INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Telomeres are the nucleoprotein complexes that protect chromosome ends from degradation and allow their complete replication. In most organisms, telomere DNA consists of an array of short TG-rich repeats. Saccharomyces cerevisiae telomeres consist of a 250- to 400-bp array of the heterogeneous repeat TG_1-3 (58). Work from several laboratories has shown that these repeats are all that is required for yeast telomere function in mitosis and meiosis (6, 39, 45, 55). The number of these TG_1-3 repeats, or telomere length, can be reduced by removal of the RNA primer for DNA synthesis or by degradation of the C_1-3A strand at the end of S phase. The TG_1-3 repeats can be elongated by the action of telomerase, a reverse transcriptase that contains an internal RNA template from which it synthesizes new TG_1-3 repeats (59). Each yeast telomere contains numerous binding sites within the TG_1-3 repeats for the RAP1 protein (Rap1p) (5, 53). Rap1p is required for yeast viability and functions both as a transcriptional activator of many yeast ribosomal protein and glycolytic genes and as an important component of the transcriptional silencing machinery at the yeast silent mating type cassettes and at telomeres (46).

Rap1p can be divided into two domains, a large DNA binding domain (amino acids 361 to 596 [14]) and a large C-terminal domain (amino acids 600 to 827), which contains multiple subdomains involved in transcriptional activation, transcriptional silencing, and telomere length control (4, 11, 18, 32, 50) (see Fig. 1). The Rap1p C terminus binds directly to at least three other proteins: Sir3p, Rif1p, and Rif2p (12, 36, 57). The interaction with Sir3p is important for the formation of a heterochromatin complex, consisting of Sir2p, Sir3p, Sir4p, and Rap1p, that spreads into internal regions of the chromosome to silence the transcription of nearby genes, a phenomenon known as telomere position effect, or TPE (1, 13, 33, 43, 49). Elimination of SIR2, SIR3, or SIR4 function eliminates TPE (1) and the association of Sir proteins with telomeric heterochromatin (13, 49).

The Rap1p C terminus also plays an important role in telomere length regulation. To date, the majority of studies have examined the effects of mutations in the Rap1p C terminus on the steady-state length of existing telomeres. Overproduction of the Rap1p C-terminal domain in vivo causes chromosomal telomeres to lengthen (4, 11, 44, 56), presumably because Rap1p interacting factors are titrated away from telomeres. Point mutations and deletion mutations in the Rap1p C terminus also cause lengthening of existing chromosomal telomeres (18, 19, 27, 50). Recent work with synthetic telomeres indicates that yeast cells measure telomere length by counting Rap1p C termini, because tethering Rap1p C termini adjacent to the terminal TG_1-3 tract causes cells to maintain the terminal tract at a shorter equilibrium length (35). Experiments with the Rap1p homolog of Kluyveromyces lactis indicate that the C termini of Rap1p molecules bound to the very ends of the chromosome interact with proteins that inhibit telomere elongation, presumably by inhibiting the access of telomerase to the chromosome terminus (17). These data have led to the hypothesis that the Rap1p C terminus inhibits lengthening of established telomeres (9).

The role of Rap1p in telomere formation, the de novo addition of TG_1-3 repeats onto DNA ends, has received less attention. Telomeres can be efficiently formed on linear plasmids and chromosomes in vivo when the DNA ends are capped by telomeric repeats (6, 31, 32, 41, 47, 53, 58). Previous work using TG_1-3 sequences that do or do not contain Rap1p sites has suggested that Rap1p binding can increase the frequency of telomere formation on linear plasmids (32). However, since these Rap1p sites were at the ends of the TG_1-3 repeats, these data could not distinguish between bound Rap1p protecting the TG_1-3 sequences from exonucleolytic degradation and Rap1p actively stimulating telomere formation. Experiments with temperature-sensitive rap1 mutants grown at the highest temperature where growth is possible, where Rap1p function should be limiting, found that telomeres gradually shorten as cells grow. As with the linear-plasmid experiments, these results could not distinguish between Rap1p protecting the ends from degradation and Rap1p enhancing telomere lengthening (4, 32). Therefore, while the role of the Rap1p C terminus in limiting the elongation of existing telomeres is established, the exact role of Rap1p in telomere formation and elongation is not clear.

Here we demonstrate that the Rap1p C terminus can promote telomere formation by a mechanism that is distinct from protection from degradation. We constructed synthetic telomeres containing three different very short substrates for telomere formation (telomere seeds). Using a quantitative transformation assay, we found that internally tethered Rap1p molecules or a subset of Gal4p-Rap1p C-terminal fusions could greatly stimulate telomere formation independently of the telomere seed sequence. This enhancement of telomere formation requires most of the Rap1p C terminus, amino acids 630 to 827. This enhancement is dependent upon telomerase and is unaffected by mutations that alter the chromatin structure of steady-state telomeres. These data suggest a model in which internally located Rap1p C termini stimulate telomere formation and the elongation of short telomeres by increasing the activity of or attracting telomerase. At long telomeres, Rap1p and other molecules at the chromosome end block telomerase access, so that these two Rap1p functions form a system for maintaining telomeres at constant length.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Strains. Recombinant DNA manipulations were carried out in bacterial strains MC1066 (r m⁺ pyrF::Tn5 trpC leuB) and JF1754 (r m⁺ leuB hisB Met). Yeast strains used were KR36-6L [MATa ade2-(1 or 101) ade8-18 ura3-52 trp11 leu2-RC his3] (44), the gal4 strain YM708 (MAT ade2-101 ura3-52 trp1-901 his3-200 lys2-801 LEU2 can^R gal4-542) (from Mark Johnston), and VPS106est1::hisG (MATa ade2 ade3 ura3 trp1 leu2-3,112 lys2-801 can1 est1::hisG) (from V. Schulz and K. Runge). The tel1 (YDM911) and TEL1 (YDM884) congenic strains were from Dwight Morrow and have been described elsewhere (37).

Plasmids. The PvuII fragment of pADHUCAIV containing the ADH4-URA3-TG_1-3 sequences (6) was ligated to the 3.3-kb EcoRV-SmaI fragment of YIp5 to form YIpADH. The TG_1-3 repeats were removed from YIpADH by digestion with BamHI and NotI and were replaced with the oligonucleotide pair 35 (Table 1) to generate YIpADH-35. At high Rap1p concentrations in vitro, both Rap1p sites in this fragment can be bound simultaneously (15a). The single BamHI site between URA3 and the TG_1-3 repeats was the site of insertion of six 35-bp TEF oligonucleotides (Table 1) in head-to-tail orientation, where the resulting BamHI site was closest to the NotI site, to form YIpADHTEF-35. A plasmid with the six TEF oligonucleotides in the opposite orientation was also constructed. Construction of the head-to-tail repeats will be detailed elsewhere (42a). Four GAL4 binding sites were also inserted by using four head-to-tail concatemers of the 22-bp GAL oligonucleotides (Table 1) to form YIpADHGAL-35. A 210-bp fragment of  DNA was generated by using the PCR primers GGCCAGATCTAAAACAGGCTGAGCACGG and GGCCGGATCCGTTTCTGCGGGAAAGTGT to amplify bp 10101 to 10310 of lambda phage DNA, cleaving the product with BglII and BamHI, and cloning it into the BamHI site of YIpADH-35 to form YIpADH. The 275 bp of TG_1-3 was isolated from pCT300 (275 bp of TG_1-3 in pVZ-1, from K. Runge, R. Wellinger, J. Wright, and V. Zakian; the same sequence as Tel 270 [5]) by cleavage with HincII and SmaI and was cloned into the filled-in BamHI site of YIpADH-35 to yield YIpADH275. The 5-bp difference in length came about because we counted the 5 bp of TG sequences from the polylinker that are continuous with the telomeric sequence, while Gilson et al. (5) did not. The orientation of the 275 bp of TG_1-3 repeats was the same as that of the telomere. Digestion of all of these YIpADH plasmids with SalI and NotI releases a SalI-ADH4-URA3-insert-TG_1-3-NotI fragment which can replace the left telomere of chromosome VII (VIIL). To form the YIpADH-GT and YIpADH-G₂T versions of YIpADH-35, YIpADHTEF-35, and YIpADHGAL-35, each of the latter three plasmids was cleaved with BamHI and NotI, and the GT and G₂T oligonucleotides (Table 1) were ligated to these vectors. The correct transformants were identified by incorporation of the XhoI site. The sequences of all of these synthetic telomeres were verified by DNA sequencing. The leu2::URA3-insert-TG_1-3 constructions were made by cutting YIpADH-35, YIpADHTEF-35, and YIpADHGAL-35 with HindIII and NotI, filling in the ends with the Klenow fragment of Escherichia coli DNA polymerase I, and cloning the URA3 fragment into the EcoRV site of LEU2 in pLEU2-0.9 (which contains the 0.9-kb EcoRI-SalI fragment of LEU2 in the same sites of pBR322). The yeast artificial chromosomes (YACs) were constructed by using YAC-ATA (from K. Runge and R. Wellinger; to be described elsewhere [43a]) and replacing one of two 275-bp telomeres with the SalI-NotI fragment from YIpADH-35 and YIpADHTEF-35. The 275-bp TG_1-3 telomere and the test telomere are separated by 1.8 kb of HIS3 DNA for propagation in bacteria. The Gal4p-Rap1p fusions are expressed from the ADC1 promoter on a multicopy (2µm) HIS3 plasmid. The 653-800 and 653-817 fusions were constructed by introducing a stop codon followed by an XbaI site by PCR, cloning the fragments into the original vector, and verifying the products by sequencing. The remaining fusions were provided by D. Shore (11). The tlc1::HIS3 allele replaces all of the TLC1 transcript (nucleotides 1 to 1306) with the HIS3 gene from pRS313 by the method of Morrow et al. (37), and the est1::hisG allele replaces the internal EcoRI-to-NsiI fragment of the EST1 coding region with a 0.9-kb fragment from Salmonella typhimurium hisG. A plasmid containing the TLC1 gene was provided by M. Singer and D. Gottschling, and the EST1 gene was provided by V. Lundblad.

Quantitative telomere formation and integration. Quantitative transformations were performed as described elsewhere (44) by transforming 5 µg of completely digested plasmid or 1 µg of the replicating plasmid YEp24 into yeast strain KR36-6L, KR36-6L bearing sir mutations (sir1::HIS3 and sir2::HIS3 insertion mutations and complete open reading frame deletions of sir3 and sir4, to be described elsewhere [43a]), or YM708 expressing different Gal4p-Rap1p fusions. To quantitate the rate of telomere formation, the number of transformants was determined, and in most cases 100 to 200 transformants of each type were transferred to a master plate lacking uracil, grown overnight at 30°C, replica plated to a plate containing uracil and histidine, grown overnight, and assayed for TPE by testing for growth on YC-Ura and 5-fluoroorotic acid plates (6). Subsequently, 5 to 10 transformants of each type predicted to have telomere formation events were checked by Southern analysis using the StuI-NsiI 3' fragment of URA3 as a probe (see Fig. 2). For YIpADH275 and YIpADHTEF-35, 100% of all TPE-positive strains formed telomeres. For YIpADH-35, 91% of TPE-positive cells formed telomeres. For YIpADH, 50% of TPE-positive cells formed telomeres. Because the values in Tables 2 through 4 are based on TPE-positive cells, the fold increase in telomere formation is slightly underestimated. Integration of the YIpADH275 construction at internal loci (URA3) did not give detectable levels of TPE, i.e., did not score as a telomere formation event, in this assay (data not shown). In the cases of sir2, sir3, and sir4 mutants which do not exhibit TPE, 6 to 12 transformant colonies from each strain were analyzed by Southern hybridization to determine the fraction of telomeres formed. The fold enhancement of telomere formation is expressed as follows: number of telomeres formed by using the test telomere with an insert between URA3 and the TG tracts/number of telomeres formed by using the vector telomere bearing only URA3 and the TG tracts (e.g., number of YIpADHTEF-35 telomeres/number of YIpADH-35 telomeres). The fold differences from two to four single experiments were then averaged to obtain the final value. The range of these values is noted in each table and is ±20% or less in most cases. The number of YIpADH-35 transformants was usually greater than 40/5 µg of plasmid, and the number of YEp24 transformants was always greater than 10³/µg. The numbers of YIpADH-GT and -G₂T transformants were lower, usually 10 to 30/5 µg for the experiments reported in Table 4. For Table 2, the fraction of transformants that showed TPE in wild-type cells was 0.71 for YIpADH-35, 0.47 for YIpADH, 1.0 for YIpADHTEF-35, and 1.0 for YIpADH275. For Table 3, the fraction of transformants that showed TPE was 0.69 to 0.88 for YIpADH-35, 0.96 to 1.0 for YIpADHTEF-35, 0.64 to 0.76 for YIpADHGAL-35 in strains that do not show enhancement, and 0.90 to 1.0 for YIpADHGAL-35 in strains that do show enhancement, except for 0.75 for 653-800. Thus, the increased number of transformants parallels the increased number of telomere formation events. Cells bearing the Gal4p-Rap1p(618-827) and Gal4p-Rap1p(630-827) fusions grew poorly and gave fewer transformants per microgram for all plasmids tested. For Table 4 in strain YM708, the fraction of YIpADH-GT transformants that showed TPE was 0.54; for YIpADHTEF-GT it was 0.94, for YIpADH-G₂T it was 0.38, and for YIpADHTEF-G₂T it was 0.88. For Table 4 in strain YM708/Gal4-Rap1p(653-827), the fraction of YIpADH-GT transformants that showed TPE was 0.70; for YIpADHGAL-GT it was 0.99, for YIpADH-G₂T it was 0.39, and for YIpADHGAL-G₂T it was 0.41.

Other methods. Yeast cell extracts were prepared by the method of Steiner et al. (48). Western analysis used a mouse monoclonal antibody (Ab) to the DNA binding domain of Gal4p (Santa Cruz), horseradish peroxidase-conjugated goat antimouse secondary Ab, and a NEN Renaissance Western Chemiluminescence kit. Protein concentrations were determined by Bradford assay (Bio-Rad). Southern blot analysis of yeast telomere length will be described in detail elsewhere (42).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Internal Rap1p sites enhance the frequency of telomere formation. To assay telomere formation quantitatively, the left telomere of chromosome VII was truncated at the ADH4 locus by using homologous recombination to replace the distal sequences with the URA3 gene followed by TG_1-3 sequences. Subsequent elongation of the TG_1-3 repeats converts this construct to a functional yeast telomere (Fig. 1A) (6). We modified the previous construction of Gottschling et al. (6) by replacing the 125-bp fragment that contains 81 bp of TG_1-3 and five Rap1p binding sites (5) with a synthetic 35-bp oligonucleotide containing two overlapping Rap1p sites (Table 1); this construct will be referred to as YIpADH-35 (Fig. 1C).

View larger version (41K): [in this window] [in a new window]   FIG. 1.   Transformation assays used to monitor telomere formation efficiency. (A) Replacement of the left telomere of chromosome VII with synthetic URA3 telomeres. Homologous recombination at the ADH4 locus replaces the terminal 17 kb of VIIL with a URA3 gene followed by different DNA inserts and 29 bp of TG1-3. Telomeres are formed when the short TG1-3 tract is elongated by de novo TG1-3 repeat addition mediated by telomerase (47) or by a recombination mechanism (see Fig. 4). The solid circle represents the centromere of chromosome VII. (B) C-terminal domain structure of the yeast telomere binding protein Rap1p based on data from several laboratories presented as in reference 27. The activation domain refers to activation of transcription; the rap1s domain refers to mutations that affect silencing at HMR and interaction with RIF1 (12); and the C-terminal domain refers to truncations that alter telomere length and telomeric silencing of established telomeres (27). (C) Synthetic telomeres used in this work. The ADH4 portion is not shown. Each telomere contains a BamHI site at the junction of the TG1-3, GT, or G2T repeats and the internal sequences.

View larger version (64K): [in this window] [in a new window]   FIG. 2.   Transformants exhibiting TPE have formed telomeres from the terminal 29-bp TG1-3 tract. Representative genomic DNAs from cells transformed with the indicated telomere (Fig. 1C) that exhibited TPE were digested with either StuI or StuI plus BamHI and were analyzed by Southern hybridization using the 3' StuI-NsiI fragment of URA3 as a probe. Telomeric URA3 is the URA3 telomere at VIIL, and ura3-52 is the chromosome V URA3 locus. The StuI-plus-BamHI digestion showed that the BamHI site was not deleted during telomere formation, indicating that de novo telomere addition was to the terminal 29-bp TG1-3 tract.

Enhancement of telomere formation is independent of SIR genes and TEL1. TPE is a property of telomere chromatin structure, similar to silencing at the yeast silent mating type cassettes HMRa and HML (1). Silencing at HMRa and HML requires the SIR1, SIR2, SIR3, and SIR4 genes, while TPE requires only SIR2, SIR3, and SIR4 (1), although tethering Sir1p to the telomere can increase TPE (2). Sir2p, Sir3p, and Sir4p are associated with telomere-proximal DNA (49). A folded-back telomeric chromatin structure requiring Sir2p, Sir3p, Sir4p, and Rap1p has recently been proposed to explain TPE (49). To determine if these gene products were important for this Rap1p-mediated enhancement of telomere formation, these experiments were repeated in strains bearing different sir mutations (Table 2). Telomere formation was monitored in sir2, sir3, and sir4 cells by Southern blot analysis of 6 to 12 transformants for each construction. All the sir mutants showed as much stimulation as the wild-type strain or more, indicating that these gene products are not required for this enhancement. These data indicate that telomere formation enhancement does not require SIR2, SIR3, SIR4, or the proposed folded-back telomeric chromatin structure but uses some other TPE-independent mechanism.

Internal Rap1p C termini are sufficient to enhance telomere formation. Rap1p binding can induce changes in the DNA helix (5), which might play a role in the enhancement of telomere formation that we observed. To determine whether the entire Rap1p molecule bound to internal DNA sites was required for telomere formation enhancement, different portions of the Rap1p C-terminal domain fused to the DNA binding domain of Gal4p were tested for their ability to stimulate the formation of telomeres containing internal Gal4p sites. Synthetic telomeres containing four Gal4p sites, which can bind eight Gal4p molecules (YIpADHGAL-35), were transformed into cells that contained no endogenous GAL4 gene (gal4 cells) and were expressing different Gal4p-Rap1p C-terminal fusions, and the efficiency of telomere formation was monitored (Table 3). Fusions containing amino acids 630 to 827 of the Rap1p C terminus, including the transcription activation domain, the Rif1p-Sir3p interaction domain, and the C-terminal domain (Fig. 1B), enhanced telomere formation as well as the six TEF sites. Thus, the Rap1p C terminus tethered by a different DNA binding domain can mediate telomere formation enhancement.

View larger version (32K): [in this window] [in a new window]   FIG. 3.   Expression of Gal4p-Rap1p fusions. Yeast cell extracts from YM708 cells expressing the indicated Gal4p-Rap1p fusion (100 µg/lane) were analyzed by Western blotting using a mouse monoclonal Ab to Gal4p amino acids 1 to 147 (see Materials and Methods). Amino acid numbers are shown as in Table 3. No plasmid, no Gal4p-Rap1p expression plasmid. The two panels show lanes from the same gel. The unusual migration of the 630-827 fusion and the multiple forms of some of the proteins have been observed in the analysis of these proteins in many different experiments (data not shown). These results indicate that differences in telomere formation enhancement (Table 3) cannot be accounted for by underexpression of various fusion proteins.

Telomere formation enhancement by internal Rap1p C termini is independent of the terminal TG tract. Telomere formation enhancement appeared to be due to stimulation by internal Rap1p C termini, as opposed to protection from degradation, because the nontelomeric Rap1p and Gal4p-Rap1p binding sites that stimulated formation were internal to the terminal TG_1-3 sequences in these telomeres. In addition, some Gal4p-Rap1p fusions failed to stimulate telomere formation, indicating that any Gal4p-Rap1p fusion binding to these sites was not sufficient to enhance telomere formation (Table 3). However, these data could not rule out a model in which the terminal TG_1-3 sequences can be degraded but the internal Rap1p C termini protect the chromosome terminus from degradation until telomerase can add telomeric sequences. Previous experiments have indicated that only a small number of T or G residues are required to seed telomere formation (16, 38). Alternatively, the internal Rap1p C termini form some structure that encompasses the two Rap1p sites in the 29-bp TG_1-3 tract and somehow protects the terminal TG_1-3 tract from degradation. Such a structure must be distinct from the recently proposed folded-back telomere chromatin because internal Rap1p sites can enhance telomere formation in strains lacking Sir2p, Sir3p, or Sir4p and TPE (Table 2), which should lack this structure (13, 49).

Telomere formation is not due to increased homologous recombination. An alternative model to explain these data is that the Rap1p C termini tethered to the TEF or GAL telomere constructions increase the frequency of homologous recombination that occurs during our telomere formation assay (Fig. 1A). To test this possibility, the YIpADH-35, TEF-35, and GAL-35 telomere constructs were inserted into the LEU2 gene in vitro (Fig. 4). These constructions were used to monitor the frequency of homologous integration at the LEU2 locus in gal4 cells and in gal4 cells expressing the Gal4p-Rap1p(653-827) fusion. The differences in the frequency of homologous integration were an order of magnitude less than the 20- to 36-fold stimulation of telomere formation in the TEF and GAL telomeres (Tables 3 and 4). Thus, telomere formation enhancement was not due to increased levels of homologous integration. An experiment with telomere formation on YACs described below also rules out increased telomere-telomere recombination (54) as a mechanism for enhancement of telomere formation (see Table 5 below). The sum of these data suggests that internal Rap1p C termini stimulate telomere formation by improving the cell's ability to lengthen or heal the chromosome terminus (see Discussion).

View larger version (36K): [in this window] [in a new window]   FIG. 4.   Rap1p sites do not increase the frequency of homologous integration at LEU2. To test if extra Rap1p sites increase the frequency of homologous integration during transformation, the HindIII-NotI fragments from YIpADH-35, YIpADHTEF-35, and YIpADHGAL-35 (see Table 2 and Materials and Methods) were used to disrupt LEU2 coding sequences in YM708 cells. The leu2::URA3-insert-TG1-3 constructs were used to transform LEU2 cells or LEU2 cells expressing a Gal4p-Rap1p fusion (containing Rap1p amino acids 653 to 827 [Table 3]). The number of Ura+ Leu yeast transformants for each construct was then normalized to the YIpADH-35 amount, and the results from duplicate experiments are shown. The range of values is ±20%.

Enhancement of telomere formation requires telomerase and is not due to recombination-mediated telomere formation. Telomere formation enhancement by Rap1p C termini could occur by stimulating telomerase activity or by an alternative pathway of acquiring TG_1-3 repeats such as a recombination-mediated mechanism (29, 41, 47, 60) (summarized in Fig. 5A). Telomerase contains an internal RNA which templates the addition of TG_1-3 repeats. The yeast telomerase RNA is encoded by the yeast TLC1 gene, deletion of which causes telomeres to shorten over successive divisions until cells die (47). Deletion of the yeast EST1 gene causes a similar phenotype (30, 52), and Est1p appears to play an important role in telomerase activity (23, 48), but not as a catalytic subunit of telomerase (3, 20, 26, 52). Two recombination pathways have been demonstrated, a nonreciprocal strand-copying mechanism (41) and a reciprocal transfer of subtelomeric repeats (29). The telomerase pathway requires TLC1 and EST1, while the recombination pathways should not, so only the recombination pathway can promote telomere formation in tlc1 cells. If the Rap1p C terminus-mediated enhancement of telomere formation occurs through the telomerase pathway, e.g., by increasing telomerase activity, loss of tlc1 or est1 function should reduce this enhancement and the YIpADH-35 and YIpADHTEF-35 telomeres should be formed at similar frequencies. However, if this enhancement depends on either recombination pathway, the relative telomere formation frequencies for YIpADH-35, YIpADHTEF-35, and YIpADHGAL-35 would still be the same in tlc1 or est1 mutants. To distinguish between these hypotheses, we determined whether tlc1 and est1 mutations altered Rap1p C-terminal telomere formation enhancement by forming telomeres in these mutant cells.

View larger version (28K): [in this window] [in a new window]   FIG. 5.   Telomere formation pathways on chromosomes and short YACs. (A) Telomeres can be formed on chromosomes by integration and subsequent elongation by telomerase or by two telomerase-independent pathways: a double reciprocal recombination event with the ADH4 locus and TG1-3 repeats (the TG1-3 repeats need not be cis to ADH4) or a nonreciprocal strand-copying event that has been shown to take place at the ends of linear plasmids during transformation (see the text). Both the telomerase-dependent and strand-copying pathways predict a single-stranded TG1-3 intermediate that is later made double stranded by DNA repair replication (60). (B) The 12-kb YAC vector for testing telomere formation in strains lacking telomerase RNA. One telomere contains 275 bp of TG1-3 sequences, while the other contains the YIpADH-35 and YIpADHTEF-35 telomeres (Fig. 1C). The close proximity of the two YAC telomeres allows the 275-bp TG1-3 repeats to serve as substrates for the test telomere in the strand-copying pathway of telomere formation (41).

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

In this study, a quantitative transformation assay for telomere formation at VIIL with a short telomere formation substrate, or seed, has revealed a novel function for the major yeast telomere binding protein Rap1p. Previous work from many laboratories has shown that the Rap1p C terminus inhibits the lengthening of established telomeres by acting at the chromosome terminus. The data presented here show that internally located Rap1p C termini can stimulate telomere formation in a telomerase-dependent manner. Because the telomere substrates used here require elongation of the TG_1-3 repeats to form a telomere, this system is a model for the stimulation of telomere elongation. Thus, internal Rap1p C termini on short telomeres most probably stimulate telomere lengthening, in contrast to the action of Rap1p at the ends of long, established telomeres (17). These results suggest a model in which a balance between the activities of internal Rap1p C termini, which stimulate telomere elongation, and those of terminal Rap1p molecules, which limit elongation, regulates telomere length (see below).

Telomere formation enhancement by internal Rap1p C termini occurred by a mechanism that was distinct from protection from degradation as judged by several criteria. First, the Rap1p C termini that enhance formation, tethered by either the Rap1p or Gal4p DNA binding domain, were located internal to the terminal TG tracts that seed telomere formation. Second, the folded-back telomere chromatin structure recently proposed to explain TPE was unlikely to be involved in the enhancement of telomere formation because cells lacking both SIR genes and TPE had as high or higher levels of telomere formation enhancement (Table 2). If the folded-back structure were involved in telomere formation enhancement by protecting the end from degradation, the level of enhancement should have been greatly reduced in sir mutants. Third, telomere formation enhancement occurred with telomere seeds that contained no Rap1p binding sites, so Rap1p binding to these terminal tracts was dispensable for enhancement. In the telomeres containing poly(GT) and poly(G₂T) seeds, the only binding sites for Rap1p and Gal4p were internal to these tracts (Table 1 and Fig. 1C). Fourth, the relative level of telomere formation enhancement was independent of the sequence of the terminal tract (Table 4). Since the individual tracts formed telomeres with different frequencies (in descending order, TG_1-3, GT, and G₂T) but the TEF and GAL constructs showed the same fold enhancement with all three telomere seeds, the internal Rap1p C termini function independently of the terminal tract. These results are inconsistent with a model in which the Rap1p C termini form a structure which protects the terminal tract; such a model predicts that the TG_1-3 tract with two Rap1p sites should show a much greater level of enhancement in the TEF-35 and GAL-35 constructs because the TG_1-3 repeats would be part of such a structure. The simplest explanation for all these data is that the internal Rap1p C termini enhance telomere formation by a mechanism that is independent of the terminal tract and so is distinct from the internal Rap1p C termini protecting the terminal tract from exonucleolytic degradation.

The Rap1p C terminus-mediated enhancement of telomere formation requires telomerase RNA (the product of the TLC1 locus) and is enhanced by Est1p (Table 5). When the tlc1 and est1 strains were tested for telomere formation by replacing VIIL (Fig. 1A) or on short YACs (Fig. 5), stimulation was greatly reduced in both cases. However, VIIL telomeres formed at such low rates in the tlc1 and est1 strains that, while the ~35-fold higher level of formation of the TEF-35 telomere compared to the YIpADH-35 telomere was reduced, the final level was highly variable. This low rate of formation in tlc1 and est1 strains made it impossible to use the telomere formation assay at VIIL to determine an accurate fold enhancement. Telomere formation on short linear plasmids can use an alternative, telomerase-independent mechanism to transfer sequences between linear plasmid ends (41, 54), which can allow the YIpADH-35 or TEF-35 telomere to acquire TG_1-3 sequences from the other end of the YAC (Fig. 5). We verified that telomere formation enhancement mediated by internal Rap1p molecules occurred in this system. The fold enhancement was smaller, most probably because the telomerase-independent mechanism increases the absolute number of YIpADH-35 telomere formation events. By use of short YACs, larger numbers of telomere formation events were obtained in tlc1 and est1 cells, which allowed an accurate comparison between the rates of YIpADH-35 and TEF-35 telomere formation. These data show that telomerase RNA and therefore active telomerase, as well as Est1p, must be present in the cell in order for the internal Rap1p molecules to stimulate telomere formation. Est1p is a single-stranded TG_1-3 binding protein that coimmunoprecipitates with telomerase RNA and activity (23, 48, 52) but is probably not a part of the core catalytic enzyme (3, 20, 25).

Our results suggest a model in which internal Rap1p C termini play a role in telomere length control. We propose that the Rap1p C terminus stimulates the elongation of short telomeres by increasing telomerase activity in cis. We suggest that one of the many components that can interact with the Rap1p C terminus is a protein that can either attract the telomerase enzyme or increase its activity, so we refer to this protein as the telomerase accessory subunit (Fig. 6). If the telomere is short because of chromosome breakage or degradation, the activated telomerase can add telomere repeats to the nearest available substrate (Fig. 6), which in most cases will be the chromosome terminus that need not be capped by telomere sequences (16, 38). Data from other laboratories indicate that if the telomere is long or of normal length, Rap1p molecules bound to the chromosome terminus interact with factors there to block telomerase access and prevent lengthening (4, 17, 18). In our model, these inhibitory factors would be absent from short telomeres. The simplest form of this model is that telomerase is always attracted by internal Rap1p C termini but its action at chromosome ends is determined by whether the Rap1p molecules at the chromosome terminus can block telomerase access. This model parallels the results in Table 4, where formation enhancement by internal Rap1p C termini was independent of the sequence at the chromosome terminus. A direct consequence of this model is that attracting telomerase to normal-length telomeres where lengthening is blocked is futile, and only those telomeres that are short (i.e., without the inhibiting Rap1p at the chromosome terminus) will be elongated. These "futile" cycles in wild-type cells provide a way to constantly monitor telomere length and keep it within a set range. When telomeres become too short, Rap1p at the terminus no longer inhibits telomere lengthening (see below) and elongation occurs. If telomerase always adds a constant number of TG_1-3 repeats equivalent to the amount of sequence lost over several cell cycles, only a few active telomerase molecules are required to maintain all telomeres within a constant range of lengths. Those telomeres that become too long would be shortened by telomere deletion mechanisms (21).

View larger version (34K): [in this window] [in a new window]   FIG. 6.   Speculative model for Rap1p C terminus-mediated enhancement of telomere formation and length regulation. (A) A telomerase subunit (see the text) interacts with internal Rap1p C termini. (B) The telomerase subunit provides a docking site for the catalytic subunits of telomerase or serves to increase telomerase activity. (C) If a short telomere or broken chromosome end is near the bound Rap1p C termini, telomerase can bind to the free 3' end and add telomeric repeats. The free 3' end need only have limited homology to telomerase RNA (16, 38). If the TG1-3 repeats are long, then the Rap1p and chromosome terminus-specific factors bound at the chromosome end (e.g., Cdc13p, Stn1p, Est1p) block telomerase access to the 3' end and no lengthening occurs (7, 17, 24, 40, 52) (see the text). Over the course of many cell divisions, the combined actions of telomerase recruitment and inhibition of elongation at only those telomeres with normal lengths maintains all chromosomal telomeres within the same length range. A model similar to the activity at short telomeres was previously proposed by Kramer and Haber (16) to describe TTGGGG-stimulated telomere formation in yeast, but the proteins involved in that stimulation were not identified (see the text).

These considerations suggest that Rap1p C termini at different locations within the telomere repeats are seen differently by the cell. These differences may reflect interactions with different sets of proteins at these sites, such as Cdc13p, Est1p, Stn1p (7, 24, 40, 52), and other single-stranded TG_1-3 binding factors (15, 22). In addition, recent work has shown that yeast cells monitor the number of Rap1p C termini at each telomere (35, 42). The cell may determine if the most distal Rap1p C terminus is inhibitory by "counting" the number of Rap1p C termini from the telomere-nontelomere junction.

Our model claims that telomerase mediates the Rap1p C terminus-dependent enhancement of telomere lengthening because a telomerase accessory subunit is part of telomeric chromatin structure (Fig. 6). This model is consistent with previous results showing that overexpression of a truncated TLC1 RNA (47) and the Rap1p C terminus (56) can have similar effects on TPE, which is dependent on telomere chromatin structure (1). Presumably, both telomerase RNA and the Rap1p C terminus compete for telomere-associated proteins critical for maintaining normal telomere structure and TPE. The shorter telomeres in cells overexpressing TLC1 RNA (5a, 47) are also consistent with the model, as excess telomerase RNA is expected to compete for telomerase protein subunits. Removal of the proposed telomerase accessory subunit from internal Rap1p C termini would reduce the frequency with which telomerase is brought to or activated at the telomere, reducing the frequency of telomere elongation and causing a net shortening of telomeres.

The concept that proteins that bind at or near the telomere can directly or indirectly attract telomerase can explain several previous observations in yeast and human cells. In HeLa cells, telomere formation can be seeded by telomere repeats, but a large number of repeats is necessary for efficient formation (10). These requirements could reflect a similar property of internally bound human telomere repeat factor, TRF1, to attract or stimulate telomerase activity at short telomeres and, similarly to Rap1p, inhibit telomere elongation on existing telomeres (51). Internal TTGGGG sequences have been shown to stimulate telomere formation in yeast (16, 38). Tbf1p is a protein that binds to TTAGGG repeats in the telomere-associated X repeats that can also bind to TTGGGG (28). If Tbf1p can also attract telomerase, X repeats could form an efficient back-up mechanism for stimulating telomere formation in the event of loss of the terminal TG_1-3 sequences. Telomerase would be attracted to sequences within X elements and add telomere sequences to the nearby broken end. Thus, this model can explain telomere behavior in human cells and provides a mechanism for telomere formation or chromosome "healing" in the event of catastrophic loss of telomere repeats.