Previous Article | Next Article 
Mol Cell Biol, February 1998, p. 919-925, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Plasmodium falciparum Telomerase: De
Novo Telomere Addition to Telomeric and Nontelomeric Sequences and
Role in Chromosome Healing
Emmanuel
Bottius,
Nassera
Bakhsis, and
Artur
Scherf*
Unité de Parasitologie
Expérimentale, CNRS URA 1960, Institut Pasteur, 75724 Paris,
France
Received 10 July 1997/Returned for modification 9 September
1997/Accepted 31 October 1997
 |
ABSTRACT |
Telomerase, a specialized cellular reverse transcriptase,
compensates for chromosome shortening during the proliferation of most
eucaryotic cells and contributes to cellular immortalization. The
mechanism used by the single-celled protozoan malaria parasite Plasmodium falciparum to complete the replication of its
linear chromosomes is currently unknown. In this study, telomerase
activity has for the first time been identified in cell extracts of
P. falciparum. The de novo synthesis of highly variable
telomere repeats to the 3' end of DNA oligonucleotide primers by
plasmodial telomerase is demonstrated. Permutated telomeric DNA primers
are extended by the addition of the next correct base. In addition to
elongating preexisting telomere sequences, P. falciparum
telomerase can also add telomere repeats onto nontelomeric 3' ends. The
sequence GGGTT... was the predominant initial DNA sequence
added to the nontelomeric 3' ends in vitro. Poly(C) at the 3' end of
the oligonucleotide significantly alters the precision of the new
telomerase added repeats. The efficiency of nontelomeric primer
elongation was dependent on the presence of a G-rich cassette upstream
of the 3' terminus. Oligonucleotide primers based on natural P. falciparum chromosome breakpoints are efficiently used as
telomerase substrates. These results imply that P. falciparum telomerase contributes to chromosome maintenance and
to de novo telomere formation on broken chromosomes. Reverse
transcriptase inhibitors such as dideoxy GTP efficiently inhibit
P. falciparum telomerase activity in vitro. These data
point to malaria telomerase as a new target for the development of
drugs that could induce parasite cell senescence.
 |
INTRODUCTION |
Recent advances in telomere biology
have been exciting and have pointed to telomeres as important elements
for cell survival. Telomeres, the essential genetic elements at the
ends of eucaryotic chromosomes, consist of proteins and simple G-rich
repeats which are highly conserved among widely diverged eucaryotes
(for reviews, see references 2, 14, and
40). These ends of linear duplex DNA cannot be fully
replicated by the conventional DNA polymerase complex, which requires
an RNA primer to initiate DNA synthesis (25, 37). In normal
human cells, short terminal deletions occur with each cell division
probably due to the terminal sequence loss that accompanies DNA
replication (11, 13). For example, the average loss of human
somatic telomere DNA has been estimated to be 30 to 200 bp/cell
doubling in vitro (10). Telomere shortening is especially a
problem for rapidly dividing cells, and this shortening can lead to
cellular senescence and death after a limited number of cell divisions,
as has been demonstrated for the yeasts Kluyveromyces lactis, Saccharomyces cerevisiae, and
Schizosaccharomyces pombe (17, 21, 24, 31). This
sequence loss is usually balanced by the de novo addition of telomere
repeats onto chromosome ends by a ribonucleoprotein enzyme called
telomerase. This enzyme complex is a specialized reverse transcriptase
which uses its RNA moiety to template the addition of new telomeric
repeats to chromosomal DNA ends (for reviews, see references
5, 7, and 8). In a wide
phylogenetic range of eucaryotic cells, telomerase compensates for
potentially fatal telomere shortening and probably contributes to the
cell immortalization (for a review, see reference
10).
Unicellular protozoan parasites such as Plasmodium species
and trypanosomes represent a large group of human and animal pathogens with significant impact on the health and economies of many countries. More than 300 million people are infected by malaria parasites, and
infections caused by Plasmodium falciparum, the most
virulent human malaria species, are responsible for approximately 1 to 1.5 million deaths per year (38). Protozoan parasites are
generally capable of very rapid replicative divisions, and in many
cases the severity of the disease correlates with the high parasite load found in the vertebrate host. Given that protozoan cells can
undergo an unlimited number of divisions, they must have a mechanism
for overcoming the problem of incomplete chromosome replication. Thus,
interfering with parasite telomere maintenance might limit growth of
these parasites.
Telomerase activity has not previously been reported for this group of
pathogens. However, molecular analysis of a number of randomly broken
chromosomes occurring naturally in P. falciparum suggested
that a plasmodial telomerase might be implicated in the reformation of
a functional telomere by the addition of new telomere repeats to broken
chromosomes (for a review, see reference 28). The 14 linear chromosomes of P. falciparum are bounded by closely
related G-rich repeats, and the most frequent type, of telomere repeat
motifs consists of GGGTTT/CA (4, 35). The average
telomere length has been estimated to be approximately 1.3 kb (1,
29).
This study intend to uncover the mechanism implicated in malaria
parasite chromosome length maintenance. Several attempts to demonstrate
specific plasmodial telomerase activity failed due to the relatively
low level of sensibility of the conventional telomerase assay
(6). Here, we present, for the first time, evidence for a
specific telomerase activity in cell extracts of P. falciparum. We developed a modification of the recently reported, highly sensitive PCR-based telomere repeat amplification protocol (TRAP) (15). The in vitro telomerase assay Pf-TRAP
demonstrated that P. falciparum telomerase efficiently
elongates, in an RNase A-sensitive manner, oligonucleotide primers with
short telomere-like sequences at the 3' end. Primers having
nontelomeric sequences such as poly(C) or poly(A) at the 3' end could
be efficiently elongated when a telomere repeat cassette was placed
close to the 3' end. DNA sequence analysis of the telomerase products
of various primers did not reveal any exonuclease activity of the plasmodial telomerase. Very importantly, the plasmodial telomerase can
be efficiently inhibited in vitro by reverse transcriptase inhibitors.
The potential induction of cellular senescence through inhibition of
malaria telomerase will be discussed.
 |
MATERIALS AND METHODS |
Manufacturers of reagents.
Azidothymidine triphosphate
(AZT-TP) was a gift of S. Sarfati, Institut Pasteur, Unité de
Chimie Organique. RNase A was purchased from Boehringer Mannheim, and
dideoxy GTP (ddGTP) was purchased from Pharmacia. Oligonucleotides were
obtained from GENSET SA and were purified on polyacrylamide gel
electrophoresis (PAGE) gels before use.
Cell culture conditions.
P. falciparum strains were
maintained in culture as described by Trager and Jensen
(34). P. falciparum lines included Palo Alto
Uganda (9) and FCR-3 (34). Schizont-infected
erythrocytes were purified by the gel flotation method (26).
Preparation of cytoplasmic and nuclear cell extracts of P. falciparum.
P. falciparum-infected erythrocytes were
enriched by the gel flotation technique, and the parasites were
liberated from the erythrocytes by subsequent treatment with 0.15%
saponine in 1.5 volumes of phosphate-buffered saline (PBS) for 5 min at
room temperature. Free parasites were diluted in 5 volumes of PBS and
recovered by centrifugation for 10 min at 2,400 × g.
The dark parasite pellet was washed twice in PBS. The
3-[(3-cholamidopropyl)-dimethyl-ammonio]-1-propanesulfonate (CHAPS)
buffer used for the lysis of human cells in the TRAP assay (15) did not efficiently lyse P. falciparum
membranes. A total of 109 parasites were lysed mechanically
in a volume of 200 µl of buffer B (10 mM Tris-HCl [pH 7.5], 1 mM
MgCl2, 1 mM EGTA, 5 mM
-mercaptoethanol, 10-µg/ml
leupeptine, 10-µg/ml pepstatine, 10% glycerol) by using a
homogenizer (Kontes; size 19, 60 to 80 strokes). These conditions lyse
the parasite membrane but leave the nucleus intact. After centrifugation for 1 h at 4°C and 17,600 × g
(Eppendorf centrifuge; Sigma), the supernatant, which was called the
cytoplasmic fraction, was aliquoted and stored at
70°C. The pellet
containing the nuclei was resuspended in 200 µl of buffer B, lysed by
sonication, and centrifuged as described above. The supernatant was
called the nuclear fraction. The cytoplasmic and the nuclear fraction
contained telomerase activity. For practical reasons, all P. falciparum telomerase experiments presented in this work were
performed with the cytoplasmic fraction. Cytoplasmic cell extracts of
HeLa were prepared as previously described (15).
TRAP and Pf-TRAP assays.
Telomerase activity assays of HeLa
cytoplasmic extracts were performed essentially as described by Kim and
collaborators (15), with the following minor changes: we
used the reverse primer CX with a gas chromatography (GC) clamp at the
5' end (3), and, for the hot start PCR, AmpliTaq Gold DNA
polymerase (Perkin-Elmer) was used according to the recommendation of
the manufacturer.
The assay developed to measure plasmodial telomerase activity (called
Pf-TRAP) was based on the protocol developed by Kim (15),
with several important modifications. The TS primer PfTS-I (5'
AATCCGTCGAGCAGAGTTCA 3') contained a P. falciparum-specific telomere sequence at its 3' end, and the
reverse primer PfCX (5' GGCGCGTG/AAACCCTG/AAACCCTG/AAACCC 3')
had three repeats complementary to the two major plasmodial
telomere repeats GGGTTT/CA and a GC clamp at the 5' end.
P. falciparum telomerase (corresponding to 106
parasites) was allowed to extend the PfTS-I primer (0.1 µg) for 1 h at 37°C in 48.2 µl of the buffer described by Kim
(15). The PCR was performed in a 50-µl final volume by
adding 1.8 µl of a mixture containing AmpliTaq Gold (2.5 U), PfCX
primer (0.1 µg), and [
-32P]dTTP (3 µCi). The PCR
was initiated with 10 min of incubation at 94°C (activation step of
AmpliTaq Gold), followed by 31 cycles with a 10-s denaturation step at
94°C, 30 s of annealing at 55°C, and a 1-min extension step at
72°C. As a control for nontelomerase-mediated incorporation, we
pretreated cell extracts for 30 min at 37°C with 10 µg of RNase A
or for 10 min at 95°C. The specificities of the plasmodial primers
PfTS-I and CX on cell extracts prepared from noninfected erythrocytes
and HeLa cells were tested. No telomerase elongation products were
detected in these extracts. Products were resolved by electrophoresis
in nondenaturing 15% polyacrylamide gels (Mini-Protean II cells;
Bio-Rad) for 150 min at 120 V in 1× Tris-borate-EDTA buffer. The gels
were washed briefly for 5 min in distilled water and exposed without
drying to Kodak film for 1 to 12 h.
Inhibition studies of telomerase activity in vitro were performed in
the presence of increasing amounts of AZT-TP (final concentration,
1 µM to 1 mM) or ddGTP (final concentration, 1 to 50 µM) in the
Pf-TRAP reaction mixture. Pf-TRAP products were quantified with
a
PhosphorImager (Molecular Dynamics). The gels were phosphorimaged
for 1 to 3 h. The mean values of duplicate reactions were taken
from a
central region of each gel, and the standard deviations
were
calculated. The values from RNase A-treated reactions were
subtracted
as background. The 0 µM inhibitor reaction was used
as 100% total
telomerase activity. As control PCR, a synthetic
180-bp DNA fragment
carrying DNA sequences at one end corresponding
to PfTS-I and carrying
DNA sequences on the other end corresponding
to the PfCX primer was
amplified by using the standard PCR conditions
of the Pf-TRAP assay.
The highest inhibitor concentration used
in these studies did not
interfere with PCR amplification of the
synthetic PfTS-I-CX fragment.
Cloning and DNA sequence analysis of telomerase elongation
products.
Telomerase elongation products corresponding to 5 volumes of the standard Pf-TRAP assay were concentrated by ethanol
precipitation in the presence of 2 µg of glycogen (Appligene-Oncor)
and were separated on one lane on a 15% polyacrylamide gel. After
exposure, a region of the gel superior to six bands was cut out and cut into fine pieces by using a sterile razor blade. The pieces were resuspended in 1 volume of elution buffer (0.5 ammonium acetate and 1 mM EDTA [pH 8.0]), and the suspension was incubated at 37°C overnight on a rotating wheel. After centrifugation at 10,000 × g for 10 min, the supernatant was recovered and the DNA was precipitated with 2 volumes of EtOH in the presence of 2 µg of glycogen. The Pf-TRAP products were cloned into pCRII (Invitrogen). Plasmid DNA was purified through spin columns (Qiagen) as specified by
the manufacturer. Double-stranded DNA sequencing reactions were
performed with the AmpliCycle Taq polymerase sequencing kit (Perkin-Elmer). Two independent clones for each primer elongation were
sequenced.
 |
RESULTS |
Telomerase activity in cell extracts of P. falciparum.
The fact that P. falciparum can repair broken chromosomes by
the addition of telomere repeats, i.e., de novo telomere formation, suggested the presence of a plasmodial telomerase (28).
However, the conventional telomerase activity assay developed by
Greider and Blackburn (6) did not detect telomerase activity
in cell extracts of P. falciparum (28a).
Recently, a more sensitive PCR-based telomerase detection assay called
TRAP has been reported (15). A modified version of the TRAP
assay (termed Pf-TRAP) permitting in vitro detection of P. falciparum telomerase activity for the first time is shown
diagramatically in Fig. 1A. Current data
suggest that in most eucaryotic cells, the telomere forms a 3'
single-stranded overhang onto which telomerase synthesizes
additional G-rich repeats. Therefore, a substrate primer containing a
Plasmodium-specific telomere repeat sequence (PfTS-I; for
DNA sequence, see Table 1) at its 3' end
was incubated with cellular extracts from blood stage parasites
cultivated in vitro. A reverse primer (PfCX) was then added, and hot
start PCR was carried out. PCR-amplified elongation products were then
separated by 15% PAGE. As shown in Fig. 1B, a typical TRAP ladder of
variable intensities was detected when Plasmodium cell
extracts were assayed. This activity was sensitive to heat and RNase A
treatment; these features are typical of telomerase (7). The
same amounts of protein extracts from uninfected erythrocytes and HeLa
cells did not show any activity by the standard Pf-TRAP assay. The
spacing of the plasmodial ladder is slightly larger than the
six-nucleotide ladder of the human telomerase in HeLa cells (Fig. 1B).
This observation is consistent with the expected P. falciparum telomere repeat length of 7 bp. Enzymatic activity was
detected in nuclear as well as in cytoplasmic extracts prepared from
P. falciparum-infected erythrocytes (trophozoite-schizont stage). Subsequent telomerase experiments were performed with the
cytoplasmic cell fraction. The plasmodial telomerase shows maximal
activity in a temperature range of between 30 and 37°C (Fig.
2A). Enzymatic activity of cytoplasmic
extracts corresponding to 105 to 107 parasite
equivalents could be readily detected after autoradiography for 1 h, and 103 equivalents could be detected after overnight
exposure. The protocol of the optimized Pf-TRAP assay is described in
Material and Methods.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Detection of P. falciparum telomerase
activity in cell extracts of blood stage parasites. (A) Recently, a
highly sensitive PCR-based telomerase assay was developed
(15). In the TRAP assay, telomerase first elongates a
synthetic oligonucleotide that carries a telomeric sequence at the 3'
end (6), which then serves as a template for PCR
amplification. This assay was modified to detect telomerase activity in
plasmodial cell extracts by substituting P. falciparum-specific oligonucleotide primers and was called
Pf-TRAP. (B) Fractionation of 32P-labeled elongation
products on a nondenaturing 15% polyacrylamide gel. Elongation
products of a control extract from human HeLa cells and P. falciparum cytoplasmic extracts from infected erythrocytes (RBC)
are shown. Cell extracts were heated at 94°C or pretreated with (+)
or without ( ) RNase A prior to the telomerase assay as a control for
nontelomerase-mediated incorporation of 32P label. Cell
extracts from uninfected erythrocytes or HeLa cells did not have
activity in the Pf-TRAP assay.
|
|

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 2.
P. falciparum telomerase elongation activity
in vitro. (A) Temperature profile of telomerase activity of cytoplasmic
cell extract; (B) detection limits of telomerase activity in diluted
cell extracts of parasitized erythrocytes (P-RBC) by the Pf-TRAP assay.
The values given are the parasite equivalents used in the assay deduced
from the dilution.
|
|
Permutated telomeric sequence primers are elongated by the addition
of the next correct base.
To analyze the interactions of the
P. falciparum telomerase with different substrates, primers
with permutated telomeric sequences at the 3' terminus were used. The
DNA sequences of primers PfTS-I, PfTS-II, PfTS-III, and PfTS-IV are
shown in Table 1. The first three primers terminate in partial
GGGTTCA repeats (-GTTCA, -GTT, and -GGG). PfTS-IV has a
nontelomeric motif (-CCC) at the 3' end. The Pf-TRAP assay reveals that
oligonucleotides with short telomere-like motifs at the 3' end can
efficiently recruit plasmodial telomerase. The -GTTCA terminus gives a
stronger signal than -GTT or -GGG (Fig.
3A). No telomerase activity was detected
with primer PfTS-IV under these conditions.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Telomerase activity with telomeric primers. (A) Pf-TRAP
assay with oligonucleotide primers PfTS-I, PfTS-II, and PfTS-III that
contain short P. falciparum telomere repeat motifs of 5 and
3 bases. Pf-IV contains nontelomeric bases (-CCC) at the 3' end. Only
oligonucleotides with telomeric 3' ends are efficiently used as
substrates. Cell extracts were treated with (+) or without ( ) RNase
A. (B) De novo synthesis of DNA at the 3' end of the primers PfTS-I to
PfTS-III. The elongation reaction of one long extension product is
shown for each input primer. The partial telomere repeat sequence at
the 3' end is underlined. Newly synthesized repeats are aligned and
shown without the sequence of the Pf-CX primer. The initial sequence
added to the primer depends on the telomeric DNA sequence at the 3'
terminus of the primer. The telomerase first completes a repeat before
adding new telomere repetitions.
|
|
Molecular cloning and DNA sequence analysis of Pf-TRAP products of the
primers PfTS-I to PfTS-III demonstrated that the initial
extension of
the primer depends on the 3' end of the substrate.
As shown in Fig.
3B,
PfTS-I to PfTS-III are elongated by the addition
of the correct
nucleotide base in the classic telomere repeat
sequence GGGTTT/CA.
These results suggest that once the 3' end
of the primer is base
paired with the putative
P. falciparum RNA
template,
telomerase synthesizes de novo telomere repeats in phase
with the
aligned telomere repeat sequence. These findings are
in agreement with
the proposed telomerase elongation model (
8).
According to
this model, the terminal telomere repeat is base
paired with the
complementary template sequence of the RNA component,
the RNA is copied
to the end of the template region, and translocation
repositions the
terminal repeat sequence to the 5' template region.
Telomerase processing of nontelomeric 3' ends.
Spontaneous
chromosome healing in P. falciparum results in the formation
of new telomeres at the broken ends (28). Break sites with
short telomere repeat motifs ranging from 2 to 5 bp are most frequently
observed (16, 18, 27, 29, 30). Here, we analyzed whether
telomerase can elongate DNA oligonucleotide sequences derived from
natural chromosome breakpoints. The following break site sequences were
used: PfTS-VIII from the histidine rich protein I (HRPI)
gene (27), PfTS-IX from the histidine rich protein II
(HRPII) gene (30), and PfTS-X from the
Pf11-1 gene (29) (Table 1). All three
oligonucleotides are elongated in the standard Pf-TRAP assay with an
efficiency comparable to that of the control primer PfTS-I (Fig.
4A). These results demonstrate that the
P. falciparum telomerase can use a variety of DNA sequences as a substrate if the 3' end carries a few bases homologous to a
plasmodial telomere repeat.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
Telomerase activity with nontelomeric primers and
oligonucleotides based on naturally occurring healed P. falciparum chromosome break sites. (A) Pf-TRAP assay with
different substrates. The nontelomeric primers PfTS-IV and PfTS-VI are
elongated with very low efficiency compared to primers PfTS-V and
PfTS-VII, which carry a telomeric sequence motif GGTTCA
(shown underlined) positioned upstream to the nontelomeric 3'
end. Chromosome breakpoint sequences which have been healed by the
addition of telomere repeats in vivo (16, 29, 30)
efficiently recruit plasmodial telomerase in vitro. (B) DNA sequence
analysis of one Pf-TRAP elongation product on input primers PfTS-V and
PfTS-VII. Note the extreme degeneracy of the telomere repeats added to
the -CCC 3' terminus of PfTS-V.
|
|
Previous work demonstrated that
P. falciparum chromosome
break sites with no evident similarity to 3' ends have been healed
in
vivo by the addition of telomere repeats (
18). In order to
study the potential implication of plasmodial telomerase in the
elongation of nontelomeric 3' ends, oligonucleotide primers that
carry
either -CCC or -AAAA at the 3' termini (Table
1) were examined.
These
nontelomeric primers (PfTS-IV and PfTS-VI) did not efficiently
recruit
telomerase in the Pf-TRAP assay (Fig.
4A). Upstream telomere
repeat
motifs have been previously shown to enhance telomere elongation
of
nontelomeric 3' ends by human,
Euplotes, and
Tetrahymena telomerases
(
12,
22,
23). When a
telomeric repeat motif was positioned
upstream to the poly(C)/poly(A)
tract, the assay yielded Pf-TRAP
ladder intensities comparable to those
of the telomeric primer
PfTS-I (Fig.
4A). Cloning and DNA sequence
analysis of the elongation
products of primers PfTS-V and PfTS-VII
revealed several important
features of
P. falciparum
telomerase (Fig.
4B). First, nontelomeric
primers can serve directly as
substrates for the addition of new
telomere repeats without
endonucleolytic modification of the 3'
terminus. Second, elongation of
the different nontelomeric primers
PfTS-V and PfTS-VII is initiated
with the same sequence motif
-GGGTT. Third, the synthesis of new
telomere repeats onto the
poly(C) tract is significantly less precise
than on telomeric
or poly(A) substrate ends (Fig.
3B and
4B). Two
independent clones
of telomerase elongated PfTS-V have been sequenced,
and each clone
shows a distinct pattern of highly degenerated G-rich
repeats
(data not shown).
De novo telomere repeat synthesis in vitro.
P.
falciparum telomeres are composed of a mixture of G-rich
heptanucleotide repeats. GGGTTTA and GGGTTCA are
the most frequently found (approximately 80%); however, a number of
degenerated repeats are interspersed in these motifs (Fig.
5). A comparable frequency of repeats has
also been shown to exist on healed chromosome ends (28). DNA
sequence analysis of in vitro-synthesized telomere repeats on various
primers yielded a similar overall distribution of the two main repeats
(Fig. 5). Surprisingly, several types of G-rich repeats synthesized de
novo by the Pf-TRAP assay have been detected neither on intact nor on
repaired chromosome ends. This result suggests that P. falciparum telomerase activity monitored in vitro might display
reduced precision of initial telomere repeat synthesis due to low
anchoring forces of the single-stranded primer to the enzyme protein
subunit. Alternatively, a telomerase component important for the
precision of the telomerase might be absent in the cytoplasmic cell
extract.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of motif frequencies in the sequences of
P. falciparum telomere repeats generated by telomerase
activity in vitro (this work) and on healed (18, 29, 30) and
intact (35) chromosome ends. In all cases, comparable motifs
of the two main repeats GGGTTT/CA are found with similar
frequencies. These results support the idea that the in vitro
telomerase reaction reflects de novo telomeric addition in vivo. It is
noteworthy that some degenerated repeats are found only in the in vitro
telomerase products.
|
|
Inhibition of in vitro P. falciparum telomerase
activity by chain-terminating nucleoside triphosphate analogs.
Human and Tetrahymena telomerase activities have been shown
to be sensitive to reverse transcriptase inhibitors (32,
33). Given that Plasmodium telomerase shares many
features with telomerases of other organisms, the abilities of known
reverse transcriptase inhibitors such as AZT-TP or ddGTP to inhibit the
Pf-TRAP assay were measured. Increasing amounts of AZT-TP and ddGTP
were added to the Pf-TRAP assay mix primed with oligonucleotide PfTS-I.
Both nucleoside analogs decreased Pf-TRAP product intensities in a dose-dependent manner (Fig. 6A and B).
Quantification of Pf-TRAP elongation products from duplicate reactions
with a PhosphorImager showed that ddGTP is a more potent inhibitor than
AZT-TP. Approximately 50% inhibition of the plasmodial telomerase
activity is achieved at concentrations of approximately 20 µM ddGTP,
whereas approximately two to three times higher AZT-TP concentrations
were necessary to obtain comparable inhibition in the presence of 50 µM deoxynucleoside triphosphate (dNTP) (Fig. 6C and D). A similar
degree of inhibition has been reported recently for the human
telomerase by a comparable assay (33). The observed
inhibition of plasmodial telomerase is presumably due to chain
termination, but these experiments do not rule out the possibility that
the inhibition is due to competition with dNTPs without analog
incorporation into the product.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of triphosphate analogs on P. falciparum telomerase activity in vitro. PAGE on 15%
polyacrylamide gels showing duplicate reaction products of Pf-TRAP
telomerase assays was performed with increasing concentrations of ddGTP
(A) and AZT-TP (B). The indicated concentrations of ddGTP and AZT-TP
were added to the telomerase reaction mixtures. RNase A (lanes +R) was
added to the Pf-TRAP assay and used as a control for
nontelomerase-mediated incorporation of 32P label. (C and
D) Quantification of a central region of the gels with a
PhosphorImager. The mean values of the corresponding duplicate lanes
are shown.
|
|
 |
DISCUSSION |
Malaria parasites carry G-rich tandem repeats at their chromosome
ends; thus, it has been assumed that these parasites have chromosome
maintenance machinery similar to that of ciliated protozoa and higher
eucaryotes (28). The recently developed PCR-based telomerase
assay (15) has enabled us for the first time to identify telomerase activity in this human pathogen. Our results show that P. falciparum telomerase shares a number of features with
telomerases of evolutionary distinct organisms: the de novo addition of
species-specific telomere repeats onto the 3' terminus of G-rich
single-stranded DNA and the sensitivity of the enzymatic activity to
treatment with RNase A. Characterization of the enzymatic properties in vitro suggests that de novo telomere addition follows two pathways. First, 3' ends which can form a few base pairs with the putative plasmodial RNA template are elongated by the addition of the next base
in the telomere repeat. This observation is fully in agreement with the
telomerase elongation-translocation model established based on data
obtained with Tetrahymena telomerase (7). Second, 3' termini with no apparent sequence complementary to the RNA template
acquire new telomere repeats starting invariably with GGGTT. The
efficiency of repeat addition to nontelomeric sequences depends
essentially on the presence of G-rich motifs in the primer sequence.
This suggests that the internal telomeric sequence attaches the 3'
terminus of the oligonucleotide close to the active site of the RNA
template. In this case, extension by telomerase might occur via a
default mechanism which initially adds the same sequence to a
nontelomeric 3' end. A default mechanism of de novo telomere formation
to nontelomeric sequences has been extensively documented for the
Euplotes and Tetrahymena enzyme (22,
36) and suggests that this mechanism might be a general enzymatic
property of telomerase. However, a recent report demonstrated that de
novo telomere formation, at least in Euplotes, is mediated
by a transacting factor (1a). Therefore, we cannot exclude
that in P. falciparum the formation of a new telomere is
developmentally regulated during the complex life cycle.
How do the in vitro P. falciparum telomerase data relate to
findings observed in the malaria parasite? The mean lengths of telomeres on P. falciparum chromosomes appear to be constant
during the highly replicative blood stage phase (2a). Thus,
it is likely that telomerase compensates for telomere shortening by the
addition of new telomere repeats to chromosome ends. Molecular
characterization of a number of chromosome breakpoints which had been
repaired by the addition of new telomere repeats revealed preferential healing of ends that can form base pairing with the putative RNA template (18). Our in vitro telomerase data obtained with
various substrates clearly indicate a role for this enzyme in the
healing process of truncated chromosomes. Three different primers
derived from natural break sites within different genes were very
efficient telomerase substrates in the Pf-TRAP assay. In almost all
cases studied, plasmodial chromosome breaks have been observed in
coding regions and they either terminate with telomere-like motifs at the 3' end or have a G-rich sequences nearby. Noncoding regions of
P. falciparum genomic DNA are generally extremely AT rich
(>80%) and, thus, are probably not efficiently used by telomerase.
This observation correlates with the in vitro finding that a primer ending in poly(A) in the absence of G-rich internal sequences was
barely elongated by telomerase. In conclusion, the telomerase data
gained from in vitro studies generally correlate well with the
biological data obtained from Plasmodium parasites. However, the precision of telomere repeat synthesis by telomerase in vitro seems
to be altered (Fig. 5). This observation could be explained by the use
of short oligonucleotide primers in the Pf-TRAP assay which might have
a looser association with the ribonucleoprotein complex compared to
natural chromosome ends. Unlike in vitro telomere synthesis, the
addition of telomere repeats to truncated chromosomes has a normal
frequency of variable telomere repeats at the break site. Precision of
de novo synthesis might improve once a critical number of repeats has
been added to the input primer. Thus, it is possible that the altered
in vitro precision described in Fig. 5 is biased by the fact that only
telomerase elongation products with relatively few repeats (7 to 16 repeats) have been cloned and sequenced. It will be interesting to
study whether telomerase activity is regulated in the P. falciparum life cycle, which consists of different phases of
highly replicative activities and long phases of cell differentiation
in which several days can pass without apparent cell division.
One of the most intriguing aspects of the plasmodial telomerase is
the variant repeat sequences that are synthesized in vitro and in vivo.
Telomeric DNA of the mouse malaria parasite Plasmodium berghei consists of a random mixture of the two type of repeats GGGTTT/CA, whereas the telomere repeats of P. falciparum are composed mainly of GGGTTT/CA repeats
(<80%) and at a lower frequency of degenerated telomere repeats (Fig.
5). The underlying mechanism of variable repeat synthesis remains
unknown, since the sequence and number of the telomerase RNA genes of
P. falciparum are not yet known. Thus, molecular cloning of
the plasmodial telomerase components will be crucial to analyze
functional aspects. Telomere repeat organization of
Paramecium species resembles more closely the
Plasmodium situation, where one telomerase RNA can give
rise to primarily one repeat and another one to two different repeats probably by stuttering (19, 20). Transfection of malaria
parasites with mutated telomerase RNA template would also allow
functional in vivo studies on Plasmodium telomeres.
Previous work has shown that mutations that lead to loss of telomeric
DNA in different single-cell organisms induce a cell senescence
phenotype (17, 21, 31, 39), and in certain mammalian cells,
telomere shrinkage has been correlated with cellular senescence
(10). Malaria parasites are haploid unicellular protozoa whose rapid growth should be dependent on complete chromosome replication in order to avoid fatal chromosome shortening and to ensure
immortalization. P. falciparum alternates between two hosts
during its complex life cycle, the mosquito vector Anopheles and humans. During this life cycle, the parasites run through different
phases of intense mitotic division (schizogeny) within human
hepatocytes and erythrocytes. For example, approximately 20,000 merozoites are released from a single infected hepatocyte. These
merozoites invade erythrocytes and undergo multiple mitotic divisions
(four to five) each 48 h before releasing 16 to 32 merozoites into
the blood. This blood stage is responsible for the symptoms of the
disease, and high parasite loads of 109 to 1010
infected erythrocytes are frequently observed in infected patients. Thus, it is tempting to speculate that parasite blood stage cell proliferation could be controlled at the level of chromosomal replication. A first step to test this hypothesis would be to identify
efficient inhibitors of P. falciparum telomerase. The Pf-TRAP assay allows one to rapidly screen in vitro for potential telomerase inhibitors. In this work, we have identified two reverse transcriptase inhibitors (ddGTP and AZT-TP) which significantly inhibit
plasmodial telomerase in vitro in a dose-dependent manner and at
micromolar concentrations. The correlation between telomerase activity
and unlimited cell proliferation in unicellular eucaryotes suggests
that telomerase inhibitors might be valuable anti-malarial therapeutics. This possibility is under investigation.
 |
ACKNOWLEDGMENTS |
We thank L. Pereira da Silva for his support, T. de Lange and
N. W. Kim for helpful discussions on the Pf-TRAP assay, S. Sarfati for the kind gift of AZT-TP, and C. Roth for critically reading the
manuscript and helpful comments.
This work has been supported by a grant from the Commission of the
European Communities for research and technical development (contract
no. CT96-0071).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité de
Parasitologie Expérimentale, Institut Pasteur, 25 rue du Dr.
Roux, 75724 Paris Cedex 15, France. Phone: 33-1-45688616. Fax:
33-1-40613185. E-mail: ascherf{at}pasteur.fr.
 |
REFERENCES |
| 1.
| Bakhsis, N., and A. Scherf. Unpublished data.
|
| 1a.
|
Bednenko, J.,
M. Melek,
E. C. Greene, and D. E. Shippen.
1997.
Developmentally regulated initiation of DNA synthesis by telomerase: evidence for factor-assisted de novo telomere formation.
EMBO J.
16:2507-2518[Medline].
|
| 2.
|
Blackburn, E. H.
1994.
Telomeres: no end in sight.
Cell
77:621-3[Medline].
|
| 2a.
| Bottius, E., and A. Scherf. Unpublished data.
|
| 3.
|
Broccoli, D.,
J. W. Young, and T. de Lange.
1995.
Telomerase activity in normal and malignant hematopoietic cells.
Proc. Natl. Acad. Sci. USA
92:9082-9086[Abstract/Free Full Text].
|
| 4.
|
Dore, E.,
T. Pace,
M. Ponzi,
R. Scotti, and C. Frontali.
1986.
Homologous telomeric sequences are present in different species of the genus Plasmodium.
Mol. Biochem. Parasitol.
21:121-127[Medline].
|
| 5.
|
Greider, C.
1995.
Telomerase biochemistry and regulation, p. 35-68. In
E. Blackburn, and C. Greider (ed.), Telomeres.
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 6.
|
Greider, C. W., and E. H. Blackburn.
1985.
Identification of a specific telomere terminal transferase activity in Tetrahymena extracts.
Cell
43:405-413[Medline].
|
| 7.
|
Greider, C. W., and E. H. Blackburn.
1987.
The telomere terminal transferase of Tetrahymena is a ribonucleoprotein enzyme with two kinds of primer specificity.
Cell
51:887-898[Medline].
|
| 8.
|
Greider, C. W., and E. H. Blackburn.
1989.
A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis.
Nature
337:331-337[Medline].
|
| 9.
|
Gysin, J.,
P. Dubois, and L. Pereira da Silva.
1982.
Protective antibodies against erythrocytic stages of Plasmodium falciparum in experimental infection of the squirrel monkey, Saimiri sciureus.
Parasite Immunol.
4:421-430[Medline].
|
| 10.
|
Harley, C.
1995.
Telomeres and aging, p. 247-264. In
E. Blackburn, and C. Greider (ed.), Telomeres.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 11.
|
Harley, C. B.,
A. B. Futcher, and C. W. Greider.
1990.
Telomeres shorten during ageing of human fibroblasts.
Nature
345:458-460[Medline].
|
| 12.
|
Harrington, L., and C. Greider.
1991.
Telomerase primer specificity and chromosome healing.
Nature
353:451-453[Medline].
|
| 13.
|
Hastie, N. D.,
M. Dempster,
M. G. Dunlop,
A. M. Thompson,
D. K. Green, and R. C. Allshire.
1990.
Telomere reduction in human colorectal carcinoma and with ageing.
Nature
346:866-868[Medline]. (Comments.)
|
| 14.
|
Henderson, E.
1995.
Telomere DNA structure, p. 11-34. In
E. Blackburn, and C. Greider (ed.), Telomeres.
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 15.
|
Kim, N. W.,
M. A. Piatyszek,
K. R. Prowse,
C. B. Harley,
M. D. West,
P. L. Ho,
G. M. Coviello,
W. E. Wright,
S. L. Weinrich, and J. W. Shay.
1994.
Specific association of human telomerase activity with immortal cells and cancer.
Science
266:2011-2015[Abstract/Free Full Text]. (Comments.)
|
| 16.
|
Lanzer, M.,
S. P. Wertheimer,
D. de Bruin, and J. V. Ravetch.
1994.
Chromatin structure determines the sites of chromosome breakages in Plasmodium falciparum.
Nucleic Acids Res.
22:3099-3103[Abstract/Free Full Text].
|
| 17.
|
Lundblad, V., and J. W. Szostak.
1989.
A mutant with a defect in telomere elongation leads to senescence in yeast.
Cell
57:633-643[Medline].
|
| 18.
|
Mattei, D., and A. Scherf.
1994.
Subtelomeric chromosome instability in Plasmodium falciparum: short telomere-like sequence motifs found frequently at healed chromosome breakpoints.
Mutat. Res.
324:115-120[Medline].
|
| 19.
|
McCormick-Graham, M.,
W. J. Haynes, and D. P. Romero.
1997.
Variable telomeric repeat synthesis in Paramecium tetraurelia is consistent with misincorporation by telomerase.
EMBO J.
16:3233-3242[Medline].
|
| 20.
|
McCormick-Graham, M., and D. P. Romero.
1996.
A single telomerase RNA is sufficient for the synthesis of variable telomeric DNA repeats in ciliates of the genus Paramecium.
Mol. Cell. Biol.
16:1871-1879[Abstract].
|
| 21.
|
McEachern, M. J., and E. H. Blackburn.
1995.
Runaway telomere elongation caused by telomerase RNA gene mutations.
Nature
376:403-409[Medline].
|
| 22.
|
Melek, M.,
E. C. Greene, and D. E. Shippen.
1996.
Processing of nontelomeric 3' ends by telomerase: default template alignment and endonucleolytic cleavage.
Mol. Cell. Biol.
16:3437-3445[Abstract].
|
| 23.
|
Morin, G. B.
1991.
Recognition of a chromosome truncation site associated with alpha-thalassaemia by human telomerase.
Nature
353:454-456[Medline].
|
| 24.
|
Nakamura, T. M.,
G. B. Morin,
K. B. Chapman,
S. L. Weinrich,
W. H. Andrews,
J. Lingner,
C. B. Harley, and T. R. Cech.
1997.
Telomerase catalytic subunit homologs from fission yeast and human.
Science
277:955-959[Abstract/Free Full Text]. (Comments.)
|
| 25.
|
Olovnikov, A. M.
1973.
A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon.
J. Theor. Biol.
41:181-190[Medline].
|
| 26.
|
Pasvol, G.,
R. J. Wilson,
M. E. Smalley, and J. Brown.
1978.
Separation of viable schizont-infected red cells of Plasmodium falciparum from human blood.
Ann. Trop. Med. Parasitol.
72:87-88[Medline].
|
| 27.
|
Pologe, L. G., and J. V. Ravetch.
1988.
Large deletions result from breakage and healing of P. falciparum chromosomes.
Cell
55:869-874[Medline].
|
| 28.
|
Scherf, A.
1996.
Plasmodium telomeres and telomere proximal gene expression.
Semin. Cell Biol.
7:49-57.
|
| 28a.
| Scherf, A. Unpublished data.
|
| 29.
|
Scherf, A.,
R. Carter,
C. Petersen,
P. Alano,
R. Nelson,
M. Aikawa,
D. Mattei,
L. Pereira da Silva, and J. Leech.
1992.
Gene inactivation of Pf11-1 of Plasmodium falciparum by chromosome breakage and healing: identification of a gametocyte-specific protein with a potential role in gametogenesis.
EMBO J.
11:2293-2301[Medline].
|
| 30.
|
Scherf, A., and D. Mattei.
1992.
Cloning and characterization of chromosome breakpoints of Plasmodium falciparum: breakage and new telomere formation occurs frequently and randomly in subtelomeric genes.
Nucleic Acids Res.
20:1491-1496[Abstract/Free Full Text].
|
| 31.
|
Singer, M. S., and D. E. Gottschling.
1994.
TLC1: template RNA component of Saccharomyces cerevisiae telomerase.
Science
266:404-409[Abstract/Free Full Text]. (Comments.)
|
| 32.
|
Strahl, C., and E. H. Blackburn.
1994.
The effects of nucleoside analogs on telomerase and telomerase in Tetrahymena.
Nucleic Acids Res.
22:893-900[Abstract/Free Full Text].
|
| 33.
|
Strahl, C., and E. H. Blackburn.
1996.
Effects of reverse transcriptase inhibitors on telomere length and telomerase activity in two immortalized human cell lines.
Mol. Cell. Biol.
16:53-65[Abstract].
|
| 34.
|
Trager, W., and J. B. Jensen.
1976.
Human malaria parasites in continuous culture.
Science
193:673-675[Abstract/Free Full Text].
|
| 35.
|
Vernick, K. D., and T. F. McCutchan.
1988.
Sequence and structure of a Plasmodium falciparum telomere.
Mol. Biochem. Parasitol
28:85-94[Medline].
|
| 36.
|
Wang, H., and E. H. Blackburn.
1997.
De novo telomere addition by Tetrahymena telomerase in vitro.
EMBO J.
16:866-879[Medline].
|
| 37.
|
Watson, J. D.
1972.
Origin of concatemeric T7 DNA.
Nature New Biol.
239:197-201[Medline].
|
| 38.
|
World Health Organization.
1993.
Global malaria control. WHO malaria unit.
Bull. W. H. O.
71:281-284[Medline].
|
| 39.
|
Yu, G. L.,
J. D. Bradley,
L. D. Attardi, and E. H. Blackburn.
1990.
In vivo alteration of telomere sequences and senescence caused by mutated Tetrahymena telomerase RNAs.
Nature
344:126-132[Medline]. (Comments.)
|
| 40.
|
Zakian, V. A.
1995.
Telomeres: beginning to understand the end.
Science
270:1601-1607[Abstract/Free Full Text].
|
Mol Cell Biol, February 1998, p. 919-925, Vol. 18, No. 2
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chakrabarti, K., Pearson, M., Grate, L., Sterne-Weiler, T., Deans, J., Donohue, J. P., Ares, M. Jr
(2007). Structural RNAs of known and unknown function identified in malaria parasites by comparative genomics and RNA analysis. RNA
13: 1923-1939
[Abstract]
[Full Text]
-
Kuo, H.-F., Olsen, K. M., Richards, E. J.
(2006). Natural Variation in a Subtelomeric Region of Arabidopsis: Implications for the Genomic Dynamics of a Chromosome End. Genetics
173: 401-417
[Abstract]
[Full Text]
-
Figueiredo, L. M., Rocha, E. P. C., Mancio-Silva, L., Prevost, C., Hernandez-Verdun, D.èl., Scherf, A.
(2005). The unusually large Plasmodium telomerase reverse-transcriptase localizes in a discrete compartment associated with the nucleolus. Nucleic Acids Res
33: 1111-1122
[Abstract]
[Full Text]
-
Munoz, D. P., Collins, K.
(2004). Biochemical properties of Trypanosoma cruzi telomerase. Nucleic Acids Res
32: 5214-5222
[Abstract]
[Full Text]
-
Oulton, R., Harrington, L.
(2004). A Human Telomerase-associated Nuclease. Mol. Biol. Cell
15: 3244-3256
[Abstract]
[Full Text]
-
Ballif, B. C., Yu, W., Shaw, C. A., Kashork, C. D., Shaffer, L. G.
(2003). Monosomy 1p36 breakpoint junctions suggest pre-meiotic breakage-fusion-bridge cycles are involved in generating terminal deletions. Hum Mol Genet
12: 2153-2165
[Abstract]
[Full Text]
-
Pace, T., Scotti, R., Janse, C. J., Waters, A. P., Birago, C., Ponzi, M.
(2000). Targeted Terminal Deletions as a Tool for Functional Genomics Studies in Plasmodium. Genome Res
10: 1414-1420
[Abstract]
[Full Text]
-
Sprung, C. N., Reynolds, G. E., Jasin, M., Murnane, J. P.
(1999). Chromosome healing in mouse embryonic stem cells. Proc. Natl. Acad. Sci. USA
96: 6781-6786
[Abstract]
[Full Text]
-
Magnenat, L., Tobler, H., Muller, F.
(1999). Developmentally Regulated Telomerase Activity Is Correlated with Chromosomal Healing during Chromatin Diminution in Ascaris suum. Mol. Cell. Biol.
19: 3457-3465
[Abstract]
[Full Text]
-
Ye, A. J., Haynes, W. J., Romero, D. P.
(1999). Expression of Mutated Paramecium Telomerase RNAs In Vivo Leads to Templating Errors That Resemble Those Made by Retroviral Reverse Transcriptase. Mol. Cell. Biol.
19: 2887-2894
[Abstract]
[Full Text]
-
Cano, M. I. N., Dungan, J. M., Agabian, N., Blackburn, E. H.
(1999). Telomerase in kinetoplastid parasitic protozoa. Proc. Natl. Acad. Sci. USA
96: 3616-3621
[Abstract]
[Full Text]