INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Exposure of mammalian cells to stressful stimuli triggers a variety of response mechanisms, including alterations in the pattern of gene expression. Ultimately, these modifications determine the global response of the cell, ranging from transformation, growth stimulation, growth inhibition, differentiation, senescence, and cell death. Much of the altered gene expression seen in response to stress occurs through activation of selective gene transcription, and much attention has been focused on delineating the mechanisms regulating these transcriptional events. Central to the stress response is the activation of one or more mitogen-activated protein (MAP) kinase cascades, including those leading to the activation of the extracellular signal-regulated kinases (ERKs) (38, 48, 49), the c-Jun N-terminal kinases (JNKs; also known as stress-activated protein kinases) (3, 29), and a 38-kDa kinase termed CSBP/HOG1 (25, 29, 30). These MAP kinases serve to regulate, via phosphorylation, the activity of critical transcription factors (23). Alterations in posttranscriptional events also contribute to the regulation of gene expression during stress. Enhanced mRNA stability, in particular, has been associated with increased expression of many stress-responsive genes (26), and changes in the rate of translation and/or stability of proteins have likewise been implicated in regulating the expression of particular gene products during the stress response (9, 21). However, the mechanisms regulating these posttranscriptional processes remain largely unknown.

Among the genes that are believed to play an important role in determining cell fate during stress is the cyclin-dependent kinase inhibitor gene p21^Waf1. p21^Waf1 was originally identified as a gene regulated by the tumor suppressor protein p53 (8), and, indeed, induction of p21^Waf1 in response to X irradiation and other DNA-damaging agents relies, to different extents, on its transcriptional upregulation by p53 (19). However, induction of p21^Waf1 in response to other stresses, as well as by mitogenic stimulation, occurs via mechanisms that are independent of p53 (1, 8, 16, 27, 31, 35, 40). The role of p21^Waf1 during stress remains controversial. Although there is evidence to suggest that p21^Waf1 is proapoptotic in certain situations, most studies have provided evidence indicating that it functions as a protective factor during stress, associated with its growth-inhibitory properties. Thus, colorectal carcinoma cells lacking p21^Waf1 display enhanced sensitivity to the cytotoxic effects of chemotherapeutic drugs (47). Furthermore, inhibiting p21^Waf1 expression results in apoptosis of SH-SY5Y neuroblastoma cells (37) and sensitizes human breast carcinoma MCF-7 cells to killing by prostaglandin A₂ (PGA₂) (15). Conversely, elevated p21^Waf1 expression protects the human colorectal carcinoma RKO line against the cytotoxic effects of PGA₂ (15), prevents p53-mediated apoptosis of SK-MEL-110 cells (18), and enhances survival of UVC-treated DLD1 colorectal carcinoma cells (42).

In the present study, we investigated the mechanism(s) contributing to the regulation of p21^Waf1 expression in response to UVC treatment and its influence on cell survival. Following exposure of mouse embryonal fibroblasts (MEFs) or RKO cells to UVC, increased p21^Waf1 expression was found to depend on the presence of functional p53 and to correlate with enhanced cell survival. Not only did UVC treatment fail to induce p21^Waf1 expression in either p53-deficient MEFs (p53^/ MEFs) or p53-deficient RKO cells; it also prevented p21^Waf1 induction by mimosine, an agent that induces p21^Waf1 expression independently of p53 function. The p53-dependent increase in p21^Waf1 expression involves stabilization of p21^Waf1 mRNA. However, even in the absence of p53, UVC was found to be capable of augmenting p21^Waf1 expression if tyrosine phosphatase activity was blocked by vanadate. These studies implicate p53 in the control of a vanadate-sensitive system, possibly involving regulation of protein tyrosine phosphorylation, in the augmentation of p21^Waf1 mRNA stability.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Cell culture and treatments. The human colorectal carcinoma cell lines RKO neo (exhibiting wild-type p53 function) and RKO E6 (p53 deficient) (28, 43) were cultured in minimum essential medium (Gibco BRL, Gaithersburg, Md.), and embryonal fibroblasts derived from wild-type, p21^Waf1 knockout (p21^/) (7), and p53 knockout (p53^/) mice (32) were cultured in Dulbecco's modified essential medium (Gibco BRL). Both media were supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah) and 50 µg of gentamicin (Gibco BRL) per ml. RKO cells also received 350 µg of neomycin (Gibco BRL) per ml. Suramin, N-acetyl cysteine, rapamycin, sodium orthovanadate, dithiothreitol, H7, staurosporine, wortmannin, genistein, actinomycin D (ActD), and okadaic acid were purchased from Sigma (St. Louis, Mo.). Mimosine was purchased from Aldrich Chemical Co. (St. Louis, Mo.). SB 203580 and PD 098059 were kindly provided by SmithKline Beecham and Parke Davis, respectively. Drugs were added directly to the medium to the final concentrations indicated. For irradiation with UVC, cells were grown to approximately 50% confluence in 100- or 150-mm-diameter plates, and their medium was removed. Cells were then rinsed with phosphate-buffered saline and irradiated, and tissue culture medium was added back. In every experiment, untreated controls were subjected to mock irradiation.

Northern blot analysis. Total RNA was isolated with STAT-60 (Tel-Test "B," Friendswood, Tex.), and 20-µg RNA samples were denatured, size fractionated by electrophoresis in 1.2% agarose-formaldehyde gels, and transferred onto GeneScreen Plus nylon membranes (DuPont/NEN, Boston, Mass.). For the detection of p21^Waf1 mRNA in RKO cells and gadd153 in MEFs, the p21^Waf1 and gadd153 cDNAs were excised from plasmid pCEP-Waf1 (8) or pCMVgadd153, respectively, and labeled by using [-³²P]dCTP with a random primer labeling kit (Boehringer Mannheim, Indianapolis, Ind.). For the detection of p21^Waf1 mRNA in MEFs and for normalization of differences in loading and transfer among samples in all Northern blots, an oligomer complementary to the mouse p21^Waf1 mRNA (5'-CTCCGTGACGAAGTCAAAGTTCCACCGTTCTCGGGCCTCCTGGAGACAGCC-3') and an oligomer complementary to the 18S rRNA (5'-ACGGTATCTGATCGTCTTCGAACC-3' (Integrated DNA Technologies, Coralville, Iowa) were 3' end labeled with [-³²P]dATP by terminal deoxynucleotidyltransferase (Life Technology Laboratories, Gaithersburg, Md.). Hybridization and washes were performed by the method of Church and Gilbert (4). Incorporation of ³²P was visualized by using a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.).

Transient transfection. For transfection experiments, 5 × 10⁵ cells were seeded in 100-mm-diameter plates 24 h before transfection. The p21^Waf1 promoter-luciferase construct WWT-Luc (5 µg of DNA) was transfected into cells by standard calcium phosphate precipitation methods, and luciferase activity was assayed with a luciferase assay system kit (Promega, Madison, Wis.). Values represent means ± standard errors of the means (SEM) of three independent experiments.

Colony formation assays. Cell survival was measured by using a standard clonogenic assay. Twenty hours after treatment, 5 × 10⁵ cells were trypsinized and serially diluted according to the expected surviving fraction (from 1:10 to 1:1,000,000). Plates were then returned to the incubator and cultured for an additional 12 to 14 days. The plates were fixed and stained with a crystal violet solution (10% [vol/vol] ethanol, 0.1% [wt/vol] crystal violet), and colonies (defined as greater than 50 cells) were counted. The surviving fraction was measured as the number of colonies divided by the dilution factor. For each UVC dose, plates were seeded at four different dilutions, and routinely, three of these were counted. Each colony formation assay was performed at least three times.

Nuclear run-on assay. Nuclei were prepared from 5 × 10⁷ MEFs 8 h after treatment with either UVC irradiation (20 J/m²) or mimosine (300 µM). Nascent RNA was labeled essentially as previously described previously (20) except that radiolabeled RNA was isolated by using the STAT-60 reagent and precipitated with 0.7 volume of isopropanol. Five micrograms of denatured -actin and gadd153 cDNAs, 5 µg of an oligomer complementary to mouse p21^Waf1 (5'-CT CCGTGACGAAGTCAAAGTTCCACCGTTCTCGGGCCTCCTGGAGACA GCC-3'), and 5 µg of pBlueScript plasmid (included as a negative control) were dot blotted onto nitrocellulose membranes. After blocking with 100 µg of tRNA per ml, membranes were hybridized with 4 × 10⁶ cpm in 2 ml of hybridization buffer for 72 h at 65°C, washed extensively in 1% sodium dodecyl sulfate-1× SSC (0.15 M NaCl plus 0.015 M sodium citrate) at 65°C, and visualized with a PhosphorImager.

Western blot analysis. Fifty-microgram samples of total cell lysates were size fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes by using standard techniques. p21^Waf1 protein was detected with the ECL system (Amersham, Arlington Heights, Ill.) following incubation with a polyclonal rabbit anti-mouse p21^Waf1 antibody (PC55) from Calbiochem (Cambridge, Mass.).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Effect of UVC irradiation on p21^Waf1 mRNA expression and survival of MEFs and RKO cells differing in p53 status. In agreement with earlier reports, exposure of wild-type MEFs (wt MEFs) and parental RKO neo cells to UVC resulted in a dose- and time-dependent elevation in p21^Waf1 mRNA. Maximum induction of p21^Waf1 mRNA expression (25- to 30-fold) was achieved with doses of UVC between 10 and 20 J/m² (Fig. 1A) and within 6 to 12 h of treatment. Induction was sustained for up to 24 h but declined thereafter (Fig. 1B and data not shown). To determine whether the enhanced p21^Waf1 expression following UVC irradiation was dependent on the presence of functional p53, p53-deficient MEFs and RKO cells were examined. As shown, MEFs derived from a mouse where both p53 alleles had been disrupted (p53^/ MEFs) as well as RKO cells where p53 function was inactivated by constitutive overexpression of the viral oncoprotein E6 (RKO E6 cells) failed to exhibit a substantial induction of p21^Waf1 mRNA following UVC exposure, regardless of the UVC doses used or the times examined (Fig. 1).

View larger version (44K): [in this window] [in a new window]   FIG. 1.   p21Waf1 mRNA expression following UVC irradiation in MEFs or RKO cells differing in p53 status. (A) MEFs and RKO cells with functional p53 (wt MEFs and RKO neo cells, respectively) or nonfunctional p53 (p53/ MEFs and RKO E6 cells, respectively) were exposed to increasing doses of UVC irradiation. Ten hours later, cells were lysed and p21Waf1 mRNA expression was assessed by Northern blot analysis as described in Materials and Methods. Assessment of loading and transfer of RNA samples, detected by hybridization to an oligomer complementary to 18S rRNA, indicated that all lanes contained equal amounts of RNA (not shown). (B) MEFs and RKO cells differing in p53 status were exposed to UVC at 20 J/m2, and p21Waf1 mRNA expression was monitored at the times indicated.

/

/

View larger version (18K): [in this window] [in a new window]   FIG. 2.   Colony survival assay following UVC irradiation of MEFs and RKO cells. (A) Survival of wt, p53/, and p21/ MEFs following UVC irradiation. (B) Survival of RKO neo and RKO E6 cells following UVC irradiation. A total of 5 × 105 cells (in 100-mm-diameter tissue culture dish) were irradiated with the indicated doses of UVC. Twenty-four hours later, cells were trypsinized, serially diluted (10 to 1,000,000 times), replated, and returned to the incubator for an additional 12 to 14 days. Surviving colonies were then fixed with crystal violet and counted. For each UVC dose, plates were seeded at four different dilutions, and routinely, three of these were counted. Experiments were done at least five times. Values represent means ± SEM.

Effect of UVC on p53-independent p21^Waf1 induction. The correlation between p21^Waf1 expression and survival of the MEFs and RKO lines was fully consistent with p21^Waf1 contributing to the enhanced survival following exposure to UVC. However, we sought to assess the role of p21^Waf1 expression in the survival of the p53-deficient lines by inducing an increase in p21^Waf1 levels via an alternative, p53-independent mechanism before exposure to UVC. Mimosine was chosen as the inducer, as we had previously reported that mimosine induces p21^Waf1 expression in p53-deficient RKO cells independent of p53 function, an effect that was correlated with enhanced survival during subsequent exposure to PGA₂ (17).

/

/

View larger version (31K): [in this window] [in a new window]   FIG. 3.   Effect of mimosine on p21Waf1 expression and UVC-mediated cytotoxicity in p53/ MEFs. (A) RNA was extracted from wt and p53/ MEFs treated with 200 or 300 µM mimosine (Mimo) for the indicated times, and p21Waf1 mRNA expression was monitored by Northern blot analysis as described in Materials and Methods. (B) Western blot analysis of p21Waf1 expression in p53/ MEFs treated with 250 µM mimosine (Mimo) was carried out as described in Materials and Methods. (C) Following irradiation of p53/ MEFs (5 × 105 cells per 100-mm-diameter tissue culture dish), cells received either normal medium (untr.) or medium containing 200 µM mimosine (Mimosine). Twenty-four hours later, cells were trypsinized, serially diluted (10 to 1,000,000 times), replated, and returned to the incubator for an additional 14 days. Surviving colonies were fixed with crystal violet and counted. For each UVC dose, plates were seeded at four different dilutions, and routinely, three different dilutions were counted. Experiments were done at least three times. Values represent means ± SEM.

View larger version (36K): [in this window] [in a new window]   FIG. 4.   Dose- and time-dependent effects of UVC on mimosine-induced p21Waf1 expression in MEFs and RKO cells differing in p53 status. (A) MEFs and RKO cells with or without functional p53 status were either treated with 300 µM mimosine (Mimo), exposed to UVC at 20 J/m2 (UVC), or treated with 300 µM mimosine immediately following exposure to UVC at 20 J/m2 (Mimo+UVC). RNA was isolated at the times indicated, and p21Waf1 mRNA expression was analyzed. (B) Western blot analysis of p21Waf1 expression in wt and p53/ MEFs 16 h after treatment with either UVC at 20 J/m2 (U), 300 µM mimosine (M), or 300 µM mimosine and UVC at 20 J/m2 (MU). C, control.

/

View larger version (46K): [in this window] [in a new window]   FIG. 5.   Dose- and time-dependent effects of UVC on mimosine-induced p21Waf1 mRNA expression. (A) Wild-type and p53/ MEFs were either left untreated, treated with 300 µM mimosine (Mimo), or UVC irradiated at the doses indicated with 300 µM mimosine. Ten hours after treatment, RNA was extracted and p21Waf1 mRNA expression was analyzed. (B) p53/ MEFs were irradiated with UVC (20 J/m2) at various time intervals (from 0 to 36 h) prior to treatment with mimosine. p21Waf1 mRNA expression was assessed 10 h following treatment with mimosine. u, untreated control; UVC, cells irradiated 10 h prior to harvesting of RNA.

Posttranscriptional regulation of p21^Waf1 expression by UVC. To address the mechanisms whereby UVC inhibits p21^Waf1 induction by mimosine, it was first necessary to determine how mimosine acted to induce p21^Waf1. Two approaches were used to investigate whether the mimosine effect was due to enhanced transcription of the p21^Waf1 gene. First, the activity of the p21^Waf1 promoter was measured by using a p21^Waf1 promoter-luciferase reporter construct transiently transfected into wt and p53^/ MEFs (Fig. 6A). UVC, mimosine, and combined UVC-plus-mimosine treatments all failed to substantially elevate p21^Waf1 promoter activity (Fig. 6A, right), regardless of p53 status. This is in sharp contrast to the effect of these treatments on p21^Waf1 mRNA levels (Fig. 6A, left). Treatment with the DNA-alkylating agent methyl methanesulfonate (MMS), included as a positive control, both activated the p21^Waf1 promoter and enhanced endogenous levels of p21^Waf1 mRNA, although maximal induction in each case required wt p53 function (Fig. 6A). The second approach used nuclear run-on assays to directly determine whether the rate of transcription of the p21^Waf1 gene was increased following treatment with either mimosine or UVC. Measurements were performed at 8 h, a time at which p21^Waf1 mRNA levels are approaching maximal levels. As shown in Fig. 6B, neither UVC nor mimosine treatment led to any perceptible change in the transcription rates of the p21^Waf1 gene, regardless of p53 status. Transcription of the gadd153 gene (included here as a positive control) was modestly increased by the mimosine and UVC treatments. This elevated transcription accounted, at least in part, for the similarly modest elevation in gadd153 mRNA expression in wt and p53^/ MEFs following treatment with either UVC or mimosine (Fig. 6C).

View larger version (40K): [in this window] [in a new window]   FIG. 6.   Induction of p21Waf1 mRNA expression by UVC and mimosine is not regulated transcriptionally. (A) Right, relative luciferase activity driven by the p21Waf1 promoter in transiently transfected wt or p53/ MEFs following treatment with 300 µM mimosine (Mimo), UVC at 20 J/m2 (UVC), a combination of 300 µM mimosine plus UVC at 20 J/m2 (Mimo+UVC) or 100 µg of MMS per ml (MMS). Values represent the means of three independent experiments. Left, quantitation of p21Waf1 mRNA levels in identically treated populations of wt and p53/ MEFs. mRNA expression was analyzed 10 h after addition of 300 µM mimosine (Mimo) and exposure to UVC at 20 J/m2 (UVC), mimosine plus UVC (Mimo+UVC), or 100 µg of MMS per ml (MMS). Values are represented as fold induction relative to the level of expression in untreated control cells (untr.). p21Waf1 mRNA signal was measured with a PhosphorImager and normalized to hybridization signal to 18S rRNA. (B) Nuclear run-on analysis of wt or p53/ MEFs that were either left untreated (c), treated with mimosine (Mimo), or exposed to UVC at 20 J/m2 (UVC) 8 h prior to collection of cells and nuclear run-on assay, carried out as described in Materials and Methods. (C) Northern blot analysis of gadd153 mRNA expression in wt or p53/ MEFs following treatment with 300 µM mimosine (Mimo) or exposure to UVC at 20 J/m2 (UVC). (D) The levels of p21Waf1 mRNA in wt MEFs treated with ActD alone or in combination with mimosine (300 µM) or UVC (20 J/m2) were assessed by Northern blot analysis and quantitated with a PhosphorImager.

/

Vanadate prevents UVC-mediated suppression of p21^Waf1 expression through stabilization of p21^Waf1 mRNA. A number of signaling cascades are triggered by UVC and contribute to the cellular changes that characterize the response (22, 45, 46). The evidence presented thus far, indicating that UVC suppresses the induction of p21^Waf1 mRNA by other agents, strongly suggests that p53^/ cells do not simply lack a pathway which is otherwise activated by UVC; rather, it is consistent with the existence of an abnormally active mechanism of p21^Waf1 mRNA degradation in p53-deficient cells. To begin exploring which, if any, of the established UVC-triggered signaling mechanisms might be important in influencing p21^Waf1 mRNA stability, p53^/ MEFs were pretreated with a variety of specific inhibitors of these pathways before treatment with mimosine, UVC, or mimosine plus UVC. p21^Waf1 mRNA expression was examined 10 h later to determine if any of the agents tested would alter the UVC-mediated suppression of p21^Waf1. No change in the general pattern of p21^Waf1 mRNA expression was seen in the presence of any of the agents tested, except for vanadate, an inhibitor of tyrosine phosphatases (Table 1). Vanadate treatment alone did not alter p21^Waf1 mRNA levels. However, it effectively allowed for induction of p21^Waf1 mRNA by UVC and completely prevented the loss of mimosine-induced p21^Waf1 expression by UVC. These findings argue strongly for the involvement of a tyrosine kinase/phosphatase regulatory system in the modulation of p21^Waf1 mRNA stability.

View this table: [in this window] [in a new window]   TABLE 1.   Effects of various inhibitory agents on p21Waf1 expression in p53/ MEFs following mimosine treatment, UVC irradiation, or botha

/

View larger version (47K): [in this window] [in a new window]   FIG. 7.   Dose- and time-dependent effect of vanadate on p21Waf1 expression after UVC irradiation of p53/ MEFs. (A) Northern blot analysis of p21Waf1 expression in p53/ MEFs that were treated with increasing doses of vanadate and either left unirradiated () or irradiated with UVC at 20 J/m2. Expression of p21Waf1 mRNA was analyzed 10 h after UVC treatment. Mimo, mimosine. (B) Time-dependent effect of 50 µg of vanadate per ml on p21Waf1 mRNA expression. Quantitation of p21Waf1 mRNA levels in p53/ MEFs subjected to the various treatment regimens. For vanadate removal, cells were treated with vanadate for 1 h before exposure to UVC, and then vanadate was removed at the time of UVC irradiation or at different time intervals thereafter; for vanadate addition, vanadate was added at different times after UVC irradiation. RNA was isolated 10 h after exposure to UVC.

/

/

/

View larger version (19K): [in this window] [in a new window]   FIG. 8.   Influence of vanadate on clearance of p21Waf1 mRNA in p53/ MEFs. Following exposure to 300 µM mimosine for 14 h, p53/ MEFs were either pretreated for 1 h with 40 µg of vanadate (Van) per ml or not pretreated and were then exposed to ActD (1 µM), UVC (20 J/m2), or both. At the times indicated, RNA was collected and p21Waf1 mRNA expression was determined by Northern blot analysis. The p21Waf1 mRNA signals were quantitated with a PhosphorImager. Mimosine remained in the culture media throughout the entire treatment period.

Vanadate enhances survival of UVC-treated p53^/ MEFs. Finally, since p21^Waf1 expression could be elevated in p53^/ cells by UVC in the presence of vanadate, it was of interest to compare the survival of p53^/ MEFs following UVC irradiation in the presence or absence of vanadate. p21^/ MEFs were also included in the experiment as a control, since p21^Waf1 expression could not be induced in them regardless of vanadate treatment. Wild-type, p53^/, and p21^/ MEFs were pretreated with either 40 or 60 µg of vanadate per ml for 1 h, after which vanadate was removed and the cells were irradiated with UVC at 10, 15, or 20 J/m² (Fig. 9). Survival was assessed with a colony proliferation assay 12 to 14 days later. While vanadate pretreatment did not substantially alter the survival of wt MEFs (which already expressed significant amounts of p21^Waf1), it markedly enhanced the survival of p53^/ MEFs to levels comparable to those seen in wt cells (Fig. 9). That the enhanced survival was attributed to enhanced p21^Waf1 expression rather than some other effect of vanadate is supported by the finding that vanadate did not improve survival of p21^/ MEFs. Taken together, these findings argue strongly that p21^Waf1 functions as a survival factor in this stress paradigm.

View larger version (22K): [in this window] [in a new window]   FIG. 9.   Effect of vanadate treatment on the survival of wt, p53/, and p21/ MEFs following UVC irradiation. MEFs (5 × 105 in 100-mm-diameter tissue culture dishes) were pretreated with 40 or 60 µg of vanadate (Van) per ml for 1 h prior to irradiation with the indicated doses of UVC. Vanadate was removed at the time of irradiation. Twenty-four hours later, cells were trypsinized, serially diluted (10 to 1,000,000 times), replated, and returned to the incubator for an additional 12 to 14 days, whereupon plates were fixed and stained with crystal violet and surviving colonies were counted. For each vanadate and UVC dose, plates were seeded at four different dilutions, and routinely, three of these were counted.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Alterations in gene expression in response to external stimuli constitute a key component of the cellular response to stress. Although most studies examining the genetic response to environmental insults have focused on the transcriptional control of the induced genes, it is likely that posttranscriptional mechanisms also contribute significantly to stress-induced changes in gene expression. In support of this view, we have provided evidence that induction of p21^Waf1 expression following UVC irradiation is regulated primarily through posttranscriptional events that increase the stability of p21^Waf1 mRNA. We provide further evidence indicating that this is mediated by a tyrosine kinase/phosphatase regulatory system and requires the presence of functional p53. In the absence of p53, UVC irradiation not only fails to elevate p21^Waf1 expression but potently inhibits p21^Waf1 induction by mimosine, and also by other agents such as hydrogen peroxide, okadaic acid, PGA₂, or MMS (not shown). This suppressive effect of UVC is likely to reflect a general mechanism important for regulating mRNA stability of stress-responsive genes, as we have found that UVC treatment also inhibits the expression of other stress-inducible genes such as gadd45 and MAP kinase phosphatase 1 genes in cells lacking p53 (not shown).

The regulation of the stability of labile mRNAs is poorly understood. It is thought to employ a number of proteins that control the degradative pathway through interaction with a number of cis elements, most frequently located in the 3' untranslated region of the mRNA (5). The most common of 3' untranslated region stability determinants are AU-rich elements (AREs) (with very high incidence of adenosine and uridine residues), notably the pentamer AUUUA (14). AREs have been reported to confer instability to otherwise stable mRNAs (41). Although AREs are typically found in the transcripts encoding cytokines (interleukins and interferons) and oncogenes (c-myc and c-fos), they have also been found in other short-lived stress-inducible mRNAs, including those encoding gadd153, vascular endothelial growth factor, cyclin D1, and p21^Waf1. Indeed, both human and mouse p21^Waf1 mRNAs contain AREs, including several AUUUA repeats (8, 24). Among the various RNA-binding proteins which have been identified to date are the AU-binding (11, 34, 39) and ELAV families of proteins (12). Members of these families (Hel-N1, Hel-N2, HuR, HuD, Hel-N, and HuC) display high affinity for AREs (10, 33). Several reports have linked protein kinase C (PKC) activation with mRNA stabilization events involving AU-binding proteins following exposure to various agents (13, 14, 34, 44). However, PKC does not appear to contribute to the regulatory events reported here, since PKC inhibitors failed to alter p21^Waf1 expression by UVC, mimosine, or combined treatment.

UVC irradiation leads to a rapid increase in tyrosine phosphorylation of cellular proteins, many of which have not been identified. Both receptor-linked and non-receptor-linked tyrosine kinases are believed to play a central role in initiating the UVC response, leading to the activation of MAP kinase signaling cascades, involving ERK, JNK, and p38. The MAP kinase pathways play an important role in activating transcription factors leading to increased gene transcription. Recent reports have provided evidence that both serine/threonine and tyrosine phosphatases play a key role in regulating the activity of the ERK, JNK, and p38 MAP kinases at numerous stages of the signaling cascades. Although a role for MAP kinases in mRNA stabilization has not been explored, neither ERK nor p38 appears to contribute to regulating p21^Waf1 mRNA expression, since inhibitors of these pathways did not alter the p21^Waf1 mRNA levels. While the involvement of the JNK pathway could not be tested directly in these cells, due to the lack of availability of a suitable inhibitor, other preliminary findings generated in our laboratory suggest that p21^Waf1 expression might be modulated by JNK. We have found that transfection of human lung carcinoma A549 cells with a construct that constitutively expresses a dominant-negative isoform of SEK1 (a kinase that specifically phosphorylates, thereby activating, JNK) results in a marked enhancement p21^Waf1 mRNA expression by UVC (our unpublished observations). Thus, a JNK-regulated protein might contribute to an enhanced p21^Waf1 mRNA degradation following UVC exposure. To the best of our knowledge, ours is the first study to provide evidence that tyrosine phosphorylation contributes to the regulation of mRNA stability. Obviously, the identity of the specific kinases/phosphatases involved will require further investigation. Such activities could function upstream, downstream, or independent of the JNK pathway, but we speculate that the activity of RNA-binding proteins may be subject to regulation either directly by a tyrosine kinase or through a downstream target (e.g., JNK).

The p21^Waf1 promoter has been shown to contain multiple p53 binding sites which are important for transcriptional activation of p21^Waf1 by ionizing radiation. Given the dependency of p21^Waf1 induction by UVC on p53, it was surprising to find that induction by UVC does not involve such transcriptional activation. In addition to its well-established function as a bona fide transcription factor, several other gene regulatory functions have been ascribed to p53. For example, in certain situations, p53 has been shown to repress transcription (36) and translation (9) and to decrease protein stability (21). However, to our knowledge, our studies provide the first evidence that p53 function is involved in the regulation of gene expression by modulating mRNA stability; whether this regulation is direct or indirect remains to be addressed. Although our efforts have focused on the stability of the mRNA encoding p21^Waf1, mRNAs encoding other gene products such as MKP-1 and gadd45 also appear to follow a pattern of p53 dependency after UVC irradiation similar to that described here for p21^Waf1 mRNA (unpublished observations). Further experiments are required to elucidate the precise role that p53 plays in the expression of these genes and the contribution of transcriptional and posttranscriptional regulatory events.

Finally, our results are consistent with p21^Waf1 conferring a survival advantage during the cellular response to UVC irradiation. That is, we observed a strong correlation between expression of p21^Waf1 following UVC irradiation and survival, with the p53^/ and p21^/ MEFs exhibiting much greater sensitivity than their wild-type counterparts. These findings contrast with those reported by DeFrank et al. (6), who observed that wt and p53^/ MEFs had comparable survival rates following exposure to UVC irradiation. The cause for this discrepancy remains unclear. Nonetheless, the fact that in our studies vanadate treatment, which restored p21^Waf1 expression in p53^/ MEFs, likewise enhanced their survival strongly argues for a protective function of p21^Waf1.

In summary, we have provided several novel findings regarding p21^Waf1 induction by cellular stress: (i) that p21^Waf1 induction in response to UVC occurs largely through posttranscriptional modifications leading to enhanced stability of p21^Waf1 mRNA, (ii) that p21^Waf1 mRNA stability is regulated via a regulatory system sensitive to vanadate (possibly involving changes in tyrosine phosphorylation), and (iii) that these putative tyrosine kinase/phosphatase activities are subject to modulation by UVC irradiation in a p53-dependent fashion. Future studies will address the identity of the specific tyrosine kinase/phosphatases involved, their downstream targets, and the nature of the p53 dependency of this effect.