Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1339-1348, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Regulator of Nitrate Assimilation in
Ascomycetes Is a Dimer Which Binds a Nonrepeated, Asymmetrical
Sequence
Joseph
Strauss,1,2,
M. Isabel
Muro-Pastor,1 and
Claudio
Scazzocchio1,*
Institut de Génétique et
Microbiologie, Université Paris-Sud, URA D2225, 91405 Orsay
Cedex, France,1 and
Institut
für Biochemische Technologie und Mikrobiologie, Technische
Universität Wien Vienna, Austria2
Received 6 October 1997/Returned for modification 13 November
1997/Accepted 11 December 1997
 |
ABSTRACT |
The regulation of nitrate assimilation seems to follow the same
pattern in all ascomycetes where this process has been studied. We show
here by in vitro binding studies and a number of protection and
interference techniques that the transcription factor mediating nitrate
induction in Aspergillus nidulans, a protein containing a
binuclear zinc cluster DNA binding domain, recognizes an asymmetrical sequence of the form CTCCGHGG. We further show that the protein binds to its consensus site as a dimer. We establish the role of the
putative dimerization element by its ability to replace the analogous
element of the cI protein of phage
. Mutagenesis of crucial leucines
of the dimerization element affect both the binding ability of the
dimer and the conformation of the resulting protein-DNA complex. This
is the first case to be described where a dimer recognizes such an
asymmetrical nonrepeated sequence, presumably by each monomeric subunit
making different contacts with different DNA half-sites.
 |
INTRODUCTION |
A number of transcription factors of
the ascomycetes contain a specific DNA binding motif, the Zn binuclear
cluster. In this taxonomic group, almost all processes where a specific
inducer elicits the transcription of genes involved in a single
metabolic pathway are mediated by proteins comprising this motif. The
Zn binuclear cluster motif has a canonical sequence Ala/Ser Cys 2X Cys
6X Cys 5-17X Cys 2X Cys 5-7X Cys. Two Zn atoms and the six cysteines
form a tetrahedrally coordinate complex where cysteines 1 and 4 chelate
both Zn atoms (24, 25). The third loop usually consists of
five to eight residues and contains a conserved proline in the fifth
position, but the thoroughly studied AlcR protein of Aspergillus
nidulans has a much longer loop and lacks the canonical proline
(17). A subgroup of these proteins binds as a dimer to an
inverted repeated sequence of the form CGG-nX-CCG, where n is 11 for Gal4p, 10 for Put3p, and 6 for Ppr1p of
Saccharomyces cerevisiae, 11 for Lac9p of
Kluyveromyces lactis, and 6 for the UaY protein of A. nidulans. These proteins contain a dimerization element, separated
from the DNA binding domain by a variable linker. Thus, it is the
nature of this linker that determines the specificity of binding
(23, 29). The differences between Gal4p and Lac9p, on the
one hand, and Ppr1p and UaY, on the other, are accounted for by the
fact that the linker of the latter forms a
-sheet which shortens the
distance between the dimerization element and the DNA binding domain
(13, 24, 25, 32). Recently, it has been shown that Cyp1p
(Hap1p) recognizes a direct repeat of the same base composition as
those of the above proteins and that Leu3p and probably Pdr3p recognize
identical everted repeats (14, 36). However, it should be
noted that an everted repeat of a CGG motif is formally identical to an
inverted repeat of the complementary sequence CCG. However, the
difference between everted and complementary inverted repeats is
structurally important, because it implies that the two Zn clusters in
the dimer structure have opposite orientations (14) and
hence that the topology of dimerization is a determinant of
specificity. It has been stated or implied that the CGG motif repeated
in a variety of orientations and at different distances is the
universal recognition motif for the binuclear Zn clusters (14,
29).
While this is correct for a number of proteins of this class, this
generalization is not warranted by the data. The AlcR and NirA proteins
of A. nidulans do not recognize motifs which could be
reduced to the CGG sequence in any form. Furthermore, AlcR has been
reported to recognize direct, inverted, and everted repeats, with the
last two separated by a variable number of base pairs. The solution to
this apparent paradox is simple: AlcR is able to bind as a monomer
(8, 18, 19, 22).
In this publication, we describe in detail the mode of binding of NirA.
This protein mediates nitrate induction of the niaD, niiA, and crnA genes of A. nidulans,
which encode nitrate reductase, nitrite reductase, and a nitrate
permease, respectively (4, 5, 9, 34). We have summarized
(28) data that suggest strongly that this protein and its
cognate DNA binding sequences are conserved among the ascomycetes that
are able to assimilate nitrate. Experimental interspecies
complementation data (as distinct from similarity data, which are
available for many other fungi) are available for organisms as
distantly related as A. nidulans, Neurospora
crassa, and Fusarium oxysporum (28). Figure
1 shows the amino acid sequence of the Zn
cluster and cognate putative dimerization and linker sequences of the
NirA protein and the homologous NIT4 protein of N. crassa.
Recently, in vivo footprinting data has proven the conservation of
binding sites among A. nidulans, Penicillium
chrysogenum, and Aspergillus niger (34a). We
have proposed that the sequence bound by NirA is the asymmetrical
sequence 5'CTCCGHGG (where H stands for A, C, or T, not G).
Four such sequences are present in the intergenic region which lies
between the divergently transcribed niiA and niaD
genes. The physiological role of each NirA binding sequence was
demonstrated by deletion and/or point mutation experiments
(28).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of the zinc cluster and putative linker and
dimerization domains of the NirA and Nit4 proteins. The NirA and Nit4
sequences were described previously (5, 35). The putative
dimerization domains shown for NirA (A and B) are those predicted by
Schjerling and Holmberg (30). Numbers indicate the positions
of residues in the translated protein sequences in the above-mentioned
references.
|
|
Here we show rigorously that the 8-bp DNA sequence bound by NirA is
indeed asymmetric. Moreover, we show that the NirA protein necessarily
binds as a dimer.
 |
MATERIALS AND METHODS |
Strains.
The following Escherichia coli strains
were used. DH5
[F
endA1 hsdR17
(mK+ rK
) supE44
thi-1 recA1 gyrA96 relA1
lacU169 (f80d-lacZ
M15)]
was used for routine plasmid preparation; CSH50 [
(pro
lac) F
(proAB
lacIqZ
M15)
traD36] was used in phage immunity tests; and CJ236
[dut-1 ung-1 thi-1 relA1; pCJ105 (Cmr)] was
used in the in vitro mutagenesis experiments.
Recombinant plasmids.
The pNirA(1-121) plasmid was
constructed by subcloning an NcoI(filled
in)-EcoRI fragment from pGex2T-NirA (28) into the NdeI(filled in)-EcoRI sites of plasmid pET22-b(+)
(Novagen). A second plasmid, pNirA(1-222) was generated by ligating an
NcoI(filled in)-BclI nirA fragment
into the NdeI(filled in)-BamHI sites of pET22-b(+).
For mutagenesis purposes, an XbaI-EcoRI fragment
from pNirA(1-121) was subcloned into pBluescriptII KS(+) (Stratagene)
digested with XbaI-EcoRI. The mutated fragments
were reintroduced into pET22-b(+) digested with
XbaI-EcoRI.
In all pET22-b(+) derivatives, the nirA fragments are under
the control of the bacteriophage T7 promoter.
pC132 and pC135 (7) are plasmids that direct the synthesis
of the
repressor (cI)-Rop fusion protein under the control of the
pLac promoter. pC135 differs from pC132 only in the codon encoding
Asp32 of Rop, which is replaced by a TAA nonsense codon. pC132 and
pC135 were kindly supplied by F. Gigliani and G. Cesareni, respectively.
The pcI-NH2 plasmid was constructed from pC132 by
elimination of the rop gene (excised as a
HindII-XmaI fragment) followed by filling in
and religation.
The pcI-NDD plasmid was obtained from pC132 by replacing the
rop gene (excised as a SalI-BamHI
fragment) with the putative NirA dimerization domain-coding fragment.
The nirA fragment coding for amino acid residues 78 to 148 was amplified by PCR primed by specific oligonucleotides containing
SalI and BamHI sites at their 5' and 3' ends,
respectively. The following oligonucleotides were used:
5'GCATGTCGACACACCGGCGAAAAGGAG3' and
5'GCATGGATCCGCTATACCGCATTTGACAGCC3'.
NirA proteins used in binding and footprinting assays.
The
preparation of the GST-NirA(1-125) fusion protein has been described
previously (28). The NirA(1-125) peptide was prepared as
follows. GST-NirA fusion protein (28) was cleaved with
thrombin from human plasma (Sigma, St. Louis, Mo.). A 10-U portion of
thrombin/µg of fusion protein was incubated for 30 min at 25°C in
150 mM NaCl-16 mM Na2HPO4-4 mM
NaH2PO4-2.5 mM CaCl2. Cleavage
products were separated on glutathione-Sepharose columns (Pharmacia,
Uppsala, Sweden) as specified by the manufacturer and analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
The NirA(1-121) and NirA(1-222) proteins were obtained by in vitro
transcription and translation with appropriate pET22-b(+) derivative
plasmids.
In vitro transcription and translation.
In vitro protein
synthesis was carried out with the TNT T7 coupled reticulocyte lysate
system (Promega). The reactions were carried out as recommended by the
manufacturer. The amounts of NirA protein present in the
transcription-translation reaction mixtures were determined, when
necessary, by Western blot analysis. Translation products were analyzed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12%
polyacrylamide) as described previously (21). Prestained
low-molecular-weight markers (Bio-Rad) were used as molecular weight
standards. After electrophoresis, the proteins were transferred to
nitrocellulose filters (pore size, 0.2 µm; Schleicher & Schuell) and
immunoblotted with antiserum against the N-terminal portion of NirA
(amino acids 1 to 125), kindly supplied by F. Lema. Antigen-antibody
complexes were revealed by enhanced chemiluminescence detection
(Amersham). The translated products were used immediately for DNA
binding gel mobility shift experiments or stored at
80°C.
Mobility shift assays.
Binding reactions for mobility shift
assays were as described previously (28). For the in vitro
transcription and translation products, 5 to 10 µl of the translation
mixtures was used in the binding reactions.
Radiolabelled double-stranded oligonucleotides for mobility shift
assays were prepared as follows. Equimolar amounts of single-stranded oligonucleotides were annealed in annealing buffer (100 mM Tris-HCl [pH 8.0], 150 mM NaCl) by heating the mixture for 2 min at 95°C and
cooling it to 40°C in a thermocycler over a period of 3 h. Then
the mixtures were chilled on ice. The receding ends of the double-stranded oligonucleotides were filled in with Sequenase version
2.0 (Amersham) and [
-32P]dCTP as specified by the
manufacturer. The reaction products were purified on a 6%
nondenaturating polyacrylamide gel, and approximately 10 pmol
(104 dpm) was used together with 500 ng of purified
NirA1-125 in the mobility shift assay. The single-stranded
oligonucleotide used to fill in the wild-type and mutant probes for
binding site 2 (WT, 1A, 2G, 3G, 4G, 5A, 6G, 7T, 8T, and HS) was
5'CTGCCTGAATTT3'. The sequence of the complementary strand
for binding site 4 (WT and 6/7GA) was 5'CTGCCTTTCAGC3'. In
experiments determining the relative binding efficiencies of
oligonucleotides containing wild-type or mutated binding sequences, the
protein concentrations were calibrated to yield an approximately 1:3
ratio of bound to free probe. The ratio between free and bound probe
was determined by excising bands from the gel and Cerenkov counting the
gel slices. The percentage of probe shifted was obtained by dividing
the disintegrations per minute of each shifted probe by the
disintegrations per minute of the corresponding free probe. The ratio
obtained for the wild-type probes WT2 and WT4 was set to 100%, and the
ratios for mutant probes are relative to that of the wild-type probes.
Protection and interference assays.
The restriction
fragments used for the footprinting assays were as follows: for site 1, the DdeI (30)-ClaI (230) fragment [
-32P]dCTP labelled in the upper strand and
[
-32P]dATP labelled in the lower strand; for site 2, (i) the ClaI (230)-DdeI (439) fragment
[
-32P]dCTP labelled in both strands and then digested
with HpaII (305) to obtain the HpaII
(305)-DdeI (439) fragment [
-32P]dCTP
labelled in the upper strand, and (ii) the HpaII
(305)-BanI (471) fragment [
-32P]dCTP
labelled in both strands and then digested with DdeI (439) to obtain HpaII (305)-DdeI (439)
[
-32P]dCTP labelled in the lower strand; for site 3, the HinfI (731)-DdeI (948) fragment
[
-32P]dATP labelled in the upper strand and
[
-32P]dCTP labelled in the lower strand; and for site
4, the BamHI (927)-HpaII (1093) fragment
[
-32P]dCTP labelled in the upper strand and the
BamHI (927)-EcoRI (1268) fragment
[
-32P]dCTP labelled in the lower strand. End-labelled
DNA fragments derived from the niiA-niaD intergenic region
were subjected to footprinting analysis by the different protection and
interference methods described below.
Methylation protection footprinting, methylation interference, and
depurination interference assays were carried out as described previously (10).
Depyrimidination mixtures (20 µl) containing 50 ng (105
dpm) of end-labelled probe and 2 µg of yeast tRNA were chilled on ice for 5 min. Hydrazine (30 µl; Sigma) was added, and the mixture was
incubated for 7 min at 20°C. The reactions were stopped by adding 60 µl of 3 M sodium acetate (pH 7.0), and the DNA was ethanol precipitated. The precipitation was repeated twice, and the DNA was
washed with 70% ethanol and resuspended in 20 µl of water. Binding-reaction mixtures containing 5 ng (104 dpm) of
probe and 0.5 to 1 µg of purified protein were used for binding
reactions as described previously (10). Free and bound probes were separated, recovered, and cleaved with piperidine (26). The reaction products were analyzed on a 6%
polyacrylamide-urea sequencing gel.
Phosphate contact interference assays were carried out as follows. To
obtain partially ethylated probes, end-labelled fragments (50 ng
containing 105 dpm) were incubated for 15 min at 50°C in
50-µl mixtures containing 2 µl of cacodylate buffer (0.5 M sodium
cacodylate, 10 mM EDTA), 2 µg of yeast tRNA, and 30 µl of a
saturated solution of nitroso-ethyl-urea in 96% ethanol (Sigma).
Stopping of the reaction, purification of the ethylated probe and
binding assays were as described above. Separated free and bound probes
were cleaved at modified phosphates by incubating recovered DNA in 50 µl of phosphate buffer (50 mM Na2HPO4, 5 mM EDTA [pH 7.0]) at 90°C for 15 min. Subsequently, 2 µl of 1 M NaOH was added to the mixture, and incubation was continued for another 30 min at 90°C. Cleaved DNA was ethanol precipitated, washed twice with
70% ethanol, and analyzed on a sequencing gel as described above.
Maxam-Gilbert sequencing reactions of the same fragment were run in
parallel with the probes. In all these studies, the protein
concentration used was calibrated by a mobility shift assay to yield an
approximately 1:1 ratio of bound to free probe.
Mutagenesis of the conserved leucines.
Oligonucleotide-directed mutagenesis was used to generate mutants with
site-specific mutations in the NirA dimerization domain.
The nirA cDNA fragment containing the dimerization region
was cloned into pBluescriptII KS(+) in the negative orientation, and
thus the mutated priming oligodeoxynucleotides correspond to the coding
strand of the nirA gene. In the oligonucleotides shown
below, numbers in parentheses refer to nucleotide positions in the
nirA locus (5) and boldface characters indicate
mutated bases:
Mutagenesis was carried out as previously described
(20). Five picomoles of each oligonucleotide, phosphorylated
with T4 DNA kinase, was hybridized to 0.2 pmol of uracil-containing
single-stranded DNA. The single-stranded DNA template was prepared
after transformation of CJ236, an E. coli strain which
contains the dut ung double mutation, with the pBluescript
derivative plasmid and subsequent infection with the M13KO7 helper
phage. The complementary strand of DNA was synthesized in the presence
of T4 DNA polymerase and T4 DNA ligase. The double-stranded DNA was
transformed into competent DH5
cells (Bethesda Research
Laboratories), and clones were screened directly by DNA sequencing.
Phage immunity test.
Bacterial cells transformed with
plasmids expressing different
repressor fusion proteins were tested
for sensitivity to
phages. Phages of different virulent phenotype
were assayed by spot tests, at concentrations varying from
102 to 104 phages per spot, on lawns of
transformed bacteria. The
phage used as a wild-type control is that
of Bailone and Galimbert (2), and
vir is
668, an
ultravirulent phage carrying several mutations affecting both lambda
operators (2).
 |
RESULTS |
Binding of NirA protein to wild-type and mutant probes.
There
are four NirA binding sites in the intergenic region between
niiA and niaD. All these sites are involved in
the induction of either or both genes (28). The four sites
correspond to the consensus sequence CTCCGHGG. We shall
number the bases 5' to 3' from 1 to 8 in the top strand and from 1* to
8* in the bottom strand (Fig. 2).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Summary of protection and interference footprinting
studies on all four consensus NirA binding sites in the
niiA-niaD intergenic region. For the sake of consistency,
the orientations of sites 2 and 3 have been inverted with respect to
their orientations in the intergenic region. Hence, upper strands in
sites 1 and 4 are niaD coding strands whereas upper strands
in sites 2 and 3 are niiA coding strands. Regions protected
from DNase I digestion are shown as brackets above and under each
strand (28). Dots represent guanine contacts identified by
methylation protection. Triangles between bases symbolize phosphate
contacts identified by ethylation interference. Purine contacts
(squares) or pyrimidine contacts (diamonds) were identified by
missing-base interference, and symbols above the line between the two
strands denote contacts on the upper strand whereas symbols under this
line denote contacts on the lower strand. In all cases, solid and open
symbols represent strong and weak protection or interference,
respectively. Both depurination and depyrimidination interference
experiments were carried out for sites 2 and 3; only depurination
interference was carried out for sites 1 and 4. Footprint experiments
for sites 1, 3, and 4 were carried out with the GST-NirA(1-125) fusion
protein, while all techniques used for site 2 were carried out both
with the GST-NirA(1-125) fusion protein and with the NirA(1-125)
peptide with virtually identical results (see Fig. 3 through 5). See
Materials and Methods for descriptions of probes and footprinting
techniques used. Numbers indicate the position of the first nucleotide
shown for each sequence in the niiA-niaD intergenic region
as previously described (28). Note that the boundaries of
DNase I protection do not always correspond exactly to those published
previously (28). Careful densitometry was carried out on the
gels used to construct this figure, and while exact boundaries could be
somewhat subjective, we believe the present ones to be accurate.
|
|
Previous work carried out with a glutathione S-transferase
(GST)-NirA(1-125) fusion protein suggested strongly that NirA binds to asymmetrical, nonrepeated sequences. We have now carried out similar
experiments with a NirA protein not carrying any GST sequences in order
to eliminate any artifacts due to GST dimerization sequences, artifacts
known to occur for the AlcR-DNA complex (22). We have extended the analysis to mutations in all nucleotides of the consensus sequence and have estimated quantitatively the effect of each mutation.
The results are shown in Table 1. All
bases of the CTCCGHGG consensus sequence are essential for
binding. C1 cannot be replaced by an A, and this shows that the
palindromic sequences TCCGCGGA, CCGCGG, and
CC2XGG, which are found within one or more NirA binding sites, are not
recognized by NirA. Table 1 shows that a G3 is not acceptable, while
previous data showed that a T3 is not acceptable (28). It
can be proposed that the consensus sequence is an imperfect variant of
the palindromic sequence CTCCGGAG. This is shown not to be
the case for probe 6/7GA (Table 1). The base in position 6 can be A, T,
or C but not G (Fig. 2), which would be the base symmetrical with the C
in position 3. It can be further proposed that the consensus sequence
is an imperfect variant of a longer, 10-bp symmetrical sequence,
CTCCGCGGAG (probe HS). Table 1 shows that this longer,
symmetrical sequence has no higher affinity for NirA than the
asymmetrical, physiological sequence it contains. This was confirmed by
gel shift experiments where the concentration of protein varied from
that resulting in 10% binding of the probe to saturating
concentrations. The kinetics of binding of the wild type and the 10-bp
symmetrical sequence (HS) are, within the limits of this technique,
identical (results not shown). Figure 3
gives an example of a gel retardation experiment of the type used to
obtain the data shown in Table 1. We show, in this figure, the effect
of mutating the crucial first C to A.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Summary of the gel shift analysis of 10 double-stranded
DNA oligonucleotides containing mutations in the core
binding sequencea
|
|

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 3.
Gel retardation experiment with the wild type and a
mutant probe. In this experiment, we give a semiquantitative example of
the effect of a point mutation on binding of the NirA(1-125) peptide.
The probes used are WT2 (right) and 1A (left). Lanes: 1, free probe; 2 through 4, probes incubated with 360, 240, and 120 ng of protein,
respectively. The results shown in Table 1 were obtained with probes
incubated with 500 ng of protein.
|
|
Footprint analysis of the NirA-DNA binding.
We have
investigated the binding of a GST-NirA(1-125) fusion protein by DNase
I protection, missing-base (both purines and pyrimidines) interference,
and methylation protection and/or interference. When both methylation
techniques were used (site 2), the results were very similar. We have
investigated the symmetry of binding for all natural sites by
determining the phosphate contacts by ethylation interference. For one
site (site 2), the one with the most important role in vivo, we have
repeated all footprinting techniques (except DNase I protection) with
the NirA(1-125) peptide cleaved from the GST protein. The collated
results obtained with the fusion protein are shown in Fig. 2. The
results obtained with the GST-NirA(1-125) fusion protein and with the
NirA(1-125) peptide are virtually identical for all the techniques
(but see below), validating the results shown in Fig. 2. For one of the
techniques, depurination interference, we show comparatively the
results with the GST-NirA(1-125) fusion protein and the NirA(1-125)
peptide (Fig. 4). The results of
depyrimidination interference and ethylation interference of site 2 carried out with the NirA(1-125) peptide are shown in Fig.
5. Densitometric analysis of missing-base
interference, methylation interference, and protection and ethylation
interference results obtained with the NirA(1-125) peptide and site 2 are shown in Fig. 6. The results of
densitometric analysis of methylation protection of all three other
sites complexed with the GST-NirA(1-125) fusion protein are virtually
identical to that shown in Fig. 6B for site 2, including the
quantitative differences in the extent of protection of the different
G's (data not shown).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
Purine missing-base interference footprints of
GST-NirA(1-125) fusion protein (A) and NirA(1-125) peptide (B) on
site 2 of the niiA-niaD intergenic region. "upper" and
"lower" refer to strands as in Fig. 2. fp, free probe; b, bound
probe. Only the sequence of the limited region bracketing the NirA
binding sequence is shown. Solid squares, strongly interfering purines;
open squares, partially interfering purines. The probe for site 2 is as
described above. Footprint experiments have been carried out at least
twice with identical results.
|
|

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
Pyrimidine missing-base (A) and ethylation (B)
interference footprints of NirA(1-125) peptide on site 2 of the
niiA-niaD intergenic region. "upper" and "lower"
refer to strands as in Fig. 2. fp, free probe; b, bound probe; Py,
Maxam-Gilbert pyrimidine reaction used as the sequence standard; filled
symbols, strongly interfering bases or phosphates; open symbols,
partially interfering bases or phosphates. squares (A), pyrimidines;
triangles (B), phosphates. The probe is as described above. Footprint
experiments have been carried out at least twice with identical
results.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Densitometric scanning of footprints of binding site 2. (A) Methylation interference analysis, showing reduction in relative
binding as a consequence of methylation of guanines. (B) Methylation
protection analysis, showing reduction in relative methylation of
guanines in the protein-DNA complex. (C) Purine and pyrimidine
missing-base analysis, showing reduction in relative binding as a
consequence of loss of each nucleoside. (D) Reduction in relative
binding as a consequence of ethylation of each phosphate. Differences
in the labelling of the lanes were normalized by equating the
absorbance of bands clearly outside the interfering area for the free
and bound lanes. All the experiments were carried out with the
NirA(1-125) peptide; the probe is as in Fig. 2 through 4.
|
|
The conclusions of this study are straightforward. Loss of any of the
eight bases of the consensus sequence in either strand interferes
strongly with NirA binding. Loss of the variable base in position 6 (and of its complement, 3*) interferes strongly, irrespective of its
nature. Missing-base interference (Fig. 6C) does not shed any light on
the issue of symmetry of binding, except by the fact that all bases in
an asymmetric sequence interfere without any suggestion of "internal
symmetry" within the consensus. Methylation protection and, when
studied (site 2), interference patterns are imperfectly symmetric. An
obvious asymmetry is the strong interference found for G7.
While missing-base interference and methylation protection patterns are
very similar in the four sites, phosphate contacts, as revealed by
ethylation interference, show some differences between sites. Sites 2 and 3 show very similar patterns of phosphate contacts. It should be
noticed that sites 2 and 3 have a C · G pair in the variable
position, while sites 1 and 4 have T · A and A · T,
respectively. Flanking sequences may also have some influence in the
pattern of phosphate contacts (see Discussion). The phosphate contacts
are not compatible with a symmetric pattern of binding for any of the
four sites (Fig. 5 and 6). The interference by ethylation of the 2-3 bond, found in all four sites, has no equivalent in the 2*-3* bond. The
strong interference by ethylation of the 4*-5* and 5*-6* bonds at sites
2 and 3 does not have a symmetrical counterpart in the 4-5 and 5-6 bonds. When phosphate contacts are seen in flanking sequences, these
are also arranged completely (sites 2 and 3) or partially (sites 1 and
4) asymmetrically.
There are some minor differences between the ethylation interference
results shown in Fig. 2 and 6D for site 2. The weak interferences seen
in Fig. 6 (e.g., between positions 5 and 6 and positions 2* and 3*) are
probably not genuine differences between the NirA(1-125) peptide and
the GST-NirA(1-125) fusion protein but a result of the sensitivity of
the densitometric methods used to calculate the data in Fig. 6.
However, the phosphate contact 5' of position 1 (Fig. 2) is not seen in
the experiments carried out with the NirA(1-125) peptide and
constitutes the only genuine qualitative difference observed between
the GST-NirA(1-125) fusion protein and the NirA(1-125) peptide. This
difference does not affect the pattern of asymmetry of phosphate
contacts seen for site 2 with the GST-NirA(1-125) fusion protein and
the NirA(1-125) peptide as discussed above.
NirA binds DNA as a dimer.
Two NirA partial peptides of
different lengths were synthesized either separately or together from a
vector containing a T7 promoter, by using an in vitro
transcription-translation coupled system. The formation of the
heterodimer was evident in gel shifts with a 239-bp
32P-labelled restriction fragment containing binding site 2 as a probe (Fig. 7). Heterodimers were
never obtained when analogous His-tagged proteins expressed in E. coli were purified and mixed (data not shown), in either the
native or denatured form (followed by renaturation). A similar
situation has been described for Gal4p (6).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
NirA binds DNA as a dimer. A coupled in vitro
transcription-translation system was used to synthesize NirA(1-121)
and NirA(1-222) either singly or jointly. A 239-bp
ClaI-BanI fragment containing the NirA binding
site 2 was used as a probe. The position of the heterodimer is
indicated by an arrow.
|
|
Note that the NirA(1-121) protein used in this and previous
experiments contains only the first, amino-terminal dimerization domain
proposed by Schjerling and Holmberg (30), while the
NirA(1-222) protein contains both domains. Therefore, the
amino-terminal domain is sufficient for dimerization. The crucial
importance of this domain is demonstrated by in vitro mutagenesis (see
below). However, the carboxy-terminal dimerization domain does play a
role. The difference in the affinity for the probe between the
NirA(1-121) and NirA(1-222) proteins (Fig. 7) is genuine and has been
observed in several independent experiments.
Mapping the NirA dimerization domain.
We assumed that a
coiled-coil dimerization element is present in NirA in a position
similar to that of other proteins of this group. Since the sequences
bound by NirA are identical to those bound by the N. crassa
protein NIT4, we assumed that the essential residues of linker and
dimerization elements had to be conserved. Interestingly, while the Zn
cluster and putative linker domains are almost identical between the
two organisms, the sequence of the putative dimerization domain is not
so highly conserved. However, hydrophobic amino acids are present at
crucial positions of both proteins. Two coiled coils, comprising
residues 98 to 111 and 115 to 139, have been predicted within the
region following the zinc cluster of NirA (30). We have
tested the dimerization activity of a peptide encompassing the whole
putative dimerization element, from residues 78 to 148 of the NirA
protein (Fig. 1). The nirA fragment coding for this peptide
was introduced into a vector containing a sequence coding for the
cI DNA binding domain without its dimerization sequences. Since the cI
repressor functions as a dimer, substituting its dimerization domain
with a heterologous protein region leads to a functional repressor only
if the heterologous region is able to dimerize (3, 15). The
results are shown in Fig. 8. The putative
NirA dimerization domain is able to confer DNA binding activity to the
cI DNA binding domain. This is seen by the immunity to wild-type
phage (but not to an ultravirulent
phage, multiply mutated in both
oR and oL) conferred by
the appropriate plasmid to E. coli cells.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 8.
Phage immunity test. phages of wild-type ( ) and
ultravirulent ( vir) phenotypes (2) were
assayed on lawns of bacteria by spot tests at increasing phage titers
(from left to right, 102, 103, and
104 PFU per spot). Bacteria were transformed with plasmids
containing the repressor fused to the actual or putative
dimerization elements indicated below. "none," CSH50 E. coli cells transformed with pcI-NH2 (expressing the
NH2-terminal domain of repressor without any putative
dimerization element); NirA, the same cells transformed with pcI-NDD,
containing the putative NirA dimerization domain; Rop, a positive
control transformed with pC132, expressing a cI-Rop fusion (the Rop
protein efficiently dimerizes to form a bundle of four antiparallel
helices); Rop*, transformed with pC135 expressing a cI-Rop* fusion with
a mutated Rop protein unable to dimerize (7).
|
|
Mutagenesis of the NirA dimerization domain.
To determine
whether dimerization was a prerequisite for binding, we mutagenized the
leucines included in a putative coiled-coil domain of the NirA(1-121)
protein. The first hydrophobic residues of heptad repeats predicted to
form a coiled coil are Leu98 and Leu105 or, alternatively, Leu99 and
Leu106 (30). Leu91 is 7 residues upstream of Leu98 and thus
could also be included in a potential coiled coil. We mutagenized
Leu91, Leu98 and Leu99 simultaneously, or Leu105 and Leu106
simultaneously. Some combinations of these mutations were also
analyzed. All the mutations were conservative changes from leucine to
valine. These changes should prevent the formation of a coiled-coil
dimerization element while not altering the overall hydrophobicity or
the
-helical structure of this peptidic region (1). The
mutant proteins were synthesized in vitro and examined for DNA binding
activity in gel shift assays with a DNA fragment containing NirA
binding site 2 as a probe. The results are shown in Fig.
9. Mutation of Leu91Val (L1) does not
affect binding or dimerization, since the complex formed has the same
mobility as the wild-type complex. Simultaneous mutations at Leu98 and
Leu99 (LL2) do not seem to affect binding (but see below), while a
double substitution at Leu105 and Leu106 (LL3) affects binding
drastically without completely abolishing it. Simultaneous mutation of
these four leucine residues has a very marked effect on binding. It is
clear that a dimer is formed, since the complex moves with a mobility
even lower than that of the wild-type complex. This effect is more
marked when Leu98, Leu99, Leu105, and Leu106 are all mutagenized. Thus,
Leu98 or Leu99 must contribute to dimerization, even if this is not
obvious when they are mutated on their own. This is supported by the
fact that a double substitution at Leu98 and Leu99 decreases the
mobility of the complex very slightly. This effect is genuine, since it has been observed in several independent experiments. The conclusion that can be drawn is that Leu98 or Leu99 and Leu105 or Leu106 are
involved in the formation of a coiled coil. When they are mutated, the
putative coiled coil can still form, even when all the leucines are
mutated to valine, but it has a less rigid structure, which could
account nicely for the decrease in the mobility of the complex. It is
quite clear that proper dimerization is necessary for efficient
binding.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 9.
DNA binding activities of NirA proteins mutated in the
dimerization element. Wild type, NirA(1-121) peptide as described in
the legend to Fig. 7. Mutants: L1, Leu91Val; LL2, Leu98Val and
Leu99Val; LL3, Leu105Val and Leu106Val. A plus sign between the symbols
for each mutation denotes the presence of two or three mutations in the
dimerization element. Equal amounts of in vitro-synthesized protein
substitutions were incubated with the probe described in the legend to
Fig. 6, containing NirA binding site 2. The NirA protein present in the
transcription-translation reactions was quantified by Western blot
analysis with polyclonal antibodies against the NirA(1-125) peptide
followed by densitometry.
|
|
It is worth noticing that either Leu105 or Leu106, whose simultaneous
mutation has the most drastic effect on the binding and mobility of the
DNA-protein complex, is the first hydrophobic residue in the second
heptad of the first short coiled coil predicted by Schjerling and
Holmberg (30) (see above). However Leu91, whose
mutation does not affect binding, is not included in either of the two
predicted coiled coils.
 |
DISCUSSION |
The NirA protein mediates the induction by nitrate and nitrite of
the genes involved in nitrate assimilation in A. nidulans. It is extremely similar in a number of domains to the NIT4 protein of
N. crassa; the DNA binding domains are almost identical
(5). The latter protein was reported to bind the perfect
palindromic sequence TCCGCGGA. Note that this sequence is
contained in site 2 of the niiA-niaD intergenic region of
A. nidulans. However, both sites reported for N. crassa contain a C (C1 in our consensus) before the "first" T
(T2 of our consensus) and one of them contains a C in place of the
"last" A (base in position 9 after our consensus) (12).
If we consider the composite 9-bp sequence CTCCGHGGA, we
observe that the first C is conserved among all the N. crassa and A. nidulans sites and the last A (position
9) is present only in site 2 of A. nidulans and one of the
sites of N. crassa. Thus, comparative evidence indicates
that both proteins bind to an asymmetrical site of the form
CTCCGHGG. For the A. nidulans protein, the
conclusive evidence is provided by the mutagenesis of the C in position
1 (see Results).
We have investigated the asymmetry of binding by all possible
interference reactions. Removal of any of the bases within the consensus sequence interferes strongly with binding. There is some
generally partial, variable asymmetrical interference outside the
consensus sequence; this will be discussed below. Methylation interference (and protection) is consistent only with asymmetrical binding. While methylation of G5, G5*, G8, and G8* interferes with
binding (but not always to the same extent), interference by
methylation of G7 has no symmetrical counterpart, since there is no G
in 7*. The pattern of methylation interference clearly differs from
that found in proteins recognizing the CGG motif. For both Lac9p and
UaY, the only base where methylation interferes with binding is the
second G (13, 32). This is the only G whose N7 accepts a
proton from the
-NH2 group of a conserved lysine in the
structures of the Gal4p and Ppr1p protein-DNA complexes (24,
25). The phosphate contacts as revealed by ethylation interference are compatible only with asymmetrical binding of NirA.
Missing purine and methylation interference patterns of the N. crassa NIT4 protein are strikingly similar to what is reported in
this article. These studies were conducted with a
-galactosidase fusion protein containing amino acids 1 to 202 of NIT4, and it is
reassuring that three different proteins, the NirA(1-125)
peptide, the GST-NirA(1-125) fusion protein, and the
NIT4(1-202)-
-galactosidase fusion protein, gave such consistent
results. The comparison can be extended to the flanking sequences of
different sites in both organisms. In N. crassa site 1, the
sequence 5'AAAT is found 5' of base 1*. The three A's are revealed by
methylation interference. In A. nidulans site 2, the
sequence in the same position is 5'ATTT. The 3 T's are revealed by
missing-base interference (Fig. 2). When methylation protection of this
site was carried out under conditions where the N3 sites of the
A's are methylated, a striking hypersensitivity of the A's in
positions 9 and 10 and a strong protection of the two A's 5' to
position 1 were apparent (data not shown). Site 2 of N. crassa has 3 A's following position 8*. These three A's are
revealed both by missing-base interference and methylation
interference. We found exactly the same sequence in site 4 of A. nidulans (Fig. 2). Two of the A's immediately 3' to 8* are
revealed by missing-base interference, and there are clear phosphate
contacts in the corresponding phosphodiester bonds (Fig. 2). When the
methylation protection of these region was studied as above, again the
same two A's showed clear methylation protection (data not shown). The
role of external AT sequences is not identical in different sites. We
have investigated the effect of distamycin, a drug that binds in the
minor groove of AT-rich regions (16). Distamycin (30 µM)
completely inhibits the binding of the GST-NirA(1-125) fusion protein
to site 4 but not to sites 2 and 3. Interestingly, binding to site 1, which is preceded by a long run of AT sequences, is also strongly
inhibited by distamycin (31). These results are again
consistent with an overall asymmetry of binding. The two sites where
binding is inhibited by distamycin have AT-rich sequences on the 5'
site of position 1 (site 4 actually on both 5' and 3' sites), site 3 has no AT-rich sequences, and site 2 has an AT-rich sequence 3' of
position 8.
An obvious way in which a protein can recognize a nonrepeated,
asymmetrical sequence is if the sequence is bound by a monomer. Other
work from this laboratory has already shown that the zinc binuclear
cluster AlcR protein can bind as a monomer (8, 22) and that
the single sites play physiological roles in vivo (27). Residues of a monomer located in different places along the DNA binding
domain could recognize the two half-sites of the NirA binding sequence.
It should be noted that, besides the cluster of basic residues in the
first loop, common to all the proteins of the Zn binuclear cluster
class, NirA and NIT4 contain two further clusters of basic residues,
one amino terminal to the Zn motif and the second in the putative
linker element. Results shown above establish unequivocally that NirA
binds as a dimer. Cross-linking studies with a truncated NIT4 protein
(residues 48 to 179) suggests that the unbound protein also
exists as a dimer in solution (12).
Mutation of putative crucial residues in the dimerization element
results in drastically diminished binding. Since we are detecting the
protein by the binding assay, it is impossible to determine whether
this is due to a reduced affinity of the dimer, to the defective
formation of the dimer, or to a combination of the two. However, the
altered mobility of the complex shows that the mutation of the
dimerization element changes the overall structure of the dimer-DNA
complex and presumably that of the free dimeric protein, if the latter
forms at all.
Inverted and everted repeats of the same sequences can be recognized by
proteins differing in their dimerization and/or linker elements in such
a way that the crucial base recognition residues have opposite
orientations. This, however, maintains an overall symmetry of the
binding domains in relation to each other (14). To account
for the recognition of direct repeats by dimeric proteins, it has been
proposed that the dimer must have an asymmetric head-to-tail orientation (36). Interestingly, it has recently been shown for Cyp1p (Hap1p) that such head-to-tail orientation is not determined by the linker or dimerization element but by the DNA binding domains (37). In fact, as the Cyp1p protein is a monomer in solution (37), the asymmetric pattern of dimerization is determined
by the DNA binding domain/DNA-specific contacts. The relevance of this
observation will be made clear below.
The results obtained for NirA contradict the picture of the class of Zn
binuclear cluster proteins as a monotonous group, recognizing the same
CGG sequence in different orientations as described above and/or
separated by different sequence lengths (14, 29). If we
assume that both Zn binuclear clusters are involved in recognizing the
octet of base pairs that constitute the NirA and NIT4 binding sites, it
follows that each half of the asymmetrical sequence must bind to
different amino acids. Thus, either different amino acids within the
first loop make different contacts in each monomer or one monomer may
contact DNA by using amino acids outside the first loop. This is
discussed below. For the models developed to account for the binding of the proteins recognizing CGG half-sites in ascomycetes, it is assumed,
and shown in some cases, that the amino acid/base contacts are
identical and that what varies is their orientation or separation along
the DNA axis or both (14, 23-25, 29, 37). Any model able to
account for the specificity of NirA binding must postulate that the
specific base contacts and phosphate contacts made by the two zinc
clusters are different.
This is, as far as we are aware, the only case hitherto described where
each subunit of a dimer protein binds to such an asymmetrical, nonrepeated DNA sequence, not only within the class of the Zn binuclear
cluster transcription factors but also among all DNA binding proteins.
The closest precedent seems to be the E47 protein of Drosophila
melanogaster. This protein belongs to a group of helix-loop-helix
transcription factors which bind as dimers to the so-called E box, a
CAXXTG sequence. While some proteins of this group bind to perfectly
symmetrical CACGTG or CAGCTG sequences, E47
prefers a CACCTG sequence. The difference seems to depend on
one residue of the DNA binding domain. The E47 has an hydrophobic valine at the junction of the DNA binding domain and helix 1. The
proteins of this group which recognize symmetrical sequences have an
arginine in this position (11).
It is clearly impossible to reduce the NirA binding sequence to a
tandem repetition of two half-sites. If we try to reduce it to an
inverted repeated sequence, we could write CzzCGzzG, where z denotes
the residues where no symmetry can be seen. Most striking is the
asymmetry in the 3 and 3* positions. C is canonical in position 3 (and
cannot be mutated to a G), but C is the only base that cannot be
accepted in position 3* (i.e., a G is not acceptable in position 6 [Table 1]). However, this skeleton of an inverted repeat could
provide a basis to explain NirA binding. Only two lysines make specific
base contacts in the Ppr1p and Gal4p/DNA complexes. These two lysines
of the first loop are flanked by hydrophobic residues in both proteins.
On the other hand, the first loop of NirA an NIT4 is CRRRKSKC,
where all side chains of residues between the Zn-chelating cysteines,
including that of serine, are able to form hydrogen bonds. It can be
proposed that the two zinc binuclear clusters of a symmetrical dimer
bind to the "skeleton sequence" in such a way that different
residues are able to make base and phosphate contacts in each
half-site. If half-sites are separated by less than a whole helix turn,
the overall structure of the complex will necessarily be asymmetrical. In addition, asymmetrical binding could be generated by local deviations of DNA from its canonical structure. Independently of its
origin, this asymmetry will be reflected in either distortion of the
linker and/or dimerization elements, thus allowing symmetrical binding
to the DNA half-sites, or, if suitable side chains are available,
different residues may establish bases and backbone contacts to each
half-site. The binding of UaY and Ppr1p to apparently perfectly
symmetrical sequences (CGG-6X-CCG) show, after more detailed chemical
and crystallographic analysis, respectively, obvious asymmetrical
features (25, 32). A comparison with Cyp1p (Hap1p) binding
is again relevant here. It has been proposed that the latter protein
has a very "weak" dimerization element (37). Thus, the
recognition of direct repeats, imposed in an unspecified manner by
DNA-protein binding sequence interaction, would be permitted by the
flexibility of the dimerization element. The opposite is true for NirA.
Here the dimerization element is "strong" enough to act as a
dimerization element in vivo for the cI repressor and dimerization is
not completely abolished even after mutagenesis of several residues.
Two tandemly arranged coiled-coil regions, potentially acting as
dimerization elements, have been proposed for NirA (30), and
this work has shown that while the amino-terminal domain in essential
for NirA dimerization, the carboxy-terminal domain may participate in
proper dimer assembly. Thus, we can expect the dimer structure to be
quite rigid. The result of an asymmetry of base contacts imposed by the
protein-DNA interaction would not be resolved here by a rotation around
the axis of the dimerization element (as proposed for Cyp1p)
(37), permitting the recognition of a direct repeat, but by
a "sliding" along the first loop of the zinc cluster in such a way
that different side chains make crucial contacts. The interplay of
specific contacts by the first loop of the zinc cluster, the structure
of the linker element, and the stability of the dimerization element
indeed determine the specificity of binding of zinc binuclear cluster proteins but in a more varied and richer fashion than has been hitherto
supposed. While this article was being completed, the crystal structure
of the Put3p/DNA complex was published (33). The CGG-10X-CCG
sequence, is as expected, recognized by a protein dimer. The complex is
highly asymmetric, in spite of the symmetry of the DNA sequence.
However, the asymmetry does not involve the two Zn binuclear clusters,
as proposed here for NirA; indeed, the only base-specific contact made
by a side chain is by a histidine, which occupies the same crucial
position in the cluster as the lysine in Gal4p and Ppr1p. The asymmetry
is due to contacts in the minor groove that are made by the linker and
dimerization regions.
In spite of substantial work describing either minor (25,
32) or considerable (11, 33) asymmetry of binding by
dimeric proteins, the structural and thermodynamic parameters which
determine such asymmetries remain elusive. The NirA-DNA interaction
provides the most striking example of such an asymmetrical complex.
 |
ACKNOWLEDGMENTS |
Joseph Strauss and M. Isabel Muro-Pastor contributed equally to
this work.
We thank F. Gigliani for CSH50 E. coli cells, plasmid pC132,
and
phages used in this work; G. Cesareni for plasmid pC135; and F. Lema for polyclonal antibodies against the NirA(1-125) protein. J.S.
is grateful to C. P. Kubicek, Technical University, and to the
Department of Medical Biochemistry, University of Vienna, for
laboratory space. Wilhelm Guschlbauer is thanked for helpful discussion.
This work was supported by CEE grants SCI-CT92-0815 and BIO2-CT93-0147.
The work at Vienna was supported by grant 6105 from the Jubilaeumsfonds
der Oesterreichischen Nationalbank to J.S. J.S. was supported by a
studentship of Austauschprogramm France-Austria and by a short-term
EMBO fellowship (ASTF 7958). M.I.M.-P. has been the recipient of,
successively, a postdoctoral fellowship from the Ministerio de
Educación y Ciencia of the Spanish Government, CE fellowship
BIO-CT-94-8102, and a fellowship from Fondation pour la Recherche
Médicale.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut de
Génétique et Microbiologie, Université Paris-Sud, URA
D2225, 91405 Orsay Cedex, France. Phone: 33 1 69156356. Fax: 33 1 69157808. E-mail: scazzocchio{at}igmors.u-psud.fr.
Present address: Institut für Biochemische Technologie und
Mikrobiologie, Technische Universität Wien, Vienna, Austria.
 |
REFERENCES |
| 1.
|
Alber, T.
1992.
Structure of the leucine zipper.
Curr. Opin. Genet. Dev.
2:205-210[Medline].
|
| 2.
|
Bailone, A., and F. Galimbert.
1980.
Nucleotide sequence of the operators of ultravirulent mutants.
Nucleic Acids Res.
8:2147-2164[Abstract/Free Full Text].
|
| 3.
|
Battaglia, P. A.,
F. Longo,
C. Ciotta,
M. F. Del Grosso,
E. Ambrosini, and F. Gigliani.
1994.
Genetic tests to reveal Tat homodimer formation and select Tat homodimer inhibitor.
Biochem. Biophys. Res. Commun.
201:701-708[Medline].
|
| 4.
|
Burger, G.,
J. Tilburn, and C. Scazzocchio.
1991.
Molecular cloning and functional characterization of the pathway-specific regulatory gene nirA, which controls nitrate assimilation in Aspergillus nidulans.
Mol. Cell. Biol.
11:795-802[Abstract/Free Full Text].
|
| 5.
|
Burger, G.,
J. Strauss,
C. Scazzocchio, and B. F. Lang.
1991.
nirA, the pathway-specific regulatory gene of nitrate assimilation in Aspergillus nidulans, encodes a putative GAL4-type zinc finger protein and contains four introns in highly conserved regions.
Mol. Cell. Biol.
11:5746-5755[Abstract/Free Full Text].
|
| 6.
|
Carey, M.,
H. Kakidani,
J. Leatherwood,
F. Mostashari, and M. Ptashne.
1989.
An amino terminal fragment of GAL4 binds DNA as a dimer.
J. Mol. Biol.
209:423-432[Medline].
|
| 7.
|
Castagnoli, L.,
C. Vetriani, and G. Cesareni.
1994.
Linking an easily detectable phenotype to the folding of a common structural motif. Selection of rare turn mutations that prevent the folding of Rop.
J. Mol. Biol.
237:378-387[Medline].
|
| 8.
|
Cerdan, R.,
D. Collin,
F. Lenouvel,
B. Felenbok, and E. Guittet.
1997.
The Aspergillus nidulans transcription factor AlcR forms a stable complex with its half-site DNA: a NMR study.
FEBS Lett.
408:235-240[Medline].
|
| 9.
|
Cove, D. J., and J. A. Pateman.
1963.
Independently segregating genetic loci concerned with nitrate reductase activity in Aspergillus nidulans.
Nature
198:262-263[Medline].
|
| 10.
|
Cubero, B., and C. Scazzocchio.
1994.
Two different adjacent and divergent zinc-finger binding sites are necessary for CREA-mediated carbon catabolite repression in the proline gene cluster of Aspergillus nidulans.
EMBO J.
13:407-415[Medline].
|
| 11.
|
Ellenberger, T.,
D. Fass,
M. Arnaud, and S. C. Harrison.
1994.
Crystal structure of transcription factor E47: E-box recognition by a basic region helix-loop-helix dimer.
Genes Dev.
8:970-980[Abstract/Free Full Text].
|
| 12.
|
Fu, Y. H.,
B. Feng,
S. Evans, and G. A. Marzluf.
1995.
Sequence-specific DNA binding by NIT4, the pathway-specific regulatory protein that mediates nitrate induction in Neurospora.
Mol. Microbiol.
15:935-942[Medline].
|
| 13.
|
Halvorsen, Y. D. C.,
K. Nanadabalan, and R. C. Dickson.
1991.
Identification of base and backbone contacts used for DNA sequence recognition and high-affinity binding by LAC9, a transcription activator containing a C6 zinc finger.
Mol. Cell. Biol.
11:1777-1784[Abstract/Free Full Text].
|
| 14.
|
Hellauer, K.,
M. H. Rochon, and B. Turcotte.
1996.
A novel DNA binding motif for yeast zinc cluster proteins: the Leu3p and Pdr3p transcriptional activators recognize everted repeats.
Mol. Cell. Biol.
16:6096-6102[Abstract].
|
| 15.
|
Hu, J. C.,
E. K. O'Shea,
P. S. Kim, and R. T. Sauer.
1990.
Sequence requirements for coiled-coils: analysis with repressor-GCN4 leucine zipper fusions.
Science
250:1400-1403[Abstract/Free Full Text].
|
| 16.
|
Kopka, M. L.,
C. Yoon,
D. Goodsell,
P. Pjura, and R. Dickerson.
1985.
The molecular origin of DNA-drug specificity in netropsin and distamycin.
Proc. Natl. Acad. Sci. USA
82:1376-1380[Abstract/Free Full Text].
|
| 17.
|
Kulmburg, P.,
T. Prangé,
M. Mathieu,
D. Sequeval,
C. Scazzocchio, and B. Felenbok.
1991.
Correct intron splicing generates a new type of a putative zinc-binding domain in a transcriptional activator of Aspergillus nidulans.
FEBS Lett.
280:11-16[Medline].
|
| 18.
|
Kulmburg, P.,
D. Sequeval,
F. Lenouvel,
M. Mathieu, and B. Felenbok.
1992.
Identification of the promoter region involved in the autoregulation of the transcriptional activator ALCR in Aspergillus nidulans.
Mol. Cell. Biol.
12:1932-1939[Abstract/Free Full Text].
|
| 19.
|
Kulmburg, P.,
N. Judewicz,
M. Mathieu,
F. Lenouvel,
D. Sequeval, and B. Felenbok.
1992.
Specific binding sites for the activator protein ALCR, in the alcA promoter of the ethanol regulon of Aspergillus nidulans.
J. Biol. Chem.
267:21146-21153[Abstract/Free Full Text].
|
| 20.
|
Kunkel, T. A.
1985.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc. Natl. Acad. Sci. USA
82:488-492[Abstract/Free Full Text].
|
| 21.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 22.
|
Lenouvel, F.,
I. Nikolaev, and B. Felenbok.
1997.
In vitro recognition of specific DNA targets by AlcR, a zinc binuclear cluster activator different from the other proteins of this class.
J. Biol. Chem.
272:15521-15526[Abstract/Free Full Text].
|
| 23.
|
Liang, S. D.,
R. Marmorstein,
S. C. Harrison, and M. Ptashne.
1996.
DNA sequence preferences of GAL4 and PPR1: how a subset of Zn2Cys6 binuclear cluster proteins recognizes DNA.
Mol. Cell. Biol.
16:3773-3780[Abstract].
|
| 24.
|
Marmorstein, R.,
M. Carey,
M. Ptashne, and S. C. Harrison.
1992.
DNA recognition by GAL4: structure of a protein-DNA complex.
Nature (London)
356:408-415[Medline].
|
| 25.
|
Marmorstein, R., and S. C. Harrison.
1994.
Crystal structure of a PPR1-DNA complex: DNA recognition by proteins containing a Zn2Cys6 binuclear cluster.
Genes Dev.
8:2504-2512[Abstract/Free Full Text].
|
| 26.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:497-559[Medline].
|
| 27.
|
Panozzo, C.,
V. Capuano,
S. Fillinger, and B. Felenbok.
1997.
The zinc binuclear cluster activator AlcR is able to bind to single sites, but requires multiple repeated sites for synergistic activation of the alcA gene in Aspergillus nidulans.
J. Biol. Chem.
272:22859-22865[Abstract/Free Full Text].
|
| 28.
|
Punt, P. J.,
J. Strauss,
R. Smit,
J. R. Kinghorn,
C. A. M. J. J. van den Hondel, and C. Scazzocchio.
1995.
The intergenic region between the divergently transcribed niiA and niaD genes of Aspergillus nidulans contains multiple NirA binding sites which act bidirectionally.
Mol. Cell. Biol.
15:5688-5699[Abstract].
|
| 29.
|
Reece, R., and M. Ptashne.
1993.
Determinants of binding-site specificity among yeast C6 zinc cluster proteins.
Science
261:909-911[Abstract/Free Full Text].
|
| 30.
|
Schjerling, P., and S. Holmberg.
1996.
Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators.
Nucleic Acids Res.
24:4599-4607[Abstract/Free Full Text].
|
| 31.
|
Strauss, J.
1993.
.
Bases moléculaires de la régulation des gènes de la voie d'assimilation du nitrate chez Aspergillus nidulans. Ph.D. thesis.
Université Paris Sud, Centre d'Orsay, Orsay, France.
|
| 32.
|
Suárez, T.,
M. Vieira de Queiroz,
N. Oestreicher, and C. Scazzocchio.
1995.
The sequence and binding specificity of UaY, the specific regulator of the purine utilization pathway in Aspergillus nidulans, suggest an evolutionary relationship with the PPR1 protein of Saccharomyces cerevisiae.
EMBO J.
14:1453-1467[Medline].
|
| 33.
|
Swaminathan, K.,
P. Flynn,
R. J. Reece, and R. Marmorstein.
1997.
Crystal structure of a PUT3-DNA complex reveals a novel mechanism for DNA recognition by a protein containing a Zn2Cys6 binuclear cluster.
Nat. Struct. Biol.
4:751-759[Medline].
|
| 34.
|
Unkles, S. E.,
K. L. Hawker,
C. Grieve,
E. I. Campbell,
P. Montague, and J. R. Kinghorn.
1991.
crnA encodes a nitrate transporter in Aspergillus nidulans.
Proc. Natl. Acad. Sci. USA
88:204-208[Abstract/Free Full Text].
|
| 34a.
| Wolschek, M., F. Narendja, J. Karlseder, B. Cubero, C. Scazzocchio, C. P. Kubicek, and J. Strauss. Unpublished data.
|
| 35.
|
Yuan, G. F.,
Y. H. Fu, and G. A. Marzluf.
1991.
nit4, a pathway-specific regulatory gene of Neurospora crassa, encodes a protein with a putative binuclear zinc DNA-binding domain.
Mol. Cell. Biol.
11:5735-5745[Abstract/Free Full Text].
|
| 36.
|
Zhang, L., and L. Guarente.
1994.
The yeast activator HAP1 a GAL4 family member binds DNA in a directly repeated orientation.
Genes Dev.
8:2110-2119[Abstract/Free Full Text].
|
| 37.
|
Zhang, L., and L. Guarente.
1996.
The C6 zinc cluster dictates asymmetric binding by HAP1.
EMBO J.
15:4676-4681[Medline].
|
Mol Cell Biol, March 1998, p. 1339-1348, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bernreiter, A., Ramon, A., Fernandez-Martinez, J., Berger, H., Araujo-Bazan, L., Espeso, E. A., Pachlinger, R., Gallmetzer, A., Anderl, I., Scazzocchio, C., Strauss, J.
(2007). Nuclear Export of the Transcription Factor NirA Is a Regulatory Checkpoint for Nitrate Induction in Aspergillus nidulans. Mol. Cell. Biol.
27: 791-802
[Abstract]
[Full Text]
-
MacPherson, S., Larochelle, M., Turcotte, B.
(2006). A Fungal Family of Transcriptional Regulators: the Zinc Cluster Proteins. Microbiol. Mol. Biol. Rev.
70: 583-604
[Abstract]
[Full Text]
-
Pachlinger, R., Mitterbauer, R., Adam, G., Strauss, J.
(2005). Metabolically Independent and Accurately Adjustable Aspergillus sp. Expression System. Appl. Environ. Microbiol.
71: 672-678
[Abstract]
[Full Text]
-
Hasper, A. A., Trindade, L. M., van der Veen, D., van Ooyen, A. J. J., de Graaff, L. H.
(2004). Functional analysis of the transcriptional activator XlnR from Aspergillus niger. Microbiology
150: 1367-1375
[Abstract]
[Full Text]
-
Muro-Pastor, M. I., Strauss, J., Ramon, A., Scazzocchio, C.
(2004). A Paradoxical Mutant GATA Factor. Eukaryot Cell
3: 393-405
[Abstract]
[Full Text]
-
Garcia, I., Gonzalez, R., Gomez, D., Scazzocchio, C.
(2004). Chromatin Rearrangements in the prnD-prnB Bidirectional Promoter: Dependence on Transcription Factors. Eukaryot Cell
3: 144-156
[Abstract]
[Full Text]
-
Nikolaev, I., Lenouvel, F., Felenbok, B.
(1999). Unique DNA Binding Specificity of the Binuclear Zinc AlcR Activator of the Ethanol Utilization Pathway in Aspergillus nidulans. J. Biol. Chem.
274: 9795-9802
[Abstract]
[Full Text]
-
Noel, J., Turcotte, B.
(1998). Zinc Cluster Proteins Leu3p and Uga3p Recognize Highly Related but Distinct DNA Targets. J. Biol. Chem.
273: 17463-17468
[Abstract]
[Full Text]