Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1444-1448, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
I-SceI-Induced Gene Replacement at a
Natural Locus in Embryonic Stem Cells
Michel
Cohen-Tannoudji,1
Sylvie
Robine,2
André
Choulika,3
Daniel
Pinto,2
Fatima
El
Marjou,2
Charles
Babinet,1
Daniel
Louvard,2 and
Frédéric
Jaisser2,*
UMR 144 CNRS Laboratoire de
Morphogenèse et Signalisation Cellulaires, Institut Curie, 75248 Paris Cedex 05,2 and
Unité de Biologie du Développement, CNRS
URA 1960,1 and
Unité de Biologie
Moléculaire du Développement,3
Institut Pasteur, 75015 Paris, France
Received 15 October 1997/Returned for modification 14 November
1997/Accepted 11 December 1997
 |
ABSTRACT |
Gene targeting is a very powerful tool for studying mammalian
development and physiology and for creating models of human diseases.
In many instances, however, it is desirable to study different
modifications of a target gene, but this is limited by the generally
low frequency of homologous recombination in mammalian cells. We have
developed a novel gene-targeting strategy in mouse embryonic stem cells
that is based on the induction of endogenous gap repair processes at a
defined location within the genome by induction of a double-strand
break (DSB) in the gene to be mutated. This strategy was used to knock
in an NH2-ezrin mutant in the villin gene, which encodes an
actin-binding protein expressed in the brush border of the intestine
and the kidney. To induce the DSB, an I-SceI yeast
meganuclease restriction site was first introduced by gene targeting to
the villin gene, followed by transient expression of
I-SceI. The repair of the ensuing DSB was achieved with
high efficiency (6 × 10
6) by a repair shuttle
vector sharing only a 2.8-kb region of homology with the villin gene
and no negative selection marker. Compared to conventional
gene-targeting experiments at the villin locus, this represents a
100-fold stimulation of gene-targeting frequency, notwithstanding a
much lower length of homology. This strategy will be very helpful in
facilitating the targeted introduction of several types of mutations
within a gene of interest.
 |
INTRODUCTION |
The ability to introduce specific
alterations of endogenous genes into the germ line of mice via targeted
mutagenesis in embryonic stem (ES) cells has represented a major
breakthrough in mouse genetics. Gene inactivation has been widely used
to examine the effects of loss of function in various biological
processes such as development, cellular biology, and physiology. This
has already permitted the accumulation of new insights into gene
function and also the creation of mouse models of human genetic
diseases. Introduction of subtle mutations at specific locations of the mammalian genome is also useful to refine genetic analysis and to
produce models of genetic diseases which do not necessarily result from
null mutations. Several strategies have been developed, each aimed at
generating subtle mutations in a given gene (6). One common
limitation to all current gene-targeting procedures is the low
frequency of correct targeting. This becomes a serious problem
especially with use of two successive rounds of targeting, a method
common to several strategies used for the generation of mutated genes
devoid of foreign selection sequences. Therefore, attempts have been
made to increase the efficiency of gene targeting by several means,
such as increasing the size of the region of homologies with the target
locus, using isogenic genomic DNA, or improving the selection
procedures (6).
In this report, we present an alternative approach to overcome these
limitations which relies on the observation that double-strand ends of
broken chromosomes are highly recombinogenic (reviewed in reference
5). Double-strand breaks (DSB) are frequently associated with DNA alteration events in eukaryotes (4, 31); during meiosis in Saccharomyces cerevisiae, for example,
transient DSB are induced at a number of positions known to be hot
spots for recombination (23). It has recently been shown
that a unique DSB can specifically be induced in the yeast
(12), plant (24), and mammalian (8, 22, 26,
28) genomes by using the yeast I-SceI meganuclease.
The I-SceI protein is an endonuclease responsible for intron
homing in yeast mitochondria, a process that apparently proceeds by DSB
repair (18); I-SceI endonuclease can induce recombination in yeast nuclei (12). In mammalian cells, the yeast meganuclease I-SceI has been shown to efficiently
induce a DSB in a chromosomal target containing an I-SceI
recognition sequence. This allows DNA break repair with high frequency
by recombination with a donor molecule homologous to the regions flanking the break (7, 8, 22, 25, 26, 28).
We reasoned that the introduction of a DSB in an endogenous gene could
increase targeting frequency at this natural locus through stimulation
of the cellular recombination machinery. The gene encoding villin, a
major component of the actin cytoskeleton of intestine and kidney cells
(13), was chosen to develop this gene targeting strategy. We
found that induction of a DSB in the target gene by using the
meganuclease I-SceI resulted in greatly enhanced homologous
replacement by the incoming DNA, even when the length of genomic DNA
homology is reduced.
 |
MATERIALS AND METHODS |
Constructs and electroporation of ES cells.
The targeting
construct was made as follows. An I-SceI restriction site
was introduced in a unique XhoI site flanking the 5' end of
the neomycin resistance (neo) gene (pMC1neo; Stratagene), using an oligodimer (sense oligonucleotide,
TCGAGTAGGGATAACAGGGTAAT; antisense oligonucleotide,
TCGAGATTACCCTGTTATCCCTA). We derived from the
PGK-hygromycin resistance (Hygror) gene
(32) two nonfunctional Hygror cassettes,
hygro A-B and hygro B-C. These two cassettes
shared an 800-bp region of homology (region B), between the
AatII and SacII restriction sites. Homologous
recombination of the two genes will lead to a functional
Hygror gene (hygro A-B-C). When electroporated
into ES cells, neither of the hygro A-B and hygro
B-C cassettes was able to confer hygromycin resistance. The
hygro B-C fragment is 1.5 kb long, starting at the
SacII restriction site of the
PGK-Hygror gene and including part of the coding
sequence, the stop codon, and the simian virus 40 poly(A) region. This
fragment was ligated 3' to the I-SceI/neo
cassette. This I-SceI/neo hygro B-C cassette was
then introduced in a unique KpnI site present in a 9.6-kb BglII-BamHI fragment isolated from a
DASHII
phage containing 16 kb of the mouse villin gene (kindly furnished by G. Tremp, Rhone Poulenc Rorer) and subcloned in pBS/KS+ (Stratagene).
Insertion of the I-SceI/neo hygro B-C cassette
disrupted the second exon of the villin gene. A 2-kb thymidine kinase
(TK) cassette (33) was subcloned in the unique
ClaI site flanking the 5' end of the construct. The
resulting pvillin I-SceI/neo hygro B-C
targeting construct contains 6.1 kb of 5' and 3.5 kb of 3' villin
genomic sequence flanking a 2.5-kb I-SceI/neo hygro
B-C cassette.
The replacement construct was made as follows. A 5' 2-kb
BamHI-NcoI villin gene fragment (located upstream
of the initiation codon) was subcloned upstream of the 1-kb
NH2-terminal domain of human ezrin cDNA fused to
nucleotides encoding the 11-amino-acid carboxy terminus of the
vesicular stomatitis virus glycoprotein G (1). The
1.5-kb-long hygro A-B fragment includes the PGK promoter and part of the Hygror gene coding sequence ending
at the AatII restriction site of the
PGK-Hygror gene. This hygro A-B
cassette was subcloned downstream of the 3-kb
villin-NH2-ezrin fragment, resulting in the pvillin
NH2-ezrin hygro A-B replacement construct. A total of
2 × 107 CK35 ES cells (9) were
electroporated with 20 µg of the NotI-linearized targeting
construct. G418 (300 µg/ml) and gancyclovir (2 µM) were added
36 h after plating for 8 days. Cell culture was performed in
Dulbecco modified Eagle medium (Gibco-BRL) supplemented with 1 mM
sodium pyruvate, 5% fetal calf serum (Seromed, Berlin, Germany), 1,000 U/ml LIF (ESGRO; Gibco-BRL) per ml, and 50 mM
-mercaptoethanol (Gibco-BRL) as described previously (9). The G418-resistant, gancyclovir-resistant (Gangr) clones were isolated, and
their genotypes were analyzed by Southern blotting. The
I-SceI-targeted ES clone (ES 3.1) was chosen for further
experiments.
The supercoiled pI-SceI expression plasmid (allowing
expression of the yeast endonuclease I-SceI under the
control of the cytomegalovirus promoter [7]) and the
supercoiled pvillin NH2-ezrin hygro A-B
replacement construct (20 µg of each) were coelectroporated into the
2 × 107 ES 3.1 cells obtained in the first targeting
step. Hygromycin (150 µg/ml) was added 36 h after plating.
Hygror ES clones were isolated after 10 to 12 days.
Southern blot analysis.
Genomic DNAs of ES clones obtained
after selection with G418 and gancyclovir in the first targeting step
were digested with the ScaI endonuclease. Correct gene
targeting was analyzed with a 3' external probe (0.4-kb
BamHI-HincII) (data not shown). After amplification, the I-SceI-targeted ES 3.1 clone was further
analyzed after BglII digestion using a 5' internal probe
(0.5-kb BglII-StuI). When required, DNA was
digested with the commercially available I-SceI restriction
enzyme (Boehringer, Mannheim, Germany). Hygror ES clones
obtained in the second targeting step were characterized by Southern
blotting after digestion of the genomic DNAs with the BglII
endonuclease. A 5' external probe (0.5-kb
BglII-StuI) and an internal probe (2 kb;
Hygror gene) were used to analyze the 5' and 3' homologous
recombination events, respectively.
 |
RESULTS |
The use of DSB to enhance homologous recombination at a given
locus is based on the two-step strategy depicted in Fig.
1. To test this experimental design, we
chose to introduce an ezrin cDNA into the villin gene, a natural locus.
In the first step, an I-SceI restriction site was introduced
into the villin locus, using the pvillin
I-SceI/neo hygro B-C targeting vector.
I-SceI is a yeast rare-cutter endonuclease (18)
that has been shown to initiate DSB in the mammalian genome, naturally
devoid of endogenous I-SceI target sequences. In the second
step, a unique DSB was induced at the villin locus and the effect of
DSB on homologous integration of a pvillin NH2-ezrin
hygro A-B replacement vector in the targeted ES cells was assessed
(Fig. 1). To facilitate recovery of the targeted clones, we combined to
this scheme the plug-and-socket strategy developed by Detloff et al.
(11), which is based on the restoration by homologous
recombination of a functional Hygror gene.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Strategy for the induction of gene replacement upon DSB
repair in a natural locus. First step, gene targeting of the
I-SceI restriction site in a natural locus by homologous
recombination. Second step, cotransfection of expression plasmid
pI-SceI and of the replacement construct. Expression of the
meganuclease I-SceI leads to cleavage of the targeted gene
at the I-SceI site. The ensuing DSB is repaired by gene
exchange with the replacement construct. This allows the introduction
in the locus of any sequence of interest (reporter gene, mutated
allele, etc.). Selection of the recombined ES cells by hygromycin was
possible due to the restoration of a functional Hygror gene
(hygro A-B-C).
|
|
Introduction of the I-SceI recognition site into the
endogenous villin locus.
We prepared a targeting vector,
pvillin I-SceI/neo hygro B-C (Fig.
2A), containing one I-SceI
restriction site, a G418r cassette, and a 1.5-kb partial,
nonfunctional Hygror cassette (hygroB-C) flanked
with 6.1 and 3.5 kb of villin isogenic genomic DNA at the 5' and 3'
ends, respectively. A negative selection step was possible due to the
addition of a TK counterselection cassette at the 5' end of the
construct. The linearized vector was electroporated into 2 × 107 CK35 ES cells, and the cells were cultured in the
presence of G418 and gancyclovir. Of 60 G418 Gancr clones
recovered, one ES clone (ES 3.1) was correctly targeted with the
pI-SceI/neo hygro B-C targeting construct, as
demonstrated by Southern blot analysis. This clone displays a modified
allele with the I-SceI/neo hygro B-C gene
sequences in exon 2 of the villin gene (Fig. 2B). This analysis also
showed that the meganuclease I-SceI is able to specifically
cleave the targeted allele in vitro (Fig. 2B, lane 4).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Introduction of the I-SceI restriction site
in the villin locus by gene targeting. (A) Diagram of the mouse villin
locus (wild-type [wt] allele), the targeting construct, and the
I-SceI-targeted allele (I-SceI allele). From top
to bottom, the dark rectangles represent the two first exons of the
villin gene, and the black bar represents the probe A (0.5-kb
BglII-StuI, 5' probe) used for hybridization.
BglII (B) and I-SceI restriction sites are
indicated. (B) Southern blot analysis of wild-type (wt) and targeted ES
(clone 3.1) cells. Genomic DNAs of ES cells were digested with (lanes 2 and 4) or without (lanes 1 and 3) meganuclease I-SceI
followed by BglII and then hybridized with probe A. The
9.0-kb band represents the targeted allele and is further cleaved into
a 6.5-kb band when digested with I-SceI. Numbers on the
right indicate sizes of the bands in kilobases.
|
|
I-SceI-induced recombination at the villin locus.
The ES 3.1 clone was then used in the second step. ES cells were
electroporated with 20 µg of supercoiled plasmid pvillin NH2-ezrin hygro A-B with or without the
I-SceI expression plasmid (pI-SceI). Transient
expression of I-SceI induces a unique DSB by in vivo
digestion at the target locus. The replacement construct is composed of
a 1.0-kb 5' ezrin mutant cDNA flanked 5' with a 2-kb region of the
murine villin promoter and 3' with the 1.5-kb hygro A-B
cassette.
No Hygro
r ES clones were recovered when plasmid
p
villin NH2-ezrin hygro A-B alone was
electroporated (Table
1, experiments
1 and 2). This finding suggests that under the conditions used,
homologous recombination between the modified villin locus and
the
incoming replacement construct was not achieved. In contrast,
when
plasmid pI-
SceI was electroporated together with the
replacement
construct, 105 and 139 clones, respectively, survived to
the hygromycin
selection step in two independent experiments (Table
1,
experiments
3 and 4).
Hygro
r clones should result from the recombination between
the modified villin allele of the 3.1 clone and the replacement
construct, since either
hygro A-B or
hygro B-C
alone is not able
to confer hygromycin resistance to ES cells (data not
shown).
To analyze the molecular nature of the recombination event, we
performed Southern blot analysis of 24 Hygro
r clones from
experiments 3 and 4. Hybridization of
BglII-digested
genomic
DNA with a 5' external probe reveals that all Hygro
r clones
have lost the 9-kb band characteristic of the I-
SceI allele,
while they exhibit a 6-kb band diagnostic of a correct 5' homologous
recombination event between the replacement construct and the
I-
SceI allele (Fig.
3).
Accuracy of the 3' homologous recombination
event was confirmed by
using a Hygro
r gene probe (data not shown). Thus, 100% of
the analyzed clones
have been correctly targeted, a result that
strongly suggests
that all of the Hygro
r clones contained
the same allelic modification. The homologous
recombination frequency
could therefore be estimated at 6 × 10
6 (Table
1).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3.
Gene replacement of the I-SceI-targeted
villin locus after I-SceI expression. (A) Diagram of the
I-SceI-targeted allele (I-SceI allele), the
replacement construct, and the villin-NH2-ezrin recombinant
locus (targeted allele). BglII (B) and I-SceI
restriction sites are indicated. The black bar represents the probe A
(0.5-kb BglII-StuI, 5' external probe) used for
hybridization. (B) Southern blot analysis of genomic DNAs of ES
wild-type (wt), 3.1, and Hygror clones. DNA was digested
with BglII and probed with probe A. The 9.0-kb band
represents the I-SceI-targeted allele that resulted in a
6.0-kb band after I-SceI expression and homologous
integration of the replacement construct. Sizes are indicated in
kilobases.
|
|
 |
DISCUSSION |
Rare-cutting endonucleases provide a powerful tool for genome
manipulation. Several studies have shown that expression of such
endonucleases in mammalian cells stimulated homologous recombination between a transfected repair matrix and a randomly integrated DNA
construct containing an I-SceI recognition site (7, 8, 22, 25, 26, 28). Here, the I-SceI recognition site was introduced into a natural locus by gene targeting, and we analyzed whether induction of a DSB in a natural locus affected the
gene-targeting frequency. The strategy that we have developed is
applicable when several rounds of gene targeting at a specific locus
are needed. As a first step, we introduced an I-SceI
recognition site at the villin locus by a standard gene-targeting
procedure. Subsequently, we showed that highly efficient gene targeting
could be obtained upon coelectroporation of the modified ES cells with
an I-SceI-expressing vector and a villin replacement vector
in a circular form. Thus, ES cells with a modified allele having a
unique I-SceI recognition site can be used to efficiently
introduce any desired modification at the locus. When needed,
repetition of the second step with different replacement constructs
would allow rapid and efficient recovery of the corresponding
recombinant ES cells.
Our data indicate that introduction of a site-specific DSB in a natural
locus allows gene targeting with high frequency. Indeed, we observed a
gene-targeting frequency of 6 × 10
6 when a DSB was
induced in the target locus, whereas no homologous recombination event
could be observed when pI-SceI was omitted. The frequency
for a conventional gene-targeting experiment is highly dependent on
several parameters, including the nature of the locus and the size of
homology between the targeting construct and the endogenous locus
(10, 16). In several independent conventional gene-targeting
experiments at the villin locus, we obtained a frequency of 5 × 10
8, using replacement constructs sharing 8 to 10 kb of
homology with the endogenous locus (step 1 of this study and reference 24a). Strikingly, in the second step, which includes
a DSB and involves the same genomic region, the targeting frequency was at least 100 times higher, notwithstanding a much lower length of
homology (2.8 kb between the targeting construct and the modified villin locus). This high efficiency might rely on the DSB repair mechanism used for the integration of foreign DNA in the target locus,
which requires less homology between the replacement construct and the
target locus than classical gene-targeting procedures (3, 20,
21). Furthermore, the homologous recombination frequency that we
have observed is probably underestimated because not every cell
received both constructs. Moreover, the quantity of replacement
construct that we have electroporated may be limiting. Thus, even
higher efficiency might be obtained by including the cytomegalovirus-I-SceI cassette into the replacement vector
and transfecting ES cells with a higher quantity of the replacement construct.
Previous studies of I-SceI-induced gene replacement into
randomly integrated transgenes has disclosed a high rate of one-sided homologous recombination events in mammalian cells. This could account
for 45 and 21% of drug-resistant clones in NIH 3T3 and ES cells,
respectively (25, 28). One-sided homologous recombination events were not observed in the 24 Hygror clones analyzed
here, which suggests that it is a relatively rare event at the
endogenous villin locus under the conditions used. Whether this
observation is specific to the villin locus and/or the targeting
construct or rather depends on the route of introduction of the
recombination constructs (electroporation versus calcium phosphate
transfection) awaits further analysis.
To alleviate the screening of recombined clones during the second step,
we used a strategy similar to the plug-and-socket strategy previously
described by Detloff et al. (11). They reported that using
linearized constructs, insertion (O-type) targeting events occurred in
their experiment, noticeably reducing the proportion of desired
replacement recombinational (
-type) events among the drug-resistant
clones. Our strategy, based on DSB repair using a circular matrix,
appears to be very efficient, as all Hygror ES clones
elicited the expected replacement targeting event. The differences
between the results of these two experiments might be due to the design
of the targeting constructs or to differences between the
recombinational processes involved. More experiments will be needed to
resolve this issue.
Introduction of I-SceI in mammalian cells is apparently
nontoxic. Due to the size of the mammalian genome, the probability that
an endogenous 18-bp I-SceI restriction site exists in the genome of ES cells is very low. Moreover, even if I-SceI
induces a DSB elsewhere in the genome, it would probably be repaired by interchromosomal gene conversion (12). After transient
expression of I-SceI, no obvious effects were observed in ES
cells; in particular, pI-SceI-transfected ES cells formed
apparently normal embryoid bodies after in vitro differentiation (data
not shown).
In contrast to other gene-targeting procedures (2, 14, 17,
29), the modified target locus is altered such that the endogenous repair machinery can be stimulated. This helps to overcome the major limitation of the gene targeting procedure, i.e., the low
frequency of adequate gene targeting, especially when various mutations
of the same locus are needed. Moreover, as short regions of homology
are sufficient, replacement constructs may be smaller than previously
required and therefore easier to handle. This gene-targeting procedure
is very versatile, allowing the knock-in of any sequence of interest in
a locus and/or creation of various deletions (Fig.
4A). In addition, it has been suggested
from studies in yeast (15) and mammalian (28)
cells that chromosomal DSB is preferentially repaired in regard to the
unbroken matrix. This implies that any modification present in the
replacement vector (unbroken) will be copied into the target locus
(harboring the DSB). Therefore, this approach offers an efficient way
to introduce subtle mutations at desired locations in the genome (Fig.
4B). Combination of the DSB-mediated gene-targeting procedure with site-specific recombinase-based strategies (19, 27) should increase the range of genetic manipulation of the mammalian genome.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Various applications of I-SceI-induced
gene-targeting strategy. (A) Depending on the design of the replacement
construct, the same I-SceI-targeted allele can be modified
in different ways. Use of different replacement constructs allows the
introduction of any sequence of interest in the locus or any deletion
of genomic sequences (production of truncated protein, targeted
deletion of cis-acting regulatory sequences, domain
swapping, etc.). Two examples showing different deletions of variable
length together with knock-in of a given sequence are illustrated. (B)
Because of the mechanisms operating during the second step (i.e., DSB
gap repair), any modification (point mutation, small deletion, etc.)
present in the replacement vector would be introduced with high
efficiency in the locus. This is an advantage compared to other
gene-targeting strategies where a DNA mismatch repair mechanism, for
example, may limit the cointroduction of other modifications
(30).
|
|
In conclusion, we have constructed an ES cell line carrying the
recognition site of the meganuclease I-SceI in a natural
locus, the villin gene. Our data suggest that the yeast endonuclease I-SceI can specifically induce gene-targeting and homologous
recombination events with high frequency, allowing specific and highly
efficient gene replacement in ES cells. The use of I-SceI in
gene-targeting experiments will greatly enhance the possibility of
obtaining mutations needed for a comprehensive analysis of gene
function.
 |
ACKNOWLEDGMENTS |
We specially thank M. Buchwald, head of the Research Department
at the Sick Children Hospital in Toronto, Canada, who spent 6 months as
a sabbatical fellow at the Curie Institute in Paris. He played a key
role in the success of these experiments, and his continuous
stimulating advice in the ES cell program is specially acknowledged. We
are grateful to S. Memet for the gift of the PGK-Hygror cassette. We thank R. Golsteyn, S. Holmes, and E. Ferrary for critical reading of the manuscript. We also
thank F. Apiou and B. Dutrillaux.
This work was supported by grants from the Centre National de la
Recherche Scientifique, Institut Pasteur, Institut Curie, Ligue
National contre le Cancer, Association pour la Recherche sur le Cancer,
MENESR (ACC-SV1), and Rhone-Poulenc SA. F.J. was a
recipient of a long-term EMBO fellowship.
 |
FOOTNOTES |
*
Corresponding author. Present address: INSERM U246,
Faculté de Médecine X. Bichat, 16 rue H. Huchard, 75018 Paris, France. Phone: 33 01 44856320. Fax: 33 01 42 34 63 77. E-mail:
jaisser{at}bichat.inserm.fr.
 |
REFERENCES |
| 1.
|
Algrain, M.,
O. Turunen,
A. Vaheri, and D. Louvard.
1993.
Ezrin contains cytoskeleton and membrane binding domains accounting for its proposed role as a membrane-cytoskeletal linker.
J. Cell Biol.
120:129-139[Abstract/Free Full Text].
|
| 2.
|
Askew, G. R.,
T. Doetschman, and J. B. Lingrel.
1993.
Site-directed point mutations in embryonic stem cells: a gene-targeting tag-and-exchange strategy.
Mol. Cell. Biol.
13:4115-4124[Abstract/Free Full Text].
|
| 3.
|
Ayares, D.,
L. Chekuri,
K. Y. Song, and R. Kucherlapati.
1986.
Sequence homology requirements for intermolecular recombination in mammalian cells.
Proc. Natl. Acad. Sci. USA
83:5199-5203[Abstract/Free Full Text].
|
| 4.
|
Bernstein, C., and H. Bernstein (ed.).
1991.
.
Aging, sex, and DNA repair.
Academic Press, San Diego, Calif.
|
| 5.
|
Bollag, R. J.,
A. S. Waldman, and R. M. Liskay.
1989.
Homologous recombination in mammalian cells.
Annu. Rev. Genet.
23:199-225[Medline].
|
| 6.
|
Bronson, S. K., and O. Smithies.
1994.
Altering mice by homologous recombination using embryonic stem cells.
J. Biol. Chem.
269:27155-27158[Free Full Text].
|
| 7.
|
Choulika, A.,
A. Perrin,
B. Dujon, and J. F. Nicolas.
1994.
The yeast I-SceI meganuclease induces site-directed chromosomal recombination in mammalian cells.
C. R. Acad. Sci. (Paris)
317:1013-1019.
|
| 8.
|
Choulika, A.,
A. Perrin,
B. Dujon, and J. F. Nicolas.
1995.
Induction of homologous recombination in mammalian chromosomes by using the I-SceI system of Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:1968-1973[Abstract].
|
| 9.
|
Cohen-Tannoudji, M.,
P. Marchand,
S. Akli,
S. A. Sheardown,
J.-P. Puech,
C. Kress,
P. Gressens,
M.-C. Nassogne,
T. Beccari,
A. L. Muggleton-Harris,
P. Evrard,
J. L. Stirling,
L. Poenaru, and C. Babinet.
1995.
Disruption of murine Hexa gene leads to enzymatic deficiency and to neuronal lysosomal storage, similar to that observed in Tay-Sachs disease.
Mamm. Genome
6:844-849[Medline].
|
| 10.
|
Deng, C., and M. R. Capecchi.
1992.
Reexamination of gene targeting frequency as a function of the extent of homology between the targeting vector and the target locus.
Mol. Cell. Biol.
12:3365-3371[Abstract/Free Full Text].
|
| 11.
|
Detloff, P. J.,
J. Lewis,
S. W. John,
W. R. Shehee,
R. Langenbach,
N. Maeda, and O. Smithies.
1994.
Deletion and replacement of the mouse adult beta-globin genes by a "plug and socket" repeated targeting strategy.
Mol. Cell. Biol.
14:6936-6943[Abstract/Free Full Text].
|
| 12.
|
Fairhead, C., and B. Dujon.
1993.
Consequences of unique double-stranded breaks in yeast chromosomes: death or homozygosis.
Mol. Gen. Genet.
240:170-180[Medline].
|
| 13.
|
Friederich, E.,
E. Pringault,
M. Arpin, and D. Louvard.
1990.
From the structure to the function of villin, an actin-binding protein of the brush border.
Bioessays
12:403-408[Medline].
|
| 14.
|
Gu, H.,
J. D. Marth,
P. C. Orban,
H. Mossmann, and K. Rajewsky.
1994.
Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting.
Science
265:103-106[Abstract/Free Full Text].
|
| 15.
|
Haber, J. E.,
B. L. Ray,
J. M. Kolb, and C. I. White.
1993.
Rapid kinetics of mismatch repair of heteroduplex DNA that is formed during recombination in yeast.
Proc. Natl. Acad. Sci. USA
90:3363-3367[Abstract/Free Full Text].
|
| 16.
|
Hasty, P.,
P. J. Rivera, and A. Bradley.
1991.
The length of homology required for gene targeting in embryonic stem cells.
Mol. Cell. Biol.
11:5586-5591[Abstract/Free Full Text].
|
| 17.
|
Hasty, P.,
S. R. Ramirez,
R. Krumlauf, and A. Bradley.
1991.
Introduction of a subtle mutation into the Hox-2.6 locus in embryonic stem cells.
Nature
350:243-246[Medline]. (Erratum, 353:94.)
|
| 18.
|
Jacquier, A., and B. Dujon.
1985.
An intron encoded protein is active in a gene conversion process that spreads an intron into a mitochondrial gene.
Cell
41:383-394[Medline].
|
| 19.
|
Kilby, N. J.,
M. R. Snaith, and J. A. H. Murray.
1993.
Site-specific recombinases: tools for genome engineering.
Trends Genet.
9:413-421[Medline].
|
| 20.
|
Lin, F. L.,
K. Sperle, and N. Sternberg.
1990.
Repair of double-stranded DNA breaks by homologous DNA fragments during transfer of DNA into mouse L cells.
Mol. Cell. Biol.
10:113-119[Abstract/Free Full Text].
|
| 21.
|
Lin, F. L. M.,
K. Sperle, and N. Sternberg.
1990.
Intermolecular recombination between DNAs introduced into mouse L cells is mediated by a nonconservative pathway that leads to crossover products.
Mol. Cell. Biol.
10:103-112[Abstract/Free Full Text].
|
| 22.
|
Lukacsovich, T.,
D. Yang, and A. S. Waldman.
1994.
Repair of a specific double-strand break generated within a mammalian chromosome by yeast endonuclease I-SceI.
Nucleic Acids Res.
22:5649-5657[Abstract/Free Full Text].
|
| 23.
|
Petes, T. D.,
R. E. Malone, and L. S. Symington.
1991.
Recombination in yeast, p. 407-521. In
J. R. Broach, J. R. Pringle, and E. W. Jones (ed.), Molecular and cellular biology of the yeast Saccharomyces cerevisiae.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Puchta, H.,
B. Dujon, and B. Hohn.
1993.
Homologous recombination in plant cells is enhanced by in vivo induction of double strand breaks into DNA by a site-specific endonuclease.
Nucleic Acids Res.
21:5034-5040[Abstract/Free Full Text].
|
| 24a.
| Robine, S., and F. Jaisser. Unpublished
observations.
|
| 25.
|
Rouet, P.,
F. Smih, and M. Jasin.
1994.
Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells.
Proc. Natl. Acad. Sci. USA
91:6064-6068[Abstract/Free Full Text].
|
| 26.
|
Rouet, P.,
F. Smih, and M. Jasin.
1994.
Introduction of double-strand breaks into genome of mouse cells by expression of a rare-cutting endonuclease.
Mol. Cell. Biol.
14:8096-8106[Abstract/Free Full Text].
|
| 27.
|
Sauer, B.
1994.
Site-Specific recombination: developments and applications.
Curr. Opin. Biotechnol.
5:521-527[Medline].
|
| 28.
|
Smih, F.,
P. Rouet,
P. J. Romanienko, and M. Jasin.
1995.
Double-strand breaks at the target locus stimulate gene targeting in embryonic stem cells.
Nucleic Acids Res.
23:5012-5019[Abstract/Free Full Text].
|
| 29.
|
Stacey, A.,
A. Schnieke,
J. McWhir,
J. Cooper,
A. Colman, and D. W. Melton.
1994.
Use of double-replacement gene targeting to replace the murine alpha-lactalbumin gene with its human counterpart in embryonic stem cells and mice.
Mol. Cell. Biol.
14:1009-1016[Abstract/Free Full Text].
|
| 30.
|
Steeg, C. M.,
J. Ellis, and A. Bernstein.
1990.
Introduction of specific point mutations into RNA polymerase by gene targeting in mouse embryonic stem cells: evidence for a DNA mismatch repair mechanism.
Proc. Natl. Acad. Sci. USA
87:4680-4684[Abstract/Free Full Text].
|
| 31.
|
Szostak, J. W.,
T. L. Orr-Weaver, and R. J. Rothstein.
1983.
The double-strand break repair model for recombination.
Cell
33:25-35[Medline].
|
| 32.
|
te Riele, H.,
E. R. Maandag,
A. Clarke,
M. Hooper, and A. Berns.
1990.
Consecutive inactivation of both allele of the pim-1 proto-oncogene by homologous recombination in embryonic stem cells.
Nature
348:649-651[Medline].
|
| 33.
|
Thomas, K. R., and M. R. Capecchi.
1987.
Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells.
Cell
51:503-512[Medline].
|
Mol Cell Biol, March 1998, p. 1444-1448, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jarjour, J., West-Foyle, H., Certo, M. T., Hubert, C. G., Doyle, L., Getz, M. M., Stoddard, B. L., Scharenberg, A. M.
(2009). High-resolution profiling of homing endonuclease binding and catalytic specificity using yeast surface display. Nucleic Acids Res
37: 6871-6880
[Abstract]
[Full Text]
-
Chen, Z., Wen, F., Sun, N., Zhao, H.
(2009). Directed evolution of homing endonuclease I-SceI with altered sequence specificity. Protein Eng Des Sel
22: 249-256
[Abstract]
[Full Text]
-
Parenteau, J., Durand, M., Veronneau, S., Lacombe, A.-A., Morin, G., Guerin, V., Cecez, B., Gervais-Bird, J., Koh, C.-S., Brunelle, D., Wellinger, R. J., Chabot, B., Abou Elela, S.
(2008). Deletion of Many Yeast Introns Reveals a Minority of Genes that Require Splicing for Function. Mol. Biol. Cell
19: 1932-1941
[Abstract]
[Full Text]
-
Beumer, K., Bhattacharyya, G., Bibikova, M., Trautman, J. K., Carroll, D.
(2006). Efficient Gene Targeting in Drosophila With Zinc-Finger Nucleases. Genetics
172: 2391-2403
[Abstract]
[Full Text]
-
Chames, P., Epinat, J.-C., Guillier, S., Patin, A., Lacroix, E., Paques, F.
(2005). In vivo selection of engineered homing endonucleases using double-strand break induced homologous recombination. Nucleic Acids Res
33: e178-e178
[Abstract]
[Full Text]
-
Chen, Z., Zhao, H.
(2005). A highly sensitive selection method for directed evolution of homing endonucleases. Nucleic Acids Res
33: e154-e154
[Abstract]
[Full Text]
-
Epinat, J.-C., Arnould, S., Chames, P., Rochaix, P., Desfontaines, D., Puzin, C., Patin, A., Zanghellini, A., Paques, F., Lacroix, E.
(2003). A novel engineered meganuclease induces homologous recombination in yeast and mammalian cells. Nucleic Acids Res
31: 2952-2962
[Abstract]
[Full Text]
-
Bibikova, M., Beumer, K., Trautman, J. K., Carroll, D.
(2003). Enhancing Gene Targeting with Designed Zinc Finger Nucleases. Science
300: 764-764
[Full Text]
-
Vasquez, K. M., Marburger, K., Intody, Z., Wilson, J. H.
(2001). Manipulating the mammalian genome by homologous recombination. Proc. Natl. Acad. Sci. USA
98: 8403-8410
[Abstract]
[Full Text]
-
Bibikova, M., Carroll, D., Segal, D. J., Trautman, J. K., Smith, J., Kim, Y.-G., Chandrasegaran, S.
(2001). Stimulation of Homologous Recombination through Targeted Cleavage by Chimeric Nucleases. Mol. Cell. Biol.
21: 289-297
[Abstract]
[Full Text]
-
Ferrary, E., Cohen-Tannoudji, M., Pehau-Arnaudet, G., Lapillonne, A., Athman, R., Ruiz, T., Boulouha, L., El Marjou, F., Doye, A., Fontaine, J.-J., Antony, C., Babinet, C., Louvard, D., Jaisser, F., Robine, S.
(1999). In Vivo, Villin Is Required for Ca2+-Dependent F-Actin Disruption in Intestinal Brush Borders. JCB
146: 819-830
[Abstract]
[Full Text]
-
Pinto, D., Robine, S., Jaisser, F., Marjou, F. E., Louvard, D.
(1999). Regulatory Sequences of the Mouse Villin Gene That Efficiently Drive Transgenic Expression in Immature and Differentiated Epithelial Cells of Small and Large Intestines. J. Biol. Chem.
274: 6476-6482
[Abstract]
[Full Text]