Institute of Cell and Molecular Biology,
University of Edinburgh, Edinburgh EH9 3JR, United
Kingdom1;
EMBL, Heidelberg,
Germany2; and
LBME-CNRS, 31062 Toulouse
Cedex, France3
Received 20 August 1997/Returned for modification 14 October
1997/Accepted 5 December 1997
The genes encoding the small nucleolar RNA (snoRNA) species snR190
and U14 are located close together in the genome of Saccharomyces cerevisiae. Here we report that these two snoRNAs are synthesized by processing of a larger common transcript. In strains mutant for two
5'
3' exonucleases, Xrn1p and Rat1p, families of 5'-extended forms of
snR190 and U14 accumulate; these have 5' extensions of up to 42 and 55 nucleotides, respectively. We conclude that the 5' ends of both snR190
and U14 are generated by exonuclease digestion from upstream processing
sites. In contrast to snR190 and U14, the snoRNAs U18 and U24 are
excised from the introns of pre-mRNAs which encode proteins in their
exonic sequences. Analysis of RNA extracted from a dbr1-
strain, which lacks intron lariat-debranching activity, shows that U24
can be synthesized only from the debranched lariat. In contrast, a
substantial level of U18 can be synthesized in the absence of
debranching activity. The 5' ends of these snoRNAs are also generated
by Xrn1p and Rat1p. The same exonucleases are responsible for the
degradation of several excised fragments of the pre-rRNA spacer
regions, in addition to generating the 5' end of the 5.8S rRNA.
Processing of the pre-rRNA and both intronic and polycistronic snoRNAs
therefore involves common components.
 |
INTRODUCTION |
Eukaryotic cells contain a large
number of small nucleolar RNA (snoRNA) species that play major roles in
the processing and modification of the pre-rRNAs (reviewed in
references 29 and 41). The mode
of synthesis of many of the snoRNA species differs from that of other
small RNAs. Rather than being expressed from simple genes, most of the
known snoRNAs are encoded in the intronic sequences of genes which also
encode mRNAs in the exonic sequences. This was first observed for the
mammalian U14 snoRNA (27) and has subsequently been
demonstrated for several other species (for reviews, see references
29, 31, and 37). In most cases
there is some relationship between the protein product of the host gene and ribosome synthesis or function. Several snoRNAs are located in the
introns of genes encoding ribosomal proteins (r-proteins), nucleolar
proteins, or translation factors (reviewed in reference 29). It has been suggested that this provides a
mechanism for the coregulation of the synthesis of the snoRNAs and
other components involved in ribosome synthesis. No small RNA species
other than the snoRNAs are known to follow this pathway of
biosynthesis.
The mechanism of synthesis of vertebrate snoRNAs has been the subject
of considerable interest. The faithful synthesis of snoRNAs in
Xenopus oocytes and in vitro has been reported. The best-studied example is the U16 snoRNA, which is encoded within intron
III of the L1 r-protein gene (7, 9, 13, 34). Synthesis of
U16 is mutually exclusive with pre-mRNA splicing and involves
endonucleolytic cleavage within intron III, followed by trimming to
generate the 5' and 3' ends of the mature snoRNA. A similar pathway of
processing has been reported for U18, which is also encoded in introns
of the L1 r-protein gene (34). Processing of other snoRNAs,
i.e., U15 (44), U17 (10, 21, 22), and U19
(20), appears to be slightly different; for these snoRNAs, no upstream endonuclease cleavage site was identified, and both 5' and
3' processing appear to be purely by exonuclease digestion of either
the pre-mRNA or the excised intron. The exonucleases that carry out
these processing reactions have not been identified.
Two homologous proteins with in vitro 5'3' exoribonuclease activity
have been purified from yeast (19, 24, 38). These are Xrn1p
(also known as Rar5p, Kem1p, Dst2p, and Sep1p) (reviewed in reference
18), which functions in the cytoplasm
(17), and Rat1p (also known as Tap1p and Hke1p) (1, 2,
12, 19), which functions in the nucleus (17). The
genes encoding each of these proteins have been cloned by a number of
different groups by using selection techniques which are not obviously
related, although in several cases they potentially involve RNA
metabolism. We have previously reported that strains which have the
XRN1 gene deleted and carry a temperature-sensitive lethal
mutation in RAT1 are impaired in the formation of the 5' end
of the 5.8S rRNA (14). In addition, xrn1 mutant
strains accumulate high levels of an excised pre-rRNA spacer fragment
containing the 5' region of internal transcribed spacer 1 (ITS1)
between sites D and A2 (Fig.
1B) (39). Other studies have
shown that xrn1 mutants are impaired in 5'3' degradation
of mRNA (15, 32, 33). Homologs of both Rat1p and Xrn1p have
been identified in mice (5, 36), and mouse Xrn1p can
functionally replace the yeast protein, showing that their functions
have been highly conserved in evolution.
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Accumulation of excised pre-rRNA fragments in
exonuclease mutants. (A) Northern hybridization of RNAs extracted from
strains of the indicated genotypes following growth at 25°C or 2 h after transfer to 37°C. Panels: a, Riboprobe specific for the
A0-A1 region; b, probe specific for the
D-A2 region (oligonucleotide 002); c, riboprobe specific
for the A2-A3 region; d, 5'-extended 5.8S
detected with the probe for the A3-B1 region
(oligonucleotide 003); e, mature 5.8S rRNA (oligonucleotide 017). RNA
was separated on a gel containing 8% polyacrylamide. (B) Structure of
the pre-rRNA, showing the locations of processing sites above the
pre-rRNA. Lines below the pre-rRNA indicate the species detected in
panels a to d of panel A. The effects of the mutations on the
accumulation of the fragments referred to as a, b, c, and d are shown
in panels a, b, c, and d, respectively, of panel A.
|
|
The yeast U18 and U24 snoRNAs are intron encoded (23, 29,
35), like their vertebrate homologs (8, 35).
Vertebrate U14 is encoded within introns of the hsc70 gene
(27, 29), but the genomic arrangement is different in
Saccharomyces cerevisiae. The yeast SNR128 gene,
which encodes U14, lacks consensus promoter elements and is located
just 67 bp 3' to the end of the gene encoding another snoRNA, snR190
(46). The U14 and snR190 snoRNAs lack the 5' cap structure
characteristic of primary transcripts of RNA polymerase II, and both
species show 5' heterogeneity, consistent with synthesis by processing
of larger transcripts (reference 3 and this work).
This suggested that these snoRNAs are transcribed from a polycistronic
snoRNA precursor, as is also the case for maize U14 (25,
26). Here we analyze the in vivo processing of both
intron-encoded and polycistronic snoRNAs in yeast and report that
formation of their 5' ends involves the 5'3' exonucleases Rat1p and
Xrn1p. We also show that these enzymes process a variety of pre-rRNA
spacer fragments, in addition to forming the 5' end of the 5.8S rRNA.
| |
MATERIALS AND METHODS |
Strains and media.
The growth and handling of S. cerevisiae were by standard techniques. Cultures were grown in SD
minimal medium containing 2% glucose, 0.67% yeast nitrogen base
(Difco), and appropriate supplements. The strains used were as follows:
XRN1 strain, MATa trp1-1 ura3-52
his3-11,15 ade2-1 (strain W303-1A; kindly provided by S. Kearsey);
xrn1- strain, same as the XRN1 strain except for xrn1::URA3 (strain R934; kindly provided by S. Kearsey) (in the xrn1::URA3 mutation the
URA3 gene is inserted at a point corresponding to 97 amino
acids from the amino terminus of the protein encoded by the gene; no
Xrn1p can be detected on Western blots prepared from this strain
[17a]); rat1-1 strain, MATa
rat1-1 leu2-1 ura3-52 his3-200 (DAH18; kindly provided
by C. Cole) (2); rat1 xrn1 strain,
MATa rar5::URA3 rat1-1 (strain 966-1C; kindly provided by S. Kearsey); DBR1 strain MATa
trp1-1 his3-200 leu2-1 ura3-167 (strain YH8; kindly
provided by J. Boeke) (11); and dbr1- strain,
same as the DBR1 strain but with
dbr1::HIS3 (strain KC99) (11).
RNA extraction, Northern hybridization, and primer
extension.
RNA extraction (43) Northern hybridization
(40), and primer extension (42) were performed as
previously described. For Northern hybridization and primer extension,
total RNA equivalent to that of cells at an optical density at 600 nm
of 0.1 (approximately 2 × 106 cells; equivalent to 4 µg of RNA for wild-type cells) was used for each sample. Prior to RNA
extraction, the rat1-1 and tap1-1 strains were
pregrown at 25°C to mid-log phase (optical density at 600 nm = 0.3) and either harvested or transferred to 37°C for 2 or 6 h
prior to being harvested.
Hybridization probes. (i) rRNA probes.
For the
A0-A1 and A2-A3
fragments, riboprobes overlapping the entire regions were used
(28, 45). The hybridization probe for the D-A2
fragment was oligonucleotide 002 (GCTCTTTGCTCTTGCC), the
oligonucleotide probe for the A2-A3 region was
oligonucleotide 003 (TGTTACCTCTGGGCCC), the probe for the
5'-extended 5.8S rRNA was oligonucleotide 001 (CCAGTTACGAAAATTCTTG), the probe for the 5.8S rRNA was
oligonucleotide 017 (GCGTTGTTCATCGATGC), the probe for the
5S rRNA was oligonucleotide 041 (CTACTCGGTCAGGCTC), the probe for the 5' region of ITS2 was oligonucleotide 013 (GGCCAGCAATTTCAAGTTA), the probe for the 3' region of ITS2
was oligonucleotide 006 (AGATTAGCCGCAGTTGG), and the probe
for the external transcribed spacer (ETS) 5' to site A0 was
oligonucleotide 024 (TCGGGTCTCTCTGCTGC).
(ii) snoRNA probes.
The oligonucleotide complementary to the
5' flanking sequence of snR190 was CAATCAATTCTTCTTTTCTG
(
snR190+1), the internal snR190 oligonucleotide was
CGTCATGGTCGAATCGG (snR190), the oligonucleotide complementary to the 5' flanking sequence of U14 was
ATATATTATCTGTCTCCTC (U14-9), the internal U14
oligonucleotide was TGCGAATGTTAAGGAACC (U14), the
internal U24 oligonucleotide was TCAGAGATCTTGGTGATAAT (U24), the U24 3' flanking oligonucleotide was
AAACCATTCATCAGAG (U24-3'fl), the U18 internal
oligonucleotide was GTCAGATACTGTGATAGTC (U18), and the
U18 3' flanking oligonucleotide was GCTCTGTGCTATCGTC (U18-3'fl).
| |
RESULTS |
Excised pre-rRNA spacer fragments accumulate in 5'3' exonuclease
mutants.
RNA was extracted from a strain carrying an
xrn1::URA3 gene disruption and from an otherwise
isogenic wild-type strain following growth at 25°C and from the
rat1-1 mutant strain and the rat1-1 xrn1-
double-mutant strain following growth at 25°C and after transfer to
37°C for 2 or 6 h. All data shown are for the 2-h time point;
the 6-h time point gave similar results. Growth of rat1-1
strains essentially ceased within 2 h of transfer to 37°C (2).
Endonucleolytic cleavage of the pre-rRNA releases a number of discrete
fragments from the transcribed spacer regions (see Fig. 1B for the
structure of the pre-rRNA). The levels of these excised fragments were
assessed by Northern hybridization (Fig. 1A). Strong accumulation of a
number of spacer fragments was observed in the exonuclease mutants.
Hybridization with a probe specific for the region from site
A0, in the 5' ETS, to site A1, the 5' end of
the 18S rRNA, showed that this fragment (fragment a in Fig. 1B)
accumulated significantly in either the xrn1- or
rat1-1 single-mutant strain. The accumulation was, however,
much stronger in the double mutant at 37°C, the nonpermissive
temperature for the rat1-1 strain (Fig. 1A, panel a). This
indicates that both exonucleases normally play roles in the degradation
of this pre-rRNA region. The largest band visible in the wild-type
strain probably corresponds to the full-length
A0-A1 fragment (91 nucleotides [nt])
(45), indicating that most of the accumulated spacer
fragments in the mutants have undergone some digestion.
Cleavage at sites A0 and A1 is inhibited in
strains with the U3 snoRNA depleted (16); to confirm the
identification of the hybridizing RNA, the
A0-A1 probe was used on a Northern blot of RNA
from a strain genetically depleted of U3 by growth of a
GAL::U3 strain (16) on glucose medium.
As expected, the A0-A1 fragment was lost during
U3 depletion (data not shown).
Interestingly, cleavage at site A0 can be detected by
primer extension in wild-type strains by using a primer which
hybridizes 3' to site A1, (6, 16, 45), but no
effects of the exonuclease mutations were observed with this primer
(data not shown). We conclude that while degradation of the excised
A0-A1 fragment from A0 very rapidly
follows processing at A1, the 5' exonuclease digestion
occurs only after cleavage of A1.
Strains carrying mutations of XRN1 have previously been
reported to accumulate the pre-rRNA fragment from site D, the 3' end of
the 18S rRNA, to site A2 in ITS1 (fragment b in Fig. 1B).
As expected, the xrn1- strain strongly accumulated this
fragment (Fig. 1A, panel b, lane 2). The fragment which accumulated in the rat1-1 xrn1- double-mutant strain at the
nonpermissive temperature (Fig. 1A, panel b, lane 6) was, however,
significantly longer than that observed in the xrn1-
single mutant (Fig. 1A, panel b, lane 2) or in the double mutant grown
at the permissive temperature for the rat1-1 strain (Fig.
1A, panel b, lane 5). We conclude that while the degradation of
fragment b is largely due to Xrn1p, Rat1p also plays a role in this
activity, at least in xrn1 mutants.
A hybridization probe specific for the region between the
A2 and A3 cleavage sites in ITS1 (fragment c in
Fig. 1B) showed that this fragment was accumulated in the
rat1-1 single-mutant strain (Fig. 1A, panel c), with much
stronger accumulation in the double-mutant strain, particularly after
growth at the nonpermissive temperature for the rat1-1
strain (Fig. 1A, panel c, lane 6). Clear accumulation was not seen in
the xrn1- single-mutant strain. The hybridization probe
used for Fig. 1A, panel c, is an antisense riboprobe to the
A2-A3 region. Hybridization with an
oligonucleotide complementary to the sequence immediately 5' to site
A3 gave the same result (data not shown), suggesting that
the accumulated fragments have undergone partial digestion from the 5'
end.
We also show the level of the mature 5.8S rRNA (Fig. 1A, panel e) and
the accumulation of the 5'-extended form of the 5.8S rRNA (fragment d
in Fig. 1B) by using a hybridization probe to the 3' region of ITS1
(Fig. 1A, panel d). Here, too, accumulation was strongest in the
double-mutant strain grown at the nonpermissive temperature (Fig. 1A,
panel d, lane 6). As previously reported (14), the major
product has undergone partial digestion from the 5' end to the base of
a stable stem structure located between site A3 and the 5'
end of the 5.8S rRNA.
Probes to the 5' or 3' region of ITS2 or further upstream in the 5' ETS
did not detect accumulation of pre-rRNA fragments in the mutant strains
(data not shown; see Materials and Methods for details of the
hybridization probes used). From these data we conclude that both Xrn1p
and Rat1p play roles in the turnover of several excised fragments of
the pre-rRNA. In each case, the steady-state level of the pre-rRNA
fragment was very low in wild-type cells, indicating that degradation
very rapidly follows generation of the excised pre-rRNA fragments.
5'-extended forms of snR190 and U14 accumulate in 5'3'
exonuclease mutants.
Northern hybridization with probes to the
mature snR190 (Fig. 2A, panel b) and U14
(Fig. 2A, panel d) sequences revealed a reduction in the levels of the
mature snoRNAs compared to 5S rRNA (Fig. 2A, panel e), particularly in
the xrn1- rat1-1 double mutant at 37°C. The mature
snoRNAs are expected to be stable, so the reduction observed 2 h
after transfer to nonpermissive conditions indicates that the synthesis
of new snR190 and U14 was strongly inhibited. The rat1-1
strain essentially ceases growth after 2 h at 37°C (reference
2 and data not shown), and further reduction was not
observed at later time points (data not shown).
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Northern analysis of the synthesis of U14 and snR190.
(A) Northern hybridization of RNAs extracted from strains of the
indicated genotypes following growth at 25°C or 2 h after
transfer to 37°C. Panels: a, 5'-extended forms of snR190
(oligonucleotide snR190+1); b, mature snR190 (oligonucleotide
snR190); c, 5'-extended forms of U14 (oligonucleotide U14-9); d,
mature U14 (oligonucleotide U14); e, mature 5S rRNA (oligonucleotide
041). RNA was separated on a gel containing 8% polyacrylamide. (B)
Predicted structure of the precursor to snR190 and U14. Lines below the
pre-snoRNA indicate the species detected in panels a to d of panel A.
|
|
Probes to the 5' flanking sequences of snR190 (Fig. 2A, panel a) and
U14 (Fig. 2A, panel c) revealed the accumulation of 5'-extended forms
of the snoRNAs in the exonuclease mutants. For both snR190 and U14 the
5'-extended RNA was most clearly seen in the double mutant at the
nonpermissive temperature (Fig. 2A, panels a and c, lanes 6). A lower
accumulation of 5'-extended snR190 was seen in the rat1-1
single-mutant strains. In addition, longer RNAs were weakly detected;
RNAs with the same gel mobility were detected by both snR190 and U14
internal and 5' flanking probes (data not shown), indicating that these
represent common transcripts of snR190 and U14 pre-snoRNAs. The
5'-extended snoRNA species accumulated to much lower levels than the
mature snoRNAs (ca. 10%), suggesting that other pathways for their
turnover exist.
Primer extension was used to better characterize the 5'-extended forms
of snR190 and U14 seen in the exonuclease mutant strains. The
rat1-1 mutant strains accumulated a ladder of 5'-extended forms of snR190 which extend to a position 42 nt longer than mature snR190, but not beyond. This accumulation was evident in the
rat1-1 single mutant (Fig. 3,
lanes 3 and 4) but was much stronger in the double-mutant strain at the
nonpermissive temperature (Fig. 3, lane 6). Consistent with the results
of Northern hybridization, the level of mature U14 fell substantially
in the rat1-1 strains, particularly in the rat1-1
xrn1- strain at 37°C (Fig. 3, lane 6). A ladder of
5'-extended forms of U14, which extended to a position 55 nt longer
than mature U14 but not beyond, was also observed in the
rat1-1 strain at 37°C (Fig. 3, lane 4) and was more
strongly accumulated in the xrn1- rat1-1 double-mutant
strain (Fig. 3, lane 6).
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension analysis of the synthesis of U14 and
snR190. 5'-extended forms of snR190 and U14 are detected in 5'3'
exonuclease mutants. Primer extension was performed with the U14 or
snR190 oligonucleotide on RNA extracted from strains of the
indicated genotypes following growth at 25°C or 2 h after
transfer to 37°C. The lower panels show shorter exposures of the same
primer extensions as the corresponding upper panels.
|
|
As with pre-rRNA processing (14), the accumulation of the
pre-snoRNAs was similar but not identical in strains carrying the
tap1-1 mutation (data not shown), which is allelic with
rat1-1 (1). From these data we conclude that
Rat1p has the major activity in the processing of mature snR190 and U14
from 5'-extended pre-snoRNAs, with Xrn1p also playing a role, at least
in rat1-1 mutant strains.
In primer extension analysis, the internal snR190 oligonucleotide also
gave a strong stop at a position 302 nt 5' to the end of the mature
snR190 (data not shown). A primer extension stop at a similar position
was detected with an internal U14 oligonucleotide, but this product is
too long for its end to be accurately identified. In addition, the
internal U14 primer gave a stop at the position corresponding to the 5'
end of the mature snR190; as expected, this stop was reduced in the
xrn1- rat1-1 double-mutant strain (data not shown). These
data are consistent with processing of both U14 and snR190 from a
common pre-snoRNA transcript.
Processing of intron-encoded snoRNAs.
In contrast to snR190
and U14, the snoRNAs U18 (4) and U24 (35) are
encoded in introns of the genes EFB1 (encoding EF-1 beta)
and BEL1(encoding a G-beta-like protein of unknown
function), respectively. To determine whether intron debranching is
required for their synthesis, RNA was extracted from a strain with
DBR1, the gene encoding the intron lariat debranching enzyme
(11), deleted. Strains lacking this activity are viable and
accumulate the excised intron lariats to high levels (11).
Since these are circular molecules, synthesis of intron-encoded snoRNA
species that are processed exclusively by exonucleases is expected to be severely inhibited in the dbr1- strain. In contrast,
synthesis of snoRNAs that are generated by pathways involving
endonuclease cleavage is predicted to be little affected.
Northern hybridization (Fig. 4A) showed
that formation of mature U24 was almost entirely abolished in the
dbr1- mutant. This strongly indicates that U24 is
synthesized exclusively by exonuclease digestion. Synthesis of U18 was
also reduced, but only to ~30% of the wild-type level.
Slow-migrating RNA species were detected with both the U18 and U24
probes in the dbr1- strain. To determine whether these
represent the intron lariats, their mobilities on gels containing
either 6% (Fig. 4B) or 8% (Fig. 4C) polyacrylamide were compared. The
relative mobility of circular RNA species compared to linear RNA is
expected to be more retarded in the 8% gel than the 6% gel, and this
was observed. Strains carrying dbr1- are reported to
accumulate intron lariats which lack the sequence 3' to the intron
branch site (11). This has not been tested for the lariats
containing the U24 and U18 sequences but is likely to be the case.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
Lariat forms of U18 and U24 accumulate in an
intron-debranching mutant. (A) In RNA from the dbr1-
strain, mature U18 and U24 are underaccumulated and longer forms are
detected. (B and C) RNAs extracted from the dbr1- strain
and an otherwise isogenic DBR1 strain were separated by long
migration on gels containing either 6% (B) or 8% (C) polyacrylamide.
Lanes + and  , DBR1 and dbr1- strains,
respectively. The slow-migrating forms of U18 and U24 differ in their
relative migrations on the gels compared to the linear RNA species U3
(311 nt), U1 (568 nt), and 18S rRNA (1,860 nt). Note that mature U18
and U24 are substantially smaller than the linear RNA species shown and
have been lost from the gels in panels B and C.
|
|
The effects of 5'3' exonuclease mutations on the synthesis of U18
and U24 were also assessed. Northern hybridization (Fig. 5)
showed some reduction in the levels of mature U24 (Fig. 5B) and U18
(Fig. 5D) relative to tRNA3Leu (Fig. 5E) 2 h after
transfer to 37°C, indicating an inhibition of their synthesis.
Interestingly, the mobility of U24 was reproducibly shifted downwards,
i.e., to slightly shorter forms. Since the location of the 5' end of
U24 is unaltered on primer extension (see Fig. 6), this presumably
represents the formation of 3'-shortened species. Larger forms of U18
and U24 were detected in the rat1-1 mutant strain at 37°C
(Fig. 5, lane 4) and were more abundant in the xrn1-
rat1-1 double mutant (Fig. 5, lane 6). For both snoRNAs two major
extended species were detected. The gel mobility of the larger U24
species (+5' +3' in Fig. 5A) is appropriate for the entire intron (273 nt). From its mobility, the smaller species (+3' in Fig. 5A) is
predicted to be 3' matured but 5' extended to the end of the intron
(169 nt). Consistent with this, the U24 +5 +3 band hybridized to the
U24-3' flanking oligonucleotide probe, while the U24 +5' band did not
(data not shown); as the probe lies across the 3' end of the mature
U24, the U24 +5' species is very likely to be fully 3' matured. The
accumulation of the U24 intron in the exonuclease mutant suggests that
some inhibition of 3' processing also occurs. In other systems, e.g.,
pre-tRNA processing, 3' processing is inhibited in the absence of prior 5' processing. In the wild-type strain an RNA species of ~190 nt (+5'
in Fig. 5A) is detected with the U24 probe. This is in agreement with
the size of a pre-snoRNA which is 5' mature but 3' extended to the end
of the intron (192 nt). Consistent with this, the 190-nt species is
depleted in the double-mutant strain (Fig. 5, lane 6) and is detected
with the U24-3' probe in the same samples (data not shown). From the
primer extension data (see below), this species would not, however, be
expected in the rat1-1 mutant strain, and we assume that the
band at this position in Fig. 5, lane 4, represents an aberrant
processing intermediate.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Northern analysis of the synthesis of U18 and U24.
Longer forms of U18 and U24 are detected in 5'3' exonuclease
mutants. Northern hybridization of RNAs extracted from strains of the
indicated genotypes is shown. For U18, RNA was separated on a gel
containing 6% polyacrylamide; for U24, which is smaller, a gel
containing 8% polyacrylamide is shown. The positions of migration of
U14 (126 nt), snR190 (190 nt), snR10 (245 nt) and U3 (311 nt)
determined by subsequent Northern hybridization of the same filters are
indicated, as are the positions of migration of mature 5S and 5.8S
rRNAs. Species predicted to be 5'- and 3'-extended forms of U24 and U18
are indicated (+5', +3', and +5' +3').
|
|
In the case of U18, the mobility of the U18 +5' band in Fig. 5C, lane
6, is consistent with a species which is 3' mature but 5' extended to
the end of the intron (220 nt). The mobility of the larger U18 +5' +3'
species in Fig. 5C, lane 6, is, however, greater than that predicted
for the intact intron (366 nt); the faint band above this species may
represent the intact intron. The U18 +5' +3' species may therefore be a
form of the intron which has undergone partial digestion. A faint band
present in the wild-type but not in the double-mutant strain (+3' in
Fig. 5C) shows a gel mobility consistent with U18 that is 5' mature but
3' extended to the end of the intron (253 nt)
The synthesis of U24 and U18 was also examined by primer extension. In
the dbr1- strain, the mature 5' end of U24 is lost and a
strong primer extension stop at the position corresponding to the 5'
end of the mRNA intron was observed (labeled 5' IVS in Fig.
6) with either an internal U24
oligonucleotide or an oligonucleotide complementary to the 3' flanking
sequence. With the internal U24 oligonucleotide, an RNA species
extended to the 5' end of the intron was detected in the
rat1-1 strains at 37°C (Fig. 6); a reduction in the mature
5' end of U24 was also observed, particularly in the xrn1-
rat1-1 double-mutant strain at 37°C. A striking reduction in the
stop corresponding to the mature 5' end of U24 was observed in the
rat1-1 strains at 37°C by using the 3' flanking oligonucleotide, which detects the 3'-immature pre-snoRNA species. This
is consistent with the inhibition of 5' processing of newly synthesized
U24 in the mutant. Similar results were obtained for U18 (data not
shown), with the interesting difference that the mature 5' end of
U18 was only weakly detected with the 3' flanking oligonucleotide even
in the wild-type strain. This suggests that 3' processing of U18
normally precedes 5' processing.
View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Primer extension analysis of the synthesis of U24.
(Left) Primer extension with a probe to mature U24 (U24). (Right)
Primer extension with an oligonucleotide (oligo) spanning the 3' end of
U24 (U24-3'fl). The positions of the mature 5' end of U24 and the
intron 5' splice site (5' IVS) are indicated on the DNA sequence
ladder.
|
|
We conclude that the 5' ends of U18 and U24 are synthesized by
exonuclease digestion requiring Rat1p, with Xrn1p also playing a role,
at least in the rat1-1 strains. U24 can be synthesized only
from the debranched intron lariat, while U18 can be generated with
moderate efficiency in the absence of intron debranching.
| |
DISCUSSION |
Results from higher eukaryotic systems indicate that the 5' ends
of many snoRNA species are generated by 5'3' exonuclease activities
(7, 13, 20, 22, 34, 44). Two 5'3' exonucleases, Xrn1p and
Rat1p, have been identified in S. cerevisiae, and we therefore tested whether mutants defective in these activities are also
defective in the 5' processing of pre-snoRNA species. The data
presented here establish that Xrn1p and Rat1p play roles in the
formation of the 5' ends of the yeast snoRNAs, snR190, U14, U18, and
U24. In each case, the rat1-1 mutation led to some accumulation of 5'-extended species at 37°C, but this was stronger in
the xrn1- rat1-1 double-mutant strain, whereas the
xrn1- single mutation alone had little effect. After
2 h at the nonpermissive temperature, depletion of the mature
snoRNAs was observed in the rat1-1 xrn1- strains,
indicating that the major biosynthetic pathway was inhibited. As
rat1-1 strains rapidly cease growth at 37°C
(2), stronger depletion of the mature snoRNAs was not observed at later time points. The pre-rRNA spacer fragments and the
5'-extended snoRNA and 5.8S rRNA species were, however, present at
relatively low levels compared to the mature rRNA and snoRNAs. The
xrn1- allele is a gene disruption construct
(14), whereas the rat1-1 allele is a
temperature-sensitive point mutation (2). It is not clear
whether Rat1p retains some residual processing activity in the
rat1-1 strain or whether the accumulated RNAs were degraded
by another pathway. In the rat1-1 mutant strain, the nuclear
poly(A) signal is lost after prolonged incubation at the nonpermissive
temperature (2), suggesting that there is some residual
activity in the mutant. A complex of 3'5' exonucleases processes the
3' end of the 5.8S rRNA (30) and degrades the excised
pre-rRNA spacer 5' to site A0 (11a). This
complex may also contribute to turnover of the RNAs that accumulate in
the 5'3' exonuclease mutants.
Northern and primer extension data indicate that snR190 and U14 are
synthesized from a common, dicistronic transcript. In the
rat1-1 and xrn1- rat1-1 strains, ladders of
5'-extended snoRNAs that extend to positions 42 for snR190 and 55
for U14 were detected. These sites do not have any obvious homology to
each other or to consensus snoRNA promoter sequences. Moreover, U14
position 55 lies only 12 nt 3' to the mature snR190 region, making it unlikely to be a transcription start site. We propose that snR190 position 42 and U14 position 55 represent intermediate sites in the
processing of larger pre-snoRNA species. These could be the products of
either endonuclease or 5'3' exonuclease digestion. However,
exonuclease digestion would presumably have to involve an
exonuclease(s) other than Xrn1p and Rat1p, and other 5'3' exonuclease have not been identified in yeast extracts (19, 24,
38). Moreover, the 5' cap structure would be expected to confer
protection against exonucleases, and an endonuclease activity is more
probable. The furthest-upstream primer extension stop that we detected
lies 302 nt 5' to snR190. It has not been established whether this
represents the transcription start site or is a further upstream
processing site; however, the 5' end of the next open reading
frame lies only 190 nt upstream of this site, making this likely to be
the start site.
U18 and U24 are synthesized from the introns of host genes that also
encode mRNAs. U24 can be synthesized only from the debranched intron
lariat; the snoRNA was found almost entirely in circular form in a
mutant which lacks intron-debranching activity. This strongly indicates
that both 5' and 3' processing of the pre-snoRNA are exclusively
exonucleolytic. Moreover, little if any processing of U24 can occur on
the unspliced pre-mRNA. In the case of U18, synthesis of the mature
snoRNA was reduced to ~30% of the wild-type level in the debranching
mutant, indicating that the major processing pathway is also via
exonuclease digestion. Residual processing might be due to endonuclease
cleavage of the intron lariat or exonuclease digestion of the unspliced
pre-mRNA. For both U18 and U24, pre-snoRNAs that were 5' extended to
the intron 5' splice site in the rat1-1 and xrn1-
rat1-1 strains accumulated, indicating that these are the 5'3'
exonucleases responsible for processing the pre-snoRNAs. Primer
extension specifically on pre-U24, using a 3'-flanking oligonucleotide,
failed to detect the mature 5' end of the snoRNA in the
rat1-1 strains at 37°C, demonstrating the inhibition of 5'
processing.
In each case the accumulation of 5'-extended snoRNA species was much
stronger in the rat1-1 strain than in the
xrn1- strain, indicating that Rat1p is the major
pre-snoRNA-processing activity in wild-type cells. Since Rat1p
functions in the nucleus, the presumed site of pre-snoRNA processing,
while Xrn1p functions in the cytoplasm (17), it may be that
the processing activity normally resides only in Rat1p, with Xrn1p
functioning to process the accumulated pre-snoRNAs in the
rat1-1 mutant strains.
Together, the data suggest the models shown in Fig.
7. We envisage that snR190 and U14 are
synthesized from a dicistronic pre-snoRNA species which extends from a
position 302 nt 5' to snR190 to beyond the 3' end of U14 (Fig. 7A).
This is processed, probably endonucleolytically, at positions 42 nt 5'
to snR190 and 55 nt 5' to U14, within the intergenic spacer region.
These processing reactions are followed by 5' and 3' trimming reactions which generate the mature snoRNAs. In contrast, U24 (Fig. 7B) is
processed from the excised pre-mRNA intron. In wild-type cells processing is probably exonucleolytic from the debranched intron lariat.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
(A) Model for the processing of pre-snR190 and pre-U14.
The coding sequences of snR190 and U14 lie in the same orientation in
the genome and are separated by only 67 nt (46). We propose
that they are synthesized from a common precursor which extends from
302 nt 5' to snR190 to beyond the 3' end of U14. Cleavage of the
pre-snoRNA at snR190 position 42 and U14 position 55 is envisaged
to be followed by exonuclease digestion by Rat1p to the 5' ends of the
snoRNAs and 3' trimming. (B) Model for the processing of pre-U24. U24
is encoded in the intron of the BEL1 gene (23,
35) and is generated from the excised intron lariat. Following
intron debranching, processing is envisaged to consist of exonuclease
digestion by Rat1p to the 5' end of the snoRNA and 3' trimming. IBP,
intron branch point.
|
|
In general, the host genes for vertebrate snoRNAs encode protein
products that have some relationship to ribosome synthesis or function.
This coexpression may facilitate the coordinated synthesis of the
protein and snoRNA products. The data reported here extend the
interaction between the synthesis of the snoRNAs and the function of
the nucleolus by demonstrating that the snoRNAs and pre-rRNAs are
processed by common components. It is possible that as the snoRNAs
developed, they simply made use of whatever processing machinery was
available. Alternatively, the use of common components might have been
selected because of the obvious possibilities that it offered for
coregulation of the synthesis of the rRNAs and snoRNAs. Such
coregulation might indeed be the reason that so many snoRNAs, but no
other known small RNA species, are synthesized by such excision
mechanisms.
All studies on the in vitro processing of vertebrate snoRNAs have
implicated 5'3' exonuclease activities in formation of the 5' ends
of the snoRNAs (7, 13, 22, 34, 44; reviewed in
references 20 and 29). In no case
have the nucleases yet been identified, but we strongly predict that,
at least in some cases, these activities will involve the vertebrate
homologs of Rat1p and Xrn1p (5, 36).
| 1.
|
Aldrich, T. L.,
G. Di Segni,
B. L. McConaughy,
N. J. Keen,
S. Whelen, and B. D. Hall.
1993.
Structure of the yeast TAP1 protein: dependence of transcription activation on the DNA context of the target gene.
Mol. Cell. Biol.
13:3434-3444[Abstract/Free Full Text].
|
| 2.
|
Amberg, D. C.,
A. L. Goldstein, and C. N. Cole.
1992.
Isolation and characterization of RAT1: an essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA.
Genes Dev.
6:1173-1189[Abstract/Free Full Text].
|
| 3.
|
Balakin, A. G.,
R. A. Lempicki,
G. M. Huang, and M. J. Fournier.
1994.
Saccharomyces cerevisiae U14 small nuclear RNA has little secondary structure and appears to be produced by post-transcriptional processing.
J. Biol. Chem.
269:739-746[Abstract/Free Full Text].
|
| 4.
|
Balakin, A. G.,
L. Smith, and M. J. Fournier.
1996.
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Cell
85:823-834.
|
| 5.
|
Bashkirov, V. I.,
H. Scherthan,
J. A. Solinger,
J. M. Buerstedde, and W. D. Heyer.
1997.
A mouse cytoplasmic exoribonuclease (mXRN1p) with preference for G4 tetraplex substrates.
J. Cell Biol.
136:761-773[Abstract/Free Full Text].
|
| 6.
|
Beltrame, M.,
Y. Henry, and D. Tollervey.
1994.
Mutational analysis of an essential binding site for the U3 snoRNA in the 5' external transcribed spacer of yeast pre-rRNA.
Nucleic Acids Res.
22:5139-5147[Abstract/Free Full Text].
|
| 7.
|
Caffarelli, E.,
M. Arese,
B. Santoro,
P. Fragapane, and I. Bozzoni.
1994.
In vitro study of processing of the intron-encoded U16 small nucleolar RNA in Xenopus laevis.
Mol. Cell. Biol.
14:2966-2974[Abstract/Free Full Text].
|
| 8.
|
Caffarelli, E.,
E. De Gregorio,
A. Fatica,
S. Prislei,
P. Fragapane, and I. Bozzoni.
1996.
Processing of the intron-encoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing reactions and the stability of the mature snoRNAs.
EMBO J.
15:1121-1131[Medline].
|
| 9.
|
Caffarelli, E.,
L. Maggi,
A. Fatica,
J. Jiricny, and I. Bozzoni.
1997.
A novel Mn++-dependent ribonuclease that functions in U16 snoRNA processing in X. laevis.
Biochem. Biophys. Res. Commun.
233:514-517[Medline].
|
| 10.
|
Cecconi, F.,
P. Mariottini, and F. Amaldi.
1995.
The Xenopus intron-encoded U17 snoRNA is produced by exonucleolytic processing of its precursor in oocytes.
Nucleic Acids Res.
23:4670-4676[Abstract/Free Full Text].
|
| 11.
|
Chapman, K. B., and J. D. Boeke.
1991.
Isolation and characterization of the gene encoding yeast debranching enzyme.
Cell
65:483-492[Medline].
|
| 11a.
| de la Cruz, J., D. Kressler, D. Tollervey, and P. Linder. Dob1p (Mtr4p) is a putative ATP-dependent RNA helicase
required for the 3' end formation of 5.85 rRNA in Saccharomyces
cerevisiae. EMBO J., in press.
|
| 12.
|
Di Segni, G.,
B. L. McConaughy,
R. A. Shapiro,
T. L. Aldrich, and B. D. Hall.
1993.
TAP1, a yeast gene that activates the expression of a tRNA gene with a defective internal promoter.
Mol. Cell. Biol.
13:3424-3433[Abstract/Free Full Text].
|
| 13.
|
Fragapane, P.,
S. Prislei,
A. Michienzi,
E. Caffarelli, and I. Bozzoni.
1993.
A novel small nuclear RNA (U16) is encoded inside a ribosomal protein intron and originates by processing of the pre-mRNA.
EMBO J.
12:2921-2928[Medline].
|
| 14.
|
Henry, Y.,
H. Wood,
J. P. Morrissey,
E. Petfalski,
S. Kearsey, and D. Tollervey.
1994.
The 5' end of yeast 5.8S rRNA is generated by exonucleases from an upstream cleavage site.
EMBO J.
13:2452-2463[Medline].
|
| 15.
|
Hsu, C. L., and A. Stevens.
1993.
Yeast cells lacking 5' 3' exoribonuclease 1 contain mRNA species that are poly(A) deficient and partially lack the 5' cap structure.
Mol. Cell. Biol.
13:4826-4835[Abstract/Free Full Text].
|
| 16.
|
Hughes, J. M. X., and M. J. Ares.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 17.
|
Johnson, A. W.
1997.
Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively.
Mol. Cell. Biol.
17:6122-6130[Abstract].
|
| 17a.
| Kearsey, S. Personal communication.
|
| 18.
|
Kearsey, S., and D. Kipling.
1991.
Recombination and RNA processing: a common strand?
Trends Cell Biol.
1:110-112.
[Medline] |
| 19.
|
Kenna, M.,
A. Stevens,
M. McCammon, and M. G. Douglas.
1993.
An essential yeast gene with homology to the exonuclease-encoding XRN1/KEM1 gene also encodes a protein with exoribonuclease activity.
Mol. Cell. Biol.
13:341-350[Abstract/Free Full Text].
|
| 20.
|
Kiss, T.,
M.-L. Bortolini, and W. Filipowicz.
1996.
Characterization of the intron-encoded U19 RNA, a new mammalian small nucleolar RNA that is not associated with fibrillarin.
Mol. Cell. Biol.
16:1391-1400[Abstract].
|
| 21.
|
Kiss, T., and W. Filipowicz.
1995.
Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns.
Genes Dev.
9:1411-1424[Abstract/Free Full Text].
|
| 22.
|
Kiss, T., and W. Filipowicz.
1993.
Small nucleolar RNAs encoded by introns of the human cell cycle regulatory gene RCC1.
EMBO J.
12:2913-2920[Medline].
|
| 23.
|
Kiss-László, Z.,
Y. Henry,
J.-P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 24.
|
Larimer, F. W.,
C. L. Hsu,
M. K. Maupin, and A. Stevens.
1992.
Characterization of the XRN1 gene encoding a 5'3' exoribonuclease: sequence data and analysis of disparate protein and mRNA levels of gene-disrupted yeast cells.
Gene
120:51-57[Medline].
|
| 25.
|
Leader, D. J.,
J. F. Sanders,
R. Waugh,
P. Shaw, and J. W. S. Brown.
1994.
Molecular characterisation of plant U14 small nucleolar RNA genes: closely linked genes are transcribed as polycistronic U14 transcripts.
Nucleic Acids Res.
22:5196-5203[Abstract/Free Full Text].
|
| 26.
|
Leader, D. L.,
G. P. Clark,
J. Watters,
A. F. Beven,
P. J. Shaw, and J. W. S. Brown.
1997.
Clusters of multiple different small nucleolar RNA genes in plants are expressed as and processed from polycistronic pre-snoRNAs.
EMBO J.
16:5742-5751[Medline].
|
| 27.
|
Leverette, R. D.,
M. T. Andrews, and E. S. Maxwell.
1992.
Mouse U14 snRNA is a processed intron of the cognate hsc70 heat shock pre-messenger RNA.
Cell
71:1215-1221[Medline].
|
| 28.
|
Lygerou, Z.,
C. Allmang,
D. Tollervey, and B. Séraphin.
1996.
Accurate processing of a eukaryotic pre-rRNA by RNase MRP in vitro.
Science
272:268-270[Abstract].
|
| 29.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
35:897-934.
|
| 30.
|
Mitchell, P.,
E. Petfalski,
A. Shevchenko,
M. Mann, and D. Tollervey.
1997.
The exosome; a conserved eukaryotic RNA processing complex containing multiple 3'5' exoribonuclease activities.
Cell
91:457-466[Medline].
|
| 31.
|
Mount, S., and S. Henikoff.
1993.
Nested genes take flight.
Curr. Biol.
3:372-374[Medline].
|
| 32.
|
Muhlrad, D.,
C. J. Decker, and R. Parker.
1994.
Deadenylation of the unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5'3' digestion of the transcript.
Genes Dev.
8:855-866[Abstract/Free Full Text].
|
| 33.
|
Muhlrad, D.,
C. J. Decker, and R. Parker.
1995.
Turnover mechanisms of the stable yeast PGK1 mRNA.
Mol. Cell. Biol.
15:2145-2156[Abstract].
|
| 34.
|
Prislei, S.,
A. Michienzi,
C. Presutti,
P. Fragapane, and I. Bozzoni.
1993.
Two different snoRNAs are encoded in introns of amphibian and human L1 ribosomal protein genes.
Nucleic Acids Res.
21:5824-5830[Abstract/Free Full Text].
|
| 35.
|
Qu, L. H.,
Y. Henry,
M. Nicoloso,
B. Michot,
M. C. Azum,
M. H. Renalier,
M. Caizergues-Ferrer, and J. P. Bachellerie.
1995.
U24, a novel intron-encoded small nucleolar RNA with two 12nt long, phylogenetically conserved complementarities to 28S rRNA.
Nucleic Acids Res.
23:2669-2676[Abstract/Free Full Text].
|
| 36.
|
Shobuike, T.,
S. Sugano,
T. Yamashita, and H. Ikeda.
1995.
Characterization of cDNA encoding mouse homolog of fission yeast dhp1+ gene: structural and functional conservation.
Nucleic Acids Res.
23:357-61[Abstract/Free Full Text].
|
| 37.
|
Sollner-Webb, B.
1993.
Novel intron-encoded small nucleolar RNAs.
Cell
75:403-405[Medline].
|
| 38.
|
Stevens, A.
1980.
Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5'-mononucleotides by a 5'3' mode of hydrolysis.
J. Biol. Chem.
255:3080-3085[Abstract/Free Full Text].
|
| 39.
|
Stevens, A.,
C. L. Hsu,
K. R. Isham, and F. W. Larimer.
1991.
Fragments of the internal transcribed spacer 1 of pre-rRNA accumulate in Saccharomyces cerevisiae lacking 5'3' exoribonuclease 1.
J. Bacteriol.
173:7024-7028[Abstract/Free Full Text].
|
| 40.
|
Tollervey, D.
1987.
A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA.
EMBO J.
6:4169-4175[Medline].
|
| 41.
|
Tollervey, D., and T. Kiss.
1997.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
9:337-342[Medline].
|
| 42.
|
Tollervey, D.,
H. Lehtonen,
M. Carmo-Fonseca, and E. C. Hurt.
1991.
The small nucleolar RNP protein NOP1 (fibrillarin) is required for pre-rRNA processing in yeast.
EMBO J.
10:573-583[Medline].
|
| 43.
|
Tollervey, D., and I. W. Mattaj.
1987.
Fungal small nuclear ribonucleoproteins share properties with plant and vertebrate U-snRNPs.
EMBO J.
6:469-476[Medline].
|
| 44.
|
Tycowski, K. T.,
M.-D. Shu, and J. A. Steitz.
1993.
A small nucleolar RNA is processed from an intron of the human gene encoding ribosomal protein S3.
Genes Dev.
7:1176-1190[Abstract/Free Full Text].
|
| 45.
|
Venema, J.,
Y. Henry, and D. Tollervey.
1995.
Two distinct recognition signals define the site of endonucleolytic cleavage at the 5' end of yeast 18S rRNA.
EMBO J.
14:4883-4892[Medline].
|
| 46.
|
Zagorski, J.,
D. Tollervey, and M. J. Fournier.
1988.
Characterization of an SNR gene locus in Saccharomyces cerevisiae that specifies both dispensable and essential small nuclear RNAs.
Mol. Cell. Biol.
8:3282-3290[Abstract/Free Full Text].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
