MCB Free Medline Searching
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fasullo, M.
Right arrow Articles by Koudelik, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fasullo, M.
Right arrow Articles by Koudelik, J.

Mol Cell Biol, March 1998, p. 1190-1200, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

The Saccharomyces cerevisiae RAD9 Checkpoint Reduces the DNA Damage-Associated Stimulation of Directed Translocations

Michael Fasullo,1,2,* Thomas Bennett,2 Peter Ahching,1 and Joe Koudelik2

Department of Biochemistry and Molecular Biology, The Albany Medical College, Albany, New York 12208-3479,1 and Department of Radiotherapy, Loyola University Medical Center, Maywood, Illinois 601532

Received 6 October 1997/Returned for modification 11 November 1997/Accepted 26 November 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Genetic instability in the Saccharomyces cerevisiae rad9 mutant correlates with failure to arrest the cell cycle in response to DNA damage. We quantitated the DNA damage-associated stimulation of directed translocations in RAD9+ and rad9 mutants. Directed translocations were generated by selecting for His+ prototrophs that result from homologous, mitotic recombination between two truncated his3 genes, GAL1::his3-Delta 5' and trp1::his3-Delta 3'::HOcs. Compared to RAD9+ strains, the rad9 mutant exhibits a 5-fold higher rate of spontaneous, mitotic recombination and a greater than 10-fold increase in the number of UV- and X-ray-stimulated His+ recombinants that contain translocations. The higher level of recombination in rad9 mutants correlated with the appearance of nonreciprocal translocations and additional karyotypic changes, indicating that genomic instability also occurred among non-his3 sequences. Both enhanced spontaneous recombination and DNA damage-associated recombination are dependent on RAD1, a gene involved in DNA excision repair. The hyperrecombinational phenotype of the rad9 mutant was correlated with a deficiency in cell cycle arrest at the G2-M checkpoint by demonstrating that if rad9 mutants were arrested in G2 before irradiation, the numbers both of UV- and gamma -ray-stimulated recombinants were reduced. The importance of G2 arrest in DNA damage-induced sister chromatid exchange (SCE) was evident by a 10-fold reduction in HO endonuclease-induced SCE and no detectable X-ray stimulation of SCE in a rad9 mutant. We suggest that one mechanism by which the RAD9-mediated G2-M checkpoint may reduce the frequency of DNA damage-induced translocations is by channeling the repair of double-strand breaks into SCE.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

It has been postulated that DNA damage-induced cell cycle arrest at cell cycle checkpoints maintains genomic stability by allowing time for DNA repair prior to the replication or division of damaged chromatids (67, 68). Consistent with this idea, mutations in genes controlling cell cycle arrest at the G1-S checkpoint and G2-M checkpoint confer enhanced genetic instability. For example, p53 mutations, which confer deficiencies in the G1-S checkpoint, are correlated with enhanced spontaneous and UV-stimulated amplification of CAD genes (35, 73). Cells cultured from patients with ataxia telangiectasia that are deficient in cell cycle arrest at both the G1-S and G2-M cell cycle checkpoints (7, 49) also exhibit higher frequencies of chromosomal rearrangements, including translocations (37) and deletions (38), and chromosome end-to-end joining (41).

In Saccharomyces cerevisiae, DNA-damaging agents stimulate mitotic, homologous recombination and induce cell cycle arrest at cell cycle checkpoints (31, 59). For example, DNA damage-associated recombination between his3 fragments positioned at predetermined loci can result in chromosomal rearrangements, including translocations (18, 19), duplications (16), and deletions (54). HO endonuclease-generated double-strand breaks (DSBs) stimulate ectopic gene conversion between Ty1 elements and deletions between delta sequences (42). Because one DSB is sufficient to trigger RAD9-mediated cell cycle arrest at the G2-M cell cycle checkpoint (8, 50), we asked whether cell cycle arrest at specific cell cycle checkpoints may channel recombinogenic DNA lesions into homologous recombination pathways that minimize genomic instability.

Recombinational repair of DSBs by sister chromatid exchange (SCE) may minimize genomic instability. Since resistance to ionizing radiation is greater in the G2 phase of the cell cycle than in the G1 phase in yeast (10, 11), it seems possible that sister chromatids are preferred substrates for the repair of DSBs by homologous recombination. Using a yeast strain containing tandemly repeated fragments of the ade3 gene, Kadyk and Hartwell (27) found that X-ray-stimulated SCE is enhanced when cells are pretreated with the drug methyl benzimidazole-2-yl-carbamate, an agent that arrests cells in G2. They concluded that X-ray-induced lesions are preferentially repaired via homologous recombination between sister chromatids rather than recombination between homologs. We speculate that in cell cycle mutants defective in arrest at the G2-M checkpoint, unrepaired chromatids are more likely to be inherited in daughter cells and to increase the frequencies of some mitotic recombination events.

The S. cerevisiae rad9 mutant (32), which is defective in cell cycle arrest at the G1 (58, 59) and G2 (67, 70) checkpoints, is hypersensitive to DNA-damaging agents including UV and ionizing radiation and exhibits higher levels of chromosome loss than RAD9+ cells (69). However, no mitotic recombination phenotype has been established for the rad9 mutant. rad9 mutants do not exhibit higher levels of spontaneous, allelic recombination (69) or higher levels of spontaneous, intrachromatid deletions (53). In addition, the mitotic rate of spontaneous SCE is unchanged in rad9 mutants (44). These previous studies did not analyze recombination events between nonhomologous chromosomes (ectopic recombination) that result in chromosomal rearrangements or the effect of DNA-damaging agents on recombination frequencies.

In this study, we measured the spontaneous rates and the DNA damage-associated stimulation of directed translocations in both RAD9+ and rad9 mutant yeast strains. Both spontaneous, mitotic recombination and DNA damage-associated recombination resulting in chromosomal translocations were higher in rad9 mutants, whereas levels of DSB-stimulated SCE were lower in rad9 mutants. We suggest that the rad9 mutant represents a novel class of mitotic recombination mutants in yeast, resulting from lack of cell cycle checkpoint control.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Media and yeast strains. Media for the culture of bacteria are described in reference 3. Standard media for the culture of yeast, SC (synthetic complete, dextrose), SC-Trp (SC lacking tryptophan), SC-His (SC lacking histidine), SD (synthetic dextrose), YP (yeast extract, peptone), YPD (YP, dextrose), and sporulation media are described by Sherman et al. (57). YPL medium contains YP with 2% lactate (pH 5.5), and YPGal medium contains YP medium with 2% galactose. Ura- isolates (5-fluoro-orotic acid resistant [FOAr]) were selected on FOA medium (9). Yeast transformations were performed as described by Chen et al. (12).

Relevant yeast strains are listed in Table 1. Strains used to monitor translocations contain truncated his3 genes and were derived from YNN287 (16, 18). In this study, the trp1::his3-Delta 3' gene fragment was replaced with trp1::his3-Delta 3'::HOcs, containing the recognition sequence for HO endonuclease (HOcs).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Yeast strains used in this study

The his3-Delta 3'::HOcs gene fragment (Fig. 1) was constructed as follows. First, his3-Delta 3' was constructed by KpnI digestion of pUC18HIS3 to generate 0.8- and 3.6-kb restriction fragments; the 3.6-kb KpnI restriction fragment was circularized by DNA ligation, resulting in a deletion of the his3 sequences that encode the 11 carboxyl-terminal amino acids (62, 63). The EcoRI-BamHI restriction fragment containing his3-Delta 3' was subcloned into the EcoRI-BamHI sites of YIp5 (51). By BamHI and BstYI digestion, the 117-bp MATa fragment (30) was obtained from a modified version of pRK113 (HincII site converted to a BamHI site [this study]) and was subcloned into the BglII sites of his3-Delta 3', replacing the 60-bp HIS3 BglII fragment. The 117-bp MATa fragment contains the minimal 24 bp necessary for HO endonuclease digestion (40).


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1.   Configurations of the his3 recombinational substrates in strains used to generate reciprocal translocations (A) or SCE (B). For simplicity, the left arms of chromosomes II and IV are not shown. As shown at the bottom, an arrow without feathers represents his3-Delta 5' and an arrow without an arrowhead represents his3-Delta 3'. The recognition sequence for HO endonuclease, designated HOcs, is indicated by an arrow. Wild-type HIS3 is depicted as an arrow with feathers and an arrowhead. The reciprocal product [his3-Delta (5',3')] lacks both arrowhead and feathers. Identical shadings within these truncated arrows indicate sequence similarity. The direction of the arrow is indicative of the polarity of the amino acid coding sequence. Heavy lines represent chromosome IV sequences, and ovals represent CEN4. Black boxes represent the 3.1-kb EcoRI fragment (Sc4131). Recombination between his3 substrates generates the reciprocal translocation, CEN2::IV and CEN4::II, as shown at the bottom. (A) Strain construction in which his3-Delta 3'::HOcs is transplaced in the genome at the trp1 locus. (B) The his3 substrates for the SCE assay after DNA replication of the chromatid (G2). The product of unequal recombination between the tandem his3 fragments is also shown.

The his3-Delta 3'::HOcs gene fragment was transplaced (51) at trp1 by using plasmid MFp101, in which the 3' and 5' ends of the his3-Delta 3'::HOcs fragment are flanked by chromosomal sequences Sc4131 and Sc4124 that map immediately centromere proximal and centromere distal (61), respectively, to the 1.45-kb EcoRI TRP1 fragment. MFp100 is similar to the previously described plasmid pNN275 (17) except that MFp100 contains the his3-Delta 3'::HOcs gene fragment. To create MFp101, a 1.2-kb BamHI-XhoI partial fragment of Sc4124 was subcloned into the BamHI-SalI sites of MFp100. Plasmid MFp101 was then introduced into the diploid strain YB121 by selecting for Ura+ transformants. A FOAr isolate containing both trp1::his3-Delta 3'::HOcs and GAL1::his3-Delta 5' was sporulated and dissected; YB109 (Table 1) is a meiotic segregant containing both recombination substrates. The transplacement also deletes the entire TRP1 gene and GAL3 promoter sequences (65).

Strains to monitor SCE contain the his3 fragments in tandem at trp1 as previously described (16) except there are no direct repeats that flank the his3 fragments. They were made by first selecting Ura+ transformants of YA102 that contained plasmid MFp102 at trp1. MFp102 contains the his3-Delta 5' gene fragment at the BamHI site in MFp101 in the same orientation as in pNN287 (16). We then identified a FOAr isolate (YB146) that generated His+ recombinants.

Two sets of isogenic diploid strains containing rad1, rad9, or rad52 null mutations were made by one-step gene replacement (48). One set is isogenic to the Rad+ YB110, a diploid cross of YA102 and YB109, and the other set is isogenic to YB148, a diploid cross of YB109 and YA148. YA102 is derived from S288c, while YA148 is derived from a non-S288c strain containing a cup1 deletion that was subsequently twice backcrossed with an S288c background (34). The rad9::URA3, rad9::LEU2, rad52::LEU2, and rad1::URA3 disruptions were obtained by introducing digested DNA from plasmids pTW039, pTW0301 (69), pSM20 (55), and pDH23 (24), respectively, and selecting for transformants with the appropriate prototrophy. Haploid mutants containing both rad9 and rad1 disruptions or rad9 and rad52 disruptions were made by first introducing the rad9 disruption and then introducing either the rad1 or rad52 disruption. Diploid strains were made by crossing strains derived from YB109 with those derived from YA102 or YA148, which do not contain the recombination substrates. Diploids isogenic to YB110 include the rad9 (YB134) and the rad1 (YB138) mutants. Diploids isogenic to YB148 include the rad9 (YB135) and rad1 (YB149) mutants and the rad9 rad1 (YB141) and rad9 rad52 (YB145) double mutants. The UV or gamma -ray sensitivities of all transformants were confirmed.

Determining rates of spontaneous recombination and numbers of DNA damage-associated recombinants. The rates of spontaneous, mitotic events that generate either SCE or translocations (Table 2) were determined by the method of the median (33), as executed by Esposito et al. (14), using 11 independent colonies for each rate calculation. At least three independent rate calculations were done for each strain, and the significance of the differences between strains was determined by the Mann-Whitney U test (74).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   Rates of spontaneous translocations for rad9, rad52, and rad1 mutants and RAD9+ strains

The number of His+ recombinants stimulated by DNA-damaging agents was determined by subtracting the spontaneous frequency from the stimulated frequency and multiplying by 107, the approximate number of cells plated, as done previously (17, 18). At least three independent experiments were done for each DNA-damaging agent. The significance of the differences between rad9 mutants and RAD9+ strains was determined by using the two-tailed paired sample t test (74). Protocols used to test the recombinogenicity of methyl methanesulfonate (MMS), UV, and gamma  rays have been described elsewhere (18, 19). The X-ray radiation source was purchased from Rad Source, Inc. (Wheeling, Ill.), and the dose rate was 440 rads/min. For measuring stimulation of SCE, cells were preincubated for 30 min in YPD after treatment with the DNA-damaging agent, washed twice with sterile H2O, and then plated on selective medium (SC-His). Statistical significance of the X-ray stimulation of SCE was determined by the nonparametric sign test (74).

To arrest cells at the G2 phase of the cell cycle, cells were grown to an A600 of 0.5 to 1 in YPD, nocodazole (methyl-5-[2-thienylcarbonyl]-H-benzimidazole-2-yl-carbamate) (25) was added to a concentration of 15 µg/ml, and cells were incubated at 30°C for 3 h. Cell cycle arrest was confirmed by visualization of large budded dumbbell-shaped structures in the light microscope; more than 95% of the cells were arrested. Cells were washed three times in sterile H2O prior to irradiation.

Induction of HO endonuclease. The HO gene under GAL control (26) contained on pGHOT-GAL3 (present study) was introduced into both RAD9+ and rad9 strains by selecting for Trp+ transformants. pGHOT-GAL3 was constructed by subcloning the SmaI-SalI 3.5-kb GAL3 fragment obtained from pT13B (65) into the XhoI site in pGHOT (40). Trp+ isolates were then cultured in liquid SC-Trp and diluted in YPL. At a density of 107 cells/ml, glucose or galactose was added to a final concentration of 2%, to either repress or induce, respectively, expression of HO endonuclease. After 2 h, cells were plated directly on SC-His medium to measure prototroph formation and on SC medium or YPD medium to measure viability. Colonies were replica plated onto SC-Trp and SC media to determine the percentage of cells containing pGHOT-GAL3. No stimulation of recombination was observed when glucose was added to repress HO endonuclease.

Chromosomal DNA gels. Undigested yeast chromosomal DNA (56) was resolved on contour-clamped homogeneous electric field (CHEF) gels, using 220 V (6 V/cm) for 26 h at a 90-s pulse time (13). Chromosomal DNA was transferred to nylon membranes after exposure to 60 mJ of UV radiation for Southern blot analysis (60).

Verification that His+ recombinants result from unequal SCE. Mitotic unequal SCE results in His+ recombinants that contain HIS3 flanked by his3-Delta 5' (his3-Delta 2619 [62]) and his3-Delta 3' (16). Southern blot hybridization (60) was used to detect a 4.6-kb EcoRI-SalI restriction fragment that contains this configuration of his3 fragments. The presence of HOcs in His+ recombinants was determined by PCR (3), using primer 5'GTTGCGGAAAGCTGAAACTA3' that anneals to the HOcs and primer 5'GGATCCGCTGCACGGTCCTG3' that anneals upstream of the HIS3 promoter present on his3-Delta 3'::HOcs.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

rad9 mutants exhibit higher frequencies of chromosome loss (69), but no mitotic recombination phenotype has been described. We observed that spontaneous and DNA damage-associated translocation events were increased in rad9 mutants relative to RAD9+ strains and then addressed three questions. Is enhanced recombination dependent on RAD1 and RAD52? Is enhanced recombination correlated to deficiencies in cell cycle arrest and in DSB-induced SCE? What types of chromosomal rearrangements are found in rad9 mutants?

Recombination assays. To quantitate frequencies of either directed translocations or SCEs, we selected His+ recombinants that result from mitotic recombination between two truncated his3 fragments (16) (Fig. 2). Strains used to quantitate numbers of translocations contain the his3 fragments positioned on chromosomes II and IV (16, 17), while strains used to quantitate SCEs contain the truncated fragments of his3 in tandem at the trp1 locus. The trp1::his3-Delta 3'::HOcs fragment was used to directly target HO endonuclease-induced DSBs. Diploid strains that monitor translocations contain one set of chromosome II and IV homologs that do not contain recombinational substrates.


View larger version (51K):
[in this window]
[in a new window]
  		FIG. 2.   Electrophoretic karyotypes of spontaneous and DNA damage-associated His+ recombinants resulting from ectopic recombination of GAL1::his3-Delta 5' and trp1::his3-Delta 3'::HOcs in rad9 mutant YB134. An ethidium bromide-stained CHEF gel is shown on the left, and a Southern blot probed with 32P-labeled HIS3 is shown on the right. Arrows point to the positions of translocations, and the asterisk indicates the position of additional chromosomal polymorphisms. Lanes: A, MMS-induced reciprocal translocation; B, DNA damage-induced His+ recombinant in which CEN2::IV is mitotically unstable; C, spontaneous His+ in which CEN2::IV is unstable; D, spontaneous nonreciprocal translocation; E, reciprocal translocation; F, His- YB134 (parental configuration).

Rates of spontaneous, mitotic recombination in rad9 mutants. Isogenic haploid and diploid rad9 mutant strains were made by one-step gene replacement (48) using either the rad9::LEU2 or rad9::URA3 disruption. Rates of spontaneous His+ recombinants that contain translocations in both haploid and diploid strains increased, as measured by the method of the median (Table 2). The rate of mitotic recombination in rad9::URA3 haploid strain YB130 increased significantly (P < 0.05) to 5.4 × 10-8 from the rate of 2 × 10-8 observed in RAD9+ strain YB109. Rates of spontaneous mitotic recombination for both the rad9::URA3 homozygous diploid strain (YB134) and the rad9::LEU2 homozygous diploid strain (YB135) are four- and fivefold higher (P < 0.05) than the rates observed for the wild-type RAD9+ homozygous diploids YB110 and YB148, respectively. There are no significant differences (P > 0.5) between the rates of recombination for the RAD9+ strains YB110 and YB148 or between the rates of recombination for the rad9 mutants YB134 and YB135. The rate of mitotic recombination in the RAD9+ heterozygous diploid (YB151) is not significantly different (P > 0.5) from that in wild-type strain YB110. Thus, an enhanced rate of spontaneous recombination that generates translocations can be detected in diploid rad9 mutants.

We also determined rates of spontaneous translocations for rad1 and rad52 single mutants and rad9 rad1 and rad9 rad52 double mutants to determine whether the excision repair pathway or the recombinational repair pathway contributed to the higher recombination observed in rad9 mutants (Table 2). In comparison to the RAD9+ strains (YB110 and YB148), there is no significant decrease (P > 0.05) in rates of translocations in rad1 mutants. However, rates of translocations in the rad9 rad1 mutant (YB141) are not significantly different (P > 0.3) from the level of the RAD9+ strain (YB148). No recombinants were detected in either the rad52 mutant (YB154) or the rad9 rad52 mutant (YB145). Thus, higher rates of spontaneous translocations observed in rad9 mutants are dependent on RAD1 and RAD52.

DNA damage-associated stimulation of directed translocations in rad9 mutants. Since the DNA lesions that initiate spontaneous recombination are unknown, we investigated whether the recombinogenicity of DNA-damaging agents that produce specific DNA lesions would increase in rad9 mutants. UV, gamma  rays, and MMS, which are known to trigger cell cycle arrest at the G2-M checkpoint, stimulate the formation of directed translocations in both haploid and diploid Rad+ strains (19). Since the stimulation of translocations is greater in Rad+ diploids than in Rad+ haploids (19), the stimulation of translocations after exposure to UV, gamma  rays, or MMS was also quantitated for the diploid rad9 mutant (YB134). Compared with the RAD9+ diploid YB110 (Table 3), the greatest enhancement in the stimulation of translocations, 15-fold for X rays and 11-fold for UV, occurred after the diploid rad9 mutant was exposed to intermediate levels of radiation. Although the peak in the numbers of stimulated His+ recombinants in the rad9 mutant occurred at higher levels of radiation exposure, the lower enhancement of recombination may result from the radiation sensitivity of the rad9 mutant. The greater enhancement in the numbers of X-ray-stimulated translocations (15-fold) compared to gamma -ray stimulated translocations (7-fold) may result from the higher dose rate (440 rads/min) of ionizing radiation delivered by the X-ray source. The stimulation of translocations by the alkylating agent MMS exhibited a significant (P < 0.05) fourfold increase in the rad9 mutant. Thus, the recombinogenicity of DNA-damaging agents that create DNA base pair damage, DNA cross-links, or DNA strand breaks is enhanced in rad9 mutants.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 3.   Stimulation of translocations by DNA-damaging agents in RAD9+ and rad9::URA3 diploids

To determine whether the enhanced DNA damage-associated recombination observed in rad9 mutants is dependent on RAD1, single and double mutants were made by one-step gene replacement. Similar to the RAD9+ strain (YB148), the number of gamma -ray-stimulated His+ recombinants in the rad1 mutant (YB150) increased in a dose-dependent manner but was ~3-fold less (P < 0.05). In comparison to the rad9 mutant (YB135), the number of gamma -ray-stimulated recombinants in the rad1 rad9 double mutant (YB141) also peaked at 15.6 kilorads but was significantly reduced (P < 0.05) at all levels of radiation exposure (Table 4). The reduced number of stimulated recombinants in the rad1 rad9 double mutant at 23.4 kilorads does not result from differences in radiation sensitivity, since the sensitivity of the rad1 rad9 double mutant to ionizing radiation cannot be distinguished from the rad9 single mutant at all indicated doses (data not shown). Thus, the enhanced level of gamma -ray-stimulated translocations observed in rad9 mutants is also dependent on RAD1.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 4.   gamma -Ray stimulation of translocations in rad mutants of S. cerevisiae

The stimulation of translocations in cells treated with nocodazole before irradiation. To determine whether the increase in DNA damage-associated recombination was correlated with failure to arrest the cell cycle at the G2-M checkpoint, both RAD9+ and rad9 mutant cells were prearrested at the G2 phase with the microtubule inhibitor nocodazole before irradiation. As a control, we confirmed that the resistance to gamma  irradiation of the rad9 cells increased to wild-type levels by using this protocol (data not shown), as previously shown (67). It thus seems plausible that if the cell cycle was arrested at the G2 phase before irradiation, higher levels of DNA damage-associated translocations observed in the rad9 mutant would be reduced. Pretreatment with nocodazole without subsequent irradiation did not affect recombination frequencies (data not shown). The stimulation of His+ recombinants in the nocodazole-arrested cells after exposure to gamma  rays decreased in the rad9 mutant at least fivefold, but the level of recombination in the wild-type cells was not significantly reduced (P > 0.05). The UV stimulation of translocations decreased in both the RAD9 wild-type (YB110) and the rad9 mutant (YB134) background (Table 5) when cells were pretreated with nocodazole, although the decrease in the level of recombination was greater in the rad9 mutant (ninefold) than in the RAD9 wild-type strain (fourfold). Thus, by prearresting cells at the G2 phase, the radiation-associated stimulation of translocations is decreased in rad9 mutants.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 5.   Stimulation of translocations in rad9 mutants when cells are pretreated with nocodazole

Stimulation of translocations by HO-induced DSBs in the rad9 mutant. To determine whether the enhanced level of recombination observed in the rad9 mutant is also observed for a single directed DSB, the pGHOT-GAL3 plasmid, containing the galactose-inducible HO gene, was introduced into both diploid RAD9+ and rad9 strains. HO endonuclease digestion at trp1::his3-Delta 3'::HOcs results in a DSB in which 117 bp of the centromere proximal end and ~300 bp of the centromere distal end are homologous to the his3-Delta 5' fragment (Fig. 1). Because the number of CFU decreases after HO induction and the pGHOT plasmid is lost in 5 to 10% of the cells in nonselective growth conditions, frequencies of His+ recombinants were quantitated per Trp+ CFU before and after HO induction; His- cells that lost pGHOT-GAL3 were thus excluded from the calculations. Since the HO gene is weakly expressed under nonrepressing growth conditions, there was >5-fold increase in the recombination frequencies for the rad9 mutant and the RAD9+ strains, respectively, before galactose induction of HO. There were no significant differences (P > 0.05) in the frequencies or number of HO endonuclease-stimulated His+ recombinants between RAD9+ and rad9 mutant strains (Table 6). Thus, enhanced recombination was not observed for a single directed DSB. We speculate that the inability to detect elevated levels of translocation events results when both sister chromatids are digested at identical sites.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 6.   Stimulation of translocations and SCE by HO-induced DSBs

Nonreciprocal translocations and chromosomal polymorphisms are generated in rad9 mutants. We compared the electrophoretic karyotypes of His+ recombinants derived from the RAD9+ strain (YB110) and the rad9 mutant strain (YB134) to determine whether the same types of chromosomal rearrangements are generated in both strains (Fig. 2). We observed four classes of electrophoretic karyotypes for His+ recombinants that differ from the parental His+ karyotype (Table 7). These include (i) reciprocal translocations containing only CEN4::II and CEN2::IV, (ii) nonreciprocal translocations containing only CEN2::IV, and (iii) reciprocal or (iv) nonreciprocal translocations associated with other heterogeneous genomic rearrangements unrelated to homologous recombination between his3 sequences. Nonreciprocal translocations containing only CEN4::II could not be selected on SC-His since HIS3 is contained on CEN2::IV. Karyotypes were determined for 16 UV- and 16 gamma -ray-stimulated His+ recombinants that arose after 3 days on selective medium from the Rad+ diploid YB110, and all of 32 stimulated recombinants contain reciprocal translocations. In contrast, the majority of both spontaneous and DNA damage-associated recombinants (24 of 37) obtained from the rad9 mutant (YB134) contain nonreciprocal translocations and, less frequently, reciprocal translocations (13 of 37).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 7.   Electrophoretic karyotypes of His+ recombinants containing translocations in rad9 mutant and RAD9+ strains

A few (4 of 37) His+ recombinants obtained from the rad9 mutant YB134 also contain additional chromosomal polymorphisms (Fig. 2) in association with translocations. They include a novel chromosome VI band and chromosome polymorphisms that map between chromosomes V and VIII (Fig. 2, lanes A to C). Southern blot analysis of a CHEF gel demonstrated that these novel polymorphisms do not contain significant sequence similarity to either HIS3 (Fig. 2) or Sc4124, centromeric sequences from chromosome IV (data not shown). The recombination mechanism that generates these chromosomal polymorphisms must include an alternative mechanism other than recombination between his3 fragments. Thus, the hyperrecombinational (hyper-Rec) phenotype associated with rad9 may also be relevant to naturally occurring genomic sequences.

In two of the four His+ recombinants containing chromosomal rearrangements besides the CEN4::II and the CEN2::IV translocations, the CEN2::IV translocation which contains HIS3 was mitotically unstable. For both reciprocal and nonreciprocal translocations, the CEN2::IV translocation is lost infrequently (<1%) after 10 generations of growth on nonselective (YPD) medium, as indicated by the stability of the His+ phenotype and the appearance of the translocation on CHEF gels. In the two His+ recombinants containing additional chromosomal polymorphisms, CEN2::IV is lost frequently after 10 generations of growth on nonselective (YPD) medium, as is evident on CHEF gels (Fig. 2) and by the instability of the His+ phenotype, which ranged from 381 (His-) of 402 (total) CFU (95%) to 43 (His-) of 1,001 (total) CFU (4%). Additional chromosomal rearrangements may have occurred to decrease the mitotic stability of CEN2::IV in these recombinants.

X-ray- and HO-induced SCE are decreased in rad9 mutants. We hypothesize that the G2-M checkpoint serves to arrest the cell cycle and allows for the repair of DNA damage present on sister chromatids. If this hypothesis is correct, rad9 mutants should exhibit reduced stimulation of SCE after exposure to agents that create DSBs. To determine whether DSB-stimulated SCE differed in either rad9 mutants or RAD9+ strains, we made a novel strain (YB146) so that SCE could also be stimulated by targeted HO-induced DSBs (Fig. 1). SCE was monitored by selecting for His+ prototrophs as previously described (16). A rad9::URA3 congenic strain was made by one-step gene replacement. Rates of spontaneous SCE were 1.6 × 10-6 in a RAD9+ strain (YB146) and 1.4 × 10-6 in an isogenic rad9::URA3 (YB147) mutant.

RAD9+ and rad9 mutant strains were exposed to X rays, UV, and MMS to determine whether DNA damage-stimulated SCE was decreased in rad9 mutants. X-ray exposure of RAD9+ cells resulted in the stimulation of ~150 × 10-7 His+ recombinants resulting from SCE (Table 8), which is significantly different from the nonirradiated control (P < 0.05). X-ray exposures greater than 4.4 kilorads did not stimulate more SCE. X-ray stimulation of SCE was not observed in the rad9 mutant, and no statistically significant changes in recombination frequencies were observed (P > 0.1) (Table 8). UV and MMS stimulated SCE in either RAD9+ or rad9 strains; however, there are fewer MMS- and UV-stimulated recombinants in the rad9 mutant (P < 0.05). Thus, SCE stimulation in rad9 mutants depends on the DNA-damaging agent.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 8.   Stimulation of SCE by DNA-damaging agents in RAD9+ and rad9::URA3 mutant strains

Since UV, X rays, and MMS generate a variety of DNA lesions that may stimulate SCE, we examined the role of a site-specific DSB in stimulating SCE. After introduction of pGHOT-GAL3 into the RAD9+ and rad9 strains, the HO endonuclease was induced, and the HO-induced frequencies of His+ recombinants and the percent survival after HO induction were determined (Table 6). Survival decreased from 91% in the RAD9+ strain to 77% in the rad9 mutant per number of cells containing pGHOT-GAL3. Whereas there was a 10-fold increase in the frequency of recombination after HO induction in RAD9+ cells, there was no significant increase (P > 0.1) in recombination after HO induction in the rad9 mutant. To verify that HO endonuclease was active in the rad9 mutant, the efficiency of HO-induced mating-type switching was determined for both the rad9 mutant (YB147) and the RAD9+ strains. For both strains, ~50% of the cells that survived HO induction had also switched mating type.

HO-induced DSBs could theoretically stimulate both intrachromatid recombination and SCE. Unequal SCE was confirmed by Southern blot analysis as previously described (16). Since no replication origin is present in HIS3, there is a low probability that His+ recombinants can result from intrachromatid recombination generating an extrachromosomal HIS3 and reintegration of HIS3. Southern blot analysis demonstrated that seven of nine HO-induced His+ recombinants from the RAD9+ strain (YB148) resulted from SCE (16). Multiple rounds of unequal SCE might have occurred to generate the other two His+ recombinants, as suggested by the presence of larger restriction fragments that contain his3 fragments (data not shown). Among HO-induced His+ recombinants from the rad9 mutant, six of eight resulted from unequal SCE and two His+ recombinants may have resulted from multiple rounds of exchange. PCR analysis revealed that among HO-induced recombinants, one of nine His+ recombinants from the RAD9+ strain and four of eight His+ recombinants from the rad9 mutant still contained an HOcs at his3-Delta 3', whereas 10 of 10 spontaneous His+ recombinants from the rad9 mutant contain the HOcs at his3-Delta 3'. Thus, DSB-induced SCE occurred in both RAD9+ and rad9 mutant strains but was less frequent in the rad9 mutant.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The rad9 mutant of S. cerevisiae exhibits pleiotropic phenotypes, including radiation sensitivity and higher frequencies of chromosome loss, that are attributed to lack of cell cycle arrest at the G2-M cell cycle checkpoint (67, 69, 70). In this study, the genetic instability phenotype of rad9 was extended to include the following two novel recombination phenotypes: (i) a significant increase in both the spontaneous and DNA damage-associated frequencies of directed translocations and (ii) a decrease in the DSB-induced frequencies of SCE. Three major conclusions can be inferred from experiments to characterize these novel phenotypes. First, the higher level of recombination induced by the DNA-damaging agents in the rad9 mutant results from failure to arrest the cell cycle at the G2-M checkpoint. Second, recombinational pathways in rad9 mutants that generate higher levels of translocation events involve both RAD1 and RAD52. Third, the rad9-enhanced recombination is not limited to recombination between his3 sequences.

These conclusions were based on quantitating directed translocation events in diploid strains. Although elevated rates of spontaneous translocations were also observed for a haploid rad9 mutant, in comparison to RAD9+ strains, there is more stimulation for diploid rad9 mutants. Higher levels of translocation events in rad9 diploids may be ascribed to higher frequencies of chromosome loss exhibited by rad9 mutants, which might reduce the number of viable recombinants in haploid cells (69).

Two possible explanations for the rad9 recombination phenotypes are (i) failure to arrest the cell cycle at the G2-M checkpoint and (ii) one or more errors in DNA metabolism or DNA damage-induced gene expression in rad9 mutants. The first explanation implies that recombination phenotypes result from failure to repair recombinogenic lesions prior to the segregation of sister chromatids; specific timing of gene conversion in G1 and crossovers in G2 has been previously suggested (15, 23, 47). The second explanation implies that recombination is stimulated by more recombinogenic lesions or by a bias in processing of recombination intermediates toward reciprocal exchange. Pleiotropic phenotypes of rad9 mutants include a deficiency in the DNA damage inducibility of genes such as RAD51 (1), which is involved in DSB repair and gene conversion (45), and the accumulation of single-strand DNA gaps resulting from expression of the putative Rad17 nuclease (36).

Deficient cell cycle arrest at G2 leads to more translocation events in rad9 mutants. Our results support the hypothesis that higher numbers of DNA damage-associated translocations result from altered timing of recombinational repair and that the RAD9-dependent checkpoint is triggered by DNA damage (67). First, there is a twofold-greater difference between rad9 and RAD9+ strains when numbers of radiation-induced translocations are compared than when rates of spontaneous translocations are compared. Second, the elevated DNA damage-associated recombination in rad9 mutants can be suppressed when cells are temporarily arrested in G2-M phase by a microtubule inhibitor prior to irradiation. This implies that the G2 checkpoint serves to channel DNA damage into either a nonrecombinogenic repair pathway or a recombination pathway that does not generate translocations. Since prearresting cells with nocodazole does not completely suppress the UV sensitivity of rad9 mutants (1), the inability to completely suppress the rad9 hyper-Rec phenotype by nocodazole may be correlated with other rad9 phenotypes, such as the increased activity of the putative 3'-5' Rad17 nuclease (36). Thus, deficient cell cycle arrest at the G2 checkpoint is likely to be one of several factors that increase translocation events.

Since the major yeast DSB repair pathway is homologous recombination (46, 64) and one DSB is sufficient to arrest cells at G2 (8, 50), G2-M arrest likely facilitates DSB repair by SCE (Fig. 3). It is therefore logical that both X-ray- and HO endonuclease-induced SCE were significantly decreased in rad9 mutants that cannot arrest at the G2-M checkpoint. Although there is a correlation between defective recombinational repair of DSBs by SCE and elevated numbers of X-ray-induced translocations, further studies will be necessary to demonstrate cause and effect.


View larger version (30K):
[in this window]
[in a new window]
  		FIG. 3.   Diagram of the generation of chromosomal rearrangements in rad9 mutants. Large circles represent the mother cell, and large ovals emerging from the mother cell represent the daughter bud. The nucleus is not shown. For simplicity, only one set of chromosome II and IV homologs is shown. Small ovals represent centromeres as designated in Fig. 2. Heavy lines represent chromosome IV, and light lines represent chromosome II. Recombinogenic lesions, such as DSBs, are either generated spontaneously or created by DNA-damaging agents. (Left) in RAD9+ strains, DSBs arrest cells in G2 and trigger SCE, resulting in the repair of the DSB. (Right) In rad9 mutants, no cell cycle arrest occurs, and centric and acentric chromosomal fragments are inherited in daughter cells after segregation. Recombination between nonhomologs then generates translocations CEN2::IV and CEN4::II.

The observation that the frequencies of HO endonuclease-induced translocations were the same in RAD9+ and rad9 diploid mutants is consistent with the idea that sister chromatids are preferred substrates for recombinogenic repair of DSBs. DNA damage caused by environmental agents differs from that caused by site-specific endonucleases in that environmental agents, such as ionizing radiation, would likely create DSBs at nonidentical loci on sister chromatids. Thus, an undamaged sister chromatid may serve as a template for recombinational repair of radiation-induced DNA damage. Since the HOcs would be at identical loci on sister chromatids, we speculate that HO endonuclease could cleave both sister chromatids at the same location. Repair of both HO endonuclease-generated DSBs at unique sequences cannot occur by homologous recombination between sister chromatids if there are two identically cleaved chromatids. We suggest that the frequency of HO-induced translocations could not be increased in rad9 mutants because SCE may not contribute to recombinational repair of the targeted DSB in the RAD9+ strain.

Our results indicate that the correlation between increased numbers of DNA damage-induced translocations and decreased numbers of DNA damage-induced SCE in rad9 mutants depends on the DNA-damaging agent; environmental agents that create DNA DSBs demonstrated the best correlation. RAD9-independent SCE may result from (i) DNA lesions that trigger cell cycle arrest at other checkpoints and (ii) recombinational pathways that generate SCE but not translocations. For example, MMS and UV stimulation of SCE may result from DNA lesions that arrest the cell cycle at the S-phase checkpoint (28), which is attenuated but not absent in the rad9 mutant (43). Since UV can stimulate RAD1-independent SCE (28), whereas the rad9 hyper-Rec phenotype is RAD1 dependent, there are differences between the UV-induced recombinational pathway(s) that generate SCE and those that generate higher levels of translocations. Thus, although the defective G2 checkpoint may result in more translocations, some DNA-damaging agents may create lesions that can be repaired by SCE at other cell cycle checkpoints.

Elevated numbers of translocations in rad9 mutants are generated by a RAD1-dependent recombination pathway. Our results indicate that with respect to the rad9 hyper-Rec phenotype, RAD1 is epistatic to RAD9. Rad1, as part of the Rad1-Rad10 endonuclease that participates in UV excision repair (6), has been suggested to play two different roles in the formation of recombinogenic substrates: first, it processes DNA lesions into DSBs that can initiate mitotic recombination (39), and second, it cleaves nonhomologous DNA from recombinogenic DSBs to form stable recombination intermediates (20). RAD1-dependent hyper-Rec phenotypes are found for other mutants, including top3 (5), pms1 (4), and rem (39) mutants that are defective in Topo3, mismatch repair, and the Rad3 helicase, respectively. Both top3 and pms1 mutants exhibit enhanced ectopic recombination between the homologous SAM1 and SAM2 genes (4, 5). Thus, gene(s) involved in the excision repair pathway contribute to genomic instability observed in both DNA repair and cell cycle checkpoint mutants.

Chromosomal polymorphisms occur in rad9 mutants. Chromosomal rearrangements generated in the rad9 mutant indicate that genetic instability is not limited to directed translocations. It is unknown whether recombinants containing nonreciprocal translocations first contained reciprocal translocations and lost CEN4::II or whether the nonreciprocal translocations were generated in the absence of the reciprocal product. The unusual chromosomal polymorphisms present in rad9 mutants are secondary changes that likely occurred by recombination between dispersed repetitive sequences (22), as has been suggested for naturally occurring chromosome III polymorphisms (72).

Since chromosomal fragments may be passed on from mother cell to daughter cell in rad9 mutants, it is intriguing to imagine that some nonreciprocal translocations result from recombination of chromosomal fragments that are inherited in subsequent generations but remain recombinogenic. Recombination mechanisms that generate nonreciprocal translocations may be similar to those that generate longer yeast artificial chromosomes. Vollrath et al. (66) observed that in vivo recombination between the free end of a yeast artificial chromosome and the corresponding homologous genomic sequences results in larger artificial linear chromosomes that include DNA sequences from the homologous genomic sequence to the telomere. Similar mechanisms may account for the generation of the DSB-initiated nonreciprocal translocations (Fig. 3).

Our results may seem to contradict observations that mitotic rates of spontaneous, allelic recombination (68) and intrachromosomal recombination between direct repeats (53) are unchanged in rad9 mutants. After careful examination of previous studies, we offer the following explanations. First, the rate of spontaneous translocations in rad9 mutants is approximately 10- or 1,000-fold less than the rates of spontaneous allelic or intrachromatid events (ICE) in RAD9+, respectively, and thus if the same number of recombinants are stimulated in these assays, enhanced allelic events or ICE may be too few to detect among background events. Second, ICE and allelic recombination assays detect recombination events that are not associated with exchange of flanking markers and occur predominately by deletion (21, 52) and gene conversion (23), respectively, whereas translocations occur by recombination associated with exchange of flanking markers. Because mitotic gene conversion and reciprocal exchange can occur by independent pathways (29) and mutants may be hyper-Rec for one pathway but not the other (2), it may not be surprising that mutations in checkpoint genes may elevate particular types of mitotic recombination.

In summary, the phenotype of rad9 mutants includes higher mitotic levels of spontaneous and DNA damage-associated translocations. This is the first hyper-Rec phenotype assigned to the rad9 mutant. Although several factors may contribute to this phenotype, one factor is failure to channel repair of DSBs into SCE. Since additional cell cycle checkpoints have been identified in yeast (71), it will be interesting to determine whether other checkpoint mutants have similar recombination phenotypes.

    ACKNOWLEDGMENTS

We especially thank B. Kalemba for excellent secretarial support and P. Dave for technical support when the project was initiated. We thank S. Honigberg, R. Bauchwitz, B. Wilcox, R. Barrington, H. Lieberman, and A. Driks for useful discussions. We thank L. Prakash, D. Schild, and T. Weinert for plasmids used to make rad1, rad52, and rad9 disruptions, respectively.

This work was supported by Public Health Service grant CA70105 from the National Cancer Institute and a grant from the Leukemia Research Foundation.

    FOOTNOTES

* Corresponding author. Present address: Department of Biochemistry and Molecular Biology, The Albany Medical College, 47 New Scotland Ave., Albany, NY 12208-3479. Phone: (518) 262-6651. Fax: (518) 262-5689. E-mail: mfasullo{at}ccgateway.amc.edu.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Aboussekhra, A., J. E. Vialard, D. Morrison, M. A. Torr-Ruiz, L. Cernakova, F. Fabre, and N. F. Lowndes. 1996. A novel role for the budding yeast RAD9 checkpoint gene in DNA damage-dependent transcription. EMBO J. 15:3912-3933[Medline].
2. Aguilera, A., and H. L. Klein. 1988. Genetic control of intrachromosomal recombination in Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutants. Genetics 119:779-790[Abstract/Free Full Text].
3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. . Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
4. Bailis, A. M., and R. Rothstein. 1990. A defect in mismatch repair in Saccharomyces cerevisiae stimulates ectopic recombination between homologous genes by an excision repair process. Genetics 126:535-547[Abstract].
5. Bailis, A. M., L. Arthur, and R. Rothstein. 1992. Genome rearrangement in top3 mutants of Saccharomyces cerevisiae requires a functional RAD1 excision repair gene. Mol. Cell. Biol. 12:4988-4993[Abstract/Free Full Text].
6. Bardwell, A. J., L. Bardwell, A. E. Tomkinson, and E. C. Friedberg. 1994. Specific cleavage of model recombination and repair intermediates by the yeast Rad1/Rad10 endonuclease. Science 265:2082-2085[Abstract/Free Full Text].
7. Beamish, M., and M. F. Levin. 1994. Radiosensitivity in ataxia telangiectasia: anomalies in radiation-induction cell cycle delay. Int. J. Radiat. Biol. 65:175-184[Medline].
8. Bennett, C. B., A. L. Lewis, K. K. Baldwin, and M. A. Resnick. 1993. Lethality induced by a single site-specific double-strand break in a dispensable yeast plasmid. Proc. Natl. Acad. Sci. USA 90:5613-5617[Abstract/Free Full Text].
9. Boeke, J. D., F. Lacroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidene-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-347[Medline].
10. Brunborg, G., M. Resnick, and D. H. Williamson. 1980. Cell-cycle-specific repair of DNA DSBs in Saccharomyces cerevisiae. Radiat. Res. 82:547-558[Medline].
11. Brunborg, G., and D. H. Williamson. 1978. The relevance of the nuclear division cycle to radiosensitivity in yeast. Mol. Gen. Genet. 162:277-286[Medline].
12. Chen, D., B. Yang, and T. Kuo. 1992. One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].
13. Chu, G. D., D. Vollrath, and R. W. Davis. 1986. Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science 234:1582-1585[Abstract/Free Full Text].
14. Esposito, M. S., D. T. Maleas, K. A. Bjornstad, and C. V. Bruschi. 1982. Simultaneous detection of changes in chromosome number, gene conversion and intergenic recombination during mitosis of Saccharomyces cerevisiae: spontaneous and ultraviolet light induced events. Curr. Genet. 6:5-11.
15. Fabre, F., A. Boulet, and H. Roman. 1984. Gene conversion at different points in the mitotic cycle of Saccharomyces cerevisiae. Mol. Gen. Genet. 195:139-143[Medline].
16. Fasullo, M. T., and R. W. Davis. 1987. Recombinational substrates designed to study recombination between unique and repetitive sequences in vivo. Proc. Natl. Acad. Sci. USA 84:6215-6219[Abstract/Free Full Text].
17. Fasullo, M. T., and R. W. Davis. 1988. Direction of chromosomal rearrangements in the yeast Saccharomyces cerevisiae by use of his3 recombinational substrates. Mol. Cell. Biol. 8:4370-4380[Abstract/Free Full Text].
18. Fasullo, M. T., P. Dave, and R. Rothstein. 1994. DNA-damaging agents stimulate the formation of directed reciprocal translocations in Saccharomyces cerevisiae. Mutat. Res. 314:121-133[Medline].
19. Fasullo, M. T., and P. Dave. 1994. Mating type regulates the radiation-associated stimulation of reciprocal translocation events in Saccharomyces cerevisiae. Mol. Gen. Genet. 243:63-70[Medline].
20. Fishman-Lobell, J., N. Rudin, and J. E. Haber. 1992. Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1. Science 258:480-484[Abstract/Free Full Text].
21. Galli, A., and R. Schiestl. 1995. On the mechanism of UV and gamma-ray induced intrachromosomal recombination in yeast cells synchronized in different stages of the cell cycle. Mol. Gen. Genet. 248:301-310[Medline].
22. Goffeau, A., B. G. Barrell, H. Bussey, R. W. Davis, B. Dujon, J. Feldmann, F. Galibert, J. D. Hoheisel, C. Jacq, M. Johnston, E. J. Louis, H. W. Mewes, Y. Murakami, P. Philippsen, H. Tettelin, and S. G. Oliver. 1996. Life with 6000 genes. Science 274:546-567[Abstract/Free Full Text].
23. Golin, J. E., and M. S. Esposito. 1981. Mitotic recombination: mismatch correction and replicational resolution for Holliday structures formed at the two-strand stage in Saccharomyces cerevisiae. Mol. Gen. Genet. 183:252-253[Medline].
24. Higgins, D. R., S. Prakash, P. Reynolds, and L. Prakash. 1983. Molecular cloning and characterization of the RAD1 gene of Saccharomyces cerevisiae. Gene 26:119-126[Medline].
25. Jacobs, C., A. Adams, P. Szanszlo, and J. Pringle. 1988. Functions of microtubules in the Saccharomyces cerevisiae cell cycle. J. Cell Biol. 107:1409-1426[Abstract/Free Full Text].
26. Jensen, R., and I. Herskowitz. 1984. Directionality and regulation of cassette substitution in yeast. Cold Spring Harbor Symp. Quant. Biol. 49:13-21[Medline].
27. Kadyk, L. C., and L. H. Hartwell. 1992. Sister chromatids are preferred over homologs as substrates for recombinational repair in Saccharomyces cerevisiae. Genetics 132:387-402[Abstract].
28. Kadyk, L. C., and L. H. Hartwell. 1993. Replication dependent sister chromatid recombination in rad1 mutants of Saccharomyces cerevisiae. Genetics 133:469-487[Abstract].
29. Klein, H. L. 1984. Lack of association of intrachromosomal gene conversion and reciprocal exchange. Nature 310:748-753[Medline].
30. Kostriken, R., and F. Heffron. 1984. The product of the HO gene is a nuclease: purification and characterization of the enzyme. Cold Spring Harbor Symp. Quant. Biol. 49:89-104[Medline].
31. Kupiec, M., and G. Simchen. 1985. Arrest of the mitotic cell cycle and of meiosis in Saccharomyces cerevisiae by MMS. Mol. Gen. Genet. 201:558-564.
32. Lawrence, C. W., and R. Christiansen. 1976. UV mutagenesis in radiation sensitive strains of yeast. Genetics 82:207-232[Abstract/Free Full Text].
33. Lea, D. E., and C. A. Coulson. 1949. The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-284.
34. Lesser, C., and C. Guthrie. 1993. Mutational analysis of pre-mRNA splicing in Saccharomyces cerevisiae using a sensitive new reporter gene, CUP1. Genetics 133:851-863[Abstract].
35. Livingston, K. R., A. White, J. Sprouse, E. Livanos, T. Jacks, and T. Tisty. 1992. Altered cell cycle arrest and gene amplification potential accompany loss of wild-type p53. Cell 70:923-935[Medline].
36. Lydall, D., and T. Weinert. 1995. Yeast checkpoint genes in DNA damage processing: implications for repair and arrest. Science 270:1488-1491[Abstract/Free Full Text].
37. Metcalfe, J. A., A. Heppell-Parton, C. M. McConville, and A. M. Taylor. 1991. Characterization of a B-lymphocyte t(2;14) (p11;q32) translocation from an ataxia telangiectasia patient conferring a proliferative advantage on cells in vitro. Cytogenet. Cell Genet. 56:91-98[Medline].
38. Meyn, M. S. High spontaneous intrachromosomal recombination rates in ataxia-telangiectasia. Science 260:1327-1330.
39. Montelone, B. A., M. F. Hoekstra, and R. E. Malone. 1988. Spontaneous mitotic recombination in yeast: the hyper-recombinational rem1 mutations are alleles of the RAD3 gene. Genetics 119:289-301[Abstract/Free Full Text].
40. Nickoloff, J. A., E. Y. Chen, and F. Heffron. 1986. A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast. Proc. Natl. Acad. Sci. USA 83:7831-7835[Abstract/Free Full Text].
41. Pandita, T. K., S. Pathak, and C. R. Geard. 1995. Chromosome end associations, telomeres, and telomerase activity in ataxia telangiectasia. Cytogenet. Cell Genet. 71:86-93[Medline].
42. Parket, A., O. Inbar, and M. Kupiec. 1995. Recombination of Ty elements in yeast can be induced by a double-strand break. Genetics 140:67-77[Abstract].
43. Paulovich, A. G., R. U. Margulies, B. M. Garvick, and L. H. Hartwell. 1997. RAD9, RAD17, and RAD24 are required for S phase regulation in Saccharomyces cerevisiae in response to DNA damage. Genetics 145:45-62[Abstract].
44. Paulovich, A. G., C. D. Armour, and L. H. Hartwell. 1997. Unpublished data.
45. Rattray, A. J., and L. S. Symington. 1995. Multiple pathways for homologous recombination in Saccharomyces cerevisiae. Genetics 139:45-56[Abstract].
46. Resnick, M. A., and P. Martin. 1976. The repair of DSBs in the nuclear DNA of Saccharomyces cerevisiae and its nuclear control. Mol. Gen. Genet. 143:119-129[Medline].
47. Roman, H., and F. Fabre. 1983. Gene conversion and associated reciprocal recombination are separable events in vegetative cells of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 80:6912-6916[Abstract/Free Full Text].
48. Rothstein, R. J. 1983. One-step gene disruption in yeast. Methods Enzymol. 101:202-211[Medline].
49. Rudolph, N. S., and S. A. Latt. 1989. Flow cytometric analysis of X-ray sensitivity in ataxia telangiectasia. Mutat. Res. 211:31-41[Medline].
50. Sandell, L., and V. Zakian. 1993. Loss of a yeast telomere: arrest, recovery and chromosome loss. Cell 75:729-739[Medline].
51. Scherer, S., and R. W. Davis. 1979. Replacement of chromosome segments with altered DNA sequences in vitro. Proc. Natl. Acad. Sci. USA 76:491-495[Abstract/Free Full Text].
52. Schiestl, R. H., and S. Prakash. 1988. RAD1, an excision repair gene of Saccharomyces cerevisiae, is also involved in recombination. Mol. Cell. Biol. 8:3619-3626[Abstract/Free Full Text].
53. Schiestl, R. H., P. Reynolds, S. Prakash, and L. Prakash. 1989. Cloning and sequence analysis of the Saccharomyces cerevisiae RAD9 gene and further evidence that its product is required for cell cycle arrest induced by DNA damage. Mol. Cell. Biol. 9:1882-1896[Abstract/Free Full Text].
54. Schiestl, R. H. 1989. Nonmutagenic carcinogens induce intrachromosomal recombination in yeast. Nature 337:285-288[Medline].
55. Schild, D., I. L. Calderon, R. Contopoulou, and R. K. Mortimer. 1983. Cloning of yeast recombination repair genes and evidence that several are non-essential genes, p. 417-427. In E. C. Friedberg, and B. A. Bridges (ed.), Cellular responses to DNA damage. Alan R. Liss Inc., New York, N.Y.
56. Schwartz, D., and C. Cantor. 1984. Separation of yeast chromosome-sized DNAs by pulse field gradient gel electrophoresis. Cell 37:67-75[Medline].
57. Sherman, F., G. R. Fink, and J. B. Hicks. 1982. . Methods of yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
58. Siede, W., A. S. Friedberg, and E. C. Friedberg. 1993. RAD9-dependent G1 arrest defines a second checkpoint for damaged DNA in the cell cycle of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 90:7985-7989[Abstract/Free Full Text].
59. Siede, W., A. S. Friedberg, I. Dianova, and E. C. Friedberg. 1994. Characterization of G1 checkpoint control in the yeast Saccharomyces cerevisiae following exposure to DNA-damaging agents. Genetics 138:271-281[Abstract].
60. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517[Medline].
61. Stinchcomb, S., C. Mann, and R. W. Davis. 1982. Centromeric DNA from Saccharomyces cerevisiae. J. Mol. Biol. 158:157-179[Medline].
62. Struhl, K., and R. W. Davis. 1980. A physical, genetic, and transcriptional map of the cloned his3 gene region of Saccharomyces cerevisiae. J. Mol. Biol. 136:309-332[Medline].
63. Struhl, K. 1985. Nucleotide sequence and transcriptional mapping of the yeast PET56-HIS3-DED1 gene region. Nucleic Acids Res. 13:8585-8601.
64. Szostak, J. W., T. L. Orr-Weaver, R. Rothstein, and F. W. Stahl. 1983. The double-strand break model for recombination. Cell 33:25-35[Medline].
65. Torchia, E., and J. E. Hopper. 1986. Genetic and molecular analysis of the GAL3 gene in the expression of the galactose/melibiose regulon of Saccharomyces cerevisiae. Genetics 113:229-246[Abstract/Free Full Text].
66. Vollrath, D., R. W. Davis, C. Connelly, and P. H. Hieter. 1988. Physical mapping of large DNA by chromosome fragmentation. Proc. Natl. Acad. Sci. USA 85:6027-6031[Abstract/Free Full Text].
67. Weinert, T., and L. H. Hartwell. 1988. The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae. Science 241:317-322[Abstract/Free Full Text].
68. Weinert, T., and D. Lydall. 1993. Cell cycle checkpoints, genetic instability and cancer. Semin. Cancer Biol. 4:129-140[Medline].
69. Weinert, T. A., and L. H. Hartwell. 1990. Characterization of the RAD9 gene of Saccharomyces cerevisiae and evidence that it acts posttranslationally in cell cycle arrest after DNA damage. Mol. Cell. Biol. 10:6554-6564[Abstract/Free Full Text].