Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1544-1552, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Flexible Positioning of the Telomerase-Associated
Nuclease Leads to Preferential Elimination of Nontelomeric
DNA
Eric C.
Greene,
Janna
Bednenko, and
Dorothy E.
Shippen*
Department of Biochemistry and Biophysics,
Texas A&M University, College Station, Texas 77843-2128
Received 28 August 1997/Returned for modification 8 October
1997/Accepted 17 December 1997
 |
ABSTRACT |
In addition to a reverse transcriptase activity, telomerase
is associated with a DNA endonuclease that removes nucleotides from a
primer 3' terminus prior to telomere repeat addition. Here we
examine the DNA specificity of the primer cleavage-elongation reaction
carried out by the Euplotes crassus telomerase. We
show that the primer cleavage activity copurified with the E. crassus telomerase polymerase, indicating that it either
is an intrinsic property of telomerase or is catalyzed by a
tightly associated factor. Using chimeric primers containing stretches
of telomeric DNA that could be precisely positioned on the RNA
template, we found that the cleavage site is more flexible than
originally proposed. Primers harboring mismatches in dT tracts that
aligned opposite nucleotides 37 to 40 in the RNA template were cleaved to eliminate the mismatched residues along with the adjacent 3' sequence. The cleaved product was then elongated to generate perfect telomeric repeats. Mismatches in dG tracts were not removed, implying that the nuclease does not track coordinately with the polymerase active site. Our data indicate that the telomerase-associated nuclease could provide a rudimentary proofreading function in telomere synthesis by eliminating mismatches between the DNA primer and the 5' region of the telomerase RNA template.
| |
INTRODUCTION |
The ends of linear eukaryotic
chromosomes are nucleoprotein structures comprised of simple G-rich DNA
repeats and structural proteins that together form a protective cap
known as the telomere. The integrity of the telomere complex is
essential for genome stability. Broken chromosomes lacking
telomeres are detected at DNA damage checkpoints and, if not
repaired, lead to cell cycle arrest (13, 38), chromosome
fusion, or degradation (12). In most eukaryotes,
telomerase is responsible for the synthesis and maintenance of
telomeric DNA (15). Telomerase adds telomeric DNA to
pre-existing telomere tracts and forms telomeres de novo on
broken chromosome ends (reviewed in reference 29).
Telomerase is a reverse transcriptase ribonucleoprotein. The
telomerase RNA subunits from a variety of different organisms have been characterized (11, 16, 39, 40), and proteins that
fit the criteria for telomerase subunits have been isolated from the ciliates Tetrahymena thermophila and Euplotes
aediculatus (7, 24) and from yeast and mammals
(18, 24, 31, 32). Telomerase catalyzes polymerization of
telomeric repeats onto chromosome 3' termini by copying a sequence
within its RNA subunit. In addition to the RNA templating domain,
telomerase protein components also establish contacts with DNA
substrates. A protein anchor site in telomerase binds clusters
of dG residues upstream of a primer 3' terminus and mediates processive
elongation by maintaining primer contact during successive rounds of
polymerization and primer translocation (17, 23, 28, 30).
The telomerases from T. thermophila,
Saccharomyces cerevisiae, and Euplotes crassus
are associated with nuclease activities in vitro (6, 28,
33). The nuclease cuts single-stranded DNA primers, removing
nucleotides from the 3' terminus prior to primer elongation by
telomerase. Although initially observed with telomeric primers
(6), the nuclease activity from E. crassus was
subsequently shown to eliminate long stretches of 3' nontelomeric DNA
from primers that carry a short internal tract of telomeric sequence
(28). Nontelomeric DNA regions as long as 29 nucleotides can
be removed by this mechanism (29a). Experiments with the Tetrahymena and Euplotes enzymes suggested that
the nuclease active site is fixed relative to the 5' boundary of the
RNA template (1, 6, 28) such that any primer nucleotides
extending across this site are subject to elimination. Studies with
methylphosphonate-substituted oligonucleotide substrates revealed that
cleavage proceeds by an endonucleolytic mechanism (28).
The function of the telomerase nuclease activity has been
unclear. The combined endonucleolytic and polymerization activities of
telomerase could serve a specialized function in ciliated
protozoa during site-specific chromosome fragmentation and de novo
telomere formation. These events are developmentally programmed and
temporally coupled during the formation of the new macronuclear genome
following conjugation (reviewed in reference 8). It
has also been postulated that cleavage serves a proofreading function
(6, 28, 33) and may be mechanistically linked to
processivity (5).
Here we examine the DNA specificity of the cleavage-initiated
polymerization reaction by the Euplotes telomerase.
We show that the nuclease activity remains associated with
telomerase through extensive purification, indicating that it
either is an intrinsic property of the enzyme or is catalyzed by a
tightly associated factor. We also demonstrate that the nuclease active site is not rigidly fixed relative to the telomerase RNA.
Instead, any primer nucleotides that cannot form Watson-Crick base
pairs with the rA residues adjacent to the 5' boundary of the
telomerase RNA templating domain, even single-nucleotide
mismatches, are eliminated before synthesis initiates.
| |
MATERIALS AND METHODS |
Isolation of Euplotes macronuclei and purification of
telomerase.
E. crassus EG3 and EG15 were each grown
in 150-liter aliquots, at a density of ~104 cells/ml, and
starved for 5 to 10 days. Cells were mated as described previously
(36), and macronuclei active for telomerase were isolated approximately 65 h after mating (28). All
subsequent procedures were carried out at 4°C. For purification,
macronuclei were lysed in TMG (30 mM Tris-Cl [pH 7.5], 10% glycerol,
5 mM MgCl2) plus 1 mM dithiothreitol (DTT), 0.1 mM
phenylmethylsulfonyl fluoride, 0.25 µg each of leupeptin, pepstatin,
chymostatin, and antipain, and 0.5 M potassium glutamate (KGlu) at
18,000 per ml, 1 lb/in2 by French press and centrifuged at
16,000 × g for 15 min at 4°C. The cleared lysate was
loaded onto a DEAE-Sepharose column (Sigma) equilibrated with 0.5 M
KGlu in TMG. The column was washed with 0.5 M KGlu, and activity was
eluted with a linear salt gradient of 0.5 to 1.5 M KGlu. Peak fractions
were loaded onto a phenyl-Sepharose (Sigma) column equilibrated with
0.5 M KGlu and washed with TMG. Activity was eluted with 2% Triton
X-100. Active fractions were loaded onto a spermine-agarose (Sigma)
column equilibrated with 0.5 M KGlu, washed with 0.5 M KGlu, and eluted
with a linear salt gradient of 0.5 to 2.0 M KGlu. Active fractions were
dialyzed into TMG and stored at 
80°C or dialyzed into 50%
glycerol-30 mM Tris-Cl (pH 7.5)-5 mM MgCl2-1 mM DTT-0.1
mM phenylmethylsulfonyl fluoride and stored at 20°C. By using this
procedure, telomerase was purified approximately 500-fold,
based on the ratio of telomerase RNA to total protein
(7).
Telomerase assays.
Telomerase was assayed at 30°C in
20-µl reaction mixtures containing 0.14 µM primer DNA, 5 mM
MgCl2, 20 mM EGTA, 50 mM Tris-Cl (pH 8.0), 1 mM spermidine,
1 mM DTT, 0.1 mM dTTP, and 0.25 µM [
-32P]dGTP
(800 Ci/mmol). Reactions with purified telomerase were incubated for 15 min, and reactions with macronuclear extracts were
incubated for 1 h, except where indicated otherwise. Telomerase reactions were stopped by the addition of EDTA, extracted with phenol:chloroform, and precipitated with ethanol. The pellets were
resuspended into loading buffer (95% [vol/vol] formamide and 0.25%
[wt/vol] xylene cyanol) and resolved on 10% sequencing gels, and
products were detected with autoradiography. Cleavage products were
quantified on a FUJIX BAS2000 PhosphorImager. For activity
quantitation, a fraction of the reaction was blotted onto DE81 paper
(Whatman) and washed as previously described (7). We have
defined 1 U of activity as the amount of enzyme required to incorporate
2 fmols of [32P]dGTP (800 Ci/mmol) onto the primer
(G4T4)3 in 15 min. Typically 5 U of
telomerase was used in each reaction.
In experiments in which [-32P]dTTP was used as the
labeled nucleotide, 6.5 µM [32P]dTTP and 43.5 µM cold
dTTP were added to obtain a final concentration of 50 µM. When the
relative efficiency of primer cleavage was estimated, reactions were
performed with [32P]dGTP and dTTP or with
[32P]dTTP and dGTP (specific activities of both isotopes
were adjusted to the same value). The amount of DNA product resulting
from addition of the third dG residue in the sequence GGGGTTTT
was quantitated by phosphorimaging.
Oligonucleotides.
DNA oligonucleotides were obtained from
Oligos Etc. Inc. or Gibco BRL. Oligonucleotides were purified on 20%
denaturing polyacrylamide gels, eluted overnight into Tris-EDTA buffer
(10 mM Tris-Cl [pH 7.5], 1 mM EDTA), and purified with C18 columns
(Waters) as per the manufacturer's recommendation. Most of the
sequences for the oligonucleotides used in this study are shown in
Table 1. The remaining sequences are
listed in the figure legends.
A 22-nucleotide molecular weight marker was generated by adding
[
32P]dGTP to the 3' terminus of
7-G
4T
4-6 with terminal deoxynucleotidyl
transferase. The product corresponds to addition of the first
nucleotide in the direct addition pathway. A 16-nucleotide product,
corresponding to addition of the first nucleotide to the cleaved
substrate 7-G
4T
4, was generated in the same
manner, starting with
a 15-nucleotide oligonucleotide. The migration
positions for these
two markers were used to analyze all of the data
shown in the
paper. However, in some cases, the deduced positions for
the 15-
and 18-nucleotide cleavage-initiated elongation products are
indicated
to make data interpretation simpler.
| |
RESULTS |
Endonuclease activity copurifies with E. crassus
telomerase.
Previous experiments with
Tetrahymena indicated that a nuclease activity copurified
with telomerase (6). To determine if this was a
general property of telomerase, we purified E. crassus telomerase from macronuclei over three consecutive
chromatographic steps (estimated 500-fold purification) and then
assayed primers that are normally substrates for cleavage. In the
experiment shown in Fig. 1,
telomerase was purified over DEAE-Sepharose, phenyl-Sepharose, and spermine-agarose. The purified telomerase exhibited
decreased processivity relative to macronuclear extracts (Fig. 1,
compare lanes 1 and 3), consistent with previous results after
purification on glycerol gradients (4).
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Copurification of telomerase endonuclease
activity. Telomerase reactions were performed with 5 U of
telomerase activity for 1 h at 30°C. Reactions with
whole macronuclei (lanes 1 and 2) or purified telomerase (lanes
3 and 4) are shown. Primer substrates were
GT4(G4T4)2 (lanes 1 and
3) and 7-G4T4-6 (lanes 2 and 4). See Table 1
for primer sequences. The arrow denotes the migration position of a
molecular size standard. nt, nucleotide.
|
|
Despite its decreased processivity, the purified telomerase
preparation retained the ability to cleave and extend the DNA
primers
(Fig.
1, lane 4). We have previously shown that telomerase
utilizes two pathways for processing nontelomeric 3' ends. The
3'
terminus of chimeric oligonucleotides containing an internal
stretch of
telomeric DNA surrounded by nontelomeric DNA may either
be extended
directly by nucleotide addition or endonucleolytically
cleaved to
eliminate the nontelomeric 3' terminus. Cleavage exposes
the internal
telomeric cassette sequence for subsequent nucleotide
addition by
telomerase (
4,
28). For example, the primer
7-G
4T
4-6
contains a cassette of telomeric
sequence, G
4T
4, embedded between
seven 5'
and six 3' nontelomeric residues. In the cleavage-initiated
elongation
reaction, 7-G
4T
4-6 is cleaved so that the six
3' nontelomeric
nucleotides are eliminated. The shortened
primer is then extended
by the addition of telomeric sequence onto the
newly created 3'
end (Fig.
1, lanes 2 and 4). Cleavage-initiated
extension products
can be distinguished from products generated by
direct nucleotide
addition because they migrate below the input primer
on a DNA
sequencing gel. Both types of products are detected when
telomerase
incorporates labeled nucleotides during synthesis of
telomeric
repeats (Fig.
1).
Telomerase reverse transcriptase activity never separated from
the cleavage activity during purification. Another protocol
that
resulted in copurification of these two activities consisted
of a
polyethylene-glycol precipitation, followed by purification
on
DEAE-Sepharose, spermine-agarose, phenyl-Sepharose, and heparin-agarose
(data not shown). The cleavage activity was also retained
following
poly(dG) affinity purification (data not shown) and during
glycerol
gradient sedimentation (
4). These data
indicate that the endonuclease
activity associated with the
E. crassus telomerase either is an
intrinsic property of the
enzyme or is catalyzed by a tightly
associated factor.
Direct analysis of the cleavage reaction in the absence of
polymerization would be very informative. However, we were unable
to
biochemically uncouple these two reactions. When purified
telomerase
was reacted with a primer carrying a
32P
label on its 5' end, in the presence or absence of deoxynucleoside
triphosphates, specific cleavage products could not be detected
(data
not shown). In contrast, products arising from direct nucleotide
addition onto the intact chimeric primer were observed with a
5'-labeled primer. Competition experiments revealed that the
cleavage-elongation
reaction was less efficient than the direct
addition reaction
(data not shown), which could explain our inability
to detect
cleavage products. In the experiments presented here, we
infer
that primer cleavage occurs because the elongation products
generated
are shorter than the original oligonucleotide and the
reaction
is inhibited by nonhydrolyzable nucleotide analogs placed at
the
predicted scissile bond (
28).
The nuclease active site is not located at a fixed position
relative to the telomerase RNA templating domain.
Telomerase nuclease activity can remove both telomeric and
nontelomeric residues from a primer 3' terminus (1, 5, 6, 28,
33). Previous studies indicated that cleavage removes nucleotides
that extend across the 5' boundary of the RNA template, whether they
can form Watson-Crick base pairs with the telomerase RNA or not
(Fig. 2A). Thus, it has been suggested
that the cleavage site in telomerase is fixed at the 5'
boundary of the RNA template (1, 6, 28), which corresponds
to position 36 in the E. crassus telomerase RNA
sequence (39).
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
The nuclease active site is not fixed relative to the
telomerase RNA template. (A) The predicted alignments for a
telomeric primer and two chimeric primers on the E. crassus
telomerase RNA template are shown. The predicted templating
domain for the E. crassus telomerase RNA is
underlined, and relative nucleotide positions are indicated
(39). The proposed fixed cleavage site is illustrated at the
top with the telomeric primer
(T4G4)2T4G. Although
the 3' dG residue can align with position 36 in the telomerase
RNA, this residue is removed (arrow) before the primer is elongated
(28). Alignments for the chimeric primers
10-G4T4-3 and
10-TG4T3-3 are shown, and arrows indicate the
positions of the predominant cleavage events. (B) Telomerase reactions
with chimeric primers containing different permutations of the
T4G4 cassette are shown. Reactions were
performed with purified telomerase and either
[32P]dGTP and dTTP (lanes 1 and 4),
[32P]dGTP only (lanes 2 and 5), or
[32P]dTTP only (lanes 3 and 6). To simplify the results,
a 3' ddC was added to 10-TG4T3-3 to block its
processing by the direct addition pathway. A 12-nucleotide 5'-labeled
recovery control oligonucleotide (R.C.) was included in the reactions.
Because this oligonucleotide contains an extra phosphate on its 5'
terminus, it migrates as a 10- to 11-nucleotide DNA.
10-G4T4-3, CACTATCGACGGGGTTTTCAC;
10-TG4T3-3, CACTATCGACTGGGGTTTCAddC.
Molecular size standards are indicated at left. nt,
nucleotide.
|
|
To directly test whether the cleavage site is fixed, we performed
telomerase assays with the primer
10-G
4T
4-3. The primer
was cleaved and
then elongated, as evidenced by the labeled products
running below the
input primer (Fig.
2B). The smallest of these
products was 19 nucleotides in length, indicating that at least
3 nucleotides had been
removed from this 21-mer primer followed
by the addition of labeled
dGTP (Fig.
2B, lane 1). To determine
precisely how many residues had
been eliminated from 10-G
4T
4-3
prior to
telomerase elongation, reactions were carried out with
[
32P]dGTP or [
32P]dTTP but not with
both nucleotides (Fig.
2B, lanes 2 and 3).
Examination of the first
nucleotides added to the cleaved primer
revealed that both dG and dT
could be incorporated. In reactions
with [
32P]dGTP, four
products of 19 to 22 nucleotides were obtained (Fig.
2B, lane 2). These
corresponded to removal of the three 3' nontelomeric
nucleotides
followed by the addition of four dG nucleotides. In
addition, a
prominent product of 18 nucleotides was labeled in
the
[
32P]dTTP reaction (Fig.
2B, lane 3). This product
corresponded to
removal of the three 3' nontelomeric nucleotides plus
the fourth
dT nucleotide from the G
4T
4 cassette
followed by the addition
of a radiolabelled dTTP.
To gauge the efficiency of cleavage at these two positions, we
quantitated the cleavage-elongation products generated with
either
[
32P]dGTP and dTTP or [
32P]dTTP and dGTP.
In a reaction with [
32P]dGTP and dTTP, the 24-nucleotide
product resulting from addition
of the third dG in the first
GGGGTTTT repeat added by telomerase
will be present
whether cleavage generated the substrate
10-G
4T
4 or 10-G
4T
3.
However, the 24-nucleotide product should not be labeled
in a reaction
with [
32P]dTTP and dGTP unless cleavage generates the
10-G
4T
3 substrate.
Assuming that the elongation
efficiencies of the G
4T
4 and
G
4T
3 ends are approximately the same, the
amount of label incorporated
into the 24th nucleotide can be used to
estimate the relative
efficiency of cleavage at a particular site.
These data suggested
that the majority (
80%) of the cleavage
occurred after the fourth
dT position, resulting in the addition of
four [
32P]dGTP residues to the primer (Fig.
2A and
data not shown). However,
because a significant proportion of the
substrate (~20%) was cleaved
after the third dT residue, we conclude
that the cleavage site
is not rigidly fixed.
More direct evidence for flexible positioning of the nuclease active
site in telomerase came from assays with chimeric
oligonucleotides
harboring different permutations of the internal
G
4T
4 telomere
cassette sequence. Changing
the permutation of the internal telomeric
cassette in the primer
allowed us to systematically shift the
primer's base-pairing potential
along the RNA template (Fig.
2A).
The primer
10-TG
4T
3-3 was designed such that cleavage at
the proposed
fixed site would result in the elimination of two 3'
nontelomeric
nucleotides. If the endonuclease activity functioned to
remove
nucleotides that could not base pair with the RNA template, an
additional nucleotide would be removed. Elimination of this third
nucleotide would generate a primer ending in
G
4T
3 and would require
the incorporation of
dTTP by telomerase to initiate synthesis
and maintain a perfect
telomeric repeat (Fig.
2A). The primer
10-TG
4T
3-3 was assayed with
[
32P]dGTP or [
32P]dTTP. No products
were generated with [
32P]dGTP (Fig.
2B, lane 5).
However, a prominent band 19 nucleotides
in length was obtained with
[
32P]dTTP (Fig.
2B, lane 6). This observation
indicates that three
nucleotides were removed from the 3' terminus of
10-TG
4T
3-3, prior
to the addition of a single
[
32P]dTTP. Fainter bands, corresponding to the 18- and 20-nucleotide
elongation products were also detected, which
suggests that cleavage
of 10-TG
4T
3-3 might have
occurred at more than one position. However,
since the
E. crassus telomerase always starts extension of nontelomeric
DNA with the addition of dG and never with the addition of dT
residues
(
28), we conclude that the
10-TG
4T
3-3 was extended
only after removal of
all three nontelomeric nucleotides from
the primer 3' terminus.
A similar result was obtained when telomerase was assayed with
3-T
4G
4-10. No products resulting from primer
cleavage were
generated in reactions with [
32P]dGTP
(Fig.
3B, lane 2); however, incorporation
of [
32P]dTTP was observed in products of 12 to 15 nucleotides in length
(Fig.
3B, lane 3). Generation of a 12-nucleotide
product is consistent
with cleavage occurring after the fourth dG
residue that aligns
opposite nucleotide 41 in the telomerase
RNA template. Taken together,
these observations provide strong
evidence for flexible positioning
of the nuclease active site.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
A boundary for the telomerase-associated
nuclease on the RNA template. (A) The predicted alignments for chimeric
primers on the E. crassus telomerase RNA template
are shown. The site of primer cleavage is indicated by the vertical
arrow. The predicted templating domain for the E. crassus
telomerase RNA is underlined, and relative nucleotide positions
are indicated. (B) Telomerase reactions with chimeric primers are
shown. Reactions were performed with macronuclear extracts in the
presence of [32P]dGTP and dTTP (lanes 1, 4 and 7),
[32P]dGTP only (lanes 2, 5, and 8), or
[32P]dTTP only (lanes 3, 6). Lanes 1 to 3 and 4 to 8 show results from two separate experiments.
3-T4G4-10, CACTTTTGGGGACGCGATCAT;
9-T4G3-5, CACTATCGATTTTGGGATCAT;
9-T4G3, CACTATCGATTTTGGG.
Numbers at right of each gel are molecular size standards (in
nucleotides). R.C., recovery control oligonucleotide.
|
|
Unexpectedly, moving the telomeric DNA sequence further 3' into the
telomerase RNA template strongly inhibited the primer
cleavage-elongation reaction by telomerase. No
cleavage-initiated
elongation products were detected with
the primer 9-T
4G
3-5. Instead,
this primer
was utilized solely by the direct addition pathway
(
28), and
dG residues were added directly to its nontelomeric
3' terminus (Fig.
3B, lanes 4 to 6). If this primer were cleaved
after the third dG
residue in the T
4G
3 sequence, an elongation
product 17 nucleotides in length would be expected in a reaction
with
[
32P]dGTP. This was not observed. The predicted
cleavage product
from this reaction, 9-T
4G
3, is
an efficient substrate for telomerase
elongation (Fig.
3B,
lanes 7 and 8). Thus, failure to observe
a cleavage-elongation reaction
with 9-T
4G
3-5 is not due to the
inability of
telomerase to extend the cleaved substrate. Furthermore,
the
inefficiency of the cleavage-elongation reaction with
9-T
4G
3-5
does not result from decreasing the
number of telomeric residues
in the oligonucleotide from eight to
seven. Cleavage-elongation
reactions were observed with
oligonucleotides containing the sequences
G
4 or
GT
4G surrounded by nontelomeric DNA (data not shown).
The simplest interpretation of our results is that the nuclease active
site is restricted in its ability to cleave DNA primers
associated with
telomerase. We postulate that the nuclease "stretches"
over
only the 5' portion of the RNA template, cleaving phosphodiester
bonds
in DNA primers at residues that do not form Watson-Crick
base pairs
with residues 37 to 40 in the telomerase RNA (see below).
Altering the dG residues in the internal GGGGTTTT
telomeric cassette alters the efficiency of the primer
cleavage-elongation reaction.
We examined substrate requirements
for cleavage-initiated elongation by assessing the roles of specific
nucleotides within the telomeric sequence of the chimeric primer.
Nucleotides within the telomeric cassette sequence of
7-G4T4-6 were systematically altered, and the
primers were reacted with telomerase. Cleavage-initiated elongation products were resolved on sequencing gels (Fig.
4), and the data were quantified by
phosphorimaging (Table 1). The amount of product resulting from
polymerization to the third dG was expressed as a ratio relative to the
amount of product generated with 7-G4T4-6.
Reactions were performed with macronuclear extracts and with purified
telomerase.
View larger version (70K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of substrate point mutations on cleavage and
polymerization. Cleavage substrates containing single-nucleotide
changes within the internal telomeric sequence were reacted with
purified telomerase. The positions of individual nucleotide
changes within the telomeric cassette are shown (nucleotide sequences
are listed in Table 1). Primers containing mismatches in the dG
residues were cleaved after the fourth dT in the internal telomeric
cassette. The elongation products generated after primer cleavage are
designated +G1, +G2, and +G3 to indicate the residues that have been
added to the cleaved substrate. The cleavage elongation reaction for
primers containing mismatches in the dT tract was significantly less
efficient. Lane 1, reaction with
GT4(G4T4)2; lane 2, reaction with 7-G4T4-6. nt, nucleotide.
|
|
The ability of telomerase to cleave and extend a substrate was
strongly dependent upon the position of the nucleotide
alterations
within the internal telomeric cassette. Changing
any of the first
three dG positions (underlined) in the internal
GGGGTTTT sequence
resulted in a three- to
sevenfold increase in the amount of cleavage-initiated
elongation
product generated compared to the "wild-type" sequence
(Fig.
4,
compare lane 2 to lanes 3 to 5; Table
1). Like
7-G
4T
4-6,
these primers were preferentially
cleaved after the fourth dT
residue in the internal telomeric cassette
(see below).
We next tested whether alterations in the first three dG residues of
the substrate specifically affected the extension step
of the
cleavage-dependent elongation reaction. Our approach was
to compare
utilization of "precleaved" primers to cleavage and
extension of
the corresponding full-length parental primers (Fig.
5). Precleaved primers were designed to
mimic the predicted products
of the endonucleolytic cleavage reaction
prior to extension by
telomerase. They carried no 3'
nontelomeric DNA. Like the full-length
parental primers, precleaved
substrates with alterations in the
first three dG residues of the
telomeric repeat showed an increase
in total reaction products
generated by purified telomerase (Fig.
5, compare lane 1 to
lanes 2 and 3). These data suggest that single-nucleotide
disruptions
in the dG tract increase the efficiency of the polymerization
step in
the cleavage-elongation reaction, possibly by increasing
primer
turnover.
View larger version (72K):
[in this window]
[in a new window]
|
FIG. 5.
Reactions with precleaved substrates. Reactions were
performed with purified telomerase. Primer telomeric sequences
are indicated on the left. The 5'-flanking sequence, CACTATC,
is depicted as a solid line. Underlined residues denote the
positions of nucleotide changes within the telomeric repeat. The
migration position of a molecular size standard is indicated. nt,
nucleotide.
|
|
Altering the first three dG residues in the telomeric cassette did not
change the site of DNA cleavage within these primers.
For example,
7-G
2AGT
4-6 generated no products in a reaction
with
[
32P]dTTP (Fig.
6A, lane 3). However, abundant products,
16 to 19
nucleotides in length, were obtained with
[
32P]dGTP (Fig.
6A, lane 2). Thus, the six
nontelomeric residues
on the primer 3' terminus were removed followed
by addition of
one to four dG nucleotides. The dA residue in the dG
tract of
the telomeric cassette sequence was not eliminated. It is
conceivable
that 7-G
2AGT
4-6 was cleaved but not
extended by telomerase. To
test this possibility, we examined
7-T
4G
2AG-6. In contrast to
7-G
2AGT
4-6, this primer was not processed by
the cleavage pathway.
Instead, the six nucleotides of 3' nontelomeric
DNA remained intact
and were extended by direct addition of two dG
residues (Fig.
6A, lanes 4 to 6). The longer products generated in the
reaction
with 7-G
2AGT
4-6 resulted from
processive elongation of the cleaved
product (Fig.
6A, lane 1).
Furthermore, in the reaction with dG
only, the nontelomeric 3' termini
of both 7-T
4G
2AG-6 and
7-G
2AGT
4-6
were extended only two nucleotides
(Fig.
6A, lanes 2 and 5). Thus,
a mismatch in the dG tract inhibits
elongation by the direct addition
pathway.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Removal of mismatched nucleotides from DNA primers.
Telomerase reactions were performed with macronuclear extracts and the
primers indicated. Reactions with [32P]dGTP and dTTP
(lanes 1, 4, and 7), [32P]dGTP only (lanes 2, 5, and
8), or [32P]dTTP only (lanes 3, 6, and 9) are shown.
The flanking nontelomeric sequences are the same as in
7-G4T4-6. Molecular size standards (in
nucleotides) and the recovery control oligonucleotide (R.C.) are
indicated. The position(s) of cleavage is denoted by the arrow(s) above
each primer. Processing of chimeric primers that contain mismatched
residues in a dG tract (A) or a dT tract (B) are shown. Reactions with
7-G4AT3-6 and
7-G4TAT2-6 were less efficient than with primer
7-G4T2AT-6. Accordingly, the film was exposed
twice as long (5 versus 2.5 days) to obtain data with these two
oligonucleotides.
|
|
Primers containing variations at the fourth position in the
GGG
GTTTT in the internal cassette behaved
differently than the
other primers we tested. The most prominent band
in the cleavage-derived
products from this primer (+G2) was shifted to
a position one
nucleotide smaller than products generated with any
other primers
in this series (+G3) (Fig.
4, compare lanes 5 and 6). A
1 shift
in the banding pattern could derive from a change in the site
of primer cleavage, which results in the removal of an additional
nucleotide from the primer 3' terminus. If this was the case,
the
cleavage product should correspond to 7-G
3AT
3
and telomerase
would be expected to incorporate a single dT
residue before adding
four dG nucleotides. To test this possibility,
7-G
3AT
4-6 was reacted
with either
[
32P]dGTP or [
32P]dTTP. Only dG
residues were added (Fig.
6A, lanes 8 and 9),
and product formation was
not inhibited by ddTTP (data not shown).
The size of the most abundant
cleavage-elongation products obtained
with [
32P]dGTP
corresponded to removal of the six 3' nontelomeric residues
followed by
addition of three dG residues (Fig.
6A, lane 7). Even
when dTTP was
included in the reaction, elongation beyond this
point was strongly
inhibited (Fig.
4, lane 6). Likewise, the reaction
with a precleaved
7-G
3AT
4 primer generated mostly short
elongation
products corresponding to the addition of the first three dG
residues
(Fig.
5, lane 4). Further extension of the primer was
suppressed.
It is unclear why a primer harboring a mismatch at this
specific
position in the telomeric repeat should be so poorly elongated
by telomerase. Perhaps the active site becomes distorted when
telomerase binds a primer with this particular mismatch. Taken
together, these observations indicate that primers with nucleotide
changes in a tract of dG residues strongly affect polymerization
by
telomerase. However, these imperfections in the telomeric
repeat
sequence cannot be removed by the telomeraseassociated
nuclease.
Single-nucleotide mismatches in dT tracts are eliminated prior to
primer elongation.
We next tested the effects of single nucleotide
changes at the dT positions (underlined) within the
GGGGTTTT sequence. Such residues are predicted
to align opposite positions 37 to 40 in the telomerase RNA
template. Altering any of the dT residues strongly diminished product
formation in reactions with purified telomerase (Fig. 4, lanes
7 to 10), but the effects were less striking in reactions with
macronuclear extracts (Table 1). Hence, the purified telomerase
displayed increased stringency with respect to cleavage substrate
recognition and/or processing.
In contrast to primers bearing mismatches in dG tracts,
primers containing alterations in the dT nucleotides were specifically
cleaved to remove the mismatched residue as well as the adjacent
3'
nucleotides. In reactions with 7-G
4TAT
2-6 or
7-G
4T
2AT-6, no
cleavage-initiated elongation
products were obtained in the presence
of
[
32P]dGTP (Fig.
6B, lanes 5 and 8), and product
formation was strongly
inhibited by ddTTP (data not shown). However, in
the presence
of [
32P]dTTP,
7-G
4TAT
2-6 generated products 12 to 15 nucleotides in
length (Fig.
6B, lane 6), indicating that dT
residues had been
removed from the primer prior to elongation. In the
case of 7-G
4T
2AT-6,
products 14 and 15 nucleotides in length were the predominant
products of the reaction
with [
32P]dTTP (Fig.
6B, lane 9), implying that most
cleavage events generated
the product 7-G
4T
2,
which no longer contains the mismatched residue.
The less-abundant
products migrating below the major products
may have resulted from
imprecise positioning of the cleavage site.
Telomerase assays with the primer 7-G
4AT
3-6
gave a slightly more complex cleavage-elongation profile, with cleavage
occurring
at one of two discrete sites in this primer. A prominent
product
17 nucleotides in length was obtained with
[
32P]dGTP (Fig.
6B, lane 2), indicating that a
portion of the 7-G
4AT
3-6
primer was cleaved
after the third dT residue in the cassette
and then extended by the
addition of dG residues. Since dG residues
were added instead of a
single dT, as expected for a primer terminating
in three dTs, the
deoxyribosyladenine (dA) residue in the primer
apparently aligned
opposite an rA residue in the RNA template
prior to elongation.
The most efficient processing pathway for
7-G
4AT
3-6 resulted in removal of the dA residue
from the internal cassette prior
to telomerase elongation. Four
products, 12 to 15 nucleotides
in length, were generated in the
reaction with [
32P]dTTP, corresponding to primers
that were cleaved 5' of the dA
residue in the
G
4AT
3 cassette and then extended by one to four
dT residues (Fig.
6B, lane 3). PhosphorImager analysis indicated
that
the primer cleavage-elongation reaction that eliminated the
dA residue
and the nucleotides 3' of it was significantly more
efficient (80%)
than cleavage after the third dT residue in the
internal cassette
(20%) (data not shown).
| |
DISCUSSION |
Flexible positioning of the telomerase-associated
nuclease.
Nucleolytic activity is a common property of
template-dependent DNA and RNA polymerases (20, 21). In this
study, we used chimeric primers containing short stretches of telomeric
DNA surrounded by nontelomeric DNA to investigate the DNA specificity
of the telomerase-associated nuclease. In contrast to standard
telomeric primers, the short telomeric sequence within chimeric primers is predicted to align at only one position on the RNA template (28), allowing us to investigate how Watson-Crick base pair formation between the primer and the telomerase RNA template
influenced the cleavage reaction. We found that only a small
stretch of telomeric sequence is sufficient to allow endonucleolytic
cleavage and exposure of the telomeric DNA as a substrate for
elongation. While only a short stretch of telomeric DNA is required,
the permutation of this sequence dramatically affects both the
efficiency of the reaction and the position of primer cleavage. These
results cannot be explained by a nonspecific nuclease activity.
Instead, the data support a model in which the
telomerase-associated nuclease displays flexibility in cleaving
DNA. Working
with telomeric primers, Collins and Greider showed that
the only
primer 3' nucleotides subject to elimination were those
residues
that extended across the extreme 5' boundary of the RNA
template
(
6). We have now extended these original
observations using
chimeric primers. Our experiments revealed that the
nuclease active
site is not rigidly fixed with respect to the RNA
template but
can cleave phosphodiester bonds at the junction of
telomeric and
nontelomeric DNA up to four residues 3' of the template
boundary.
Only the 5' region of the RNA templating domain is
"scanned" by the telomerase-associated nuclease.
In
addition to removing stretches of nontelomeric DNA from a primer 3'
terminus (28), the telomerase-associated nuclease can also recognize single-nucleotide mismatches between the primer and
the RNA template. The nuclease preferentially removes the mismatch
as well as the 3' adjacent sequence, creating a 3' terminus with
precise complementarity to the RNA template. This new 3' end is now a
substrate for extension by reverse transcription. The ability of the
telomerase-associated nuclease to specifically cleave primers
at the junctions between telomeric and nontelomeric DNA suggests that
the nuclease actively scans the RNA template.
Several lines of evidence indicate that the scanning mechanism does not
occur throughout the entire telomerase active site
but rather
is confined to residues 37 to 40 where a tract of four
dT residues in a
primer would hybridize. First, the cleavage activity
fails to remove
the nontelomeric 3' terminus on the primer
9-T
4G
3-5
(Fig.
3). The telomeric cassette in
9-T
4G
3-5 is predicted to align
at residues 42 to 48 in the telomerase RNA and is not expected
to extend into
the 5' region of the template. Second, single-nucleotide
mismatches
that are predicted to be located opposite the rC residues
at positions
41 to 44 in the RNA template are not removed from
primers (Fig.
6A).
Such primers have alterations in one of the
dG residues in an internal
telomeric cassette. Nucleotide mismatches
in dT residues, by contrast,
are eliminated (Fig.
6B). Finally,
the fact that the primer
7-G
4AT
3-6 is cleaved in two discrete
places,
after the fourth dG or the third dT, prior to telomerase
elongation argues that the ability of the nuclease active site
to
recognize and cleave a primer mismatch across from residue
40 in the
RNA template is compromised relative to primer cleavage
across from
residues 36 to 39 but is not ablated.
The nuclease activity may not actually recognize single-nucleotide
mismatches between the primer and the RNA template. Rather,
mismatched
residues in the dT tract may prevent stable hybrid
formation between
the primer and 5' region of the templating domain.
The inability of the
primer to form a hybrid with this region
of the RNA may trigger the
primer cleavage reaction. The apparent
cleavage of the
7-G
4AT
3-6 primer in two places supports this
interpretation.
Base pairing between the dT residues and positions 36 to 39 in
the RNA template may not be sufficient for stable hybrid
formation
between the primer and the 5' region of the RNA template.
We speculate that a steric restriction in the telomerase
ribonucleoprotein particle prevents the cleavage site from extending
beyond nucleotide 40 on telomerase RNA. A similar barrier may
be present at the 5' end of the RNA template (residue 36 in the
E. crassus telomerase), since both telomeric and
nontelomeric
nucleotides positioned across from this rC are subject to
cleavage
and elimination (
1,
6,
28) (Fig.
7). Studies with
Tetrahymena telomerase suggest that RNA-protein interactions within the
ribonucleoprotein
influence the flexibility of the nuclease active
site. Telomerase
particles reconstituted with wild-type RNA cleave
primers only
at the previously defined site (
1). In
contrast, telomerase
complexes containing
Tetrahymena proteins reconstituted with
Glaucoma chattoni telomerase RNA exhibit aberrant nuclease activity
in
vitro, cleaving primers at other positions (
5). The
chimeric
telomerase also displays reduced processivity compared
to the
wild-type telomerase (
5). Hence, the cleavage
and processive
elongation may be mechanistically linked as is seen with
RNA polymerase
II (
19,
34,
37). Consistent with this idea,
the purified
telomerase from
E. crassus shows both
increased stringency for
cleavage substrates and significantly
decreased processivity.
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7.
Model for cleavage by the telomerase-associated
nuclease. The internal telomeric cassette sequence (open box) in a
chimeric primer aligns with the RNA templating domain (underlined). The
site of primer cleavage is dictated by primer alignment and
complementarity to the RNA template. The nuclease active site (depicted
with the vertical arrow) displays limited flexibility. All primer
nucleotides that extend beyond the 5' boundary of the templating domain
(position 36) are eliminated, whether they are complementary to the
telomerase RNA or not (A). The cleavage activity is
repositioned for primers whose complementarity does not extend to the
5' template boundary, and mismatched residues are removed (B).
Single-nucleotide mismatches can be recognized and eliminated by the
cleavage activity but only if they are positioned across from residues
37 to 40 in the RNA template (C). It is possible that mismatches in dT
tracts destabilize the DNA-RNA hybrid so that no base pairs form in the
5' region of the RNA template. The mismatch and the adjacent 3'
sequence would then be eliminated.
|
|
A possible role in proofreading for the
telomerase-associated nuclease.
Homogeneity of the
telomeric DNA tract is essential for telomere function, and indeed
in most lower eukaryotes and in mammals, the most terminal regions of
telomeres are comprised of invariant repeat arrays.
Single-nucleotide mutations in telomeric repeat sequences impair normal
interactions between structural telomere binding proteins and the
DNA (22, 41). Such disruptions in the telomere complex
can upset normal telomere length regulation (22, 27, 40,
41) which may, in turn, culminate in premature senescence and
death (27, 40, 43).
DNA-dependent DNA polymerases achieve precision during synthesis by
correct base selection and exonucleolytic removal of incorrectly
inserted residues in the nascent chain (reviewed in reference
9). Base selection is facilitated by the geometry of
the Watson-Crick
base pair in the active site, while exonucleolytic
editing reflects
the melting capacity of the mispaired DNA residue
at the 3' end
of the growing chain. Since addition of the next
nucleotide after
misincorporation is relatively slow, the exonuclease
has a greater
opportunity to eliminate the mismatched residue.
Site-directed
mutagenesis of the telomerase RNA templating
domain revealed that
the RNA bases strongly influence polymerization
fidelity, presumably
by maintaining the proper geometry of the enzyme
active site during
nucleotide selection (
14,
33,
42).
However, recent studies
with
Paramecium telomerase
indicate that the fidelity of telomere
synthesis is not mediated
solely by the telomerase RNA subunit
(
26).
Our data suggest that the telomerase reverse transcriptase may
have evolved a rudimentary system for proofreading telomeric
DNA by
using its associated endonuclease activity. Although viral
reverse
transcriptases lack 3' to 5' exonuclease activities (
2,
35)
and therefore must rely on other nucleotide-discriminating
steps in the
polymerization reaction for fidelity (reviewed in
reference
3), telomerase appears to be only distantly
related
to retroviruses. Instead, telomerase bears a remarkable
similarity
to retrotransposons (
10,
31). One of the
interesting parallels
between telomerase and retrotransposons
is that both contain associated
endonuclease activities (
25,
28).
We have previously argued that the capacity to endonucleolytically
cleave DNA primers that extend beyond the 5' boundary of
the
telomerase RNA template could enhance the fidelity of the
primer translocation step by ensuring that only those DNA residues
that
form base pairs with the functional templating domain are
retained
(
28). We can now expand the range of activities ascribed
to
the telomerase nuclease (Fig.
7). This nuclease has a strong
preference for cleaving DNA at the boundaries between telomeric
and
nontelomeric DNA, specifically eliminating those residues
that do not
hybridize with the telomerase RNA template. With this
in mind,
we can envision two additional roles that the nuclease
activity could
play in telomere synthesis. First, the activity
could "repair"
telomere ends by removing any 3'-terminal nucleotides
that do not
match the RNA template prior to telomerase elongation.
Telomerase-associated cleavage activities are known to remove
mismatched nucleotides near the 3' terminus of telomeric DNA (
4,
6,
33). Such a repair function could be very useful for
telomerases
that require their primers to display a stretch of
perfect 3'-terminal
complementarity to the RNA template for elongation
(
29). For
example, telomerase from vegetatively
growing
Euplotes cells will
not initiate synthesis on DNA
that does not carry 4 to 5 bp of
telomeric sequence on its 3' terminus
(
4). The primer cleavage
activity could help ensure that new
telomere sequences are continually
added to all chromosome ends.
Alternatively, the telomerase nuclease could provide a bona
fide, albeit limited, proofreading function for telomerase by
actively eliminating mismatched residues from primers during
telomere
synthesis. The nuclease can recognize and remove
single-nucleotide
mismatches in dT tracts but fails to eliminate
mismatches in dG
tracts. This limited capacity of the nuclease to
remove imperfections
at any position in a telomeric repeat suggests
that the nuclease
active site does not track coordinately with the
polymerization
site. However, since neither the
E. crassus
nor the
T. thermophila polymerase activities could be
biochemically separated from the
nuclease (this work and reference
6), further studies will
be required to determine
the spatial relationship between the
nuclease and polymerase active
sites.
| |
ACKNOWLEDGMENTS |
E. C. Greene and J. Bednenko contributed equally to this
work.
We thank Jeff Kapler for critically reading the manuscript and for
helpful discussions.
This study was supported by National Institutes of Health grant GM49157
(D.E.S.). National Science Foundation grant BIR9217251 was used to
obtain a PhosphorImager.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Biophysics, Texas A&M University, College
Station, TX 77843-2128. Phone: (409) 862-2342. Fax: (409) 845-9274. E-mail: dshippen{at}bioch.tamu.edu.
| |
REFERENCES |
| 1.
|
Autexier, C., and C. W. Greider.
1995.
Boundary elements of the Tetrahymena telomerase RNA template and alignment domains.
Genes Dev.
9:2227-2239[Abstract/Free Full Text].
|
| 2.
|
Battula, N., and L. A. Loeb.
1976.
On the fidelity of DNA replication. Lack of exodeoxyribonuclease activity and error correcting function in avian myeloblastosis virus DNA polymerase.
J. Biol. Chem.
251:982-986[Abstract/Free Full Text].
|
| 3.
|
Bebenek, K., and T. A. Kunkel.
1993.
The fidelity of retroviral reverse transcriptases, p. 85-102. In
A. M. Skalka, and S. P. Goff (ed.), Reverse transcriptase.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 4.
|
Bednenko, J.,
M. Melek,
E. C. Greene, and D. E. Shippen.
1997.
Developmentally regulated initiation of DNA synthesis by telomerase: evidence for factor-assisted programmed telomere formation.
EMBO J.
16:2507-2518[Medline].
|
| 5.
|
Bhattacharyya, A., and E. H. Blackburn.
1997.
A functional telomerase RNA swap in vivo reveals the importance of nontemplate RNA domains.
Proc. Natl. Acad. Sci. USA
94:2823-2827[Abstract/Free Full Text].
|
| 6.
|
Collins, K., and C. W. Greider.
1993.
Tetrahymena telomerase catalyzes nucleolytic cleavage and nonprocessive elongation.
Genes Dev.
7:1364-1376[Abstract/Free Full Text].
|
| 7.
|
Collins, K.,
R. Kobayashi, and C. W. Greider.
1995.
Purification of Tetrahymena telomerase and cloning of genes encoding the two protein components of the enzyme.
Cell
81:677-686[Medline].
|
| 8.
|
Coyne, R. S.,
D. L. Chalker, and M.-C. Yao.
1996.
Genome downsizing during ciliate development: nuclear division of labor through chromosome restructuring.
Annu. Rev. Genet.
30:557-578[Medline].
|
| 9.
|
Echols, H., and M. F. Goodman.
1991.
Fidelity mechanisms in DNA replication.
Annu. Rev. Biochem.
60:477-511[Medline].
|
| 10.
|
Eickbush, T. H.
1997.
Telomerase and retrotransposons: which came first?
Science
277:911-912[Free Full Text].
|
| 11.
|
Feng, J.,
W. D. Funk,
S.-S. Wang,
S. L. Weinrich,
A. A. Avilion,
C.-P. Chiu,
R. R. Adams,
E. Chang,
R. C. Allsopp,
J. Yu,
S. Le,
M. D. West,
C. B. Harley,
W. H. Andrews,
C. W. Greider, and B. Villeponteau.
1995.
The RNA component of human telomerase.
Science
269:1236-1241[Abstract/Free Full Text].
|
| 12.
|
Gall, J. G.
1995.
Beginning of the end: origins of the telomere concept, p. 1-10. In
E. H. Blackburn, and C. W. Greider (ed.), Telomeres.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 13.
|
Garvik, B.,
M. Carson, and L. Hartwell.
1995.
Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint.
Mol. Cell. Biol.
15:6128-6138[Abstract].
|
| 14.
|
Gilley, D.,
M. S. Lee, and E. H. Blackburn.
1995.
Altering specific telomerase RNA template residues affects active site function.
Genes Dev.
9:2214-2226[Abstract/Free Full Text].
|
| 15.
|
Greider, C. W.
1995.
Telomerase biochemistry and regulation, p. 35-68. In
E. H. Blackburn, and C. W. Greider (ed.), Telomeres.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 16.
|
Greider, C. W., and E. H. Blackburn.
1989.
A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis.
Nature
337:331-337[Medline].
|
| 17.
|
Hammond, P. W.,
T. N. Lively, and T. R. Cech.
1997.
The anchor site of telomerase from Euplotes aediculatus revealed by photo-cross-linking to single- and double-stranded DNA primers.
Mol. Cell. Biol.
17:296-308[Abstract].
|
| 18.
|
Harrington, L.,
T. McPhail,
V. Mar,
W. Zhou,
R. Oulton,
M. B. Bass,
I. Arruda, and M. O. Robinson.
1997.
A mammalian telomerase-associated protein.
Science
275:973-977[Abstract/Free Full Text].
|
| 19.
|
Izban, M. G., and D. S. Luse.
1993.
The increment of SII-facilitated transcript cleavage varies dramatically between elongation competent and incompetent RNA polymerase II ternary complexes.
J. Biol. Chem.
268:12874-12885[Abstract/Free Full Text].
|
| 20.
|
Kassavetis, G. A., and E. P. Geiduschek.
1993.
RNA polymerase marching backward.
Science
259:944-945[Medline].
|
| 21.
|
Kornberg, A., and T. A. Baker (ed.).
1992.
.
DNA replication, 2nd ed.
Freeman, New York, N.Y.
|
| 22.
|
Krauskopf, A., and E. H. Blackburn.
1996.
Control of telomere growth by interactions of RAP1 with the most distal telomeric repeats.
Nature
383:354-357[Medline].
|
| 23.
|
Lee, M., and E. H. Blackburn.
1993.
Sequence-specific DNA primer effects on telomerase polymerization activity.
Mol. Cell Biol.
13:6586-6599[Abstract/Free Full Text].
|
| 24.
|
Lingner, J.,
T. R. Hughes,
A. Shevchenko,
M. Mann,
V. Lundblad, and T. R. Cech.
1997.
Reverse transcriptase motifs in the catalytic subunit of telomerase.
Science
276:561-567[Abstract/Free Full Text].
|
| 25.
|
Luan, D. D.,
M. H. Korman,
J. L. Jakubczak, and T. H. Eickbush.
1993.
Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition.
Cell
72:595-605[Medline].
|
| 26.
|
McCormick-Graham, M.,
W. J. Haynes, and D. P. Romero.
1997.
Variable telomeric repeat synthesis in Paramecium tetraurelia is consistent with misincorporation by telomerase.
EMBO J.
16:3233-3242[Medline].
|
| 27.
|
McEachern, M. J., and E. H. Blackburn.
1995.
Runaway telomere elongation caused by telomerase RNA gene mutations.
Nature
376:403-409[Medline].
|
| 28.
|
Melek, M.,
E. C. Greene, and D. E. Shippen.
1996.
Processing of nontelomeric 3' ends by telomerase: default template alignment and endonucleolytic cleavage.
Mol. Cell. Biol.
16:3437-3445[Abstract].
|
| 29.
|
Melek, M., and D. E. Shippen.
1996.
Chromosome healing: spontaneous and programmed de novo telomere formation by telomerase.
Bioessays
18:301-308[Medline].
|
| 29a.
| Melek, M., and D. E. Shippen. Unpublished data.
|
| 30.
|
Morin, G. B.
1989.
The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats.
Cell
59:521-529[Medline].
|
| 31.
|
Nakamura, T. M.,
G. B. Morin,
K. B. Chapman,
S. L. Weinrich,
W. H. Andrews,
J. Lingner,
C. B. Harley, and T. R. Cech.
1997.
Telomerase catalytic subunit homologs from fission yeast and human.
Science
277:955-959[Abstract/Free Full Text].
|
| 32.
|
Nakayama, J.-I.,
M. Saito,
H. Nakamura,
A. Matsuura, and F. Ishikawa.
1997.
TLP1: a gene encoding a protein component of mammalian telomerase is a novel member of the WD repeats family.
Cell
88:875-884[Medline].
|
| 33.
|
Prescott, J., and E. H. Blackburn.
1997.
Telomerase RNA mutations in Saccharomyces cerevisiae alter telomerase action and reveal nonprocessivity in vivo and in vitro.
Genes Dev.
11:528-540[Abstract/Free Full Text].
|
| 34.
|
Reines, D.,
P. Ghanoui,
Q. Li, and J. Mote.
1992.
The RNA polymerase II elongation complex. Factor-dependent transcription elongation involves nascent RNA cleavage.
J. Biol. Chem.
267:15516-15522[Abstract/Free Full Text].
|
| 35.
|
Roberts, J. D.,
K. Bebenek, and T. A. Kunkel.
1988.
The accuracy of reverse transcriptase from HIV-1.
Science
242:1171-1173[Abstract/Free Full Text].
|
| 36.
|
Roth, M.,
M. Lin, and D. Prescott.
1985.
Large scale synchronous mating and the study of macromolecular development in Euplotes crassus.
J. Cell Biol.
101:79-84[Abstract/Free Full Text].
|
| 37.
|
Rudd, M. D.,
M. G. Izban, and D. S. Luse.
1994.
The active site of RNA polymerase II participates in transcript cleavage within arrested ternary complexes.
Proc. Natl. Acad. Sci. USA
91:8057-8061[Abstract/Free Full Text].
|
| 38.
|
Sandell, L. S., and V. A. Zakian.
1993.
Loss of a yeast telomere: arrest, recovery and chromosome loss.
Cell
75:729-739[Medline].
|
| 39.
|
Shippen-Lentz, D., and E. H. Blackburn.
1990.
Functional evidence for an RNA template in telomerase.
Science
247:546-552[Abstract/Free Full Text].
|
| 40.
|
Singer, M. S., and D. E. Gottschling.
1994.
TLC1: template RNA component of Saccharomyces cerevisiae telomerase.
Science
266:404-409[Abstract/Free Full Text].
|
| 41.
|
van Steensel, B., and T. de Lange.
1997.
Control of telomere length by the human telomeric protein TRF1.
Nature
385:740-743[Medline].
|
| 42.
|
Yu, G.-L., and E. H. Blackburn.
1991.
Developmentally programmed healing of chromosomes by telomerase in Tetrahymena.
Cell
67:823-832[Medline].
|
| 43.
|
Yu, G.-L.,
J. D. Bradley,
L. D. Attardi, and E. H. Blackburn.
1990.
In vivo alteration of telomere sequences and senescence caused by mutated Tetrahymena telomerase RNAs.
Nature
344:126-132[Medline].
|
Mol Cell Biol, March 1998, p. 1544-1552, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Oulton, R., Harrington, L.
(2004). A Human Telomerase-associated Nuclease. Mol. Biol. Cell
15: 3244-3256
[Abstract]
[Full Text]
-
Huard, S., Autexier, C.
(2004). Human telomerase catalyzes nucleolytic primer cleavage. Nucleic Acids Res
32: 2171-2180
[Abstract]
[Full Text]
-
Underwood, D. H., Zinzen, R. P., McEachern, M. J.
(2004). Template Requirements for Telomerase Translocation in Kluyveromyces lactis. Mol. Cell. Biol.
24: 912-923
[Abstract]
[Full Text]
-
Niu, H., Xia, J., Lue, N. F.
(2000). Characterization of the Interaction between the Nuclease and Reverse Transcriptase Activity of the Yeast Telomerase Complex. Mol. Cell. Biol.
20: 6806-6815
[Abstract]
[Full Text]
-
Tzfati, Y., Fulton, T. B., Roy, J., Blackburn, E. H.
(2000). Template Boundary in a Yeast Telomerase Specified by RNA Structure. Science
288: 863-867
[Abstract]
[Full Text]
-
Magnenat, L., Tobler, H., Muller, F.
(1999). Developmentally Regulated Telomerase Activity Is Correlated with Chromosomal Healing during Chromatin Diminution in Ascaris suum. Mol. Cell. Biol.
19: 3457-3465
[Abstract]
[Full Text]
-
Ye, A. J., Haynes, W. J., Romero, D. P.
(1999). Expression of Mutated Paramecium Telomerase RNAs In Vivo Leads to Templating Errors That Resemble Those Made by Retroviral Reverse Transcriptase. Mol. Cell. Biol.
19: 2887-2894
[Abstract]
[Full Text]
-
Cano, M. I. N., Dungan, J. M., Agabian, N., Blackburn, E. H.
(1999). Telomerase in kinetoplastid parasitic protozoa. Proc. Natl. Acad. Sci. USA
96: 3616-3621
[Abstract]
[Full Text]
-
Greene, E. C., Shippen, D. E.
(1998). Developmentally programmed assembly of higher order telomerase complexes with distinct biochemical and structural properties. Genes Dev.
12: 2921-2931
[Abstract]
[Full Text]
Top
Abstract
Introduction
