Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1284-1295, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The C Terminus of the Major Yeast Telomere Binding
Protein Rap1p Enhances Telomere Formation
Alo
Ray and
Kurt W.
Runge*
Department of Molecular Biology, Lerner
Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio
44195
Received 29 August 1997/Returned for modification 21 October
1997/Accepted 18 December 1997
 |
ABSTRACT |
The telomeres of most organisms consist of short repeated sequences
that can be elongated by telomerase, a reverse transcriptase complex
that contains its own RNA template for the synthesis of telomere
repeats. In Saccharomyces cerevisiae, the RAP1
gene encodes the major telomere binding protein Rap1p. Here we use a
quantitative telomere formation assay to demonstrate that Rap1p C
termini can enhance telomere formation more than 30-fold when they are
located at internal sites. This stimulation is distinct from protection from degradation. Enhancement of formation required the gene for telomerase RNA but not Sir1p, Sir2p, Sir3p, Sir4p, Tel1p, or the Rif1p
binding site in the Rap1p C terminus. Our data suggest that Rap1p C
termini enhance telomere formation by attracting or increasing the
activity of telomerase near telomeres. Earlier work suggests that Rap1p
molecules at the chromosome terminus inhibit the elongation of long
telomeres by blocking the access of telomerase. Our results suggest a
model where a balance between internal Rap1p increasing telomerase
activity and Rap1p at the termini of long telomeres controlling
telomerase access maintains telomeres at a constant length.
 |
INTRODUCTION |
Telomeres are the nucleoprotein
complexes that protect chromosome ends from degradation and allow their
complete replication. In most organisms, telomere DNA consists of an
array of short TG-rich repeats. Saccharomyces cerevisiae
telomeres consist of a 250- to 400-bp array of the heterogeneous repeat
TG1-3 (58). Work from several laboratories has
shown that these repeats are all that is required for yeast telomere
function in mitosis and meiosis (6, 39, 45, 55). The number
of these TG1-3 repeats, or telomere length, can be reduced
by removal of the RNA primer for DNA synthesis or by degradation of the
C1-3A strand at the end of S phase. The TG1-3
repeats can be elongated by the action of telomerase, a reverse
transcriptase that contains an internal RNA template from which it
synthesizes new TG1-3 repeats (59). Each yeast
telomere contains numerous binding sites within the TG1-3
repeats for the RAP1 protein (Rap1p) (5, 53).
Rap1p is required for yeast viability and functions both as a
transcriptional activator of many yeast ribosomal protein and
glycolytic genes and as an important component of the transcriptional
silencing machinery at the yeast silent mating type cassettes and at
telomeres (46).
Rap1p can be divided into two domains, a large DNA binding domain
(amino acids 361 to 596 [14]) and a large C-terminal
domain (amino acids 600 to 827), which contains multiple subdomains
involved in transcriptional activation, transcriptional silencing, and telomere length control (4, 11, 18, 32, 50) (see Fig. 1).
The Rap1p C terminus binds directly to at least three other proteins:
Sir3p, Rif1p, and Rif2p (12, 36, 57). The interaction with
Sir3p is important for the formation of a heterochromatin complex,
consisting of Sir2p, Sir3p, Sir4p, and Rap1p, that spreads into
internal regions of the chromosome to silence the transcription of
nearby genes, a phenomenon known as telomere position effect, or TPE
(1, 13, 33, 43, 49). Elimination of SIR2,
SIR3, or SIR4 function eliminates TPE
(1) and the association of Sir proteins with telomeric
heterochromatin (13, 49).
The Rap1p C terminus also plays an important role in telomere length
regulation. To date, the majority of studies have examined the effects
of mutations in the Rap1p C terminus on the steady-state length of
existing telomeres. Overproduction of the Rap1p C-terminal domain in
vivo causes chromosomal telomeres to lengthen (4, 11, 44,
56), presumably because Rap1p interacting factors are titrated
away from telomeres. Point mutations and deletion mutations in the
Rap1p C terminus also cause lengthening of existing chromosomal
telomeres (18, 19, 27, 50). Recent work with synthetic
telomeres indicates that yeast cells measure telomere length by
counting Rap1p C termini, because tethering Rap1p C termini adjacent to
the terminal TG1-3 tract causes cells to maintain the
terminal tract at a shorter equilibrium length (35).
Experiments with the Rap1p homolog of Kluyveromyces lactis
indicate that the C termini of Rap1p molecules bound to the very ends
of the chromosome interact with proteins that inhibit telomere
elongation, presumably by inhibiting the access of telomerase to the
chromosome terminus (17). These data have led to the
hypothesis that the Rap1p C terminus inhibits lengthening of
established telomeres (9).
The role of Rap1p in telomere formation, the de novo addition of
TG1-3 repeats onto DNA ends, has received less attention. Telomeres can be efficiently formed on linear plasmids and chromosomes in vivo when the DNA ends are capped by telomeric repeats (6, 31,
32, 41, 47, 53, 58). Previous work using TG1-3 sequences that do or do not contain Rap1p sites has suggested that
Rap1p binding can increase the frequency of telomere formation on
linear plasmids (32). However, since these Rap1p sites were at the ends of the TG1-3 repeats, these data could not
distinguish between bound Rap1p protecting the TG1-3
sequences from exonucleolytic degradation and Rap1p actively
stimulating telomere formation. Experiments with temperature-sensitive
rap1 mutants grown at the highest temperature where growth
is possible, where Rap1p function should be limiting, found that
telomeres gradually shorten as cells grow. As with the linear-plasmid
experiments, these results could not distinguish between Rap1p
protecting the ends from degradation and Rap1p enhancing telomere
lengthening (4, 32). Therefore, while the role of the Rap1p
C terminus in limiting the elongation of existing telomeres is
established, the exact role of Rap1p in telomere formation and
elongation is not clear.
Here we demonstrate that the Rap1p C terminus can promote telomere
formation by a mechanism that is distinct from protection from
degradation. We constructed synthetic telomeres containing three
different very short substrates for telomere formation (telomere seeds). Using a quantitative transformation assay, we found that internally tethered Rap1p molecules or a subset of Gal4p-Rap1p C-terminal fusions could greatly stimulate telomere formation independently of the telomere seed sequence. This enhancement of
telomere formation requires most of the Rap1p C terminus, amino acids
630 to 827. This enhancement is dependent upon telomerase and is
unaffected by mutations that alter the chromatin structure of
steady-state telomeres. These data suggest a model in which internally
located Rap1p C termini stimulate telomere formation and the elongation
of short telomeres by increasing the activity of or attracting
telomerase. At long telomeres, Rap1p and other molecules at the
chromosome end block telomerase access, so that these two Rap1p
functions form a system for maintaining telomeres at constant length.
 |
MATERIALS AND METHODS |
Strains.
Recombinant DNA manipulations were carried out in
bacterial strains MC1066 (r
m+ pyrF::Tn5 trpC leuB) and JF1754
(r
m+ leuB hisB
Met
). Yeast strains used were KR36-6L [MATa
ade2-(1 or 101) ade8-18 ura3-52 trp1
1 leu2-
RC
his3
] (44), the gal4
strain YM708
(MAT
ade2-101 ura3-52 trp1
-901 his3-200 lys2-801 LEU2 canR gal4-542) (from Mark Johnston), and
VPS106est1
::hisG (MATa ade2 ade3 ura3
trp1
leu2-3,112 lys2-801 can1 est1
::hisG) (from V. Schulz and K. Runge). The tel1
(YDM911) and
TEL1 (YDM884) congenic strains were from Dwight Morrow and
have been described elsewhere (37).
Plasmids.
The PvuII fragment of pADHUCAIV
containing the ADH4-URA3-TG1-3 sequences (6) was
ligated to the 3.3-kb EcoRV-SmaI fragment of YIp5
to form YIpADH. The TG1-3 repeats were removed from
YIpADH by digestion with BamHI and NotI and
were replaced with the oligonucleotide pair 35 (Table
1) to generate YIpADH-35. At high
Rap1p concentrations in vitro, both Rap1p sites in this fragment can be
bound simultaneously (15a). The single BamHI site
between URA3 and the TG1-3 repeats was the site
of insertion of six 35-bp TEF oligonucleotides (Table 1) in
head-to-tail orientation, where the resulting BamHI site was
closest to the NotI site, to form YIpADHTEF-35. A
plasmid with the six TEF oligonucleotides in the opposite orientation was also constructed. Construction of the head-to-tail repeats will be
detailed elsewhere (42a). Four GAL4 binding sites were also inserted by using four head-to-tail concatemers of the 22-bp GAL
oligonucleotides (Table 1) to form YIpADHGAL-35. A
210-bp fragment of
DNA was generated by using the PCR primers
GGCCAGATCTAAAACAGGCTGAGCACGG and
GGCCGGATCCGTTTCTGCGGGAAAGTGT to amplify bp 10101 to 10310 of
lambda phage DNA, cleaving the product with BglII and
BamHI, and cloning it into the BamHI site of
YIpADH-35 to form YIpADH
. The 275 bp of TG1-3
was isolated from pCT300 (275 bp of TG1-3 in pVZ-1, from K. Runge, R. Wellinger, J. Wright, and V. Zakian; the same sequence as Tel
270 [5]) by cleavage with HincII and SmaI and was cloned into the filled-in BamHI site
of YIpADH-35 to yield YIpADH275. The 5-bp difference in length
came about because we counted the 5 bp of TG sequences from the
polylinker that are continuous with the telomeric sequence, while
Gilson et al. (5) did not. The orientation of the 275 bp of
TG1-3 repeats was the same as that of the telomere.
Digestion of all of these YIpADH plasmids with SalI and
NotI releases a
SalI-ADH4-URA3-insert-TG1-3-NotI fragment which can replace the left telomere of chromosome VII (VIIL).
To form the YIpADH-GT and YIpADH-G2T versions of
YIpADH-35, YIpADHTEF-35, and YIpADHGAL-35, each
of the latter three plasmids was cleaved with BamHI and
NotI, and the GT and G2T oligonucleotides (Table
1) were ligated to these vectors. The correct transformants were
identified by incorporation of the XhoI site. The
sequences of all of these synthetic telomeres were verified by
DNA sequencing. The
leu2::URA3-insert-TG1-3
constructions were made by cutting YIpADH-35,
YIpADHTEF-35, and YIpADHGAL-35 with
HindIII and NotI, filling in the ends with
the Klenow fragment of Escherichia coli DNA polymerase I,
and cloning the URA3 fragment into the EcoRV site
of LEU2 in pLEU2-0.9 (which contains the 0.9-kb
EcoRI-SalI fragment of LEU2 in the
same sites of pBR322). The yeast artificial chromosomes (YACs) were
constructed by using YAC-ATA (from K. Runge and R. Wellinger; to be
described elsewhere [43a]) and replacing one of two
275-bp telomeres with the SalI-NotI fragment from
YIpADH-35 and YIpADHTEF-35. The 275-bp TG1-3
telomere and the test telomere are separated by 1.8 kb of
HIS3 DNA for propagation in bacteria. The Gal4p-Rap1p
fusions are expressed from the ADC1 promoter on a multicopy
(2µm) HIS3 plasmid. The 653-800 and 653-817 fusions were
constructed by introducing a stop codon followed by an XbaI
site by PCR, cloning the fragments into the original vector, and
verifying the products by sequencing. The remaining fusions were
provided by D. Shore (11). The
tlc1
::HIS3 allele replaces all of the
TLC1 transcript (nucleotides 1 to 1306) with the
HIS3 gene from pRS313 by the method of Morrow et al.
(37), and the est1
::hisG allele
replaces the internal EcoRI-to-NsiI fragment of
the EST1 coding region with a 0.9-kb fragment from Salmonella typhimurium hisG. A plasmid containing the
TLC1 gene was provided by M. Singer and D. Gottschling, and
the EST1 gene was provided by V. Lundblad.
Quantitative telomere formation and integration.
Quantitative transformations were performed as described elsewhere
(44) by transforming 5 µg of completely digested plasmid or 1 µg of the replicating plasmid YEp24 into yeast strain KR36-6L, KR36-6L bearing sir mutations
(sir1::HIS3 and sir2::HIS3
insertion mutations and complete open reading frame deletions of
sir3 and sir4, to be described elsewhere
[43a]), or YM708 expressing different Gal4p-Rap1p
fusions. To quantitate the rate of telomere formation, the number of
transformants was determined, and in most cases 100 to 200 transformants of each type were transferred to a master plate lacking
uracil, grown overnight at 30°C, replica plated to a plate containing
uracil and histidine, grown overnight, and assayed for TPE by testing
for growth on YC-Ura and 5-fluoroorotic acid plates (6).
Subsequently, 5 to 10 transformants of each type predicted to have
telomere formation events were checked by Southern analysis using the
StuI-NsiI 3' fragment of URA3 as a
probe (see Fig. 2). For YIpADH275 and YIpADHTEF-35, 100% of all TPE-positive strains formed telomeres. For YIpADH-35, 91% of
TPE-positive cells formed telomeres. For YIpADH
, 50% of
TPE-positive cells formed telomeres. Because the values in Tables 2
through 4 are based on TPE-positive cells, the fold increase in
telomere formation is slightly underestimated. Integration of the
YIpADH275 construction at internal loci (URA3) did not
give detectable levels of TPE, i.e., did not score as a telomere
formation event, in this assay (data not shown). In the cases of
sir2, sir3, and sir4 mutants which do
not exhibit TPE, 6 to 12 transformant colonies from each strain were
analyzed by Southern hybridization to determine the fraction of
telomeres formed. The fold enhancement of telomere formation is
expressed as follows: number of telomeres formed by using the test
telomere with an insert between URA3 and the TG
tracts/number of telomeres formed by using the vector telomere bearing
only URA3 and the TG tracts (e.g., number of
YIpADHTEF-35 telomeres/number of YIpADH-35 telomeres). The
fold differences from two to four single experiments were then
averaged to obtain the final value. The range of these values is noted
in each table and is ±20% or less in most cases. The number of
YIpADH-35 transformants was usually greater than 40/5 µg of
plasmid, and the number of YEp24 transformants was always greater than
103/µg. The numbers of YIpADH-GT and -G2T
transformants were lower, usually 10 to 30/5 µg for the experiments
reported in Table 4. For Table 2, the fraction of transformants that
showed TPE in wild-type cells was 0.71 for YIpADH-35, 0.47 for
YIpADH
, 1.0 for YIpADHTEF-35, and 1.0 for YIpADH275. For
Table 3, the fraction of transformants that showed TPE was 0.69 to 0.88 for YIpADH-35, 0.96 to 1.0 for YIpADHTEF-35, 0.64 to 0.76 for
YIpADHGAL-35 in strains that do not show enhancement, and 0.90 to
1.0 for YIpADHGAL-35 in strains that do show enhancement, except
for 0.75 for 653-800. Thus, the increased number of transformants
parallels the increased number of telomere formation events. Cells
bearing the Gal4p-Rap1p(618-827) and Gal4p-Rap1p(630-827) fusions grew
poorly and gave fewer transformants per microgram for all plasmids
tested. For Table 4 in strain YM708, the fraction of YIpADH-GT
transformants that showed TPE was 0.54; for YIpADHTEF-GT it was
0.94, for YIpADH-G2T it was 0.38, and for
YIpADHTEF-G2T it was 0.88. For Table 4 in strain YM708/Gal4-Rap1p(653-827), the fraction of YIpADH-GT transformants that showed TPE was 0.70; for YIpADHGAL-GT it was 0.99, for
YIpADH-G2T it was 0.39, and for
YIpADHGAL-G2T it was 0.41.
Telomere formation on YACs was determined by transforming cells with 2 µg of DNA cut with NotI and SacI to expose the
275-bp and test telomeres (see Fig. 5). YAC transformations were
performed in strain YM708 (wild type), YM708tlc1
::HIS3, or
VPS106est1
::hisG. The tlc1
and
est1
strains were generated by loss of a plasmid bearing
the wild-type gene. YM708tlc1
was transformed after ~75 divisions of growth after TLC1 plasmid loss, and VPS106 was
transformed ~35 divisions of growth after EST1 plasmid
loss to allow for complete expression of the null phenotypes (23,
30). Several hundred transformants from multiple transformations
(with the YAC containing the YIpADH-35 telomere, ~2 × 104 transformants/µg for wild-type cells, ~30/µg for
est1
cells, and ~80/µg for tlc1
cells)
were obtained. Transformants were either all large colonies in
wild-type cells or large colonies and small senescent colonies in
tlc1
and est1
cells. The fraction of
colonies in each size class was the same for YACs bearing the TEF-35 or
YIpADH-35 telomeres. To determine the fraction of transformants in
both size classes that formed telomeres, several (>10) transformants of each size class from each strain were mated to a TLC1 EST1 ura3 trp1 strain in order to form diploids. Diploids were then analyzed for linkage of URA3 and TRP1 and for TPE
and by Southern blotting. The average fraction of transformants showing
TPE (Trp+ FoaR colonies) for both size classes
for the YIpADH-35 telomere was 1.0 for wild-type cells, 0.94 for
tlc1
cells, and 0.78 for est1
cells, and
that for the TEF-35 telomere was 1.0 for wild-type cells, 0.88 for
tlc1
cells, and 0.88 for est1
cells. The
fold differences in YAC telomere formation were determined by
calculating the number of YAC telomere formation events for each size
class and then calculating the ratio of all YAC-TEF-35 formation
events to all YAC-35 formation events for each experiment. The results from two to four experiments were averaged to give the values in Table
5. Since telomere formation by the strand-copying mechanism is the same
for TEF-35 and YIpADH-35 telomeres (Table 5, tlc1
cells), comparing the relative formation frequencies of the
YIpADH-35 and TEF-35 at the left arm of chromosome VII (VIIL)
and the YAC (Tables 3 and 5) indicates that the level of formation of
the YIpADH-35 telomere by the strand-copying mechanism on the YAC is 2.8 times as high as that by telomerase at VIIL.
For quantitative integration at LEU2, identical amounts of
cut DNA (5 µg) were used for the
leu2::URA3-insert-TG1-3
transformations (see Fig. 4). Fifty to 100 Ura+
transformants were analyzed for the Leu
phenotype,
indicating correct integration at LEU2 disrupting the gene.
All transformations were carried out in strain YM708 with no plasmid or
with the 2µm HIS3 plasmid expressing the Gal4-Rap1p fusion
bearing amino acids 653 to 827.
Other methods.
Yeast cell extracts were prepared by the
method of Steiner et al. (48). Western analysis used a mouse
monoclonal antibody (Ab) to the DNA binding domain of Gal4p (Santa
Cruz), horseradish peroxidase-conjugated goat antimouse secondary Ab,
and a NEN Renaissance Western Chemiluminescence kit. Protein
concentrations were determined by Bradford assay (Bio-Rad). Southern
blot analysis of yeast telomere length will be described in detail
elsewhere (42).
 |
RESULTS |
Internal Rap1p sites enhance the frequency of telomere
formation.
To assay telomere formation quantitatively, the left
telomere of chromosome VII was truncated at the ADH4 locus
by using homologous recombination to replace the distal sequences with
the URA3 gene followed by TG1-3 sequences.
Subsequent elongation of the TG1-3 repeats converts this
construct to a functional yeast telomere (Fig.
1A) (6). We modified the
previous construction of Gottschling et al. (6) by replacing
the 125-bp fragment that contains 81 bp of TG1-3 and five
Rap1p binding sites (5) with a synthetic 35-bp
oligonucleotide containing two overlapping Rap1p sites (Table 1); this
construct will be referred to as YIpADH-35 (Fig. 1C).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Transformation assays used to monitor telomere formation
efficiency. (A) Replacement of the left telomere of chromosome VII with
synthetic URA3 telomeres. Homologous recombination at the
ADH4 locus replaces the terminal 17 kb of VIIL with a
URA3 gene followed by different DNA inserts and 29 bp of
TG1-3. Telomeres are formed when the short
TG1-3 tract is elongated by de novo TG1-3
repeat addition mediated by telomerase (47) or by a
recombination mechanism (see Fig. 4). The solid circle represents the
centromere of chromosome VII. (B) C-terminal domain structure of the
yeast telomere binding protein Rap1p based on data from several
laboratories presented as in reference 27. The
activation domain refers to activation of transcription; the
rap1s domain refers to mutations that affect
silencing at HMR and interaction with RIF1
(12); and the C-terminal domain refers to truncations that
alter telomere length and telomeric silencing of established telomeres
(27). (C) Synthetic telomeres used in this work. The
ADH4 portion is not shown. Each telomere contains a
BamHI site at the junction of the TG1-3, GT, or
G2T repeats and the internal sequences.
|
|
As described below, YIpADH-35 did not support efficient telomere
formation upon transformation compared to other constructions. Telomere
formation was defined as integration of the URA3
construction and de novo addition of TG1-3 sequences to the
short 29-bp TG1-3 tract to form a chromosome end that the
cell maintained over many generations. Telomere formation was monitored
by transforming the same preparation of competent yeast cells with 5 µg of YIpADH-35 and other constructs and determining the number
of Ura+ transformants that also exhibit TPE. The fold
increase in the number of TPE-positive transformants relative to
YIpADH-35 was calculated to measure the relative frequency of
telomere formation. TPE is the repression of constitutive, but not
induced, transcription of genes at telomeres but not at internal loci
(6). For these URA3 telomeres, TPE allows these
colonies to grow on medium lacking uracil and on medium containing
uracil and 5-fluoroorotic acid, a toxin that kills yeast containing the
URA3 gene product (6). Except where noted, 100 to
200 Ura+ transformants were picked and screened for TPE for
each quantitative assay in this work. The number of transformants and
telomere formation events increased as the amount of transforming DNA
increased from 1 to 2 and 5 µg (Materials and Methods and data not
shown). A subset of transformants that exhibited TPE was analyzed by
Southern hybridization for elongation of the terminal TG1-3
repeats (representative transformants are shown in Fig.
2). More than 86% of all TPE-positive transformants examined had elongated the 29-bp TG1-3
repeats distal to URA3 (Materials and Methods). Thus, this
system allows a replica plate assay for comparing the efficiency of
telomere formation for different constructions.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
Transformants exhibiting TPE have formed telomeres from
the terminal 29-bp TG1-3 tract. Representative genomic DNAs
from cells transformed with the indicated telomere (Fig. 1C) that
exhibited TPE were digested with either StuI or
StuI plus BamHI and were analyzed by Southern
hybridization using the 3' StuI-NsiI fragment of
URA3 as a probe. Telomeric URA3 is the
URA3 telomere at VIIL, and ura3-52 is the
chromosome V URA3 locus. The
StuI-plus-BamHI digestion showed that the
BamHI site was not deleted during telomere formation,
indicating that de novo telomere addition was to the terminal 29-bp
TG1-3 tract.
|
|
Surprisingly, a construction containing 275 bp of TG1-3
(and at least 14 Rap1p sites [5]) in place of the 29 bp of TG1-3 (data not shown) formed telomeres 47-fold more
efficiently than YIpADH-35. To determine whether the increase in
telomere formation was due to either the longer TG1-3
repeats or the presence of Rap1p molecules, different inserts were
placed into the BamHI site between the URA3 gene
and the 29-bp TG1-3 tract. These inserts included a 210-bp
fragment of lambda DNA (
), a 275-bp fragment of TG1-3
followed by 50 bp of polylinker, and a 210-bp fragment containing six
repeats of a 35-bp sequence from the TEF2 UAS, each of which
contains one Rap1p binding site (TEF) (Table 1 and Fig. 1C). The number
of telomere formation events was normalized to the YIpADH-35
control for each transformation, and the results of two to four
experiments for each cell type were averaged. A subset of
Ura+ transformants that showed TPE from each cell type in
this work was always examined by Southern analysis, and in most cases
these transformants contained new telomeres at the ADH4
locus that were formed by elongating the 29-bp TG1-3
sequences. Some exceptional YIpADH-275 telomeres in which the
terminal 29-bp TG1-3 repeats and polylinker were deleted
and telomere formation occurred by elongation of the 275-bp
TG1-3 repeats were observed, but in all cases these
transformants did contain a telomere distal to URA3. A
detailed analysis of these exceptional transformants will be given
elsewhere (42).
Constructions containing either 275 bp of internal TG1-3
sequences or six nontelomeric Rap1p binding sites (the TEF sites; see
Table 1) showed, respectively, 50- and 70-fold increases in telomere
formation compared to YIpADH-35 or YIpADH
(Table 2). This enhancement of telomere
formation was independent of the orientation of the nontelomeric Rap1p
binding sites (data not shown). The array of six TEF sites stimulated
telomere formation as well as the 275 bp of TG1-3
sequences, given the ±20% variation in fold enhancement (Table 2).
Therefore, the enhancement of telomere formation was caused by Rap1p
molecules and not by TG1-3 sequences.
Enhancement of telomere formation is independent of SIR
genes and TEL1.
TPE is a property of telomere chromatin
structure, similar to silencing at the yeast silent mating type
cassettes HMRa and HML
(1).
Silencing at HMRa and HML
requires the SIR1, SIR2, SIR3, and SIR4
genes, while TPE requires only SIR2, SIR3, and
SIR4 (1), although tethering Sir1p to the
telomere can increase TPE (2). Sir2p, Sir3p, and Sir4p are
associated with telomere-proximal DNA (49). A folded-back
telomeric chromatin structure requiring Sir2p, Sir3p, Sir4p, and Rap1p
has recently been proposed to explain TPE (49). To determine
if these gene products were important for this Rap1p-mediated
enhancement of telomere formation, these experiments were repeated in
strains bearing different sir mutations (Table 2). Telomere
formation was monitored in sir2, sir3, and
sir4 cells by Southern blot analysis of 6 to 12 transformants for each construction. All the sir
mutants showed as much stimulation as the wild-type strain or
more, indicating that these gene products are not required for this
enhancement. These data indicate that telomere formation enhancement
does not require SIR2, SIR3, SIR4, or
the proposed folded-back telomeric chromatin structure but uses some
other TPE-independent mechanism.
The effect of a known regulator of steady-state telomere length,
Tel1p, on this enhancement of telomere formation was also assayed.
Inactivating mutations of TEL1 cause cells to maintain telomeres at a new steady-state length, 50 to 100 bp of
TG1-3, while still maintaining TPE (6, 8, 34,
44). Telomere formation efficiencies of
YIpADH-35, YIpADH
, and YIpADHTEF-35 (Table 2) (Materials and Methods) were determined in a congenic pair of TEL1 (YDM884) and tel1
(YDM911)
strains (37). Telomere formation in TEL1 and
tel1
cells, respectively, for YIpADH
was 1.3- and
1.4-fold above that for YIpADH-35, and for YIpADHTEF-35 it was
23- and 45-fold increased. Therefore, Tel1p was not required for
enhancement of telomere formation mediated by the six internal Rap1p
sites. These data indicate that two properties of fully formed
telomeres, TEL1-dependent length regulation (34,
44) and TPE, are not required for the Rap1p-mediated enhancement
of telomere formation.
Internal Rap1p C termini are sufficient to enhance telomere
formation.
Rap1p binding can induce changes in the DNA helix
(5), which might play a role in the enhancement of telomere
formation that we observed. To determine whether the entire Rap1p
molecule bound to internal DNA sites was required for telomere
formation enhancement, different portions of the Rap1p C-terminal
domain fused to the DNA binding domain of Gal4p were tested for their ability to stimulate the formation of telomeres containing internal Gal4p sites. Synthetic telomeres containing four Gal4p sites, which can
bind eight Gal4p molecules (YIpADHGAL-35), were transformed into
cells that contained no endogenous GAL4 gene
(gal4
cells) and were expressing different Gal4p-Rap1p
C-terminal fusions, and the efficiency of telomere formation was
monitored (Table 3). Fusions containing
amino acids 630 to 827 of the Rap1p C terminus, including the
transcription activation domain, the Rif1p-Sir3p interaction domain,
and the C-terminal domain (Fig. 1B), enhanced telomere formation as
well as the six TEF sites. Thus, the Rap1p C terminus tethered by a
different DNA binding domain can mediate telomere formation
enhancement.
The level of enhancement was not significantly altered by the
rap1-12 double point mutation that abrogates Rap1p-Rif1p
interaction (12) (Table 3). The high level of GAL-35
enhancement over the YIpADH-35 telomere indicates that Rif1p
binding to the one or two wild-type Rap1p molecules on the 29-bp
TG1-3 tract does not significantly affect telomere
formation. These data indicate that Rif1p is not required for enhancing
telomere formation. Rif1p is known to affect the steady-state length of
established telomeres (12, 35). Thus, like the Sir proteins
and Tel1p, a protein known to function in the chromatin structure and
length regulation of fully formed telomeres was not required for the
enhancement of telomere formation mediated by internal Rap1p C termini.
Small deletions which removed amino acids 630 to 702 of the
transcriptional activation domain (11) or amino acids 800 to 827, which play a role in the length regulation of established telomeres (27), significantly reduced telomere formation
enhancement (Table 3). Even though some truncations still showed
enhancement compared to YIpADH-35 (e.g., 653-800 and 679-827 [Table 3]), the number of formation events was less than that
obtained in cells bearing the 630-827 Gal4p-Rap1p fusion. Thus, the
integrity of the entire C-terminal domain was required for maximal
enhancement of telomere formation.
To rule out the possibility that the different levels of enhancement
were due to differences in the stability of the Gal4p-Rap1p fusion
proteins, equal amounts of cell extracts from several of the different
strains tested were examined by Western blotting using a monoclonal Ab
against the Gal4p DNA binding domain (Fig. 3). All the fusion proteins tested were
detected. While the expression levels of different fusions varied, the
618-827 and 630-827 fusions, which showed the highest stimulation of
telomere formation, were expressed at lower levels than 653-827 and
679-827 (Fig. 3A), which showed reduced levels of stimulation. The
702-827 fusion, which showed a level of telomere formation more than
35-fold lower than the 618-827 fusion (Table 3), was clearly expressed,
but at a lower level than the 618-827 fusion (Fig. 3B). Thus, the large
differences in enhancement were not due to large differences in
expression of the fusion proteins. Conceivably, these differences may
result from the ability of the Rap1p C terminus in the fusion protein
to fold quickly into the structure recognized by the telomere formation
machinery, and the larger fusions may fold more efficiently than the
smaller fusions.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of Gal4p-Rap1p fusions. Yeast cell extracts
from YM708 cells expressing the indicated Gal4p-Rap1p fusion (100 µg/lane) were analyzed by Western blotting using a mouse monoclonal
Ab to Gal4p amino acids 1 to 147 (see Materials and Methods). Amino
acid numbers are shown as in Table 3. No plasmid, no Gal4p-Rap1p
expression plasmid. The two panels show lanes from the same gel. The
unusual migration of the 630-827 fusion and the multiple forms of some
of the proteins have been observed in the analysis of these proteins in
many different experiments (data not shown). These results indicate
that differences in telomere formation enhancement (Table 3) cannot be
accounted for by underexpression of various fusion proteins.
|
|
Telomere formation enhancement by internal Rap1p C termini is
independent of the terminal TG tract.
Telomere formation
enhancement appeared to be due to stimulation by internal Rap1p C
termini, as opposed to protection from degradation, because the
nontelomeric Rap1p and Gal4p-Rap1p binding sites that stimulated
formation were internal to the terminal TG1-3 sequences in
these telomeres. In addition, some Gal4p-Rap1p fusions failed to
stimulate telomere formation, indicating that any Gal4p-Rap1p fusion
binding to these sites was not sufficient to enhance telomere formation
(Table 3). However, these data could not rule out a model in which the
terminal TG1-3 sequences can be degraded but the internal
Rap1p C termini protect the chromosome terminus from degradation
until telomerase can add telomeric sequences. Previous
experiments have indicated that only a small number of T or G residues
are required to seed telomere formation (16, 38).
Alternatively, the internal Rap1p C termini form some structure that
encompasses the two Rap1p sites in the 29-bp TG1-3 tract and somehow protects the terminal TG1-3 tract from
degradation. Such a structure must be distinct from the recently
proposed folded-back telomere chromatin because internal Rap1p sites
can enhance telomere formation in strains lacking Sir2p, Sir3p, or
Sir4p and TPE (Table 2), which should lack this structure (13,
49).
To test whether internal Rap1p C termini stimulate telomere formation
through a mechanism that is distinct from protection from
degradation, telomeres were constructed with terminal sequences that
could not be bound by Rap1p but could still allow telomere formation.
These sequences, or "telomere seeds," were 29 bp of poly(GT) or 37 bp of poly(G2T) (Table 1). Both of these sequences can be
used as substrates, or seeds, for telomere formation (31). The TG1-3 seed in YIpADH-35, YIpADHTEF-35, and
YIpADHGAL-35 was replaced with either the GT or G2T
seed to form two new families of synthetic telomeres in order to test
these different models (Fig. 1C).
If the enhancement of telomere formation was due to stimulation by
internal Rap1p C termini, then the relative levels of telomere formation should be approximately equal regardless of the terminal telomere seed. However, if telomere formation enhancement is due to
protection until telomerase can add TG1-3 sequences
to any G or T residue, then the YIpADHGAL telomere lacking
any telomere seed should also show enhanced telomere formation with
respect to YIpADH-35. If telomere formation enhancement is due to
Rap1p C termini forming a structure that encompasses and protects the terminal TG1-3 sequences, then the GAL and TEF telomeres
with GT and G2T telomere seeds should show very little
enhancement, because these terminal tracts lack the Rap1p binding sites
present in the TG1-3 telomere seed.
Telomere formation using the above constructs was analyzed with
the strains shown in Table 3. In the case of YIpADHGAL
lacking a telomere seed, the rate of telomere formation in cells
expressing the Gal4p-Rap1p(653-827) fusion was extremely low (Table
4). This result is inconsistent with the
simple model in which the Rap1p C termini enhance telomere formation by
protecting URA3 and the Gal4p sites from degradation until
telomerase can add TG1-3 sequences to any G or T residue.
This result shows that a telomere seed is required to form telomeres
efficiently in this system.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
The level of telomere formation enhancement is
independent of the terminal TG tracts used as substrates for
telomere formation
|
|
The poly(GT) and poly(G2T) sequences functioned as
telomere seeds in this assay but were not as efficient as
TG1-3 (Table 4). In cells bearing the
Gal4p-Rap1p(653-827) fusion, the relative levels of telomere
formation with respect to YIpADH-35 were ~0.6 for
YIpADH-GT and ~0.2 for YIpADH-G2T. The relative
efficiencies of telomere formation for these telomere seeds alone,
highest for TG1-3, intermediate for GT, and lowest for
G2T, are qualitatively similar to previous results obtained
with linear plasmids (31). These data show that the Rap1p
binding sites in the 29-bp TG1-3 telomere seed were not
required for telomere formation.
The relative levels of telomere formation enhancement were
approximately equal for all constructs containing internal binding sites for Rap1p C termini regardless of the terminal telomere seed
(Table 4). Compared to that in the YIpADH construct with the same
telomere seed and no internal Rap1p or Gal4p sites, telomere formation
enhancement was 24-fold for YIpADHGAL-35, 30-fold for YIpADHGAL-GT, and 29-fold for YIpADHGAL-G2T. These
levels of enhancement are indistinguishable given the 20% variation in
this assay. The fold increases in telomere formation in the YM708
strain for all three YIpADHTEF constructs were also extremely
similar. These results indicate that telomere formation enhancement by
internal binding sites for Rap1p C termini was independent of the
presence of Rap1p sites in the terminal telomere seed. They also show
that the relative level of enhancement is independent of how well the terminal tract functions in telomere formation, since the sequences seed telomere formation in the order
TG1-3
GT
G2T but all show similar levels of
enhancement in the TEF and GAL constructs. These results are
inconsistent with the model that Rap1p C termini form a structure that
protects the terminal telomere seed from degradation, because the
poly(GT) and poly(G2T) sequences do not contain Rap1p sites. The simplest explanation for these data is that the internal Rap1p C termini perform some function that enhances telomere formation independent of the telomere seed, and the terminal tracts determine the
absolute level of telomere formation (see Discussion).
Telomere formation is not due to increased homologous
recombination.
An alternative model to explain these data is that
the Rap1p C termini tethered to the TEF or GAL telomere constructions
increase the frequency of homologous recombination that occurs during
our telomere formation assay (Fig. 1A). To test this possibility, the
YIpADH-35, TEF-35, and GAL-35 telomere constructs were inserted into the LEU2 gene in vitro (Fig.
4). These constructions were used to
monitor the frequency of homologous integration at the LEU2
locus in gal4
cells and in gal4
cells
expressing the Gal4p-Rap1p(653-827) fusion. The differences in the
frequency of homologous integration were an order of magnitude less
than the 20- to 36-fold stimulation of telomere formation in the TEF
and GAL telomeres (Tables 3 and 4). Thus, telomere formation
enhancement was not due to increased levels of homologous integration.
An experiment with telomere formation on YACs described below also
rules out increased telomere-telomere recombination (54)
as a mechanism for enhancement of telomere formation (see Table 5
below). The sum of these data suggests that internal Rap1p C termini
stimulate telomere formation by improving the cell's ability to
lengthen or heal the chromosome terminus (see Discussion).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Rap1p sites do not increase the frequency of homologous
integration at LEU2. To test if extra Rap1p sites increase
the frequency of homologous integration during transformation, the
HindIII-NotI fragments from YIpADH-35,
YIpADHTEF-35, and YIpADHGAL-35 (see Table 2 and Materials and
Methods) were used to disrupt LEU2 coding sequences in YM708
cells. The leu2::URA3-insert-TG1-3
constructs were used to transform LEU2 cells or
LEU2 cells expressing a Gal4p-Rap1p fusion (containing Rap1p
amino acids 653 to 827 [Table 3]). The number of Ura+
Leu yeast transformants for each construct was then
normalized to the YIpADH-35 amount, and the results from duplicate
experiments are shown. The range of values is ±20%.
|
|
Enhancement of telomere formation requires telomerase and is not
due to recombination-mediated telomere formation.
Telomere
formation enhancement by Rap1p C termini could occur by stimulating
telomerase activity or by an alternative pathway of acquiring
TG1-3 repeats such as a recombination-mediated mechanism (29, 41, 47, 60) (summarized in Fig.
5A). Telomerase contains an internal RNA
which templates the addition of TG1-3 repeats. The yeast
telomerase RNA is encoded by the yeast TLC1 gene, deletion of which causes telomeres to shorten over successive divisions until
cells die (47). Deletion of the yeast EST1 gene
causes a similar phenotype (30, 52), and Est1p appears to
play an important role in telomerase activity (23, 48),
but not as a catalytic subunit of telomerase (3, 20, 26,
52). Two recombination pathways have been demonstrated, a
nonreciprocal strand-copying mechanism (41) and a reciprocal
transfer of subtelomeric repeats (29). The telomerase
pathway requires TLC1 and EST1, while the
recombination pathways should not, so only the recombination pathway
can promote telomere formation in tlc1
cells. If the Rap1p C terminus-mediated enhancement of telomere formation
occurs through the telomerase pathway, e.g., by increasing telomerase activity, loss of tlc1 or est1 function should
reduce this enhancement and the YIpADH-35 and
YIpADHTEF-35 telomeres should be formed at similar
frequencies. However, if this enhancement depends on either
recombination pathway, the relative telomere formation frequencies
for YIpADH-35, YIpADHTEF-35, and YIpADHGAL-35
would still be the same in tlc1 or est1 mutants.
To distinguish between these hypotheses, we determined whether
tlc1
and est1
mutations altered Rap1p
C-terminal telomere formation enhancement by forming telomeres in these
mutant cells.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Telomere formation pathways on chromosomes and short
YACs. (A) Telomeres can be formed on chromosomes by integration and
subsequent elongation by telomerase or by two telomerase-independent
pathways: a double reciprocal recombination event with the
ADH4 locus and TG1-3 repeats (the
TG1-3 repeats need not be cis to
ADH4) or a nonreciprocal strand-copying event that has been
shown to take place at the ends of linear plasmids during
transformation (see the text). Both the telomerase-dependent and
strand-copying pathways predict a single-stranded TG1-3
intermediate that is later made double stranded by DNA repair
replication (60). (B) The 12-kb YAC vector for testing
telomere formation in strains lacking telomerase RNA. One telomere
contains 275 bp of TG1-3 sequences, while the other
contains the YIpADH-35 and YIpADHTEF-35 telomeres (Fig.
1C). The close proximity of the two YAC telomeres allows the 275-bp
TG1-3 repeats to serve as substrates for the test telomere
in the strand-copying pathway of telomere formation (41).
|
|
Telomere formation by replacement of the VIIL telomere was monitored in
tlc1
and est1
mutant cells. These strains
were generated by loss of a plasmid bearing the wild-type gene; the
deletion strains were grown for transformation, and the transformants
obtained were rescued from eventual cell death by mating to wild-type
strains in order to reintroduce TLC1 or EST1 and
then were scored for telomere formation (Materials and Methods).
Replacement of the VIIL telomere occurred at a very low frequency in
both cell types. Multiple transformations with 5 µg of DNA per
transformation into tlc1
cells produced only 5 to 20 transformants with YIpADH-35 and 5 to 30 transformants with
YIpADHTEF-35 (TEF-35), compared to ~150 and ~3,700
transformants, respectively, from similar experiments in wild-type
cells with these constructs. Most of the YIpADH-35 transformants
did not form telomeres, so the fold enhancement in telomere formation
could not be determined with this approach. Consequently, a system that
produced higher levels of telomere formation in tlc1
and
est1
cells was required to determine if TLC1
and EST1 were required for Rap1p C terminus-mediated
telomere formation enhancement. A YAC-based system was developed for
these experiments.
Two 12-kb YACs bearing one telomere with 275 bp of TG1-3
sequences and one YIpADH-35 or TEF-35 telomere (Fig. 5B) were
constructed. Each YAC can replicate extrachromosomally, so telomere
formation is the only requirement for obtaining a transformant. In
addition, the strand-copying mechanism of telomere formation was first
detected on extrachromosomal linear plasmids (41). Thus, the
YAC system was expected to provide a telomerase-independent means of
forming telomeres so that a sufficient number of telomere formation
events could be assayed to determine the contributions of
TLC1 and EST1 to Rap1p-mediated telomere
formation enhancement. If this enhancement occurs by stimulation of a
telomerase-independent mechanism, then the stimulation of telomere
formation by the TEF-35 telomere should also be detected in
tlc1
and est1
cells. However, if telomerase is required for enhancement, the numbers of YIpADH-35 and TEF-35 telomere formation events will be similar.
All of the YACs tested transformed cells at much higher frequencies
than the VIIL telomere replacement constructs. YACs bearing the TEF
telomere showed only a 10-fold enhancement of telomere formation in
wild-type (YM708) cells (Table 5). The
reduced level of enhancement of telomere formation most likely reflects
an increase in telomerase-independent telomere formation for the
YIpADH-35 telomere by the strand-copying mechanism, which is highly
efficient (41), and dilutes the differences in telomere
formation frequency between the TEF-35 and YIpADH-35 telomeres
(Materials and Methods). These data show that the telomere formation
enhancement observed by integration at ADH4 on VIIL also
occurs on YACs.
The level of telomere formation on YACs bearing the
YIpADH-35 or TEF-35 telomere was indistinguishable in
tlc1
strains. Thus, TLC1, the gene for yeast
telomerase RNA, was required for Rap1p-mediated telomere formation
enhancement. These data indicate that active telomerase is a required
component for internal Rap1p C termini to stimulate telomere formation.
The YAC bearing the TEF-35 telomere showed 2.8-fold enhancement of
telomere formation over the YAC bearing the YIpADH-35 telomere in
est1
cells (Table 5). This enhancement represented more
than a threefold reduction compared to wild-type cells. Thus,
EST1 was also required for stimulating telomere formation.
These data show that telomere formation enhancement by internal Rap1p C
termini requires telomerase RNA and Est1p.
 |
DISCUSSION |
In this study, a quantitative transformation assay for telomere
formation at VIIL with a short telomere formation substrate, or seed,
has revealed a novel function for the major yeast telomere binding
protein Rap1p. Previous work from many laboratories has shown that the
Rap1p C terminus inhibits the lengthening of established telomeres by
acting at the chromosome terminus. The data presented here show that
internally located Rap1p C termini can stimulate telomere formation in
a telomerase-dependent manner. Because the telomere substrates used
here require elongation of the TG1-3 repeats to form a
telomere, this system is a model for the stimulation of telomere
elongation. Thus, internal Rap1p C termini on short telomeres most
probably stimulate telomere lengthening, in contrast to the action of
Rap1p at the ends of long, established telomeres (17). These
results suggest a model in which a balance between the activities of
internal Rap1p C termini, which stimulate telomere elongation, and
those of terminal Rap1p molecules, which limit elongation, regulates
telomere length (see below).
Telomere formation enhancement by internal Rap1p C termini occurred by
a mechanism that was distinct from protection from degradation as
judged by several criteria. First, the Rap1p C termini that enhance
formation, tethered by either the Rap1p or Gal4p DNA binding domain,
were located internal to the terminal TG tracts that seed telomere
formation. Second, the folded-back telomere chromatin structure
recently proposed to explain TPE was unlikely to be involved in the
enhancement of telomere formation because cells lacking both
SIR genes and TPE had as high or higher levels of telomere
formation enhancement (Table 2). If the folded-back structure were
involved in telomere formation enhancement by protecting the end from
degradation, the level of enhancement should have been greatly reduced
in sir mutants. Third, telomere formation enhancement
occurred with telomere seeds that contained no Rap1p binding sites, so
Rap1p binding to these terminal tracts was dispensable for enhancement.
In the telomeres containing poly(GT) and poly(G2T) seeds,
the only binding sites for Rap1p and Gal4p were internal to these
tracts (Table 1 and Fig. 1C). Fourth, the relative level of telomere
formation enhancement was independent of the sequence of the terminal
tract (Table 4). Since the individual tracts formed telomeres with
different frequencies (in descending order, TG1-3, GT, and
G2T) but the TEF and GAL constructs showed the same fold
enhancement with all three telomere seeds, the internal Rap1p C termini
function independently of the terminal tract. These results are
inconsistent with a model in which the Rap1p C termini form a structure
which protects the terminal tract; such a model predicts that the
TG1-3 tract with two Rap1p sites should show a much greater
level of enhancement in the TEF-35 and GAL-35 constructs because the
TG1-3 repeats would be part of such a structure. The
simplest explanation for all these data is that the internal Rap1p C
termini enhance telomere formation by a mechanism that is independent
of the terminal tract and so is distinct from the internal Rap1p C
termini protecting the terminal tract from exonucleolytic degradation.
The Rap1p C terminus-mediated enhancement of telomere formation
requires telomerase RNA (the product of the TLC1 locus) and is enhanced by Est1p (Table 5). When the tlc1
and
est1
strains were tested for telomere formation by
replacing VIIL (Fig. 1A) or on short YACs (Fig. 5),
stimulation was greatly reduced in both cases. However, VIIL telomeres
formed at such low rates in the tlc1
and
est1
strains that, while the ~35-fold higher level of
formation of the TEF-35 telomere compared to the YIpADH-35 telomere
was reduced, the final level was highly variable. This low rate of
formation in tlc1
and est1
strains made it
impossible to use the telomere formation assay at VIIL to determine an
accurate fold enhancement. Telomere formation on short linear plasmids can use an alternative, telomerase-independent mechanism to transfer sequences between linear plasmid ends (41, 54), which can allow the YIpADH-35 or TEF-35 telomere to acquire TG1-3
sequences from the other end of the YAC (Fig. 5). We verified that
telomere formation enhancement mediated by internal Rap1p molecules
occurred in this system. The fold enhancement was smaller, most
probably because the telomerase-independent mechanism increases the
absolute number of YIpADH-35 telomere formation events. By use of
short YACs, larger numbers of telomere formation events were obtained in tlc1
and est1
cells, which allowed an
accurate comparison between the rates of YIpADH-35 and TEF-35
telomere formation. These data show that telomerase RNA and therefore
active telomerase, as well as Est1p, must be present in the cell in
order for the internal Rap1p molecules to stimulate telomere formation.
Est1p is a single-stranded TG1-3 binding protein that
coimmunoprecipitates with telomerase RNA and activity (23, 48,
52) but is probably not a part of the core catalytic enzyme
(3, 20, 25).
Our results suggest a model in which internal Rap1p C
termini play a role in telomere length control. We propose that the Rap1p C terminus stimulates the elongation of short telomeres by
increasing telomerase activity in cis. We suggest that one of the many components that can interact with the Rap1p C terminus is a
protein that can either attract the telomerase enzyme or increase its
activity, so we refer to this protein as the telomerase accessory
subunit (Fig. 6). If the telomere is
short because of chromosome breakage or degradation, the activated
telomerase can add telomere repeats to the nearest available substrate
(Fig. 6), which in most cases will be the chromosome terminus that need not be capped by telomere sequences (16, 38). Data from
other laboratories indicate that if the telomere is long or of normal length, Rap1p molecules bound to the chromosome terminus interact with
factors there to block telomerase access and prevent lengthening (4, 17, 18). In our model, these inhibitory factors would be
absent from short telomeres. The simplest form of this model is that
telomerase is always attracted by internal Rap1p C termini but its
action at chromosome ends is determined by whether the Rap1p molecules
at the chromosome terminus can block telomerase access. This model
parallels the results in Table 4, where formation enhancement by
internal Rap1p C termini was independent of the sequence at the
chromosome terminus. A direct consequence of this model is that
attracting telomerase to normal-length telomeres where lengthening
is blocked is futile, and only those telomeres that are short (i.e.,
without the inhibiting Rap1p at the chromosome terminus) will be
elongated. These "futile" cycles in wild-type cells provide a way
to constantly monitor telomere length and keep it within a set range.
When telomeres become too short, Rap1p at the terminus no longer
inhibits telomere lengthening (see below) and elongation occurs. If
telomerase always adds a constant number of TG1-3
repeats equivalent to the amount of sequence lost over several cell
cycles, only a few active telomerase molecules are required to
maintain all telomeres within a constant range of lengths. Those
telomeres that become too long would be shortened by telomere deletion
mechanisms (21).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Speculative model for Rap1p C terminus-mediated
enhancement of telomere formation and length regulation. (A) A
telomerase subunit (see the text) interacts with internal Rap1p C
termini. (B) The telomerase subunit provides a docking site for the
catalytic subunits of telomerase or serves to increase telomerase
activity. (C) If a short telomere or broken chromosome end is near the
bound Rap1p C termini, telomerase can bind to the free 3' end and add
telomeric repeats. The free 3' end need only have limited homology to
telomerase RNA (16, 38). If the TG1-3 repeats
are long, then the Rap1p and chromosome terminus-specific factors bound
at the chromosome end (e.g., Cdc13p, Stn1p, Est1p) block telomerase
access to the 3' end and no lengthening occurs (7, 17, 24, 40,
52) (see the text). Over the course of many cell divisions, the
combined actions of telomerase recruitment and inhibition of elongation
at only those telomeres with normal lengths maintains all chromosomal
telomeres within the same length range. A model similar to the activity
at short telomeres was previously proposed by Kramer and Haber
(16) to describe TTGGGG-stimulated telomere formation in
yeast, but the proteins involved in that stimulation were not
identified (see the text).
|
|
These considerations suggest that Rap1p C termini at different
locations within the telomere repeats are seen differently by the cell.
These differences may reflect interactions with different sets of
proteins at these sites, such as Cdc13p, Est1p, Stn1p (7, 24, 40,
52), and other single-stranded TG1-3 binding factors
(15, 22). In addition, recent work has shown that yeast
cells monitor the number of Rap1p C termini at each telomere (35,
42). The cell may determine if the most distal Rap1p C terminus
is inhibitory by "counting" the number of Rap1p C termini from the
telomere-nontelomere junction.
Our model claims that telomerase mediates the Rap1p C
terminus-dependent enhancement of telomere lengthening because a
telomerase accessory subunit is part of telomeric chromatin structure
(Fig. 6). This model is consistent with previous results showing that overexpression of a truncated TLC1 RNA (47) and
the Rap1p C terminus (56) can have similar effects on TPE,
which is dependent on telomere chromatin structure (1).
Presumably, both telomerase RNA and the Rap1p C terminus compete for
telomere-associated proteins critical for maintaining normal telomere
structure and TPE. The shorter telomeres in cells overexpressing
TLC1 RNA (5a, 47) are also consistent with the
model, as excess telomerase RNA is expected to compete for telomerase
protein subunits. Removal of the proposed telomerase accessory subunit
from internal Rap1p C termini would reduce the frequency with which
telomerase is brought to or activated at the telomere, reducing the
frequency of telomere elongation and causing a net shortening of
telomeres.
The concept that proteins that bind at or near the telomere can
directly or indirectly attract telomerase can explain several previous
observations in yeast and human cells. In HeLa cells, telomere
formation can be seeded by telomere repeats, but a large number of
repeats is necessary for efficient formation (10). These
requirements could reflect a similar property of internally bound human
telomere repeat factor, TRF1, to attract or stimulate telomerase
activity at short telomeres and, similarly to Rap1p, inhibit telomere
elongation on existing telomeres (51). Internal TTGGGG
sequences have been shown to stimulate telomere formation in
yeast (16, 38). Tbf1p is a protein that binds to TTAGGG repeats in the telomere-associated X repeats that can also bind to TTGGGG (28). If Tbf1p can also attract
telomerase, X repeats could form an efficient back-up mechanism for
stimulating telomere formation in the event of loss of the terminal
TG1-3 sequences. Telomerase would be attracted to sequences
within X elements and add telomere sequences to the nearby broken end.
Thus, this model can explain telomere behavior in human cells and
provides a mechanism for telomere formation or chromosome "healing"
in the event of catastrophic loss of telomere repeats.
 |
ACKNOWLEDGMENTS |
We thank the investigators mentioned in the text for
strains and plasmids, N. Roy for the KR36-6L strains bearing
sir mutations, R. Kota for unpublished data, and K. Hotmire
for technical support.
K.W.R. is supported by a Junior Faculty Research Award from the
American Cancer Society. This work was supported by NIH grant GM50752
to K.W.R.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Lerner
Research Institute, Cleveland Clinic Foundation, Department of
Molecular Biology, NC20, 9500 Euclid Ave., Cleveland, OH 44195. Phone:
(216) 445-9771. Fax: (216) 444-0512. E-mail:
rungek{at}cesmtp.ccf.org.
 |
REFERENCES |
| 1.
|
Aparicio, O. M.,
B. L. Billington, and D. E. Gottschling.
1991.
Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae.
Cell
66:1279-1287[Medline].
|
| 2.
|
Chien, C. T.,
S. Buck,
R. Sternglanz, and D. Shore.
1993.
Targeting of SIR1 protein establishes transcriptional silencing at HM loci and telomeres in yeast.
Cell
75:531-541[Medline].
|
| 3.
|
Cohn, M., and E. H. Blackburn.
1995.
Telomerase in yeast.
Science
269:396-400[Abstract/Free Full Text].
|
| 4.
|
Conrad, M. N.,
J. H. Wright,
A. J. Wolf, and V. A. Zakian.
1990.
RAP1 protein interacts with yeast telomeres in vivo: overproduction alters telomere structure and decreases chromosome stability.
Cell
63:739-750[Medline].
|
| 5.
|
Gilson, E.,
M. Roberge,
R. Giraldo,
D. Rhodes, and S. M. Gasser.
1993.
Distortion of the DNA double helix by RAP1 at silencers and multiple telomeric binding sites.
J. Mol. Biol.
231:293-310[Medline].
|
| 5a.
| Gottschling, D. Personal communication.
|
| 6.
|
Gottschling, D. E.,
O. M. Aparicio,
B. L. Billington, and V. A. Zakian.
1990.
Position effect at yeast telomeres: reversible repression of polII transcription.
Cell
63:751-762[Medline].
|
| 7.
|
Grandin, N.,
S. I. Reed, and M. Charbonneau.
1997.
Stn1, a new Saccharomyces cerevisiae protein, is implicated in telomere size regulation in association with Cdc13.
Genes Dev.
11:512-527[Abstract/Free Full Text].
|
| 8.
|
Greenwell, P. A.,
S. L. Kronmal,
S. E. Porter,
J. Gassenhuber,
B. Obermaier, and T. D. Petes.
1995.
TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human ataxia telangiectasia gene.
Cell
82:823-829[Medline].
|
| 9.
|
Greider, C. W.
1996.
Telomere length regulation.
Annu. Rev. Biochem.
65:337-365[Medline].
|
| 10.
|
Hanish, J. P.,
J. L. Yanowitz, and T. de Lange.
1994.
Stringent sequence requirements for the formation of human telomeres.
Proc. Natl. Acad. Sci. USA
91:8861-8865[Abstract/Free Full Text].
|
| 11.
|
Hardy, C. F. J.,
D. Balderes, and D. Shore.
1992.
Dissection of a carboxy-terminal region of the yeast regulatory protein RAP1 with effects on both transcriptional activation and silencing.
Mol. Cell. Biol.
12:1209-1217[Abstract/Free Full Text].
|
| 12.
|
Hardy, C. F. J.,
L. Sussel, and D. Shore.
1992.
A RAP1-interacting protein involved in transcriptional silencing and telomere length regulation.
Genes Dev.
6:801-814[Abstract/Free Full Text].
|
| 13.
|
Hecht, A.,
S. Strahl-Bolsinger, and M. Grunstein.
1996.
Spreading of transcriptional repressor SIR3 from telomeric heterochromatin.
Nature
383:92-95[Medline].
|
| 14.
|
Henry, Y. A. L.,
A. Chambers,
J. S. H. Tsang,
A. J. Kingsman, and S. M. Kingsman.
1990.
Characterisation of the DNA binding domain of the yeast RAP1 protein.
Nucleic Acids Res.
18:2617-2623[Abstract/Free Full Text].
|
| 15.
|
Konkel, L. M.,
S. Enomoto,
E. M. Chamberlain,
Z. P. McCune,
S. J. Iyadurai, and J. Berman.
1995.
A class of single-stranded telomeric DNA-binding proteins required for Rap1p localization in yeast nuclei.
Proc. Natl. Acad. Sci. USA
92:5558-5562[Abstract/Free Full Text].
|
| 15a.
| Kota, R. Unpublished data.
|
| 16.
|
Kramer, K. M., and J. E. Haber.
1993.
New telomeres in yeast are initiated with a highly selected subset of TG1-3 repeats.
Genes Dev.
7:2345-2356[Abstract/Free Full Text].
|
| 17.
|
Krauskopf, A., and E. H. Blackburn.
1996.
Control of telomere growth by interactions of RAP1 with the most distal telomere repeats.
Nature
383:354-357[Medline].
|
| 18.
|
Kyrion, G.,
K. A. Boakye, and A. J. Lustig.
1992.
C-terminal truncation of RAP1 results in the deregulation of telomere size, stability, and function in Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:5159-5173[Abstract/Free Full Text].
|
| 19.
|
Kyrion, G.,
K. Liu,
C. Liu, and A. J. Lustig.
1993.
RAP1 and telomere structure regulate telomere position effects in Saccharomyces cerevisiae.
Genes Dev.
7:1146-1159[Abstract/Free Full Text].
|
| 20.
|
Lendvay, T. S.,
D. K. Morris,
J. Sah,
B. Balasubramanian, and V. Lundblad.
1996.
Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes.
Genetics
144:1399-1412[Abstract].
|
| 21.
|
Li, B., and A. J. Lustig.
1996.
A novel mechanism for telomere size control in Saccharomyces cerevisiae.
Genes Dev.
10:1310-1326[Abstract/Free Full Text].
|
| 22.
|
Lin, J.-J., and V. A. Zakian.
1994.
Isolation and characterization of two Saccharomyces cerevisiae genes that encode proteins that bind to (TG1-3)n single strand telomeric DNA in vitro.
Nucleic Acids Res.
22:4906-4913[Abstract/Free Full Text].
|
| 23.
|
Lin, J.-J., and V. A. Zakian.
1995.
An in vitro assay for Saccharomyces telomerase requires EST1.
Cell
81:1127-1135[Medline].
|
| 24.
|
Lin, J.-J., and V. A. Zakian.
1996.
The Saccharomyces CDC13 protein is a single-stranded TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo.
Proc. Natl. Acad. Sci. USA
93:13760-13765[Abstract/Free Full Text].
|
| 25.
|
< |