRS-1 during insulin stimulation.
EMBO J.
11:3469-3479[Medline].
|
| 4.
|
Birge, R. B.,
E. J. Fajardo,
C. Reichman,
S. E. Shoelson,
Z. Songyang,
L. C. Cantley, and H. Hanafusa.
1993.
Identification and characterization of a high-affinity interaction between v-Crk and tyrosine-phosphorylated paxillin in CT10-transformed fibroblasts.
Mol. Cell. Biol.
13:4648-4656[Abstract/Free Full Text].
|
| 5.
|
Blake, T.,
K. Heath, and W. Langdon.
1993.
The truncation that generated the v-cbl oncogene reveals an ability for nuclear transport, DNA binding and acute transformation.
EMBO J.
12:2017-2026[Medline].
|
| 6.
|
Blake, T.,
M. Shapiro,
H. Morse, and W. Langdon.
1991.
The sequences of the human and mouse c-cbl proto-oncogenes show v-cbl was generated by a large truncation encompassing a proline-rich domain and a leucine zipper-like motif.
Oncogene
6:653-657[Medline].
|
| 7.
|
Bruning, J. C.,
J. Winnay,
B. Cheatham, and C. R. Kahn.
1997.
Differential signaling by insulin receptor substrate 1 (IRS-1) and IRS-2 in IRS-1-deficient cells.
Mol. Cell. Biol.
17:1513-1521[Abstract].
|
| 8.
|
Buday, L.,
A. Khwaja,
S. Sipeki,
A. Farago, and J. Downward.
1996.
Interactions of Cbl with two adapter proteins, Grb2 and Crk, upon T cell activation.
J. Biol. Chem.
271:6159-6163[Abstract/Free Full Text].
|
| 9.
|
Chomcynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 10.
|
de Herreros, A. G., and M. J. Birnbaum.
1989.
The acquisition of increased insulin-responsive hexose transporter in 3T3-L1 adipocytes correlates with expression of a novel transporter gene.
J. Biol. Chem.
264:19994-19999[Abstract/Free Full Text].
|
| 11.
|
Donovan, J. A.,
R. L. Wagner,
W. Y. Langdon, and L. E. Samelson.
1994.
The protein product of the c-cbl protooncogene is the 120-kDa tyrosine-phosphorylated protein in Jurkat cells activated via the T cell antigen receptor.
J. Biol. Chem.
269:22921-22924[Abstract/Free Full Text].
|
| 12.
|
Feller, M. S.,
B. Knudsen, and H. Hanafusa.
1995.
Cellular proteins binding to the first src homology 3 (SH3) domain of the proto-oncogene product c-Crk indicates Crk-specific signaling pathways.
Oncogene
10:1465-1473[Medline].
|
| 13.
|
Fukazawa, T.,
S. Miyake,
V. Band, and H. Band.
1996.
Tyrosine phosphorylation of Cbl upon epidermal growth factor (EGF) stimulation and its association with EGF receptor and downstream signaling proteins.
J. Biol. Chem.
271:14554-14559[Abstract/Free Full Text].
|
| 14.
|
Fukazawa, T.,
K. A. Reedquist,
T. Traub,
S. Soltoff,
G. Panchamoorthy,
B. Druker,
L. Cantley,
S. E. Shoelson, and H. Band.
1995.
The SH3 domain binding T cell tyrosyl phosphoprotein p120. Demonstration of its identity with the c-cbl protooncogene product and in vivo complexes with Fyn, Grb2, and phosphatidylinositol 3-kinase.
J. Biol. Chem.
270:19141-19150[Abstract/Free Full Text].
|
| 15.
|
Galisteo, M. L.,
I. Dikic,
A. G. Batzer,
W. Y. Langdon, and J. Schlessinger.
1995.
Tyrosine phosphorylation of the c-cbl proto-oncogene protein product and association with epidermal growth factor (EGF) receptor upon EGF stimulation.
J. Biol. Chem.
270:20242-20245[Abstract/Free Full Text].
|
| 16.
|
Holgado-Madruga, M.,
D. R. Emlet,
D. K. Moscatello,
A. K. Godwin, and A. J. Wong.
1996.
A Grb2-associated docking protein in EGF- and insulin-receptor signaling.
Nature (London)
379:560-564[Medline].
|
| 17.
|
Kandror, K. V.,
J. M. Stephens, and P. F. Pilch.
1995.
Expression and compartmentalization of caveolin in adipocytes cells: coordinate regulation with and structural segregation from GLUT4.
J. Cell Biol.
129:999-1006[Abstract/Free Full Text].
|
| 18.
|
Kim, T. J.,
Y. T. Kim, and S. Pillai.
1995.
Association of activated phosphatidylinositol 3'-kinase with p120cbl in antigen receptor-ligated B cells.
J. Biol. Chem.
270:27504-27509[Abstract/Free Full Text].
|
| 19.
|
Lazar, F. D.,
R. J. Wiese,
M. J. Brady,
C. M. Mastik,
S. B. Waters,
K. Yamauchi,
J. E. Pessin,
P. Cuatrecasas, and A. R. Saltiel.
1995.
Mitogen-activated protein kinase kinase inhibition does not block the stimulation of glucose utilization by insulin.
J. Biol. Chem.
270:20801-20807[Abstract/Free Full Text].
|
| 20.
|
Levkowitz, G.,
L. N. Klapper,
E. Tzahar,
A. Freywald,
M. Sela, and Y. Yarden.
1996.
Coupling of the c-Cbl protooncogene product to ErbB-1/EGF-receptor but not to other ErbB proteins.
Oncogene
12:1117-1125[Medline].
|
| 21.
|
Odai, H.,
K. Sasaki,
A. Iwamatsu,
Y. Hanazono,
T. Tanaka,
K. Mitani,
Y. Yazaki, and H. Hirai.
1995.
The proto-oncogene product c-Cbl becomes tyrosine phosphorylated by stimulation with GM-CSF or Epo and constitutively binds to the SH3 domain of Grb2/Ash in human hematopoietic cells.
J. Biol. Chem.
270:10800-10805[Abstract/Free Full Text].
|
| 22.
|
Ojaniemi, M.,
S. S. Martin,
F. Dolfi,
J. M. Olefsky, and K. Vuori.
1997.
The proto-oncogene product p120cbl links c-Src and phosphatidylinositol 3'-kinase to the integrin signaling pathway.
J. Biol. Chem.
272:3780-3787[Abstract/Free Full Text].
|
| 23.
|
Okada, S., and J. E. Pessin.
1996.
Interactions between Src homology (SH)2/SH3 adapter proteins and the guanylnucleotide exchange factor SOS are differentially regulated by insulin and epidermal growth factor.
J. Biol. Chem.
271:25533-25538[Abstract/Free Full Text].
|
| 24.
|
Okada, S.,
K. Yamauchi, and J. E. Pessin.
1995.
Shc isoform-specific tyrosine phosphorylation by the insulin and epidermal growth factor receptors.
J. Biol. Chem.
270:20737-20741[Abstract/Free Full Text].
|
| 25.
|
Pawson, T.
1995.
Protein modules and signaling networks.
Nature (London)
373:573-580[Medline].
|
| 26.
|
Printen, J. A., and J. F. Sprague.
1994.
Protein-protein interactions in the yeast pheromone response pathway: Ste5p interacts with all members of the MAP kinase cascade.
Genetics
138:609-619[Abstract].
|
| 27.
|
Pronk, G. J.,
A. M. Vries-Smith,
L. Buday,
J. Downward,
J. A. Maasen,
R. H. Medema, and J. L. Bos.
1994.
Involvement of Shc in insulin- and epidermal growth factor-induced activation of p21ras.
Mol. Cell. Biol.
14:1575-1581[Abstract/Free Full Text].
|
| 28.
|
Ribon, V.,
S. Hubbell,
R. Herrera, and A. R. Saltiel.
1996.
The product of the cbl oncogene forms stable complexes in vivo with endogenous Crk in a tyrosine phosphorylation-dependent manner.
Mol. Cell. Biol.
16:45-52[Abstract].
|
| 29.
|
Ribon, V., and A. R. Saltiel.
1996.
Nerve growth factor stimulates the tyrosine phosphorylation of endogenous Crk-II and augments its association with p130Cas in PC-12 cells.
J. Biol. Chem.
270:10800-10805.
|
| 30.
|
Ribon, V., and A. R. Saltiel.
1997.
Insulin stimulates tyrosine phosphorylation of the proto-oncogene product of c-Cbl in 3T3-L1 adipocytes.
Biochem. J.
324:839-846.
|
| 31.
|
Rivero-Lezcano, O.,
J. Sameshima,
A. Marcilla, and K. Robbins.
1994.
Physical association between src homology 3 elements and the protein product of the c-cbl proto-oncogene.
J. Biol. Chem.
269:17363-17366[Abstract/Free Full Text].
|
| 32.
| Rose, D. W., A. R. Saltiel, M. Majumdar,
S. J. Decker, and J. M. Olefsky. Insulin receptor
substrate 1 is required for insulin-mediated mitogenic signal
transduction. Proc. Natl. Acad. Sci. USA 91:797-801.
|
| 33.
|
Rubin, C. S.,
E. Lai, and O. M. Rosen.
1977.
Acquisition of increased hormone sensitivity during in vitro adipocyte development.
J. Biol. Chem.
252:3554-3557[Abstract/Free Full Text].
|
| 34.
|
Saltiel, A. R.
1996.
Diverse signaling pathways in the cellular actions of insulin.
Am. J. Physiol.
270:E375-E385[Abstract/Free Full Text].
|
| 35.
|
Sasoka, T.,
B. Draznin,
J. W. Leitner,
W. J. Langlois, and J. M. Olefsky.
1994.
Shc is the predominant signaling molecule coupling insulin receptor to activation of guanine nucleotide releasing factor and p21ras-GTP formation.
J. Biol. Chem.
269:10734-10738[Abstract/Free Full Text].
|
| 36.
|
Skolnik, E. Y.,
C. H. Lee,
A. Batzer,
L. M. Vicentini,
M. Zhou,
R. Daly,
M. J. Myers,
J. M. Baker,
A. Ullrich,
M. F. White, and J. Schlessinger.
1993.
The SH2/SH3 domain-containing protein GRB2 interacts with tyrosine-phosphorylated IRS1 and SHC: implications for insulin control of ras signaling.
EMBO J.
12:1929-1936[Medline].
|
| 37.
|
Soltoff, S. P., and L. C. Cantley.
1996.
p120cbl is a cytosolic adapter protein that associates with phosphoinositide 3-kinase in response to epidermal growth factor in PC12 and other cells.
J. Biol. Chem.
271:563-567[Abstract/Free Full Text].
|
| 38.
|
Sparks, A. B.,
N. G. Hoffman,
S. J. McConnell,
D. M. Fowlkes, and B. K. Kay.
1996.
Cloning of ligand targets: systematic isolation of SH3 domain containing proteins.
Nat. Biotechnol.
14:741-745.
[Medline] |
| 39.
|
Sun, X.-J.,
P. Rothenberg,
C. R. Kahn,
J. M. Backer,
E. Araki,
P. A. Wilden,
D. A. Cahill,
B. J. Goldstein, and M. F. White.
1991.
Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein.
Nature (London)
352:73-77[Medline].
|
| 40.
|
Sun, X.-J.,
L. M. Wang,
Y. Zhang,
L. Yenush,
M. G. Myers,
E. Glasheen,
W. S. Lane,
J. H. Pierce, and M. F. White.
1995.
Role of IRS-2 in insulin and cytokine signaling.
Nature (London)
377:173-177[Medline].
|
| 41.
|
Tanaka, S.,
L. Neff,
R. Baron, and J. B. Levy.
1995.
Tyrosine phosphorylation and translocation of the c-Cbl protein after activation of tyrosine kinase signaling pathways.
J. Biol. Chem.
270:14347-14351[Abstract/Free Full Text].
|
| 42.
|
Vagne-descroix, M.,
D. Panasu,
H. Jornvall,
M. Carlquist,
H. Guignard,
G. Jourdan,
G. Desvigne,
M. Collinet,
C. Caillet, and V. Mutt.
1991.
Isolation and characterization of porcine sorbin.
Eur. J. Biochem.
201:53-59[Medline].
|
| 43.
|
van den Berghe, N.,
D. M. Ouwens,
J. A. Maassen,
M. G. H. van Mackelenbergh,
H. C. M. Sips, and H. M. J. Krans.
1994.
Activation of the Ras/mitogen-activated protein kinase signaling pathway alone is not sufficient to induce glucose uptake in 3T3-L1 adipocytes.
Mol. Cell Biol.
14:2372-2377[Abstract/Free Full Text].
|
| 44.
|
Waters, S. B.,
K. Yamauchi, and J. E. Pessin.
1995.
Insulin-stimulated dissociation of the SOS-Grb2 complex.
Mol. Cell. Biol.
15:2791-2799[Abstract].
|
| 45.
|
White, M. F., and C. R. Kahn.
1994.
The insulin signaling system.
J. Biol. Chem.
269:1-4[Free Full Text].
|
| 46.
|
Wiese, R. J.,
C. M. Mastik,
F. D. Lazar, and A. R. Saltiel.
1995.
Activation of mitogen-activated protein kinase and phosphatidylinositol 3'-kinase is not sufficient for the hormonal stimulation of glucose uptake, lipogenesis, or glycogen synthesis in 3T3-L1 adipocytes.
J. Biol. Chem.
270:3442-3446[Abstract/Free Full Text].
|
Mol Cell Biol, February 1998, p. 872-879, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, M., Liu, J., Cheng, A., DeYoung, S. M., Saltiel, A. R.
(2007). Identification of CAP as a Costameric Protein that Interacts with Filamin C. Mol. Biol. Cell
18: 4731-4740
[Abstract]
[Full Text]
-
Limpert, A. S., Karlo, J. C., Landreth, G. E.
(2007). Nerve Growth Factor Stimulates the Concentration of TrkA within Lipid Rafts and Extracellular Signal-Regulated Kinase Activation through c-Cbl-Associated Protein. Mol. Cell. Biol.
27: 5686-5698
[Abstract]
[Full Text]
-
Chang, L., Chiang, S.-H., Saltiel, A. R.
(2007). TC10{alpha} Is Required for Insulin-Stimulated Glucose Uptake in Adipocytes. Endocrinology
148: 27-33
[Abstract]
[Full Text]
-
Chen, G., Liu, P., Pattar, G. R., Tackett, L., Bhonagiri, P., Strawbridge, A. B., Elmendorf, J. S.
(2006). Chromium Activates Glucose Transporter 4 Trafficking and Enhances Insulin-Stimulated Glucose Transport in 3T3-L1 Adipocytes via a Cholesterol-Dependent Mechanism. Mol. Endocrinol.
20: 857-870
[Abstract]
[Full Text]
-
Mitsushima, M., Sezaki, T., Akahane, R., Ueda, K., Suetsugu, S., Takenawa, T., Kioka, N.
(2006). Protein kinase A-dependent increase in WAVE2 expression induced by the focal adhesion protein vinexin. GENES CELLS
11: 281-292
[Abstract]
[Full Text]
-
Liu, J., DeYoung, S. M., Zhang, M., Dold, L. H., Saltiel, A. R.
(2005). The Stomatin/Prohibitin/Flotillin/HflK/C Domain of Flotillin-1 Contains Distinct Sequences That Direct Plasma Membrane Localization and Protein Interactions in 3T3-L1 Adipocytes. J. Biol. Chem.
280: 16125-16134
[Abstract]
[Full Text]
-
Mitra, P., Zheng, X., Czech, M. P.
(2004). RNAi-based Analysis of CAP, Cbl, and CrkII Function in the Regulation of GLUT4 by Insulin. J. Biol. Chem.
279: 37431-37435
[Abstract]
[Full Text]
-
Bogacka, I., Xie, H., Bray, G. A., Smith, S. R.
(2004). The Effect of Pioglitazone on Peroxisome Proliferator-Activated Receptor-{gamma} Target Genes Related to Lipid Storage In Vivo. Diabetes Care
27: 1660-1667
[Abstract]
[Full Text]
-
Ahn, M.-Y., Katsanakis, K. D., Bheda, F., Pillay, T. S.
(2004). Primary and Essential Role of the Adaptor Protein APS for Recruitment of Both c-Cbl and Its Associated Protein CAP in Insulin Signaling. J. Biol. Chem.
279: 21526-21532
[Abstract]
[Full Text]
-
Shen, Q., Cline, G. W., Shulman, G. I., Leibowitz, M. D., Davies, P. J. A.
(2004). Effects of Rexinoids on Glucose Transport and Insulin-mediated Signaling in Skeletal Muscles of Diabetic (db/db) Mice. J. Biol. Chem.
279: 19721-19731
[Abstract]
[Full Text]
-
Tujague, M., Thomsen, J. S., Mizuki, K., Sadek, C. M., Gustafsson, J.-A.
(2004). The Focal Adhesion Protein Vinexin {alpha} Regulates the Phosphorylation and Activity of Estrogen Receptor {alpha}. J. Biol. Chem.
279: 9255-9263
[Abstract]
[Full Text]
-
JeBailey, L., Rudich, A., Huang, X., Ciano-Oliveira, C. D., Kapus, A., Klip, A.
(2004). Skeletal Muscle Cells and Adipocytes Differ in Their Reliance on TC10 and Rac for Insulin-Induced Actin Remodeling. Mol. Endocrinol.
18: 359-372
[Abstract]
[Full Text]
-
Thirone, A. C. P., Carvalheira, J. B. C., Hirata, A. E., Velloso, L. A., Saad, M. J. A.
(2004). Regulation of Cbl-Associated Protein/Cbl Pathway in Muscle and Adipose Tissues of Two Animal Models of Insulin Resistance. Endocrinology
145: 281-293
[Abstract]
[Full Text]
-
Liu, J., DeYoung, S. M., Hwang, J. B., O'Leary, E. E., Saltiel, A. R.
(2003). The Roles of Cbl-b and c-Cbl in Insulin-stimulated Glucose Transport. J. Biol. Chem.
278: 36754-36762
[Abstract]
[Full Text]
-
Chunqiu Hou, J., Pessin, J. E.
(2003). Lipid Raft Targeting of the TC10 Amino Terminal Domain Is Responsible for Disruption of Adipocyte Cortical Actin. Mol. Biol. Cell
14: 3578-3591
[Abstract]
[Full Text]
-
Moon, B., Kwan, J. J.-M., Duddy, N., Sweeney, G., Begum, N.
(2003). Resistin inhibits glucose uptake in L6 cells independently of changes in insulin signaling and GLUT4 translocation. Am. J. Physiol. Endocrinol. Metab.
285: E106-E115
[Abstract]
[Full Text]
-
Townson, S. M., Dobrzycka, K. M., Lee, A. V., Air, M., Deng, W., Kang, K., Jiang, S., Kioka, N., Michaelis, K., Oesterreich, S.
(2003). SAFB2, a New Scaffold Attachment Factor Homolog and Estrogen Receptor Corepressor. J. Biol. Chem.
278: 20059-20068
[Abstract]
[Full Text]
-
Onuma, H., Osawa, H., Yamada, K., Ogura, T., Tanabe, F., Granner, D. K., Makino, H.
(2002). Identification of the Insulin-Regulated Interaction of Phosphodiesterase 3B With 14-3-3 {beta} Protein. Diabetes
51: 3362-3367
[Abstract]
[Full Text]
-
Chang, L., Adams, R. D., Saltiel, A. R.
(2002). The TC10-interacting protein CIP4/2 is required for insulin-stimulated Glut4 translocation in 3T3L1 adipocytes. Proc. Natl. Acad. Sci. USA
99: 12835-12840
[Abstract]
[Full Text]
-
Goh, E. L. K., Zhu, T., Leong, W.-Y., Lobie, P. E.
(2002). c-Cbl Is a Negative Regulator of GH-Stimulated STAT5-Mediated Transcription. Endocrinology
143: 3590-3603
[Abstract]
[Full Text]
-
Kimura, A., Mora, S., Shigematsu, S., Pessin, J. E., Saltiel, A. R.
(2002). The Insulin Receptor Catalyzes the Tyrosine Phosphorylation of Caveolin-1. J. Biol. Chem.
277: 30153-30158
[Abstract]
[Full Text]
-
Liu, J., Kimura, A., Baumann, C. A., Saltiel, A. R.
(2002). APS Facilitates c-Cbl Tyrosine Phosphorylation and GLUT4 Translocation in Response to Insulin in 3T3-L1 Adipocytes. Mol. Cell. Biol.
22: 3599-3609
[Abstract]
[Full Text]
-
Suwa, A., Mitsushima, M., Ito, T., Akamatsu, M., Ueda, K., Amachi, T., Kioka, N.
(2002). Vinexin beta Regulates the Anchorage Dependence of ERK2 Activation Stimulated by Epidermal Growth Factor. J. Biol. Chem.
277: 13053-13058
[Abstract]
[Full Text]
-
Chiang, S.-H., Hou, J. C., Hwang, J., Pessin, J. E., Saltiel, A. R.
(2002). Cloning and Functional Characterization of Related TC10 Isoforms, a Subfamily of Rho Proteins Involved in Insulin-stimulated Glucose Transport. J. Biol. Chem.
277: 13067-13073
[Abstract]
[Full Text]
-
HUBBERSTEY, A. V., MOTTILLO, E. P.
(2002). Cyclase-associated proteins: CAPacity for linking signal transduction and actin polymerization. FASEB J.
16: 487-499
[Abstract]
[Full Text]
-
Kralik, S. F., Liu, P., Leffler, B. J., Elmendorf, J. S.
(2002). Ceramide and Glucosamine Antagonism of Alternate Signaling Pathways Regulating Insulin- and Osmotic Shock-Induced Glucose Transporter 4 Translocation. Endocrinology
143: 37-46
[Abstract]
[Full Text]
-
Bickel, P. E.
(2002). Lipid rafts and insulin signaling. Am. J. Physiol. Endocrinol. Metab.
282: E1-E10
[Abstract]
[Full Text]
-
Lin, W.-H., Chiu, K. C., Chang, H.-M., Lee, K.-C., Tai, T.-Y., Chuang, L.-M.
(2001). Molecular scanning of the human sorbin and SH3-domain-containing-1 (SORBS1) gene: positive association of the T228A polymorphism with obesity and type 2 diabetes. Hum Mol Genet
10: 1753-1760
[Abstract]
[Full Text]
-
Kimura, A., Baumann, C. A., Chiang, S.-H., Saltiel, A. R.
(2001). The sorbin homology domain: A motif for the targeting of proteins to lipid rafts. Proc. Natl. Acad. Sci. USA
98: 9098-9103
[Abstract]
[Full Text]
-
Iozzo, P., Pratipanawatr, T., Pijl, H., Vogt, C., Kumar, V., Pipek, R., Matsuda, M., Mandarino, L. J., Cusi, K. J., DeFronzo, R. A.
(2001). Physiological hyperinsulinemia impairs insulin-stimulated glycogen synthase activity and glycogen synthesis. Am. J. Physiol. Endocrinol. Metab.
280: E712-E719
[Abstract]
[Full Text]
-
Kido, Y., Nakae, J., Accili, D.
(2001). The Insulin Receptor and Its Cellular Targets. J. Clin. Endocrinol. Metab.
86: 972-979
[Abstract]
[Full Text]
-
Nadler, S. T., Stoehr, J. P., Schueler, K. L., Tanimoto, G., Yandell, B. S., Attie, A. D.
(2000). The expression of adipogenic genes is decreased in obesity and diabetes mellitus. Proc. Natl. Acad. Sci. USA
97: 11371-11376
[Abstract]
[Full Text]
-
Hida, K., Wada, J., Zhang, H., Hiragushi, K., Tsuchiyama, Y., Shikata, K., Makino, H.
(2000). Identification of genes specifically expressed in the accumulated visceral adipose tissue of OLETF rats. J. Lipid Res.
41: 1615-1622
[Abstract]
[Full Text]
-
Baumann, C. A., Chokshi, N., Saltiel, A. R., Ribon, V.
(2000). Cloning and Characterization of a Functional Peroxisome Proliferator Activator Receptor-gamma -responsive Element in the Promoter of the CAP Gene. J. Biol. Chem.
275: 9131-9135
[Abstract]
[Full Text]
-
Akamatsu, M., Aota, S.-i., Suwa, A., Ueda, K., Amachi, T., Yamada, K. M., Akiyama, S. K., Kioka, N.
(1999). Vinexin Forms a Signaling Complex with Sos and Modulates Epidermal Growth Factor-induced c-Jun N-terminal Kinase/Stress-activated Protein Kinase Activities. J. Biol. Chem.
274: 35933-35937
[Abstract]
[Full Text]
-
Natesan, S., Molinari, E., Rivera, V. M., Rickles, R. J., Gilman, M.
(1999). A general strategy to enhance the potency of chimeric transcriptional activators. Proc. Natl. Acad. Sci. USA
96: 13898-13903
[Abstract]
[Full Text]
-
Kawabe, H., Hata, Y., Takeuchi, M., Ide, N., Mizoguchi, A., Takai, Y.
(1999). nArgBP2, a Novel Neural Member of Ponsin/ArgBP2/Vinexin Family That Interacts with Synapse-associated Protein 90/Postsynaptic Density-95-associated Protein (SAPAP). J. Biol. Chem.
274: 30914-30918
[Abstract]
[Full Text]
-
Desvergne, B., Wahli, W.
(1999). Peroxisome Proliferator-Activated Receptors: Nuclear Control of Metabolism. Endocr. Rev.
20: 649-688
[Abstract]
[Full Text]
-
Kapeller, R., Moriarty, A., Strauss, A., Stubdal, H., Ther