Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1400-1407, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
p53-Dependent Elevation of p21Waf1
Expression by UV Light Is Mediated through mRNA Stabilization and
Involves a Vanadate-Sensitive Regulatory System
Myriam
Gorospe,
Xiantao
Wang, and
Nikki J.
Holbrook*
Section on Gene Expression and Aging,
Laboratory of Biological Chemistry, National Institute on Aging,
National Institutes of Health, Baltimore, Maryland 21224
Received 21 July 1997/Returned for modification 27 August
1997/Accepted 21 November 1997
 |
ABSTRACT |
Exposure of mammalian cells to adverse stimuli triggers the
expression of numerous stress response genes, many of which are presumed to enhance cell survival. In this study, we examined the
mechanisms contributing to the induction of p21Waf1 by
stress and its influence on the survival of cells subjected to
short-wavelength UVC irradiation. UVC was found to elevate p21Waf1 mRNA expression in mouse embryonal fibroblasts
(MEFs) and human colorectal carcinoma (RKO) cells in a p53-dependent
manner. The lack of p21Waf1 induction in p53-deficient MEFs
and RKO cells correlated with diminished cell survival following UVC
irradiation. Unexpectedly, UVC treatment was also found to block the
induction of p21Waf1 by various stress-inducing agents such
as mimosine in the p53-deficient cells. Additional studies indicated
that induction of p21Waf1 by UVC occurs primarily through
enhanced mRNA stability rather than increased transcription; in
p53
/
MEFs, failure to elevate p21Waf1 after
treatment with UVC appears to be due to their inability to stabilize
the p21Waf1 transcripts. Treatment of the
p53
/
MEFs with the protein tyrosine phosphatase
inhibitor vanadate reversed the UVC-induced block on
p21Waf1 induction and resulted in their enhanced survival
following irradiation. Thus, in cells bearing normal p53, UVC augments
p21Waf1 expression by increasing the half-life of
p21Waf1 mRNA; without p53, p21Waf1 mRNA remains
unstable after UVC, apparently due to a pathway involving tyrosine
phosphatase activity.
 |
INTRODUCTION |
Exposure of mammalian cells to
stressful stimuli triggers a variety of response mechanisms, including
alterations in the pattern of gene expression. Ultimately, these
modifications determine the global response of the cell, ranging from
transformation, growth stimulation, growth inhibition, differentiation,
senescence, and cell death. Much of the altered gene expression seen in
response to stress occurs through activation of selective gene
transcription, and much attention has been focused on delineating the
mechanisms regulating these transcriptional events. Central to the
stress response is the activation of one or more mitogen-activated
protein (MAP) kinase cascades, including those leading to the
activation of the extracellular signal-regulated kinases (ERKs)
(38, 48, 49), the c-Jun N-terminal kinases (JNKs; also known
as stress-activated protein kinases) (3, 29), and a 38-kDa
kinase termed CSBP/HOG1 (25, 29, 30). These MAP kinases
serve to regulate, via phosphorylation, the activity of critical
transcription factors (23). Alterations in
posttranscriptional events also contribute to the regulation of gene
expression during stress. Enhanced mRNA stability, in particular, has
been associated with increased expression of many stress-responsive
genes (26), and changes in the rate of translation and/or
stability of proteins have likewise been implicated in regulating the
expression of particular gene products during the stress response
(9, 21). However, the mechanisms regulating these
posttranscriptional processes remain largely unknown.
Among the genes that are believed to play an important role in
determining cell fate during stress is the cyclin-dependent kinase
inhibitor gene p21Waf1. p21Waf1 was originally
identified as a gene regulated by the tumor suppressor protein p53
(8), and, indeed, induction of p21Waf1 in
response to X irradiation and other DNA-damaging agents relies, to
different extents, on its transcriptional upregulation by p53 (19). However, induction of p21Waf1 in response
to other stresses, as well as by mitogenic stimulation, occurs via
mechanisms that are independent of p53 (1, 8, 16, 27, 31, 35,
40). The role of p21Waf1 during stress remains
controversial. Although there is evidence to suggest that
p21Waf1 is proapoptotic in certain situations, most studies
have provided evidence indicating that it functions as a protective
factor during stress, associated with its growth-inhibitory properties.
Thus, colorectal carcinoma cells lacking p21Waf1 display
enhanced sensitivity to the cytotoxic effects of chemotherapeutic drugs
(47). Furthermore, inhibiting p21Waf1 expression
results in apoptosis of SH-SY5Y neuroblastoma cells (37) and
sensitizes human breast carcinoma MCF-7 cells to killing by
prostaglandin A2 (PGA2) (15).
Conversely, elevated p21Waf1 expression protects the human
colorectal carcinoma RKO line against the cytotoxic effects of
PGA2 (15), prevents p53-mediated apoptosis of
SK-MEL-110 cells (18), and enhances survival of UVC-treated DLD1 colorectal carcinoma cells (42).
In the present study, we investigated the mechanism(s) contributing to
the regulation of p21Waf1 expression in response to UVC
treatment and its influence on cell survival. Following exposure of
mouse embryonal fibroblasts (MEFs) or RKO cells to UVC, increased
p21Waf1 expression was found to depend on the presence of
functional p53 and to correlate with enhanced cell survival. Not only
did UVC treatment fail to induce p21Waf1 expression in
either p53-deficient MEFs (p53
/
MEFs) or p53-deficient
RKO cells; it also prevented p21Waf1 induction by mimosine,
an agent that induces p21Waf1 expression independently of
p53 function. The p53-dependent increase in p21Waf1
expression involves stabilization of p21Waf1 mRNA. However,
even in the absence of p53, UVC was found to be capable of augmenting
p21Waf1 expression if tyrosine phosphatase activity was
blocked by vanadate. These studies implicate p53 in the control of a
vanadate-sensitive system, possibly involving regulation of protein
tyrosine phosphorylation, in the augmentation of p21Waf1
mRNA stability.
 |
MATERIALS AND METHODS |
Cell culture and treatments.
The human colorectal carcinoma
cell lines RKO neo (exhibiting wild-type p53 function) and RKO E6 (p53
deficient) (28, 43) were cultured in minimum essential
medium (Gibco BRL, Gaithersburg, Md.), and embryonal fibroblasts
derived from wild-type, p21Waf1 knockout
(p21
/
) (7), and p53 knockout
(p53
/
) mice (32) were cultured in
Dulbecco's modified essential medium (Gibco BRL). Both media were
supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah) and 50 µg of gentamicin (Gibco BRL) per ml. RKO cells also received 350 µg
of neomycin (Gibco BRL) per ml. Suramin, N-acetyl cysteine,
rapamycin, sodium orthovanadate, dithiothreitol, H7, staurosporine,
wortmannin, genistein, actinomycin D (ActD), and okadaic acid were
purchased from Sigma (St. Louis, Mo.). Mimosine was purchased from
Aldrich Chemical Co. (St. Louis, Mo.). SB 203580 and PD 098059 were
kindly provided by SmithKline Beecham and Parke Davis, respectively.
Drugs were added directly to the medium to the final concentrations
indicated. For irradiation with UVC, cells were grown to approximately
50% confluence in 100- or 150-mm-diameter plates, and their medium was
removed. Cells were then rinsed with phosphate-buffered saline and
irradiated, and tissue culture medium was added back. In every
experiment, untreated controls were subjected to mock irradiation.
Northern blot analysis.
Total RNA was isolated with STAT-60
(Tel-Test "B," Friendswood, Tex.), and 20-µg RNA samples were
denatured, size fractionated by electrophoresis in 1.2%
agarose-formaldehyde gels, and transferred onto GeneScreen Plus nylon
membranes (DuPont/NEN, Boston, Mass.). For the detection of
p21Waf1 mRNA in RKO cells and gadd153 in MEFs, the
p21Waf1 and gadd153 cDNAs were excised from plasmid
pCEP-Waf1 (8) or pCMVgadd153, respectively, and labeled by
using [
-32P]dCTP with a random primer labeling kit
(Boehringer Mannheim, Indianapolis, Ind.). For the detection of
p21Waf1 mRNA in MEFs and for normalization of differences
in loading and transfer among samples in all Northern blots, an
oligomer complementary to the mouse p21Waf1 mRNA
(5'-CTCCGTGACGAAGTCAAAGTTCCACCGTTCTCGGGCCTCCTGGAGACAGCC-3') and an oligomer complementary to the 18S rRNA
(5'-ACGGTATCTGATCGTCTTCGAACC-3' (Integrated DNA
Technologies, Coralville, Iowa) were 3' end labeled with
[
-32P]dATP by terminal deoxynucleotidyltransferase
(Life Technology Laboratories, Gaithersburg, Md.). Hybridization and
washes were performed by the method of Church and Gilbert
(4). Incorporation of 32P was visualized by
using a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.).
Transient transfection.
For transfection experiments, 5 × 105 cells were seeded in 100-mm-diameter plates 24 h before transfection. The p21Waf1 promoter-luciferase
construct WWT-Luc (5 µg of DNA) was transfected into cells by
standard calcium phosphate precipitation methods, and luciferase
activity was assayed with a luciferase assay system kit (Promega,
Madison, Wis.). Values represent means ± standard errors of the
means (SEM) of three independent experiments.
Colony formation assays.
Cell survival was measured by using
a standard clonogenic assay. Twenty hours after treatment, 5 × 105 cells were trypsinized and serially diluted according
to the expected surviving fraction (from 1:10 to 1:1,000,000). Plates were then returned to the incubator and cultured for an additional 12 to 14 days. The plates were fixed and stained with a crystal violet
solution (10% [vol/vol] ethanol, 0.1% [wt/vol] crystal violet),
and colonies (defined as greater than 50 cells) were counted. The
surviving fraction was measured as the number of colonies divided by
the dilution factor. For each UVC dose, plates were seeded at four
different dilutions, and routinely, three of these were counted. Each
colony formation assay was performed at least three times.
Nuclear run-on assay.
Nuclei were prepared from 5 × 107 MEFs 8 h after treatment with either UVC
irradiation (20 J/m2) or mimosine (300 µM). Nascent RNA
was labeled essentially as previously described previously
(20) except that radiolabeled RNA was isolated by using the
STAT-60 reagent and precipitated with 0.7 volume of isopropanol. Five
micrograms of denatured
-actin and gadd153 cDNAs, 5 µg of an
oligomer complementary to mouse p21Waf1
(5'-CT CCGTGACGAAGTCAAAGTTCCACCGTTCTCGGGCCTCCTGGAGACA GCC-3'), and 5 µg of pBlueScript plasmid (included as a negative control) were
dot blotted onto nitrocellulose membranes. After blocking with 100 µg
of tRNA per ml, membranes were hybridized with 4 × 106 cpm in 2 ml of hybridization buffer for 72 h at
65°C, washed extensively in 1% sodium dodecyl sulfate-1× SSC (0.15 M NaCl plus 0.015 M sodium citrate) at 65°C, and visualized with a
PhosphorImager.
Western blot analysis.
Fifty-microgram samples of total cell
lysates were size fractionated by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis and transferred onto polyvinylidene difluoride
membranes by using standard techniques. p21Waf1 protein was
detected with the ECL system (Amersham, Arlington Heights, Ill.)
following incubation with a polyclonal rabbit anti-mouse p21Waf1 antibody (PC55) from Calbiochem (Cambridge, Mass.).
 |
RESULTS |
Effect of UVC irradiation on p21Waf1 mRNA expression
and survival of MEFs and RKO cells differing in p53 status.
In
agreement with earlier reports, exposure of wild-type MEFs (wt MEFs)
and parental RKO neo cells to UVC resulted in a dose- and
time-dependent elevation in p21Waf1 mRNA. Maximum induction
of p21Waf1 mRNA expression (25- to 30-fold) was achieved
with doses of UVC between 10 and 20 J/m2 (Fig.
1A) and within 6 to 12 h of
treatment. Induction was sustained for up to 24 h but declined
thereafter (Fig. 1B and data not shown). To determine whether the
enhanced p21Waf1 expression following UVC irradiation was
dependent on the presence of functional p53, p53-deficient MEFs and RKO
cells were examined. As shown, MEFs derived from a mouse where both p53
alleles had been disrupted (p53
/
MEFs) as well as RKO
cells where p53 function was inactivated by constitutive overexpression
of the viral oncoprotein E6 (RKO E6 cells) failed to exhibit a
substantial induction of p21Waf1 mRNA following UVC
exposure, regardless of the UVC doses used or the times examined (Fig.
1).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
p21Waf1 mRNA expression following UVC
irradiation in MEFs or RKO cells differing in p53 status. (A) MEFs and
RKO cells with functional p53 (wt MEFs and RKO neo cells, respectively)
or nonfunctional p53 (p53 / MEFs and RKO E6 cells,
respectively) were exposed to increasing doses of UVC irradiation. Ten
hours later, cells were lysed and p21Waf1 mRNA expression
was assessed by Northern blot analysis as described in Materials and
Methods. Assessment of loading and transfer of RNA samples, detected by
hybridization to an oligomer complementary to 18S rRNA, indicated that
all lanes contained equal amounts of RNA (not shown). (B) MEFs and RKO
cells differing in p53 status were exposed to UVC at 20 J/m2, and p21Waf1 mRNA expression was monitored
at the times indicated.
|
|
Next, we compared the survival of wild-type versus p53-deficient MEFs
and RKO cells following UVC treatment. A colony proliferation
assay was
used to measure cell survival with several UVC doses,
and the results,
shown in Fig.
2, are expressed as the
percentage
of colonies obtained with a given UVC dose relative to
untreated
controls. p53-deficient cells (p53
/
MEFs and
RKO E6 cells) showed significantly lower survival than
their wild-type
counterparts (wt MEFs and RKO neo cells) at all
doses tested. These
findings are similar to those recently reported
by Sheikh et al.
(
42), who used a tetracycline-inducible system
to modulate
the expression exogenous p21
Waf1 in p53-deficient cells.
Similarly, UVC treatment of p21
Waf1-deficient
(p21
/
) MEFs was also accompanied by a dramatic
reduction in the numbers
of colonies recovered. These results support
the view that p53
and p21
Waf1 are important for cell
survival following UVC treatment.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Colony survival assay following UVC irradiation of MEFs
and RKO cells. (A) Survival of wt, p53 / , and
p21 / MEFs following UVC irradiation. (B) Survival of
RKO neo and RKO E6 cells following UVC irradiation. A total of 5 × 105 cells (in 100-mm-diameter tissue culture dish) were
irradiated with the indicated doses of UVC. Twenty-four hours later,
cells were trypsinized, serially diluted (10 to 1,000,000 times),
replated, and returned to the incubator for an additional 12 to 14 days. Surviving colonies were then fixed with crystal violet and
counted. For each UVC dose, plates were seeded at four different
dilutions, and routinely, three of these were counted. Experiments were
done at least five times. Values represent means ± SEM.
|
|
Effect of UVC on p53-independent p21Waf1
induction.
The correlation between p21Waf1 expression
and survival of the MEFs and RKO lines was fully consistent with
p21Waf1 contributing to the enhanced survival following
exposure to UVC. However, we sought to assess the role of
p21Waf1 expression in the survival of the p53-deficient
lines by inducing an increase in p21Waf1 levels via an
alternative, p53-independent mechanism before exposure to UVC. Mimosine
was chosen as the inducer, as we had previously reported that mimosine
induces p21Waf1 expression in p53-deficient RKO cells
independent of p53 function, an effect that was correlated with
enhanced survival during subsequent exposure to PGA2
(17).
In agreement with our prior observations in RKO cells and those of
Alpan and Pardee (
2), treatment of MEFs with mimosine
led to
induction of p21
Waf1 mRNA irrespective of p53 activity
(Fig.
3A). That the elevated
mRNA
expression results in increased expression of p21
Waf1
protein is shown in Fig.
3B. To determine if such upregulation
of
p21
Waf1 expression could confer enhanced tolerance to UVC
in p53
/
MEFs, mimosine was added to the cells
immediately following irradiation.
This treatment condition was chosen
to mimic the time course for
p21
Waf1 induction seen in wt
MEFs treated with UVC (Fig.
1 and
2). To
our initial surprise, mimosine
treatment did not substantially
alter the survival of
p53
/
MEFs after UVC treatment; i.e., it did not confer
protection
as predicted (Fig.
3C). Analysis of p21
Waf1
expression in the p53-deficient MEFs subjected to the combined
treatments (UVC plus mimosine) revealed that p21
Waf1 levels
were not increased. UVC blocked the induction of p21
Waf1 by
mimosine (Fig.
4). This suppressive
effect of UVC was also
seen in RKO E6 cells but not in the MEFs and RKO
lines with normal
p53 function (wt MEFs and RKO neo cells,
respectively), where
p21
Waf1 was elevated with either
treatment alone as well as with the
combination.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of mimosine on p21Waf1 expression and
UVC-mediated cytotoxicity in p53 / MEFs. (A) RNA was
extracted from wt and p53 / MEFs treated with 200 or 300 µM mimosine (Mimo) for the indicated times, and p21Waf1
mRNA expression was monitored by Northern blot analysis as described in
Materials and Methods. (B) Western blot analysis of p21Waf1
expression in p53 / MEFs treated with 250 µM mimosine
(Mimo) was carried out as described in Materials and Methods. (C)
Following irradiation of p53 / MEFs (5 × 105 cells per 100-mm-diameter tissue culture dish), cells
received either normal medium (untr.) or medium containing 200 µM
mimosine (Mimosine). Twenty-four hours later, cells were trypsinized,
serially diluted (10 to 1,000,000 times), replated, and returned to the
incubator for an additional 14 days. Surviving colonies were fixed with
crystal violet and counted. For each UVC dose, plates were seeded at
four different dilutions, and routinely, three different dilutions were
counted. Experiments were done at least three times. Values represent
means ± SEM.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Dose- and time-dependent effects of UVC on
mimosine-induced p21Waf1 expression in MEFs and RKO cells
differing in p53 status. (A) MEFs and RKO cells with or without
functional p53 status were either treated with 300 µM mimosine
(Mimo), exposed to UVC at 20 J/m2 (UVC), or treated with
300 µM mimosine immediately following exposure to UVC at 20 J/m2 (Mimo+UVC). RNA was isolated at the times indicated,
and p21Waf1 mRNA expression was analyzed. (B) Western blot
analysis of p21Waf1 expression in wt and
p53 / MEFs 16 h after treatment with either UVC at
20 J/m2 (U), 300 µM mimosine (M), or 300 µM mimosine
and UVC at 20 J/m2 (MU). C, control.
|
|
A more detailed analysis of the time- and dose-dependent relationships
for suppression of mimosine-induced p21
Waf1 expression by
UVC was then undertaken (Fig.
5). With
the exception
of the highest UVC dose used (40 J/m
2), UVC
treatment of wild-type MEFs elevated p21
Waf1 mRNA levels
above that seen with mimosine treatment alone (Fig.
5A). In contrast,
in p53
/
MEFs, mimosine-mediated induction of
p21
Waf1 was inhibited by even the lowest UVC dose
tested (5 J/m
2). More striking was the length of time over
which the inhibitory
influence of UVC was sustained (Fig.
5B). Cells
that had been
exposed to UVC at 20 J/m
2 24 h before
the mimosine treatment were still totally refractory
to induction by
mimosine. Lengthening the interval between UVC
irradiation and addition
of mimosine to 36 h finally led to partial
restoration of
p21
Waf1 induction by mimosine. Thus, the UVC-induced
changes that blocked
the mimosine-induced upregulation of
p21
Waf1 lasted nearly 36 h.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Dose- and time-dependent effects of UVC on
mimosine-induced p21Waf1 mRNA expression. (A) Wild-type and
p53 / MEFs were either left untreated, treated with 300 µM mimosine (Mimo), or UVC irradiated at the doses indicated with 300 µM mimosine. Ten hours after treatment, RNA was extracted and
p21Waf1 mRNA expression was analyzed. (B)
p53 / MEFs were irradiated with UVC (20 J/m2) at various time intervals (from 0 to 36 h) prior
to treatment with mimosine. p21Waf1 mRNA expression was
assessed 10 h following treatment with mimosine. u, untreated
control; UVC, cells irradiated 10 h prior to harvesting of RNA.
|
|
Posttranscriptional regulation of p21Waf1 expression by
UVC.
To address the mechanisms whereby UVC inhibits
p21Waf1 induction by mimosine, it was first necessary to
determine how mimosine acted to induce p21Waf1. Two
approaches were used to investigate whether the mimosine effect was due
to enhanced transcription of the p21Waf1 gene. First, the
activity of the p21Waf1 promoter was measured by using a
p21Waf1 promoter-luciferase reporter construct transiently
transfected into wt and p53
/
MEFs (Fig.
6A). UVC, mimosine, and combined
UVC-plus-mimosine treatments all failed to substantially elevate
p21Waf1 promoter activity (Fig. 6A, right), regardless of
p53 status. This is in sharp contrast to the effect of these treatments
on p21Waf1 mRNA levels (Fig. 6A, left). Treatment with the
DNA-alkylating agent methyl methanesulfonate (MMS), included as a
positive control, both activated the p21Waf1 promoter and
enhanced endogenous levels of p21Waf1 mRNA, although
maximal induction in each case required wt p53 function (Fig. 6A). The
second approach used nuclear run-on assays to directly determine
whether the rate of transcription of the p21Waf1 gene was
increased following treatment with either mimosine or UVC. Measurements
were performed at 8 h, a time at which p21Waf1 mRNA
levels are approaching maximal levels. As shown in Fig. 6B, neither UVC
nor mimosine treatment led to any perceptible change in the
transcription rates of the p21Waf1 gene, regardless of p53
status. Transcription of the gadd153 gene (included here as a positive
control) was modestly increased by the mimosine and UVC treatments.
This elevated transcription accounted, at least in part, for the
similarly modest elevation in gadd153 mRNA expression in wt and
p53
/
MEFs following treatment with either UVC or
mimosine (Fig. 6C).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Induction of p21Waf1 mRNA expression by UVC
and mimosine is not regulated transcriptionally. (A) Right, relative
luciferase activity driven by the p21Waf1 promoter in
transiently transfected wt or p53 / MEFs following
treatment with 300 µM mimosine (Mimo), UVC at 20 J/m2
(UVC), a combination of 300 µM mimosine plus UVC at 20 J/m2 (Mimo+UVC) or 100 µg of MMS per ml (MMS). Values
represent the means of three independent experiments. Left,
quantitation of p21Waf1 mRNA levels in identically treated
populations of wt and p53 / MEFs. mRNA expression was
analyzed 10 h after addition of 300 µM mimosine (Mimo) and
exposure to UVC at 20 J/m2 (UVC), mimosine plus UVC
(Mimo+UVC), or 100 µg of MMS per ml (MMS). Values are represented as
fold induction relative to the level of expression in untreated control
cells (untr.). p21Waf1 mRNA signal was measured with a
PhosphorImager and normalized to hybridization signal to 18S rRNA. (B)
Nuclear run-on analysis of wt or p53 / MEFs that were
either left untreated (c), treated with mimosine (Mimo), or exposed to
UVC at 20 J/m2 (UVC) 8 h prior to collection of cells
and nuclear run-on assay, carried out as described in Materials and
Methods. (C) Northern blot analysis of gadd153 mRNA expression in wt or
p53 / MEFs following treatment with 300 µM mimosine
(Mimo) or exposure to UVC at 20 J/m2 (UVC). (D) The levels
of p21Waf1 mRNA in wt MEFs treated with ActD alone or in
combination with mimosine (300 µM) or UVC (20 J/m2) were
assessed by Northern blot analysis and quantitated with a
PhosphorImager.
|
|
To determine if the elevation in p21
Waf1 mRNA seen in the
wt MEFs was associated with enhanced stability of the mRNA, we
performed
a standard mRNA decay assay. ActD (1 µg/ml) was added to
cells
to prevent any new gene transcription, and p21
Waf1
mRNA levels were monitored over the following 8-h period in cells
treated with ActD only and in cells treated with ActD plus either
mimosine or UVC. As shown in Fig.
6D, the half-life of
p21
Waf1 mRNA in ActD-treated cells was about 65 min;
mimosine and UVC
treatments increased the half-life ~2.5-fold (to 170 min) and
~4-fold (240 min), respectively. While a similar study could
not
be performed in p53
/
MEFs due to their low levels
of basal p21
Waf1 mRNA expression, our results indicate that
both mimosine and
UVC induce p21
Waf1 mRNA levels primarily
by inhibiting its decay.
Vanadate prevents UVC-mediated suppression of p21Waf1
expression through stabilization of p21Waf1 mRNA.
A
number of signaling cascades are triggered by UVC and contribute to the
cellular changes that characterize the response (22, 45,
46). The evidence presented thus far, indicating that UVC
suppresses the induction of p21Waf1 mRNA by other agents,
strongly suggests that p53
/
cells do not simply lack a
pathway which is otherwise activated by UVC; rather, it is consistent
with the existence of an abnormally active mechanism of
p21Waf1 mRNA degradation in p53-deficient cells. To begin
exploring which, if any, of the established UVC-triggered signaling
mechanisms might be important in influencing p21Waf1 mRNA
stability, p53
/
MEFs were pretreated with a variety of
specific inhibitors of these pathways before treatment with mimosine,
UVC, or mimosine plus UVC. p21Waf1 mRNA expression was
examined 10 h later to determine if any of the agents tested would
alter the UVC-mediated suppression of p21Waf1. No change in
the general pattern of p21Waf1 mRNA expression was seen in
the presence of any of the agents tested, except for vanadate, an
inhibitor of tyrosine phosphatases (Table
1). Vanadate treatment alone did not
alter p21Waf1 mRNA levels. However, it effectively allowed
for induction of p21Waf1 mRNA by UVC and completely
prevented the loss of mimosine-induced p21Waf1 expression
by UVC. These findings argue strongly for the involvement of a tyrosine
kinase/phosphatase regulatory system in the modulation of
p21Waf1 mRNA stability.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Effects of various inhibitory agents on
p21Waf1 expression in p53 / MEFs following
mimosine treatment, UVC irradiation, or botha
|
|
The dose- and time-dependent effects of vanadate are illustrated in
Fig.
7. When added alone, vanadate at up
to 90 µg/ml (the
highest dose used) did not elevate
p21
Waf1 mRNA expression in the p53
/
MEFs.
However, culturing the cells in the presence of increasing
concentrations of vanadate allowed for the elevation of
p21
Waf1 mRNA by UVC (Fig.
7A). The relief from UVC-mediated
suppression
required only a short period of exposure to vanadate: a 1-h
pretreatment
period was sufficient to achieve maximum
p21
Waf1 mRNA induction (greater than 10-fold) even if
vanadate was removed
at the time of UVC irradiation. As expected,
addition of vanadate
after UVC irradiation was less effective in
relieving the suppression
of p21
Waf1 mRNA induction (Fig.
7B). Since high doses of vanadate have been
reported to inhibit Na-K
ATPases, it was important to determine
whether the effect of vanadate
on p21
Waf1 expression might be attributable to the
inhibition of these ATPases.
Therefore, we examined the effect of
ouabain, a specific inhibitor
of Na-K ATPases, on p21
Waf1
expression following UVC treatment. Ouabain had no effect on
p21
Waf1 expression in either control or UVC-treated cells
(not shown).
Therefore, it is unlikely that vanadate influences
p21
Waf1 expression in UVC-treated cells through
inhibition of Na-K ATPases.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Dose- and time-dependent effect of vanadate on
p21Waf1 expression after UVC irradiation of
p53 / MEFs. (A) Northern blot analysis of
p21Waf1 expression in p53 / MEFs that were
treated with increasing doses of vanadate and either left unirradiated
( ) or irradiated with UVC at 20 J/m2. Expression of
p21Waf1 mRNA was analyzed 10 h after UVC treatment.
Mimo, mimosine. (B) Time-dependent effect of 50 µg of vanadate per ml
on p21Waf1 mRNA expression. Quantitation of
p21Waf1 mRNA levels in p53 / MEFs subjected
to the various treatment regimens. For vanadate removal, cells were
treated with vanadate for 1 h before exposure to UVC, and then
vanadate was removed at the time of UVC irradiation or at different
time intervals thereafter; for vanadate addition, vanadate was added at
different times after UVC irradiation. RNA was isolated 10 h after
exposure to UVC.
|
|
Although we cannot rule out the possibility that the vanadate effects
arise from vanadate's influence on cellular targets
other than protein
tyrosine phosphatases, the findings described
above are consistent with
the notion that vanadate relieves UVC-mediated
suppression of
p21
Waf1 expression by inhibiting a tyrosine phosphatase
that regulates
p21
Waf1 mRNA stability. To gain more direct
evidence for this view, we
examined the decay of p21
Waf1
mRNA in p53
/
MEFs following UVC treatment in the
absence or presence of vanadate.
p53
/
MEFs were treated
with mimosine for 12 h prior to the addition
of ActD (time zero)
to prevent any further transcription. Replicate
plates were then either
left as such or treated with UVC at (20
J/m
2) in the
absence or presence of vanadate. p21
Waf1 mRNA levels were
assessed over the following 15-h period. It
is important to note that
mimosine remained in the cultures throughout
the length of the
experiment. As shown in Fig.
8, the
addition
of ActD led to a loss of p21
Waf1 mRNA, similar to
that seen in mimosine-ActD-treated wt MEFs (Fig.
6D). UVC-ActD
treatment resulted in a similar, though slower,
decline in
p21
Waf1 mRNA. However, vanadate treatment completely
blocked the UVC-mediated
loss in p21
Waf1 mRNA transcripts,
suggesting that a tyrosine-phosphorylated protein
may be important in
regulating mRNA stability (Fig.
8). The
fact
that p21
Waf1 mRNA transcripts are more stable in cells
with functional p53
(wt MEFs and RKO cells) relative to p53-negative
cells (p53
/
MEFs and RKO E6 cells) following UVC
treatment (i.e., UVC treatment
does not cause a decline in
p21
Waf1 mRNA levels in cells with wild-type p53 [Fig.
4
and
5]) suggests
that p53 may be somehow involved in regulating the
tyrosine kinase/phosphatase
activity necessary for stabilization.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Influence of vanadate on clearance of
p21Waf1 mRNA in p53 / MEFs. Following
exposure to 300 µM mimosine for 14 h, p53 / MEFs
were either pretreated for 1 h with 40 µg of vanadate (Van) per
ml or not pretreated and were then exposed to ActD (1 µM), UVC (20 J/m2), or both. At the times indicated, RNA was collected
and p21Waf1 mRNA expression was determined by Northern blot
analysis. The p21Waf1 mRNA signals were quantitated with a
PhosphorImager. Mimosine remained in the culture media throughout the
entire treatment period.
|
|
Vanadate enhances survival of UVC-treated p53
/
MEFs.
Finally, since p21Waf1 expression could be
elevated in p53
/
cells by UVC in the presence of
vanadate, it was of interest to compare the survival of
p53
/
MEFs following UVC irradiation in the presence or
absence of vanadate. p21
/
MEFs were also included in
the experiment as a control, since p21Waf1 expression could
not be induced in them regardless of vanadate treatment. Wild-type,
p53
/
, and p21
/
MEFs were pretreated
with either 40 or 60 µg of vanadate per ml for 1 h, after which
vanadate was removed and the cells were irradiated with UVC at 10, 15, or 20 J/m2 (Fig. 9). Survival was assessed with a colony
proliferation assay 12 to 14 days later. While vanadate pretreatment
did not substantially alter the survival of wt MEFs (which already
expressed significant amounts of p21Waf1), it markedly
enhanced the survival of p53
/
MEFs to levels comparable
to those seen in wt cells (Fig. 9). That
the enhanced survival was attributed to enhanced p21Waf1
expression rather than some other effect of vanadate is supported by
the finding that vanadate did not improve survival of
p21
/
MEFs. Taken together, these findings argue
strongly that p21Waf1 functions as a survival factor in
this stress paradigm.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 9.
Effect of vanadate treatment on the survival of wt,
p53 / , and p21 / MEFs following UVC
irradiation. MEFs (5 × 105 in 100-mm-diameter tissue
culture dishes) were pretreated with 40 or 60 µg of vanadate (Van)
per ml for 1 h prior to irradiation with the indicated doses of
UVC. Vanadate was removed at the time of irradiation. Twenty-four hours
later, cells were trypsinized, serially diluted (10 to 1,000,000 times), replated, and returned to the incubator for an additional 12 to
14 days, whereupon plates were fixed and stained with crystal violet
and surviving colonies were counted. For each vanadate and UVC dose,
plates were seeded at four different dilutions, and routinely, three of
these were counted.
|
|
 |
DISCUSSION |
Alterations in gene expression in response to external stimuli
constitute a key component of the cellular response to stress. Although
most studies examining the genetic response to environmental insults
have focused on the transcriptional control of the induced genes, it is
likely that posttranscriptional mechanisms also contribute significantly to stress-induced changes in gene expression. In support
of this view, we have provided evidence that induction of
p21Waf1 expression following UVC irradiation is regulated
primarily through posttranscriptional events that increase the
stability of p21Waf1 mRNA. We provide further evidence
indicating that this is mediated by a tyrosine kinase/phosphatase
regulatory system and requires the presence of functional p53. In the
absence of p53, UVC irradiation not only fails to elevate
p21Waf1 expression but potently inhibits
p21Waf1 induction by mimosine, and also by other agents
such as hydrogen peroxide, okadaic acid, PGA2, or MMS (not
shown). This suppressive effect of UVC is likely to reflect a general
mechanism important for regulating mRNA stability of stress-responsive
genes, as we have found that UVC treatment also inhibits the expression
of other stress-inducible genes such as gadd45 and MAP kinase
phosphatase 1 genes in cells lacking p53 (not shown).
The regulation of the stability of labile mRNAs is poorly understood.
It is thought to employ a number of proteins that control the
degradative pathway through interaction with a number of cis elements, most frequently located in the 3' untranslated region of the
mRNA (5). The most common of 3' untranslated region stability determinants are AU-rich elements (AREs) (with very high
incidence of adenosine and uridine residues), notably the pentamer
AUUUA (14). AREs have been reported to confer instability to
otherwise stable mRNAs (41). Although AREs are typically found in the transcripts encoding cytokines (interleukins and interferons) and oncogenes (c-myc and c-fos),
they have also been found in other short-lived stress-inducible mRNAs,
including those encoding gadd153, vascular endothelial growth factor,
cyclin D1, and p21Waf1. Indeed, both human and mouse
p21Waf1 mRNAs contain AREs, including several AUUUA repeats
(8, 24). Among the various RNA-binding proteins which have
been identified to date are the AU-binding (11, 34, 39) and
ELAV families of proteins (12). Members of these families
(Hel-N1, Hel-N2, HuR, HuD, Hel-N, and HuC) display high affinity for
AREs (10, 33). Several reports have linked protein kinase C
(PKC) activation with mRNA stabilization events involving AU-binding
proteins following exposure to various agents (13, 14, 34,
44). However, PKC does not appear to contribute to the regulatory
events reported here, since PKC inhibitors failed to alter
p21Waf1 expression by UVC, mimosine, or combined treatment.
UVC irradiation leads to a rapid increase in tyrosine phosphorylation
of cellular proteins, many of which have not been identified. Both
receptor-linked and non-receptor-linked tyrosine kinases are believed
to play a central role in initiating the UVC response, leading to the
activation of MAP kinase signaling cascades, involving ERK, JNK, and
p38. The MAP kinase pathways play an important role in activating
transcription factors leading to increased gene transcription. Recent
reports have provided evidence that both serine/threonine and tyrosine
phosphatases play a key role in regulating the activity of the ERK,
JNK, and p38 MAP kinases at numerous stages of the signaling cascades.
Although a role for MAP kinases in mRNA stabilization has not been
explored, neither ERK nor p38 appears to contribute to regulating
p21Waf1 mRNA expression, since inhibitors of these pathways
did not alter the p21Waf1 mRNA levels. While the
involvement of the JNK pathway could not be tested directly in these
cells, due to the lack of availability of a suitable inhibitor, other
preliminary findings generated in our laboratory suggest that
p21Waf1 expression might be modulated by JNK. We have found
that transfection of human lung carcinoma A549 cells with a construct
that constitutively expresses a dominant-negative isoform of SEK1 (a
kinase that specifically phosphorylates, thereby activating, JNK)
results in a marked enhancement p21Waf1 mRNA expression by
UVC (our unpublished observations). Thus, a JNK-regulated protein might
contribute to an enhanced p21Waf1 mRNA degradation
following UVC exposure. To the best of our knowledge, ours is the first
study to provide evidence that tyrosine phosphorylation contributes to
the regulation of mRNA stability. Obviously, the identity of the
specific kinases/phosphatases involved will require further
investigation. Such activities could function upstream, downstream, or
independent of the JNK pathway, but we speculate that the activity of
RNA-binding proteins may be subject to regulation either directly by a
tyrosine kinase or through a downstream target (e.g., JNK).
The p21Waf1 promoter has been shown to contain multiple p53
binding sites which are important for transcriptional activation of p21Waf1 by ionizing radiation. Given the dependency of
p21Waf1 induction by UVC on p53, it was surprising to find
that induction by UVC does not involve such transcriptional activation.
In addition to its well-established function as a bona fide
transcription factor, several other gene regulatory functions have been
ascribed to p53. For example, in certain situations, p53 has been shown to repress transcription (36) and translation (9)
and to decrease protein stability (21). However, to our
knowledge, our studies provide the first evidence that p53 function is
involved in the regulation of gene expression by modulating mRNA
stability; whether this regulation is direct or indirect remains
to be addressed. Although our efforts have focused on the stability of
the mRNA encoding p21Waf1, mRNAs encoding other gene
products such as MKP-1 and gadd45 also appear to follow a pattern of
p53 dependency after UVC irradiation similar to that described here for
p21Waf1 mRNA (unpublished observations). Further
experiments are required to elucidate the precise role that p53 plays
in the expression of these genes and the contribution of
transcriptional and posttranscriptional regulatory events.
Finally, our results are consistent with p21Waf1 conferring
a survival advantage during the cellular response to UVC irradiation. That is, we observed a strong correlation between expression of p21Waf1 following UVC irradiation and survival, with the
p53
/
and p21
/
MEFs exhibiting much
greater sensitivity than their wild-type counterparts. These findings
contrast with those reported by DeFrank et al. (6), who
observed that wt and p53
/
MEFs had comparable survival
rates following exposure to UVC irradiation. The cause for this
discrepancy remains unclear. Nonetheless, the fact that in our studies
vanadate treatment, which restored p21Waf1 expression in
p53
/
MEFs, likewise enhanced their survival strongly
argues for a protective function of p21Waf1.
In summary, we have provided several novel findings regarding
p21Waf1 induction by cellular stress: (i) that
p21Waf1 induction in response to UVC occurs largely through
posttranscriptional modifications leading to enhanced stability of
p21Waf1 mRNA, (ii) that p21Waf1 mRNA stability
is regulated via a regulatory system sensitive to vanadate (possibly
involving changes in tyrosine phosphorylation), and (iii) that these
putative tyrosine kinase/phosphatase activities are subject to
modulation by UVC irradiation in a p53-dependent fashion. Future
studies will address the identity of the specific tyrosine
kinase/phosphatases involved, their downstream targets, and the nature
of the p53 dependency of this effect.
 |
ACKNOWLEDGMENTS |
We thank M. B. Kastan for the RKO neo and RKO E6 cells, T. Jacks for the wt and p53
/
MEFs, P. Leder for the
p21
/
MEFs, and B Vogelstein for plasmids pCEP4Waf1 and
WWT-Luc. We are also grateful to S. Shack, A. Passaniti, K. Z. Guyton, and Y. Liu for helpful discussions and D. L. Longo for
critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Box 12, Section
on Gene Expression and Aging, Laboratory of Biological Chemistry,
National Institutes of Health, National Institute on Aging, GRC, 5600 Nathan Shock Dr., Baltimore, MD 21224-6825. Phone: (410) 558-8197. Fax: (410) 558-8335. E-mail: nikki-holbrook{at}nih.gov.
 |
REFERENCES |
| 1.
|
Akashi, M.,
M. Hachiya,
Y. Osawa,
K. Spirin,
G. Suzuki, and H. P. Koeffler.
1995.
Irradiation induces Waf1 expression through a p53-independent pathway in KG-1 cells.
J. Biol. Chem.
270:19181-19187[Abstract/Free Full Text].
|
| 2.
|
Alpan, R. S., and A. B. Pardee.
1996.
p21Waf1/CIP1/SDI1 is elevated through a p53-independent pathway by mimosine.
Cell Growth Differ.
7:893-901[Abstract].
|
| 3.
|
Chen, Y. R.,
X. Wang,
R. J. Templeton,
R. J. Davis, and T. H. Tan.
1996.
The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gamma radiation. Duration of JNK activation may determine cell death and proliferation.
J. Biol. Chem.
271:31929-31936[Abstract/Free Full Text].
|
| 4.
|
Church, G. M., and W. Gilbert.
1984.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:1991-1995[Abstract/Free Full Text].
|
| 5.
|
Decker, C. J., and R. Parker.
1995.
Diversity of cytoplasmic functions for the 3' untranslated region of eukaryotic transcripts.
Curr. Opin. Cell Biol.
7:386-392[Medline].
|
| 6.
|
DeFrank, J. S.,
W. Tang, and S. N. Powell.
1996.
p53-null cells are more sensitive to ultraviolet light only in the presence of caffeine.
Cancer Res.
56:5365-5368[Abstract/Free Full Text].
|
| 7.
|
Deng, C.,
P. Zhang,
J. W. Harper,
S. J. Elledge, and P. Leder.
1995.
Mice lacking p21CIP1/Waf1 undergo normal development, but are defective in G1 checkpoint control.
Cell
82:675-684[Medline].
|
| 8.
|
El-Deiry, W. S.,
T. Tokino,
T. Velculescu,
D. B. Levy,
R. Parsons,
J. M. Trent,
D. Lin,
W. E. Mercer,
K. W. Kinzler, and B. Vogelstein.
1993.
Waf1, a potential mediator of p53 tumor suppression.
Cell
75:817-825[Medline].
|
| 9.
|
Ewen, M. E.,
C. J. Oliver,
H. K. Sluss,
S. J. Miller, and D. S. Peeper.
1995.
p53-dependent repression of CDK4 translation in TGF- -induced G1 cell cycle arrest.
Genes Dev.
9:204-217[Abstract/Free Full Text].
|
| 10.
|
Gao, F. B.,
C. C. Carson,
T. Levine, and J. D. Keene.
1994.
Selection of a subset of mRNAs from combinatorial 3' untranslated region libraries using the neuronal RNA-binding protein Hel-N1.
Proc. Natl. Acad. Sci. USA
91:11207-11211[Abstract/Free Full Text].
|
| 11.
|
Gillis, P., and J. S. Malter.
1991.
The adenosine-uridine binding factor recognizes the AU-rich elements of cytokine, lymphokine and oncogene mRNAs.
J. Biol. Chem.
266:3172-3177[Abstract/Free Full Text].
|
| 12.
|
Good, P. J.
1995.
A conserved family of elav-like genes in vertebrates.
Proc. Natl. Acad. Sci. USA
92:4557-4561[Abstract/Free Full Text].
|
| 13.
|
Gorospe, M.,
S. Kumar, and C. Baglioni.
1993.
Tumor necrosis factor increases stability of interleukin-1 mRNA by activating protein kinase C.
J. Biol. Chem.
268:6214-6220[Abstract/Free Full Text].
|
| 14.
|
Gorospe, M., and C. Baglioni.
1994.
Degradation of unstable interleukin-1 alpha mRNA in a rabbit reticulocyte cell-free system. Localization of an instability determinant to a cluster of AUUUA motifs.
J. Biol. Chem.
269:11845-11851[Abstract/Free Full Text].
|
| 15.
|
Gorospe, M., and N. J. Holbrook.
1996.
Role of p21Waf1 in prostaglandin A2-mediated cellular arrest and death.
Cancer Res.
56:475-479[Abstract/Free Full Text].
|
| 16.
|
Gorospe, M.,
J. L. Martindale,
M. S. Sheikh,
A. J. Fornace, Jr., and N. J. Holbrook.
1996.
Regulation of p21CIP1/Waf1 expression by cellular stress: p53-dependent and p53-independent mechanisms.
Mol. Cell. Differ.
4:47-65.
|
| 17.
|
Gorospe, M.,
X. Wang,
K. Guyton, and N. J. Holbrook.
1996.
Protective role of p21Waf1/Cip1 against prostaglandin A2-mediated apoptosis of human colorectal carcinoma cells.
Mol. Cell. Biol.
16:6654-6660[Abstract].
|
| 18.
|
Gorospe, M.,
C. Cirielli,
X. Wang,
M. Capogrossi, and N. J. Holbrook.
1997.
p21Waf1/Cip1 expression prevents p53-mediated apoptotic cell death of human melanoma cells.
Oncogene
14:929-935[Medline].
|
| 19.
|
Gotz, C., and M. Montenarh.
1995.
p53 and its implications in apoptosis.
Int. J. Oncol.
6:1129-1135.
|
| 20.
|
Groudine, M.,
M. Peretz, and H. Weintraub.
1981.
Transcriptional regulation of hemoglobin switching in chicken embryos.
Mol. Cell. Biol.
1:281-288[Abstract/Free Full Text].
|
| 21.
|
Gupta, S.,
D. Campbell,
B. Derijard, and R. J. Davis.
1995.
Transcription factor ATF2 regulation by the JNK signal transduction.
Science
267:389-393[Abstract/Free Full Text].
|
| 22.
|
Holbrook, N. J.,
Y. Liu, and A. J. Fornace, Jr.
1996.
Signaling events controlling the molecular response to genotoxic stress.
EXS
77:273-288[Medline].
|
| 23.
|
Hunter, T., and M. Karin.
1992.
The regulation of transcription by phosphorylation.
Cell
70:375-387[Medline].
|
| 24.
|
Huppi, K.,
D. Siwarski,
J. Dosik,
P. Michieli,
M. Chedid,
S. Reed,
B. Mock,
D. Givol, and J. F. Mushinski.
1994.
Molecular cloning, sequencing, chromosomal localization and expression of mouse p21 (Waf1).
Oncogene
9:3017-3020[Medline].
|
| 25.
|
Iordanov, M.,
K. Bender,
T. Ade,
W. Schmid,
C. Sachsenmaier,
K. Engel,
M. Gaestel,
H. J. Rahmsdorf, and P. Herrlich.
1997.
CREB is activated by UVC through a p38/HOG1-dependent protein kinase.
EMBO J.
16:1009-1022[Medline].
|
| 26.
|
Jackman, J.,
I. J. Alamo, and A. J. Fornace, Jr.
1994.
Genotoxic stress confers preferential and coordinate messenger RNA stability on the five gadd genes.
Cancer Res.
54:5656-5662[Abstract/Free Full Text].
|
| 27.
|
Johnson, M.,
D. Dimitrov,
P. J. Vojta,
J. C. Barret,
A. Noda,
O. M. Pereira-Smith, and J. R. Smith.
1994.
Evidence for a p53-independent pathway for upregulation of SDI1/CIP1/Waf1/p21 RNA in human cells.
Mol. Carcinog.
11:59-64[Medline].
|
| 28.
|
Kessis, T. D.,
R. J. Slebos,
W. D. Nelson,
M. B. Kastan,
B. S. Plunkett,
S. M. Han,
A. T. Lorincz,
L. Hedrick, and K. R. Cho.
1993.
Human papilloma virus 16 E6 expression disrupts the p53-mediated cellular response to DNA damage.
Proc. Natl. Acad. Sci. USA
90:3988-3992[Abstract/Free Full Text].
|
| 29.
|
Kyriakis, J. M., and J. Avruch.
1997.
Protein kinase cascades activated by stress and inflammatory cytokines.
Bioessays
18:567-577.
|
| 30.
|
Lee, J. C., and P. R. Young.
1996.
Role of CSB/p38/RK stress response kinase in LPS and cytokine signaling mechanisms.
J. Leukocyte Biol.
59:152-157[Abstract].
|
| 31.
|
Liu, Y.,
J. L. Martindale,
M. Gorospe, and N. J. Holbrook.
1996.
Regulation of p21Waf1/CIP1 expression through mitogen-activated protein kinase signaling pathway.
Cancer Res.
56:1-5[Abstract/Free Full Text].
|
| 32.
|
Lowe, S. W.,
H. E. Ruley,
T. Jacks, and D. E. Housman.
1993.
p53-dependent apoptosis modulates the cytotoxicity of anticancer agents.
Cell
74:957-967[Medline].
|
| 33.
|
Ma, W. J.,
S. Cheng,
C. Campbell,
A. Wright, and H. Furneaux.
1996.
Cloning and characterization of HuR, a ubiquitously expressed Elav-like protein.
J. Biol. Chem.
271:8144-8151[Abstract/Free Full Text].
|
| 34.
|
Malter, J. S., and Y. Hong.
1991.
A redox switch and phosphorylation are involved in the post-translational up-regulation of the adenosine-uridine binding factor by phorbol ester and ionophore.
J. Biol. Chem.
266:3167-3171[Abstract/Free Full Text].
|
| 35.
|
Michieli, P.,
M. Chedid,
D. Lin,
J. H. Pierce,
W. E. Mercer, and D. Givol.
1994.
Induction of Waf1/CIP1 by a p53-independent pathway.
Cancer Res.
54:3391-3395[Abstract/Free Full Text].
|
| 36.
|
Murphy, M.,
A. Hinman, and A. J. Levine.
1996.
Wild-type p53 negatively regulates the expression of a microtubule-associated protein.
Genes Dev.
10:2971-2980[Abstract/Free Full Text].
|
| 37.
|
Poluha, W.,
D. K. Poluha,
B. Chang,
N. E. Crosbie,
C. M. Schonhoff,
D. L. Kilpatrick, and A. H. Ross.
1996.
The cyclin-dependent kinase inhibitor p21Waf1 is required for survival of differentiating neuroblastoma cells.
Mol. Cell. Biol.
16:1335-1341[Abstract].
|
| 38.
|
Price, M. A.,
F. H. Cruzalegui, and R. Treisman.
1996.
The p38 and ERK MAP kinase pathways cooperate to activate ternary complex factors and c-fos transcription in response to UV light.
EMBO J.
15:6552-6563[Medline].
|
| 39.
|
Rondon, I. J.,
L. A. MacMillan,
B. S. Beckman,
M. A. Goldberg,
T. Schneider,
H. F. Bunn, and J. S. Malter.
1991.
Hypoxia up-regulates the activity of a novel erythropoietin mRNA binding protein.
J. Biol. Chem.
266:16594-16589[Abstract/Free Full Text].
|
| 40.
|
Russo, T.,
N. Zambrano,
F. Esposito,
R. Ammendola,
F. Cimino,
M. Fiscella,
J. Jackman,
P. M. O'Connor,
C. W. Anderson, and E. Appella.
1995.
A p53-independent pathway for activation of Waf1/CIP1 expression following oxidative stress.
J. Biol. Chem.
270:29386-29391[Abstract/Free Full Text].
|
| 41.
|
Shaw, G., and R. Kamen.
1986.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:659-667[Medline].
|
| 42.
|
Sheikh, M. S.,
Y. Q. Chen,
M. L. Smith, and A. J. Fornace, Jr.
1997.
Role of p21Waf1/Cip1/Sdi1 in cell death and DNA repair as studied using a tetracycline-inducible system in p53-deficient cells.
Oncogene
14:1875-1882[Medline].
|
| 43.
|
Smith, M. L.,
I.-T. Chen,
Q. Zhan,
P. M. O'Connor, and A. J. Fornace, Jr.
1995.
Involvement of the p53 tumor suppressor in repair of U.V.-type DNA damage.
Oncogene
9:1053-1059.
|
| 44.
|
Thivierge, M.,
J. L. Parent,
J. Stankova, and M. Rola-Pleszczynski.
1996.
Modulation of human platelet-activating factor receptor gene expression by protein kinase C activation.
J. Immunol.
157:4681-4687[Abstract].
|
| 45.
|
Tyrrell, R. M.
1996.
UV activation of mammalian stress proteins.
EXS
77:255-271[Medline].
|
| 46.
|
Tyrrell, R. M.
1996.
Activation of mammalian gene expression by the UV component of sunlight from models to reality.
Bioessays
18:139-148[Medline].
|
| 47.
|
Waldman, T.,
C. Lengauer,
K. W. Kinzler, and B. Vogelstein.
1996.
Uncoupling of S phase and mitosis induced by anticancer agents in cells lacking p21.
Nature
381:713-716[Medline].
|
| 48.
|
Woodgett, J. R.,
J. Avruch, and J. Kyriakis.
1996.
The stress-activated protein kinase pathway.
Cancer Surv.
27:127-138[Medline].
|
| 49.
|
Zanke, B. W.,
K. Boudreau,
E. Rubie,
E. Winnett,
L. A. Tibbles,
L. Zon,
J. Kyriakis,
F. F. Liu, and J. R. Woodgett.
1996.
The stress-activated protein kinase pathway mediates cell death following injury induced by cis-platinum, UV irradiation or heat.
Curr. Biol.
6:606-613[Medline].
|
Mol Cell Biol, March 1998, p. 1400-1407, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Friedel, C. C., Dolken, L., Ruzsics, Z., H. Koszinowski, U., Zimmer, R.
(2009). Conserved principles of mammalian transcriptional regulation revealed by RNA half-life. Nucleic Acids Res
0: gkp542v1-gkp542
[Abstract]
[Full Text]
-
Li, X.-L., Andersen, J. B., Ezelle, H. J., Wilson, G. M., Hassel, B. A.
(2007). Post-transcriptional Regulation of RNase-L Expression Is Mediated by the 3'-Untranslated Region of Its mRNA. J. Biol. Chem.
282: 7950-7960
[Abstract]
[Full Text]
-
Al-Mohanna, M. A., Al-Khalaf, H. H., Al-Yousef, N., Aboussekhra, A.
(2007). The p16INK4a tumor suppressor controls p21WAF1 induction in response to ultraviolet light. Nucleic Acids Res
35: 223-233
[Abstract]
[Full Text]
-
Benjamin, D., Schmidlin, M., Min, L., Gross, B., Moroni, C.
(2006). BRF1 Protein Turnover and mRNA Decay Activity Are Regulated by Protein Kinase B at the Same Phosphorylation Sites. Mol. Cell. Biol.
26: 9497-9507
[Abstract]
[Full Text]
-
Shu, L., Yan, W., Chen, X.
(2006). RNPC1, an RNA-binding protein and a target of the p53 family, is required for maintaining the stability of the basal and stress-induced p21 transcript. Genes Dev.
20: 2961-2972
[Abstract]
[Full Text]
-
Zhu, H., Nie, L., Maki, C. G.
(2005). Cdk2-dependent Inhibition of p21 Stability via a C-terminal Cyclin-binding Motif. J. Biol. Chem.
280: 29282-29288
[Abstract]
[Full Text]
-
Melkoumian, Z. K., Peng, X., Gan, B., Wu, X., Guan, J.-L.
(2005). Mechanism of Cell Cycle Regulation by FIP200 in Human Breast Cancer Cells. Cancer Res.
65: 6676-6684
[Abstract]
[Full Text]
-
Huang, Y., Norton, D. D., Precht, P., Martindale, J. L., Burkhardt, J. K., Wange, R. L.
(2005). Deficiency of ADAP/Fyb/SLAP-130 Destabilizes SKAP55 in Jurkat T Cells. J. Biol. Chem.
280: 23576-23583
[Abstract]
[Full Text]
-
Yano, M., Okano, H. J., Okano, H.
(2005). Involvement of Hu and Heterogeneous Nuclear Ribonucleoprotein K in Neuronal Differentiation through p21 mRNA Post-transcriptional Regulation. J. Biol. Chem.
280: 12690-12699
[Abstract]
[Full Text]
-
Yang, X., Wang, W., Fan, J., Lal, A., Yang, D., Cheng, H., Gorospe, M.
(2004). Prostaglandin A2-mediated Stabilization of p21 mRNA through an ERK-dependent Pathway Requiring the RNA-binding Protein HuR. J. Biol. Chem.
279: 49298-49306
[Abstract]
[Full Text]
-
Tran, H., Maurer, F., Nagamine, Y.
(2003). Stabilization of Urokinase and Urokinase Receptor mRNAs by HuR Is Linked to Its Cytoplasmic Accumulation Induced by Activated Mitogen-Activated Protein Kinase-Activated Protein Kinase 2. Mol. Cell. Biol.
23: 7177-7188
[Abstract]
[Full Text]
-
Figueroa, A., Cuadrado, A., Fan, J., Atasoy, U., Muscat, G. E., Munoz-Canoves, P., Gorospe, M., Munoz, A.
(2003). Role of HuR in Skeletal Myogenesis through Coordinate Regulation of Muscle Differentiation Genes. Mol. Cell. Biol.
23: 4991-5004
[Abstract]
[Full Text]
-
Giles, K. M., Daly, J. M., Beveridge, D. J., Thomson, A. M., Voon, D. C., Furneaux, H. M., Jazayeri, J. A., Leedman, P. J.
(2003). The 3'-Untranslated Region of p21WAF1 mRNA Is a Composite cis-Acting Sequence Bound by RNA-binding Proteins from Breast Cancer Cells, Including HuR and Poly(C)-binding Protein. J. Biol. Chem.
278: 2937-2946
[Abstract]
[Full Text]
-
Tang, K., Breen, E. C., Wagner, P. D.
(2002). Hu protein R-mediated posttranscriptional regulation of VEGF expression in rat gastrocnemius muscle. Am. J. Physiol. Heart Circ. Physiol.
283: H1497-H1504
[Abstract]
[Full Text]
-
Fan, J., Yang, X., Wang, W., Wood, W. H. III, Becker, K. G., Gorospe, M.
(2002). Global analysis of stress-regulated mRNA turnover by using cDNA arrays. Proc. Natl. Acad. Sci. USA
99: 10611-10616
[Abstract]
[Full Text]
-
Wang, W., Fan, J., Yang, X., Furer-Galban, S., Lopez de Silanes, I., von Kobbe, C., Guo, J., Georas, S. N., Foufelle, F., Hardie, D. G., Carling, D., Gorospe, M.
(2002). AMP-Activated Kinase Regulates Cytoplasmic HuR. Mol. Cell. Biol.
22: 3425-3436
[Abstract]
[Full Text]
-
Bonilla, I. E., Tanabe, K., Strittmatter, S. M.
(2002). Small Proline-Rich Repeat Protein 1A Is Expressed by Axotomized Neurons and Promotes Axonal Outgrowth. J. Neurosci.
22: 1303-1315
[Abstract]
[Full Text]
-
Hattinger, C. M., Jochemsen, A. G., Tanke, H. J., Dirks, R. W.
(2002). Induction of p21 mRNA Synthesis After Short-wavelength UV Light Visualized in Individual Cells by RNA FISH. J. Histochem. Cytochem.
50: 81-90
[Abstract]
[Full Text]
-
Ming, X.-F., Stoecklin, G., Lu, M., Looser, R., Moroni, C.
(2001). Parallel and Independent Regulation of Interleukin-3 mRNA Turnover by Phosphatidylinositol 3-Kinase and p38 Mitogen-Activated Protein Kinase. Mol. Cell. Biol.
21: 5778-5789
[Abstract]
[Full Text]
-
Lin, S., Wang, W., Wilson, G. M., Yang, X., Brewer, G., Holbrook, N. J., Gorospe, M.
(2000). Down-Regulation of Cyclin D1 Expression by Prostaglandin A2 Is Mediated by Enhanced Cyclin D1 mRNA Turnover. Mol. Cell. Biol.
20: 7903-7913
[Abstract]
[Full Text]
-
Brennan, C. M., Gallouzi, I.-E., Steitz, J. A.
(2000). Protein Ligands to HuR Modulate Its Interaction with Target mRNAs In Vivo. JCB
151: 1-14
[Abstract]
[Full Text]
-
Kim, M., Lee, W., Park, J., Kim, J. B., Jang, Y. K., Seong, R. H., Choe, S. Y., Park, S. D.
(2000). The stress-activated MAP kinase Sty1/Spc1 and a 3'-regulatory element mediate UV-induced expression of the uvi15+ gene at the post-transcriptional level. Nucleic Acids Res
28: 3392-3402
[Abstract]
[Full Text]
-
Blattner, C., Kannouche, P., Litfin, M., Bender, K., Rahmsdorf, H. J., Angulo, J. F., Herrlich, P.
(2000). UV-Induced Stabilization of c-fos and Other Short-Lived mRNAs. Mol. Cell. Biol.
20: 3616-3625
[Abstract]
[Full Text]
-
Smith, M. L., Ford, J. M., Hollander, M. C., Bortnick, R. A., Amundson, S. A., Seo, Y. R., Deng, C.-X., Hanawalt, P. C., Fornace, A. J. Jr.
(2000). p53-Mediated DNA Repair Responses to UV Radiation: Studies of Mouse Cells Lacking p53, p21, and/or gadd45 Genes. Mol. Cell. Biol.
20: 3705-3714
[Abstract]
[Full Text]
-
Liu, J., Shen, X., Nguyen, V.-A., Kunos, G., Gao, B.
(2000). alpha 1 Adrenergic Agonist Induction of p21waf1/cip1 mRNA Stability in Transfected HepG2 Cells Correlates with the Increased Binding of an AU-rich Element Binding Factor. J. Biol. Chem.
275: 11846-11851
[Abstract]
[Full Text]
-
Gallouzi, I.-E., Brennan, C. M., Stenberg, M. G., Swanson, M. S., Eversole, A., Maizels, N., Steitz, J. A.
(2000). HuR binding to cytoplasmic mRNA is perturbed by heat shock. Proc. Natl. Acad. Sci. USA
97: 3073-3078
[Abstract]
[Full Text]
-
Li, X.-L., Blackford, J. A., Judge, C. S., Liu, M., Xiao, W., Kalvakolanu, D. V., Hassel, B. A.
(2000). RNase-L-dependent Destabilization of Interferon-induced mRNAs. A ROLE FOR THE 2-5A SYSTEM IN ATTENUATION OF THE INTERFERON RESPONSE. J. Biol. Chem.
275: 8880-8888
[Abstract]
[Full Text]
-
Potapova, O., Gorospe, M., Dougherty, R. H., Dean, N. M., Gaarde, W. A., Holbrook, N. J.
(2000). Inhibition of c-Jun N-Terminal Kinase 2 Expression Suppresses Growth and Induces Apoptosis of Human Tumor Cells in a p53-Dependent Manner. Mol. Cell. Biol.
20: 1713-1722
[Abstract]
[Full Text]
-
Wang, W., Furneaux, H., Cheng, H., Caldwell, M. C., Hutter, D., Liu, Y., Holbrook, N., Gorospe, M.
(2000). HuR Regulates p21 mRNA Stabilization by UV Light. Mol. Cell. Biol.
20: 760-769
[Abstract]
[Full Text]
-
Kivinen, L., Laiho, M.
(1999). Ras- and Mitogen-activated Protein Kinase Kinase-dependent and -independent Pathways in p21Cip1/Waf1 Induction by Fibroblast Growth Factor-2, Platelet-derived Growth Factor, and Transforming Growth Factor-{beta}1. Cell Growth Differ.
10: 621-628
[Abstract]
[Full Text]
-
McKay, B. C., Ljungman, M., Rainbow1, A. J.
(1999). Potential roles for p53 in nucleotide excision repair. Carcinogenesis
20: 1389-1396
[Abstract]
[Full Text]
-
Casse, C., Giannoni, F., Nguyen, V. T., Dubois, M.-F., Bensaude, O.
(1999). The Transcriptional Inhibitors, Actinomycin D and alpha -Amanitin, Activate the HIV-1 Promoter and Favor Phosphorylation of the RNA Polymerase II C-terminal Domain. J. Biol. Chem.
274: 16097-16106
[Abstract]
[Full Text]
-
Chang, D., Chen, F., Zhang, F., McKay, B. C., Ljungman, M.
(1999). Dose-dependent Effects of DNA-damaging Agents on p53-mediated Cell Cycle Arrest. Cell Growth Differ.
10: 155-162
[Abstract]
[Full Text]
-
Gentilini, G., Kirschbaum, N. E., Augustine, J. A., Aster, R. H., Visentin, G. P.
(1999). Inhibition of Human Umbilical Vein Endothelial Cell Proliferation by the CXC Chemokine, Platelet Factor 4 (PF4), Is Associated With Impaired Downregulation of p21Cip1/WAF1. Blood
93: 25-33
[Abstract]
[Full Text]
-
Joseph, B., Orlian, M., Furneaux, H.
(1998). p21waf1 mRNA Contains a Conserved Element in Its 3'-Untranslated Region That Is Bound by the Elav-like mRNA-stabilizing Proteins. J. Biol. Chem.
273: 20511-20516
[Abstract]
[Full Text]
-
Hsing, A., Faller, D. V., Vaziri, C.
(2000). DNA-damaging Aryl Hydrocarbons Induce Mdm2 Expression via p53-independent Post-transcriptional Mechanisms. J. Biol. Chem.
275: 26024-26031
[Abstract]
[Full Text]
-
Schmitt-Ney, M., Habener, J. F.
(2000). CHOP/GADD153 Gene Expression Response to Cellular Stresses Inhibited by Prior Exposure to Ultraviolet Light Wavelength Band C (UVC). INHIBITORY SEQUENCE MEDIATING THE UVC RESPONSE LOCALIZED TO EXON 1. J. Biol. Chem.
275: 40839-40845
[Abstract]
[Full Text]