Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1590-1600, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Gene Expression and Cell Cycle Arrest Mediated by Transcription
Factor DMP1 Is Antagonized by D-Type Cyclins through a
Cyclin-Dependent-Kinase-Independent Mechanism
Kazushi
Inoue1 and
Charles J.
Sherr1,2,*
Department of Tumor Cell
Biology1 and
Howard Hughes Medical
Institute,2 St. Jude Children's Research
Hospital, Memphis, Tennessee 38105
Received 8 September 1997/Returned for modification 21 October
1997/Accepted 9 December 1997
 |
ABSTRACT |
A novel 761-amino-acid transcription factor, DMP1, contains a
central DNA binding domain that includes three imperfect myb repeats
flanked by acidic transactivating domains at the amino and carboxyl
termini. D-type cyclins associate with a region of the DMP1 DNA binding
domain immediately adjacent to the myb repeats to form heteromeric
complexes which detectably interact neither with cyclin-dependent
kinase 4 (CDK4) nor with DNA. The segment of D-type cyclins required
for its interaction with DMP1 falls outside the "cyclin box," which
contains the residues predicted to contact CDK4. Hence, D-type cyclin
point mutants that do not interact with CDK4 can still bind to DMP1.
Enforced coexpression of either of three D-type cyclins (D1, D2, or D3)
with DMP1 in mammalian cells canceled its ability to activate gene
expression. This property was not shared by cyclins A, B, C, or H; did
not depend upon CDK4 or CDK2 coexpression; was not subverted by a mutation in cyclin D1 that prevents its interaction with CDK4; and was
unaffected by inhibitors of CDK4 catalytic activity. Introduction of
DMP1 into mouse NIH 3T3 fibroblasts inhibited entry into S phase. Cell
cycle arrest depended upon the ability of DMP1 to bind to DNA and to
transactivate gene expression and was specifically antagonized by
coexpression of D-type cyclins, including a D1 point mutant that does
not bind to CDK4. Taken together, these findings suggest that DMP1
induces genes that inhibit S phase entry and that D-type cyclins can
override DMP1-mediated growth arrest in a CDK-independent manner.
 |
INTRODUCTION |
Entry into the cell division cycle
from quiescence is stimulated by mitogens, which must be present
throughout most of the first gap (G1) phase for cells to
synthesize their chromosomal DNA (in S phase) (36). In
mammalian cells, three D-type cyclins (D1, D2, and D3) are induced in a
combinatorial, lineage-specific fashion in response to growth
factor-mediated signaling and accumulate throughout the G1
interval (47). D-type cyclins enter into holoenzyme complexes with cyclin-dependent kinase 4 (CDK4) and CDK6 to trigger phosphorylation of the retinoblastoma protein (Rb) in mid- to late
G1 phase (28, 29, 32). In its hypophosphorylated
state, Rb prevents G1 exit by binding to transcription
factors, such as the E2Fs, thereby inhibiting their activity (3,
9, 11, 18, 25, 57). Rb phosphorylation by the cyclin D- and
E-dependent kinases (6, 15, 20, 48, 56), probably in a
defined temporal sequence (4, 13, 43), releases E2Fs from Rb
constraint and enables them to activate a series of genes that are
required for S phase entry (8). Cells that overexpress
cyclin D1 or that lack Rb function exhibit a decreased dependency on
growth factors and a shortened G1 phase (14, 39,
42). Conversely, inhibition of cyclin D-dependent kinase prevents
S phase entry in normal cells (1, 39) but does not affect
G1 exit in cells that lack a functional Rb protein
(10, 24, 26, 27, 31, 46). Therefore, it has been suggested
that Rb, and perhaps related pocket proteins like p107 and p130, are
the only physiologic substrates of cyclin D-dependent kinases whose
phosphorylation is essential for S phase entry.
These observations do not preclude additional roles for D-type cyclins,
and indeed, other functions for these proteins have been documented.
For example, in proliferating cells, cyclin D-CDK complexes bind and
sequester CDK inhibitors during G1 phase, enabling cyclin
E-CDK2 complexes to exceed the inhibitory threshold (22, 37, 38,
49, 52). Mitogen withdrawal or treatment of cells with certain
antiproliferative cytokines, such as transforming growth factor
,
results in the loss of functional cyclin D-CDK complexes, thereby
releasing latent pools of p27Kip1 and
p21Cip1, which associate with cyclin E-CDK2 to
extinguish its activity (12, 44, 45). This coordinated
inhibition of both classes of G1 cyclin-dependent kinases
leads to G1 phase arrest, usually within a single cell
cycle. In this scenario, cyclin D-CDK complexes function
stoichiometrically to titrate CDK inhibitors and CDK catalytic activity
per se is not required (49).
Cyclin D-dependent kinases may also negatively regulate differentiation
programs whose proper execution depends upon cell cycle arrest. For
example, ectopic expression of cyclin D1 can cancel the
differentiation-promoting effects of MyoD1 in mitogen-deprived myoblasts while, conversely, the inhibition of endogenous cyclin D-dependent kinase activity by CDK inhibitors can promote
MyoD1-dependent differentiation, even in mitogen-stimulated cells
(41, 51). Overexpression of cyclins D2 and D3 inhibits the
ability of cultured interleukin-3-dependent myeloid blasts to undergo
neutrophil differentiation in response to granulocyte
colony-stimulating factor (21). Cyclin D1 also plays a
crucial, lineage-specific role in breast lobular alveolar development
(7, 50), and its overexpression in breast epithelium can
trigger tumor formation (54). Surprisingly, D-type cyclins
were found to bind directly to the estrogen receptor and were reported
to enhance its transcriptional activity via a hormone- and
CDK-independent mechanism (33, 58). The latter results raise
the intriguing possibility that D-type cyclins might participate in
physiologic processes that do not mechanistically depend upon CDKs at
all.
Using a two-hybrid interactive screen with cyclin D2 as "bait," a
cyclin D-binding myb-like protein, designated DMP1, was isolated
(17). DMP1 is a novel 761-amino-acid protein which, while
not bearing overall homology to others in available databases, contains
a central domain composed of three tandem, imperfect myb-like repeats
flanked by acidic domains at both its N and C termini. In agreement
with the idea that DMP1 might regulate transcription, the protein was
shown to stimulate transcription at synthetic minimal promoters
containing the nonameric consensus sequence CCCG(G/T)ATGT.
That subset of consensus oligonucleotide sequences containing the
GGA core can also interact with ETS-family transcription factors,
whereas those containing the GTA core do not. When radiolabeled oligonucleotide probes containing the GTA core were used, DMP1 DNA
binding activity was unambiguously detected in lysates of mammalian T
cells, fibroblasts, and embryonic kidney cells and a single DMP1 mRNA
was observed to be ubiquitously expressed at low levels in adult mouse
tissues. DMP1 is a relatively poor substrate (compared to Rb) for
cyclin D-dependent kinases. Although D-type cyclins bind to DMP1 both
in vitro and in yeast and insect cells programmed to coexpress the
recombinant proteins, DMP1 and CDK4 compete with one another for
binding to D-type cyclins and ternary complexes are not formed.
Preliminary data suggested that, in the presence or absence of CDK4,
cyclin D2 interfered with DMP1-mediated transcriptional activity when
vectors encoding both proteins were introduced together with a reporter
gene into transformed 293T human embryonic kidney cells. As the latter
cells lack functional Rb, the observed inhibition of DMP1-mediated
transactivation did not depend upon Rb phosphorylation by cyclin
D-dependent kinases. Although the physiologic role of DMP1 remains
unclear, its properties nonetheless underscore a potential for
Rb-independent control of gene expression by D-type cyclins.
We have now mapped the functional domains in DMP1 that are necessary
for DNA binding, transactivation, and association with D-type cyclins.
We show that DMP1 can induce cell cycle arrest in rodent fibroblasts
which is overridden, in a CDK-independent manner, by D-type cyclins.
 |
MATERIALS AND METHODS |
Cells and culture conditions.
NIH 3T3 cells were cultured in
a 5% CO2 incubator at 37°C in Dulbecco's modified
Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS),
2 mM glutamine, and penicillin and streptomycin (each at 100 U/ml;
Gibco/BRL, Gaithersburg, Md.). Spodoptera frugiperda Sf9
cells were maintained at 27°C in Grace's medium containing 10% FBS,
Yeastolate, lactalbumin hydrolysate, and gentamicin (all from
Gibco/BRL) in 100-ml spinner bottles. Baculoviruses were produced using
a Bac-to-Bac Baculovirus expression system according to instructions of
the manufacturer (Gibco/BRL, Gaithersburg, Md.) and propagated as
previously described (20).
Construction of DMP1 mutants.
By PCR primer-based
amplification, an EcoRI site was inserted at the expense of
the ATG initiator codon of DMP1, enabling full-length DMP1 coding
sequences to be excised with EcoRI from pBluescript-DMP1
(17) and reinserted downstream of the pSR
promoter and
Flag epitope tag in the pFLEX1 mammalian expression vector
(2). The resulting construct (pFLEX-DMP1) encodes
Met-Asp-Tyr-Lys-Asp4-Lys instead of the original DMP1
initiator codon, enabling precipitation of the encoded product by the
M2 monoclonal antibody directed to the Flag epitope (Kodak, New Haven,
Conn.). C-terminal DMP1 truncation mutants M1 to M4 (see Fig. 1A) were
created by using unique DMP1 restriction sites (EcoNI at
codon 661, StuI at codon 520, NcoI at codon 458, and BstBI at codon 380). Plasmids codigested with either of
these enzymes and with SmaI (at a unique site located in the
3' polylinker) were treated with the Klenow fragment of DNA polymerase
I and recircularized at the blunt ends; the resulting DMP1 fragments
were excised with EcoRI and transferred into pFLEX1.
The N-terminal truncation mutant M5 (see Fig. 1A) was created in the
original pBluescript-DMP1 by digestion with XbaI (5' DMP1
untranslated sequence) and BstEII (codon 86) followed by linker ligation to adjust the reading frame and create a 5'
EcoRI site. This was accomplished by preparing a partially
overlapping, self-annealing double-stranded oligonucleotide (sense
strand, 5'-CTAGAACTCGTGAATTC; antisense strand,
5'-GTCACGAATTCACGCGTT) containing the
EcoRI site (underlined), thereby enabling subsequent transfer of the truncated DMP1 fragment into pFLEX1. Mutant M15 was
created similarly, except that pBluescript-DMP1 was digested with
XbaI and NcoI (codon 458) and religated with an
analogous linker containing an EcoRI site. Mutant M10 was
derived from M5 by truncation with NcoI (codon 458),
codigestion with SmaI (3' polylinker), and blunt-end
ligation prior to transfer into pFLEX1.
Mutants M6 to M8 were created in pFLEX1-DMP1 by digestion at unique
restriction sites and linker ligation, using a strategy
analogous to
that described above for mutant M5. Sites of restriction
used were
BstEII (codon 87),
Eco47III (codon 170),
SacI (codon
237), and
BstBI (codon 380) (see Fig.
1A); for convenience, the
linkers were designed to contain an internal
MluI site, enabling
confirmation of linker insertion after
ligation.
Mutant M9 was prepared by amplifying DMP1 sequences, including codons
224 to 391, by using the following primers: sense,
5'-ACT
TCTAGAGAATTCGTGGGAAAATACACTCCTGAA
(
EcoRI site and
XbaI site underlined), and
antisense, 5'-ACTGAATTCTCATGCAATTTGCCTTTTGATGGT.
The
amplified DNA was codigested with
XbaI and
BstBI
(codon 380)
and substituted for the unique
XbaI-
BstBI fragment in pBluescript-DMP1.
The
resulting plasmid was then digested with
EcoRI, and the DMP1
fragment was transferred into pFLEX1.
The M11 point mutant (with a K-to-E mutation at position 319 [K319E])
was generated by two-step PCR with the following oligonucleotide
primers: 5'-CAATGACTGGGCAACAATAGG (an upstream sense primer
beginning
28 bp 5' of the DMP1
AvrII site at codon 253),
5'-GATGGTCCACCATTTACTTCG
(a downstream antisense primer
beginning 19 bp 3' of the
BstBI
site at codon 380),
5'-GCTCAGAA
GAGCAATGCCGTT (K319E sense strand
primer) (codon 319 is underlined), and
5'-AACGGCATTG
CTCTTCTGAGC
(K319E antisense strand
primer) (codon 319 is underlined). PCRs
were performed with either the
upstream flanking oligonucleotide
and the antisense oligonucleotide
containing the mutation at codon
319 or the downstream oligonucleotide
and the sense-strand oligonucleotide
containing the codon 319 mutation.
The two respective PCR products
were gel purified, mixed, and joined by
amplification using the
upstream and downstream oligonucleotide
primers. PCR products
were redigested with
AvrII and
BstBI and subcloned at the expense
of wild-type sequences
into pBluescript-DMP1 before transfer to
pFLEX1. All fragments
synthesized by PCR were resequenced in their
entirety to confirm their
authenticity.
For expression in insect cells, the complete Flag-tagged DMP1 coding
sequence and fragments encoding all of the above mutants
were excised
from pFLEX1 by digestion with
BamHI and cloned into
the
pFastBac expression vector (Gibco/BRL). Mutant M12 was prepared
in
pFastBac-DMP1 by deleting the unique
SacI fragment (DMP1
codon
237 to the 3' polylinker), enabling direct in-frame ligation.
Mutant M13 was obtained similarly following digestion of pFastBac-DMP1
with
BstEII (codon 86) and
XbaI (3' polylinker),
treatment with
the Klenow fragment of polymerase I, and blunt-end
ligation. Mutant
M14 was generated from pFastBac-M5-DMP1 by deleting
the unique
SacI fragment as described above.
Other expression plasmids.
Deletion mutants of cyclin D1
were generated in pBluescript-D1 by restriction enzyme digestion of the
plasmid DNA and removal of internal coding sequences (
1-99,
142-253, and
67-166 by using PstI, XmnI,
and an MnlI partial digest, respectively followed by linker
ligation to adjust the open reading frames and to provide an initiator
codon in the case of D1 (
1-99). After confirmation by nucleotide
sequencing, the cDNAs were recloned into the pFastBac baculovirus
vector.
Based on studies with human cyclin D1 (
58), we prepared an
analagous mouse D1 mutant (K114E) which does not bind or activate
CDK4.
The entire D1 coding sequence was amplified by two-step
PCR using a 5'
upstream primer
(5'-
GAATTCGGCCCGCGCC
ATGGAACACCAGCTCCTG
[
EcoRI and initiation codons are underlined]), a
downstream antisense
primer
(5'-
GGATCCTCAGATGTCCACATCTCG [
BamHI
and the termination
codon, TGA in the sense strand, are both
underlined]), a sense-strand
primer containing mutated codon 114 (5'-TTGCCTCTAAGATG
GAGGAGACCATTCCC
[codon 114 is
underlined]), and an antisense primer containing
the mutated codon
(5'-GGGAATGGTCTC
CTCCATCTTAGAGGCCA [codon 114
is
underlined]). The strategy was identical to that used for mutant
M11
as described above. The resulting product was resequenced,
excised with
EcoRI and
BamHI, and transferred into the pBJ5
expression
vector (identical to pFLEX1, but lacking sequences encoding
the
Flag epitope). Coexpression in Sf9 cells was used to confirm that
cyclin D1 (K114E) did not bind to CDK4 or activate its Rb kinase
activity. Full-length cDNAs encoding wild-type and other mutant
D
cyclins, cyclins A, B, C, and H, and p27
Kip1
were also cloned into the
EcoRI site of pBJ5. Expression
vectors
encoding a wild-type or catalytically inactive CDK4 mutant
(K35M)
(
28), CDK2 (
39),
p16
INK4a (
40), and
p19
INK4d (
16) were prepared as
previously described.
DMP1 and cyclin D association in insect cells.
Insect Sf9
cells infected with the indicated recombinant baculoviruses were
metabolically labeled 24 to 48 h postinfection for an additional
16 h in methionine-free medium with 50 µCi of [35S]methionine (1,000 Ci/mmol; ICN, Irvine, Calif.) per
ml. Infected cells (106) were lysed by repeated freezing
and thawing in 300 µl of EBC buffer (50 mM Tris HCl [pH 8.0], 120 mM NaCl, 0.5% Nonidet P-40, 1 mM EDTA) containing 2% aprotinin, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 0.1 mM sodium orthovanadate,
and 0.1 mM sodium fluoride. For detection of Flag-tagged DMP1 or its
complexes with D cyclins, 50 to 100 µl of lysate was diluted with 300 µl of EBC buffer; M2 beads (24 µl of a 1:1 suspension in
phosphate-buffered saline [PBS] [Kodak]) were added and were
recovered by centrifugation after incubation for 2 h at 4°C.
With the exception of mutant M13, the quantity of DMP1 mutants was
adjusted, based on their methionine content, to be approximately
equimolar. The beads were washed 5 times in immunoprecipitation assay
buffer (50 mM Tris HCl [pH 7.5], 150 mM NaCl, 1% Nonidet P-40, 0.1%
sodium deoxycholate, and 0.1% sodium dodecyl sulfate [SDS])
containing protease and phosphatase inhibitors as described above, and
the immunoprecipitated proteins were denatured and resolved on
denaturing polyacrylamide gels containing SDS.
Purification of Flag-tagged DMP1 and Flag-tagged cyclin D1-DMP1
complexes.
Sf9 cells were infected for 24 h with a
baculovirus vector encoding wild-type, Flag-tagged DMP1 or were
coinfected with viruses encoding Flag-tagged cyclin D1 and untagged
DMP1. Infected cells were metabolically labeled with
[35S]methionine as described above and lysed in EBC
buffer, and lysates cleared of debris were immunoprecipitated with M2
beads. The beads were washed five times with EBC buffer and suspended
in 100 µl of EBC buffer. A 400-fold molar excess (20 µg) of
FLAG-peptide was added to the suspended beads, which were incubated on
a rotary shaker for 4 h at 4°C. Supernatants were collected
after centrifugation, and portions were either subjected to
electrophoresis on denaturing polyacrylamide gels or were used for
electrophoretic mobility shift assays (EMSAs).
DMP1 and cyclin D association in NIH 3T3 fibroblasts.
In
order to detect D-cyclins bound to DMP1, 8 × 105 NIH
3T3 cells were cotransfected with 5 µg of pFLEX-DMP1 or with DMP1
mutants together with 20 µg of the pBJ5-cyclin D2 expression vector.
Cells were lysed in EBC buffer containing protease and phosphatase
inhibitors, and cleared lysates were immunoprecipitated with M2 beads
which were washed five times with EBC buffer, boiled in gel sample
buffer, and separated by electrophoresis on denaturing 10%
polyacrylamide gels. Proteins were transferred onto Immobilon membranes
(Millipore, Bedford, Mass), which were probed with rat monoclonal
antibodies to murine cyclin D2 (53). Sites of antibody
binding were detected according to manufacturer's instructions by
using rabbit antiserum to rat immunoglobulin G, followed by protein
A-conjugated horseradish peroxidase (EY Laboratories, San Mateo,
Calif.). The filters were subjected to chemiluminescence detection (ECL
detection kit; Amersham, Arlington Heights, Ill.).
EMSA.
EMSAs were performed as described previously
(17), using lysates of normal or transfected NIH 3T3 cells
as indicated. Washed cells were suspended in 10 mM HEPES (pH 7.9)-10
mM KCl-0.1 mM EDTA-0.1 mM EGTA-1 mM dithiothreitol (DTT)-0.5 mM
PMSF and swollen on ice for 15 min. Nonidet P-40 was added to a final
concentration of 0.5%, and after vigorous vortexing for 10 s,
nuclei were collected by centrifugation and washed once in the same
buffer. For all assays performed with nuclei from transfected cells,
the nuclear pellets were routinely suspended in ice-cold high-salt
buffer (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF), and rocked at 4°C for 15 min, spun for 15 min in a
microcentrifuge to clear debris, and the supernatant fluids were stored
at
70°C until used. In experiments using untransfected cells,
nuclei were suspended as indicated in low-salt extraction buffer (25 mM
glycylglycine [pH 7.8], 15 mM MgSO4, 4 mM EGTA, 1 mM DTT,
1 mM PMSF, 1% Triton X-100), frozen on dry ice and thawed through two
rapid cycles, and treated as described above. Double-stranded oligonucleotides (BS2 probe) containing binding site 2 (the nonameric DMP1 binding site included in BS2 is CCCGTATGT), which is
recognized by DMP1 but not by ETS1 or ETS2, were labeled with
[32P]dATP (6,000 Ci/mmol; New England Nuclear) using the
Klenow fragment of DNA polymerase I. Equal quantities of nuclear
extracts normalized for protein content were incubated with the labeled
BS2 probe or with a second labeled oligonucleotide (M3 probe)
containing a nonameric ETS-1 or ETS-2 binding site (CCCGGAAGT)
not bound by DMP1 (17). For competition experiments, a
100-fold excess of unlabeled BS2 or M3 oligonucleotide was added to the
reaction mixtures before addition of the labeled probes. To verify that complexes formed using extracts from untransfected cells contained endogenous DMP1, reaction mixtures were preincubated with nonimmune rabbit serum (NRS) or with an antiserum (AF) directed to the DMP1 carboxyl terminus before their electrophoretic resolution on
nondenaturing 4% polyacrylamide gels (17).
Transactivation assay.
Transactivation assays were performed
as described previously (17). Briefly, NIH 3T3 cells were
transfected with 8 µg of a BS2-containing reporter plasmid encoding
DMP1-responsive luciferase, with or without 3 µg of pFLEX-DMP1. Where
indicated, cells were cotransfected with 12 µg of mammalian
expression vectors encoding the indicated cyclins, CDKs, or CDK
inhibitors. A plasmid (4 µg) encoding secreted alkaline phosphatase
driven by the
-actin promoter was routinely cotransfected to
normalize transfection efficiencies (5, 34a). Sixteen hours
after transfection, cells were washed twice with PBS, cultured in
complete medium for 24 h, and then serum starved for an additional
18 h before lysates and supernatants were prepared and assayed for
luciferase and alkaline phosphatase activities as described previously
(5, 34a). Where indicated, cells were maintained in serum
for 42 h prior to assay.
BrdU incorporation assay and immunofluorescence.
NIH 3T3
cells were seeded on coverslips 16 h prior to transfection. Cells
were transfected with pFLEX-DMP1 or its mutants, and 14 h later,
they were washed with PBS and incubation continued for 8 h in
complete medium containing 10% FBS. Where indicated, the cells were
washed twice with PBS and starved for 24 h in medium containing
0.1% fetal calf serum, thereby rendering the cells quiescent in
G0 phase. Growth-arrested cells were restimulated to enter
the cell cycle synchronously with DMEM plus 10% FBS, and
bromodeoxyuridine (BrdU) was added to the medium. Cells were fixed
22 h later (corresponding to one complete cell cycle) in ice-cold
methanol-acetone (1:1) for 10 min at
20°C. For staining of
Flag-tagged DMP-1 proteins, the coverslips were incubated with the M2
monoclonal antibodies (6 µg/ml; Kodak) in Tris-buffered saline (TBS)
containing 1 mM CaCl2 for 1 h at room temperature. Coverslips were washed in TBS, followed by incubation for 30 min with
biotinylated antibodies to mouse immunoglobulin G (1:500 dilution;
Vector Laboratories, Burlingame, Calif.) in TBS containing 5% FBS as a
blocking agent. The coverslips were washed and incubated under the same
conditions with Texas red-conjugated streptavidin (1:500; Amersham).
Staining with antibodies to BrdU (1:12; Vector Laboratories) was
performed as described previously, and sites of BrdU incorporation into
DNA were detected with fluorescein-conjugated antibodies (green)
(35). Finally, after being washed in TBS, coverslips were
incubated for 1 min in Hoechst 33258 dye (Sigma) in TBS (blue).
Coverslips were mounted on glass slides with Vectashield medium (Vector
Laboratories), and stained cells were visualized with an Olympus BX50
microscope fitted with appropriate fluorescence filters.
 |
RESULTS |
Mapping functional domains of DMP1.
DMP1 contains two acidic
regions (N-terminal residues 4 to 169 and C-terminal residues 579 to
756) flanking three tandem myb-like repeats residing between residues
224 and 392. In an attempt to map functional domains within the
protein, we prepared the series of deletion mutants schematized in Fig.
1A. Given that a conserved sequence in
myb repeat 2 of DMP1 (K319QCRXXWXN)
corresponds to the region where the c-myb protein contacts its DNA
binding site (34), we also mutated lysine 319 to glutamic
acid (K319E) (mutant M11). All of the mutant cDNAs were tagged at their
N terminus, so that they could be precipitated with the M2 monoclonal
antibody to the Flag epitope, and they were then cloned into both
baculovirus and mammalian expression vectors.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
DMP1 mutants. (A) Schematic representation of wild-type
DMP1 (top line) and various mutants (M1 to M15). All are deletion
mutants except for M11, which contains a Glu-for-Lys substitution at
codon 319 (K319E, marked with an asterisk) located within the second
myb repeat. The numbers indicate the deletion boundaries, and the
central region containing the three tandem myb repeats is shaded. (B)
Metabolically labeled wild-type and mutant DMP1 proteins recovered from
baculovirus vector-infected Sf9 cells and separated on denaturing
polyacrylamide gels. The first lane on the left indicates the results
of precipitation of wild-type DMP1 with an irrelevant control
monoclonal antibody (designated C), as indicated at the bottom of the
panel. All other lysates were precipitated with monoclonal antibody M2
directed to the Flag epitope at the DMP1 N terminus. The mobilities of
markers of known molecular mass are indicated to the left of the
panel.
|
|
Insect Sf9 cells infected with a baculovirus vector encoding wild-type
DMP1 produce a family of ~125-kDa proteins, representing
different
phosphorylated forms of DMP1. When separated on denaturing
polyacrylamide gels containing SDS, each of these DMP1 species
is
reduced to a single major band of higher electrophoretic mobility
following treatment with calf intestinal phosphatase, although
the
apparent molecular mass of the dephosphorylated protein is
anomalous
and still remains significantly greater than that predicted
from the
DMP1 cDNA sequence (~85 kDa) (
17). Given these
considerations,
all deletion mutants were well expressed and migrated
electrophoretically
at their expected relative positions (Fig.
1B).
Those mutant proteins
retaining distal C-terminal residues 661 to 761 (M1, M5 to M9,
M11, and M15) exhibited markedly more heterogeneous
mobilities
on gels than those lacking this segment (M2 to M4, M10, and
M12
to M14), implying that multiple sites of phosphorylation were
clustered at the C terminus.
Nuclear lysates from NIH 3T3 cells transfected with vectors expressing
wild-type or mutant forms of DMP1 were used for EMSA
with a
32P-labeled oligonucleotide probe (previously designated
BS2) that
contains a nonameric DMP1 DNA binding sequence
(CCCGTATGT). In
the absence of any unlabeled competing
oligonucleotide, full-length
DMP1 and deletion mutants M1, M2, M3, M5,
and M10 generated readily
detectable probe-containing complexes (Fig.
2 [lanes marked with
minus signs]).
These were competed with the unlabeled BS2 oligonucleotide
(lanes
marked with plus signs) but not by three other probes containing
point
mutations throughout the consensus DMP1 binding sequence
(data not
shown). Taken together, these data indicate that the
domain required
for DNA binding includes the three myb-like repeats
and at least some
of the flanking sequences contained in mutant
M10 (residues 87 to 458).
The 5' boundary of this region resides
between amino acids 87 and 170 (compare results with mutant M5
and those with M6), and the 3' boundary
between residues 380 and
458 (M3 versus M4). Importantly for some of
the studies that follow,
the K319E mutation within this region (mutant
M11) was itself
sufficient to abrogate DNA binding. Data identical to
those obtained
with NIH 3T3 nuclear extracts were also obtained with
recombinant
proteins expressed in Sf9 lysates (data not shown).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of DNA binding and transactivation
domains of DMP1. (A) EMSAs performed with DMP1 proteins produced in NIH
3T3 cells and with a radiolabeled DMP1-specific (BS2) probe containing
the consensus binding sequence CCCGTATGT. NIH 3T3 cells were
transfected with expression vectors encoding the indicated wild-type or
mutant DMP1 proteins, and nuclear lysates were used for EMSA. Binding
assays were performed in the absence ( ) or presence (+) of excess
competing oligonucleotide. (B) Results of transactivation assays
performed in serum-starved NIH 3T3 cells using expression vectors
encoding a DMP1-responsive luciferase reporter gene together with
vectors specifying wild-type or mutant DMP1 proteins. Luciferase assays
were performed 60 h after transfection, and cells were starved for
serum for 18 h before assay. Error bars indicate standard
deviations from the mean from multiple experiments.
|
|
With this information in hand, we used a luciferase reporter plasmid
containing tandem DMP1 binding sites 5' to the simian
virus 40 minimal
promoter to assay the DMP1 mutants for their
ability to activate
transcription. Proliferating mouse NIH 3T3
cells transfected with the
reporter plasmid showed an approximately
fivefold increase in
luciferase activity when cotransfected with
an expression vector
encoding wild-type DMP1. However, an 8- to
15-fold increase in
transactivation was observed in a subsequent
series of experiments in
which the transfected cells were serum
starved for 18 h prior to
performing the luciferase assay (Fig.
2B). Under these conditions, the
absolute basal activity of the
reporter gene was unchanged. Consistent
with the idea that DMP1
may act as a more potent transactivator in
nonproliferating cells,
cotransfection of NIH 3T3 cells with the CDK
inhibitor p27
Kip1, at conditions under which it
induces growth arrest of cells
maintained in serum, also led
reproducibly to increased DMP1-mediated
promoter activity (10- to
15-fold basal levels) equivalent to
that observed in serum-starved,
quiescent cells (data not shown).
With the exception of M10, all DMP1 mutants that could bind to DNA
(Fig.
2A) activated transcription (Fig.
2B). The processive
C-terminal
mutants, M1 to M3, were less-potent transactivators
than the
full-length protein, as was the M5 mutant, which lacked
the extreme N
terminus. Therefore, both the acidic N- and C-terminal
domains of DMP1
contribute to transactivation, although the role
of the C-terminal
sequences (residues 458 to 761) appears to be
more significant. In
agreement, the minimal DNA binding domain
(M10) lacking the latter
sequences was completely unable to activate
transcription (Fig.
2B).
DMP1 was initially isolated in a two-hybrid interactive screen using
cyclin D2 as bait, and the recombinant protein can physically
associate
with D-type cyclins in vitro and when coexpressed with
them in Sf9
cells (
17). To map the minimal domain of DMP1 that
interacts
with D-type cyclins, we coexpressed cyclin D2 together
with Flag-tagged
DMP1 mutants in Sf9 cells. After metabolically
labeling the cells with
[
35S]methionine and adjusting the protein inputs based on
methionine
content, DMP1 was precipitated with antibodies to the Flag
tag
and the precipitates were assayed for the presence of cyclin D2.
As
shown in a representative experiment (Fig.
3A), radiolabeled
cyclin D2 failed to
efficiently coprecipitate with the M9 mutant,
which lacked N-terminal
residues 1 to 224, whereas this region
alone (mutant M12, residues 1 to
237) was sufficient for cyclin
binding. In agreement, mutants lacking
portions of the polypeptide
between residues 237 and the C terminus
(M3, M4, and M8) were
able to bind cyclin D2. Residues 1 to 87 were not
required for
binding (mutants M5 and M13), and the remaining N-terminal
sequences
between residues 87 and 237 (mutant M14) were sufficient.
Although
some of the variations in D2 signal strength shown in Fig.
3A
reflect experimental variations, the partial reduction in binding
observed with mutants M5 and M14 was reproducibly seen, leaving
open
the possibility that some residues N terminal to amino acid
87 might
contribute to the efficiency of cyclin D binding. It
is important to
note that the cyclin D-interacting segment falls
within the portion of
DMP1 that is required for DNA binding (mutant
M10) (Fig.
2A and
3A);
however, at least two, and possibly all
three, of the myb repeats
(i.e., sequences C terminal to residue
237) are dispensable for the
association with D cyclin (mutants
M8, M12, and M14 in Fig.
3A).
Moreover, mutant M11 bound D cyclins
as efficiently as wild-type DMP1.
Virtually identical data were
obtained by immunoblotting rather than
radiolabeling to detect
cyclin D2 in complexes with Flag-tagged DMP1
mutants or in experiments
in which D1 was used instead of D2 (data not
shown).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Mapping the cyclin D binding domains in DMP1. (A)
Interactions between DMP1 and cyclin D2 in insect cells. Sf9 cells were
coinfected with baculoviruses encoding either wild-type or mutant DMP1
together with murine cyclin D2. Cells metabolically labeled with
[35S]methionine were disrupted, and cleared lysates were
precipitated with anti-Flag M2 beads or with a control antibody
(designated C), as indicated at the bottom of the panel. The position
of coprecipitating cyclin D2 is indicated in the right margin. DMP1
mutants were normalized for methionine content to ensure roughly
equivalent protein inputs. The one exception was mutant M13, which
contains only a single methionine residue and was overloaded; despite
the high input concentration of M13, it did not interact strongly with
cyclin D2, reinforcing the central conclusions (see text). (B) Binding
assays performed in transfected NIH 3T3 cells. NIH 3T3 cells
cotransfected with pFLEX-DMP1 and pBJ5-cyclin D2 expression vectors
were lysed in EBC buffer, and cleared lysates immunoprecipitated with
M2 beads as indicated below the panel were immunoblotted with
monoclonal antibodies to cyclin D2 (top). Lysates from the same
transfections (one-sixth of the amounts used for immunoprecipitations)
were directly blotted with anti-D2 to confirm equal expression of the
cyclin in all transfections (bottom). The position of cyclin D2 is
indicated to the right.
|
|
In NIH 3T3 cells cotransfected with expression vectors encoding DMP1
mutants and cyclin D2, the cyclin was coprecipitated
with mutant
proteins containing N-terminal residues 87 to 233
(M3 to M5, M8, and
M10) but not with M9 or M15, which lack this
region (Fig.
3B, upper
panel). In this case, cyclin D2 binding
was detected by immunoblotting
of proteins precipitated with antibodies
to the Flag epitope. As in Sf9
cells, mutant M5 interacted less
well with cyclin D2 than those mutants
that retained residues
1 to 87. The lower panel of Fig.
3B shows the
amount of cyclin
D2 detected in aliquots of the same lysates (loading
one-sixth
of the amounts taken for immunoprecipitation), confirming
that
approximately equal amounts of cyclin D2 were expressed in each
of
the transfections shown. In these experiments, fourfold more
cyclin D2
vector than DMP1 vector was transfected into the cells
(see Materials
and Methods), so that cyclin D2 was produced in
approximately fourfold
molar excess over DMP1 (not shown). By
comparing the amounts of bound
(top) to aliquots (one-sixth) of
total (bottom) cyclin D2, we can
conclude that even under these
conditions, a significant portion of the
expressed cyclin D2 (>10%)
moved into complexes with wild-type DMP1.
Again, residues 87 to
237 were observed to contain the minimal D cyclin
binding site(s).
Similar data were obtained with cyclin D1 in lieu of
D2 (data
not shown).
A separate series of experiments was undertaken to globally map regions
within cyclin D1 which are required for the interaction
with DMP1. The
cyclin D1 deletion mutants schematized in Fig.
4A were coexpressed with Flag-tagged DMP1
in metabolically labeled
Sf9 cells, and following precipitation of DMP1
with antibodies
to the Flag epitope, coprecipitating cyclin was
visualized on
gels. The total quantities of labeled cyclins expressed
in Sf9
lysates precipitated with antiserum to cyclin D1 (Fig.
4B) are
compared to the amounts precipitated from equal aliquots of the
lysates
using antibody to Flag-tagged DMP1 (Fig.
4C). Although
wild-type cyclin
D1 and mutants D1(

1-99) and D1(

67-166) readily
associated with
DMP1 (Fig.
4C), D1(

142-253) did not. Based on
homology with other
cyclins whose structures have been determined,
D1 amino acids 56 to 152 comprise the first cyclin fold (the so-called
cyclin box), which
contains all the residues that contact CDKs
in the binary holoenzymes
(Fig.
4A) (
19,
23). Therefore, our
data suggest that the
regions in D1 which interact with CDK4 and
DMP1 are distinct.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of the DMP1-interacting domain in cyclin
D1. (A) Deletions within cyclin D1. The so-called cyclin box containing
the residues which are predicted to directly contact CDK4 is indicated
by the shaded box, and deleted amino acid segments are numerically
indicated. Cells infected with baculovirus expression vectors encoding
wild-type DMP1 and the indicated cyclin D1 mutants were metabolically
labeled with [35S]methionine, lysed, divided into equal
aliquots, and immunoprecipitated with antiserum to cyclin D1 (B) or
monoclonal antibodies to the DMP1 Flag tag (C). Control
immunoprecipitations (left lanes in both panels) were performed with
NRS or an irrelevant isotype-matched control monoclonal antibody
(designated C), as indicated below the panels. The positions of
wild-type D1 and deletion mutants are indicated by the arrows in each
lane. Only D1( 142-253) showed impaired binding.
|
|
In summary, the DNA binding domain of DMP1 is contained within residues
87 to 458, and its function is completely disrupted
by the K319E point
mutation. The C-terminal acidic domain (residues
458 to 761) and, to a
much lesser extent, the N-terminal acidic
domain (residues 1 to 86)
contribute to transactivation. The N
terminus (residues 87 to 233) is
also crucial for the association
of DMP1 with D-type cyclins, overlaps
or abuts the DNA binding
domain, and, with the possible exception of
residues 224 to 237,
does not include the myb repeats. In turn, D-type
cyclins likely
use different contact residues to interact with DMP1 and
CDK4.
D-type cyclins inhibit DMP1-mediated transactivation independently
of CDK4.
Coexpression of D-type cyclins with DMP1 in transformed
293T cells inhibits its ability to activate transcription
(17). These cells lack a functional Rb protein, underscoring
the concept that the observed inhibitory effect of D-type cyclins does
not depend upon CDK-mediated Rb phosphorylation. Figure
5 shows that each of the three D-type
cyclins also interfered with DMP1-dependent transactivation in
Rb-positive NIH 3T3 cells, whereas cyclins A, B, C, and H were unable
to do so. As expected from observations described above that D-type
cyclins interact with the DMP1 N-terminal domain, the residual
transactivating potential of DMP1 mutants M1, M2, and M3 lacking
C-terminal residues remained sensitive to cyclin D2-induced inhibition.
Although mutant M5 was less potent than full-length DMP1 as a
transactivator (Fig. 1B) and appeared to bind cyclin D2 somewhat less
efficiently than mutants retaining residues 1 to 87 (Fig. 3), its
transactivating activity was still inhibited by cyclin D2 (Fig. 5).
Similar results were obtained when cells were transfected and
maintained in serum, although the magnitude of DMP1-induced reporter
gene expression in the absence of ectopically expressed D-type cyclins
was again only four- to fivefold above basal levels (see above).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of cyclins, CDKs, and
p16INK4a on DMP1-mediated transactivation. NIH
3T3 cells were cotransfected with the DMP1-responsive reporter plasmid
and with pFLEX-DMP1, either with or without a fourfold excess of
expression plasmids encoding the indicated cyclins (D1, D2, D3, A, B,
C, or H), CDK4 (K4), CDK2 (K2), or p16INK4a. The
D1 (K114E) mutant does not assemble with CDK4, whereas the CDK4 (K35M)
mutant is catalytically inactive. Similar studies were performed with
DMP1 mutants M1 to M3 and M5, each of which binds to DNA and is only
partially handicapped in transactivation (Fig. 2B). Luciferase assays
were performed 60 h after transfection, and cells were starved for
serum for 18 h before assay. Error bars indicate standard
deviations from the mean taken from multiple experiments.
|
|
Surprisingly, CDK4 and CDK2 subunits, whether wild type or
catalytically inactive (e.g., CDK4 [K35M]) had no effect on
DMP1-mediated
transcription, either alone (Fig.
5) or when
cotransfected together
with D cyclins by using equivalent levels of
input cyclin D and
CDK4 expression plasmids (data not shown).
Consistent with these
findings, cotransfection of the specific CDK4
inhibitors, p16
INK4a (Fig.
5) or
p19
INK4d (not shown), did not alter the extent
of DMP1-mediated transactivation.
Conversely, a D1 cyclin box mutant
(K114E), which fails to bind
to CDK4, was even more potent than
wild-type D1 in reversing the
ability of DMP1 to transactivate reporter
gene expression. We
previously observed that D-type cyclins entered
into mutually
exclusive complexes with either CDK4 or DMP1, whereas
ternary
complexes containing the three proteins could not be detected
(
17). It is therefore conceivable that competition for
cyclin
D binding by endogenous CDK4 might limit the inhibitory effect
of the cyclin on DMP1-mediated transactivation. If so, cyclin
D1
mutants that are unable to bind CDK4 might be somewhat more
potent DMP1
inhibitors than the wild-type cyclin, consistent with
data in Fig.
5.
However, the explanation for the increased potency
of the K114E mutant
may lie elsewhere, since cotransfection of
CDK4 with D cyclins, at
roughly equal ratios, did not counter
the inhibitory effects of the
cyclins on DMP1-mediated reporter
gene expression. Given the total
quantities of plasmid DNA that
could be transfected, there were
technical limitations in raising
the ratio of CDK4 to D1 plasmids in
such experiments, which were
not pursued further. Together, the
critical conclusions from such
experiments are that inhibition of
DMP1-mediated transcription
by D-type cyclins does not depend upon the
ability of cyclin D
to regulate CDK4 activity or, in turn, to modify
DMP1 via CDK4-induced
phosphorylation.
Cyclin D1-DMP1 complexes do not bind DNA.
The above-mentioned
data were consistent with the hypothesis that cyclin D1 might act as a
corepressor, interacting with DNA-bound DMP1 and thereby canceling its
function as a transcriptional activator. However, we have only negative
evidence for interactions between D-type cyclins and DMP1 on DNA
(17). First, extracts from Sf9 cells coexpressing DMP1 and
D-type cyclins generated EMSA complexes whose mobilities on
nondenaturing gels could not be distinguished from those formed with
Sf9 lysates containing DMP1 alone. Similar data were obtained using
DNA-binding, cyclin-interacting DMP1 deletion mutants M1 to M3 when
they were expressed alone or together with D-type cyclins. Secondly,
both polyvalent and monoclonal antibodies to different D-type cyclins
were unable to supershift DMP1-oligonucleotide complexes formed in the
presence of the cyclins under conditions in which the mobility of these
complexes was readily altered by antibodies to DMP1. Thirdly, EMSA
complexes formed with endogenous DMP1 present in mammalian cells had
the same mobility on nondenaturing gels as that formed with the
recombinant protein in Sf9 cells, and again, these complexes could not
be supershifted with antibodies to D-type cyclins. Finally, EMSA complexes with sizes similar to those from proliferating cells (D
cyclins abundant) (17) (see below) were detected with
lysates from quiescent mammalian cells (D cyclin low or absent).
To approach this issue in another way, Sf9 cells were infected with
baculoviruses encoding Flag-tagged DMP1 or with vectors
encoding
Flag-tagged cyclin D1 with or without untagged DMP1.
Cells were labeled
24 h postinfection with [
35S]methionine, and
metabolically labeled lysates were precipitated
with agarose-bound
antibodies to the Flag epitope. Flag-tagged
proteins were then eluted
from washed beads by using excess Flag
peptide and resolved on
denaturing gels (Fig.
6A). No labeled
bands with the mobility of DMP1 were recovered from cells expressing
Flag-D1 alone (lane 1), whereas DMP1 was readily isolated from
cells
infected with Flag-DMP1 alone (lane 2). Densitometric analysis
revealed
that the quantity of DMP1 recovered in complexes with
Flag-tagged
cyclin D1 (Fig.
6A, lane 6) was equivalent to ~2%
of the recovered
Flag-tagged DMP1 (also see below). The recovered
Flag-tagged DMP1
protein was diluted serially 10-fold (Fig.
6A,
lanes 3 to 5), mixed
with a radiolabeled DMP1 binding site probe,
and subjected to EMSA.
Free Flag-tagged DMP1 generated readily
detectable complexes even after
10,000-fold dilution (Fig.
6B,
lanes 2 to 5). In contrast, DMP1-D1
complexes containing a quantity
of DMP1 equivalent to a 50- to 100-fold
dilution of the unbound
protein (Fig.
6A, compare lanes 4 and 6)
generated no detectable
complexes (Fig.
6B, lane 6). Therefore, cyclin
D1 appears to sequester
the transcription factor in a form that can no
longer bind to
DNA. Given that the cyclin D binding domain (residues 87 to 237)
overlaps the DNA binding domain (residues 87 to 458), the
simplest
idea is that D1 binding occludes the DNA binding site.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
Cyclin D1-DMP1 complexes do not bind DNA. (A)
Purification of Flag-tagged DMP1 and untagged DMP1 complexed to
Flag-tagged cyclin D1. Sf9 cells were infected with baculoviruses
encoding Flag-D1 (lane 1), Flag-DMP1 (lane 2), or Flag-D1 and untagged
DMP1 (lane 6). Flag-tagged proteins in cell lysates were bound to M2
beads and eluted with a competing peptide. Purified Flag-DMP1 was
subjected to serial 10-fold dilution (lanes 3 to 5), and equal aliquots
of the purified proteins were electrophoretically separated on
denaturing gels. Densitometric analysis indicated that the quantity of
untagged DMP1 copurified with Flag-D1 was ~2% of that of Flag-DMP1.
As expected, no protein migrating at the position of DMP1 was detected
in cells infected with Flag-D1 alone (lane 1). (B) Equal aliquots of
the purified protein samples were subjected to EMSA using a
32P-labeled DMP1-specific oligonucleotide probe. Whereas
DNA-probe complexes were detected in 10,000-fold diluted DMP1 samples,
no binding was detected when cyclin D1-bound DMP1 was used.
|
|
DMP1 induces cell cycle arrest.
The levels of DMP1 protein
expressed in mammalian fibroblasts are low, and the protein was only
revealed after sequential immunoprecipitation and blotting using
125I-protein A for detection with prolonged
autoradiographic exposures (9 days) (17). Correspondingly
low levels of DMP1 mRNA and protein were detected in quiescent and
proliferating macrophages and fibroblasts without significant
oscillations throughout the cell cycle. The inability to readily detect
the endogenous DMP1 protein has so far precluded all attempts to
demonstrate a direct association between DMP1 and D-type cyclins in a
physiologic in vivo setting. Moreover, because complexes between DMP1
and D-type cyclins do not bind to DNA (see above), we could not use
sensitive EMSAs to score for the presence of putative complexes.
Nonetheless, the fact that DMP1-mediated transactivation was
significantly higher in growth-arrested versus proliferating cells and
that its transcriptional activity was antagonized by D-type cyclins (see above) both suggested that DMP1 functions preferentially in
quiescent cells and that its activity may be canceled as cells enter
the cycle. We therefore compared the levels of endogenous DMP1 DNA
binding activity in EMSAs performed with extracts prepared from
untransfected quiescent and proliferating NIH 3T3 cells.
Using standard high-salt buffers to extract nuclear proteins and with
equivalent inputs of total protein for EMSAs, we saw
little difference
in the total endogenous DMP1 binding activity
recovered from quiescent
or proliferating cells (Fig.
7A). With
the DMP1-specific (BS2) probe, we detected equivalent levels of
complexes (Fig.
7A, lanes 1 and 5), which were disrupted by an
excess
of competing BS2 oligonucleotide (lanes 2 and 6) and were
supershifted
with antibodies to DMP1 (lanes 4 and 8) but not by
nonimmune serum
(lanes 3 and 7). However, using lower salt conditions
for extraction,
significantly more binding activity was detected
in extracts from
quiescent cells (Fig.
7B, lanes 5 to 8) than
from proliferating cells
(lanes 1 to 4). Again, the complexes
recovered from quiescent cells
were specifically supershifted
with antibodies to DMP1 (lanes 8). As a
further control for protein
recovery and specificity using the low-salt
extraction protocol,
we incubated the same extracts with an
ETS-specific probe (M3)
that contains a similar binding sequence
(CCCGGAAGT versus CCCGTATGT).
In this case,
roughly equivalent amounts of probe-bound complexes
were detected in
low-salt extracts from quiescent and proliferating
cells (Fig.
7C), and
as expected, these were competed by the unlabeled
cognate probe (lanes
2 and 6) but were not supershifted with antibodies
to DMP1 (lanes 4 and
8). Dilution of the extracts confirmed that
the probes were present in
excess (data not shown). Using low-salt
conditions, then, DMP1
extracted from proliferating cells was
inhibited in its ability to bind
to DNA (Fig.
7B), even though
approximately equivalent amounts of
latent DNA binding activity
were present (Fig.
7A). It appears that
DMP1 binding is masked
by a salt-dependent association with another
factor that either
retains DMP1 in the nucleus during extraction or
prevents its
association with DNA. Whatever the mechanism, DMP1 DNA
binding
and transactivating activity are more robust in growth-arrested
cells.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 7.
Differential, salt-dependent recovery of endogenous DMP1
binding activity from quiescent and proliferating cells. (A) Nuclear
extracts from proliferating (lanes 1 to 4) or quiescent (lanes 5 to 8)
NIH 3T3 cells were prepared with standard high-salt extraction buffer
and incubated with a radiolabeled BS2 probe containing the nonameric
DMP1 consensus binding sequence. Extracts were preincubated with
cognate oligonucleotide competitor, NRS, and antiserum to DMP1 (AF) as
indicated at the top of the panel. The positions of the DMP1-BS2
complex and a supershifted form are indicated by brackets and arrows,
respectively, to the right of the panel. (B) The experiment shown in
panel A was replicated with nuclear extracts generated with low-salt
buffer. The quantities of input protein and probe were identical to
those used for panel A. (C) The same quantities of nuclear extracts
used for the experiment shown in panel B were incubated with a
radiolabled M3 probe containing a nonameric ETS DNA binding sequence
that does not react with DMP1. Positions of complexes containing ETS
proteins are indicated by brackets to the right of the panel. All
radiographic exposure times are 8 h.
|
|
To determine whether DMP1 might negatively regulate cell proliferation
per se, we ectopically expressed the protein in quiescent
cells and
examined its effects on their ability to subsequently
enter S phase.
Cells transfected with the DMP1 expression vector
or with various
Flag-tagged DMP1 mutants were serum starved to
induce growth arrest and
then restimulated to synchronously enter
the cycle. BrdU was added to
the medium together with serum, and
cells were fixed 22 h later
and stained for BrdU incorporation
(green nuclear fluorescence) and for
DMP1 expression with antibodies
to the Flag epitope (red nuclear
fluorescence). Under these conditions,
a significant percentage of
cells expressing DMP1 remained in
G
0/G
1 and
failed to incorporate BrdU (see the representative two-color
fluorescence data in Fig.
8A
[quantitative data in bar graph at
lower right]). By contrast, cells
expressing the M11 (K319E) mutant
entered S phase (red plus green
fluorescence yielded yellow stained
nuclei in Fig.
8B), indicating that
DNA binding was required for
DMP1-induced G
1 phase arrest.
Other mutants defective in DNA binding
(e.g., M4 and M8) were also
unable to prevent S phase entry (bar
graph), even though they retain
the ability to interact with D-type
cyclins (Fig.
3). The N- and
C-terminal transactivating domains
of DMP1 were required for cell cycle
arrest, and the relative
potency of the relevant mutants in inhibiting
S phase entry correlated
with their transactivating activities. (See
results with mutants
M1 to M3 in the bar graph.) In agreement with the
ability of D-type
cyclins to antagonize DMP1-induced transcription,
cotransfection
of cyclin D2 with DMP1 overrode its growth-inhibitory
effects
(Fig.
8C and bar graph). Cyclin D1 was as potent as cyclin D2,
whereas cyclin A was not able to cancel DMP1-mediated growth arrest.
The D1 (K114E) mutant, which cannot bind to CDK4 but still inhibited
DMP1-mediated transactivation (Fig.
5), also retained its ability
to
counteract DMP1-induced cell cycle arrest (bar graph).

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 8.
DMP1 arrests cell cycle progression in G1.
NIH 3T3 cells transfected with expression vectors encoding either
wild-type DMP1 (A), the DMP1 (K319E) mutant M11 (B), or wild-type DMP1
plus cyclin D2 (C) were made quiescent by serum starvation for 24 h. Cells restimulated with FBS to enter the cell cycle were labeled
with BrdU for 22 h and then fixed and stained for the DMP1 Flag
epitope (red) and BrdU (green). Whereas DMP1-transfected cells did not
replicate their cellular DNA (A), cells infected with a DMP1 mutant
that cannot bind to DNA (B) or those cotransfected with cyclin D2 (C)
entered S phase; colocalization of DMP1 in BrdU-labeled cells is
indicated by yellow fluorescence. The relative potency of DMP1 mutants
in inhibiting S phase entry is quantitated in the bar graph at the
lower right; 200 DMP1-transfected cells were counted per slide. Error
bars indicate standard deviations from the mean, averaged from multiple
independent experiments. Where indicated, cells were cotransfected with
plasmids encoding wild-type D-type cyclins (+D1, +D2), a D1 (K114E)
point mutant that does not bind to CDK4, or cyclin A (+A).
|
|
To determine whether DMP1 could arrest cells that were already in
cycle, we introduced the expression vector into proliferating
cells
and, 14 h after transfection, recultured the cells in complete
medium for 32 h. BrdU was then added to the culture medium for
an
additional 22 h. Under these conditions, 80% of cells transfected
with a control vector remained in cycle and incorporated BrdU,
whereas
wild-type DMP1 prevented 70% of cells from entering S
phase. Again,
the M11 mutant was without effect, while cyclin
D2 was able to
completely override DMP1-induced growth arrest
(data not shown). Thus,
under both experimental conditions, DMP1
was able to induce growth
arrest, and this activity was antagonized
by D-type cyclins.
 |
DISCUSSION |
The activity of a novel transcription factor, DMP1, is antagonized
by its interaction with D-type cyclins in a CDK4-independent manner.
Deletion mutagenesis showed that the DNA binding domain of DMP1 was
confined to its central region, which includes the three tandem
myb-like repeats. Substitution of glutamic acid for lysine 319, a
residue in the second myb repeat which was predicted to contact DNA
(34), was sufficient in itself to abrogate both DNA binding
and transactivation of a DMP1-responsive reporter gene. Although this
central domain is sufficient to bind canonical DMP1 recognition sites
in DNA, other acidic sequences at both the N and C-termini of the
protein are required for transcriptional activation. Residues at the
protein C terminus seem to be more important in this regard, but they
must be widely distributed over this domain, because processive
C-terminal deletions (mutants M1 to M3) led to a stepwise loss in
transcriptional activation potential. In addition, the distal C
terminus minimally includes that subset of phosphorylation sites that
contribute to the heterogeneous migration of the protein on denaturing
polyacrylamide gels. None of these conform to ideal sites for CDK
phosphorylation ([S/T]PX[K/R]), arguing that other classes of
protein kinases likely contribute to these modifications. In contrast,
the N-terminal domain of DMP1 is crucial for its interaction with
D-type cyclins, with residues 87 to 237 being sufficient to confer
binding. Because removal of residues 1 to 86 reduced the ability of
D-type cyclins to associate with DMP1, amino acids within this segment
may contribute to optimized interactions. Together, these data suggest
that regions required for transactivation and cyclin D binding are
distinct, whereas the cyclin D binding domain abuts or overlaps the
region of DMP1 that binds to DNA. In agreement, the transactivation
potentials of all DMP1 mutants that retained the DNA binding domain
were sensitive to cyclin D-mediated inhibition. Although D-type cyclins and DMP1 can directly bind to one another in vitro (17), we cannot exclude the possibility that in yeast, insect, or mammalian cells, other proteins contribute to the formation or stability of these
complexes. However, CDKs appear not to be involved (see below).
Cotransfection of D-type cyclins with DMP1 abrogated its ability to
activate transcription of a luciferase reporter gene driven by a
minimal simian virus 40 promoter containing tandem 5' DMP1 binding
sites. Cyclins D1, D2, and D3 exerted similar effects in this assay,
whereas cyclins A, B, C, and H lacked such activity. The D-type cyclins
also antagonized the residual activity of those DMP1 deletion mutants
(M1 to M3 and M5) that were partially handicapped in transactivation
but which retained functional DNA binding and cyclin D-interactive
domains. Cotransfection of CDK4 or CDK2 with DMP1 was without effect on
reporter gene activity, and D-type cyclins inhibited DMP1-dependent
transactivation whether or not exogenous CDK-encoding vectors were
included. In transfected cells that had subsequently been rendered
quiescent by serum starvation, the introduction of vectors encoding
CDK4 inhibitors, including p16INK4a or
p19INK4d did not affect the outcome.
Importantly, a cyclin D1 mutant (K114E) that fails to bind or activate
CDK4 was highly potent in antagonizing DMP1 activity. Therefore, the
negative effects of D-type cyclins on DMP1-mediated transactivation do
not directly depend upon their catalytic partners, and phosphorylation
by CDK4 does not account for the ability of cyclin D to abrogate
DMP1-mediated transcriptional activation.
Previous experiments indicated that D-type cyclins entered into
mutually exclusive complexes with DMP1 and CDK4 whether the latter was
catalytically active or not. Although sequences in the first cyclin
fold (the cyclin box) are predicted to contain the critical cyclin
residues for contacting their respective CDKs (19, 23), our
studies suggest that sequences C terminal to this region are the
crucial ones for DMP1 binding. Observations that a cyclin D1 mutant
(K114E) that does not bind to CDK4 was still able to antagonize
DMP1-dependent transcriptional activation also support the conclusion
that CDK4 and DMP1 binding sites are distinct. However, from the
available data, we cannot discern why ternary complexes between cyclin
D, DMP1, and CDK4 do not form. A possibility raised by these results is
that CDK4 and DMP1 might compete for cyclin D binding in living cells.
In those transactivation experiments in which four expression plasmids
(DMP1, DMP1-responsive reporter, cyclin D, and CDK4) were cointroduced
into NIH 3T3 cells, cyclin D and CDK4 plasmids were transfected with
equal quantities of input DNAs, neither of which was in great excess
over that of the DMP1 expression plasmid. We would be unlikely to see
significant competition under such circumstances, but in principle,
higher ratios of CDK4 to DMP1 might quench the inhibitory effects of cyclin D. Given the inherently nonphysiologic nature of such
experiments, and for technical reasons outlined in Results, we chose
not to pursue this issue further.
Binding of D-type cyclins to DMP1 prevents its interaction with DNA.
This is likely due to the fact that the cyclin D binding site (within
residues 87 to 237) abuts or overlaps the DNA binding domain (within
residues 87 to 458). Even under optimal conditions, lysates of insect
cells coexpressing DMP1 and D-type cyclins contain a proportion of free
DMP1 molecules, and it is only these that interact with labeled
oligonucleotide probes to form the gel-shifted complexes visualized in
EMSAs. D-type cyclins were not detected in these complexes, and the
mobility of the complexes was not altered by exposing them to many
different polyvalent or monoclonal antibodies to the D cyclins; in
clear contrast, a number of different antibodies to DMP1 readily
supershifted these species (17). To further analyze this
issue, we purified DMP1 in complexes with Flag-tagged cyclin D1 and
tested them for their ability to interact with a labeled
oligonucleotide containing the DMP1 binding sequence. Comparatively low
quantities of free DMP1 interacted with the probe and produced readily
detectable EMSA complexes, but much greater quantities of cyclin
D-bound DMP1 appeared inert for DNA binding. Together, these data argue
against the idea that D-type cyclins act as DMP1 corepressors on DNA
and instead suggest that D-type cyclins squelch DMP1 activity by
titrating it into complexes that can no longer interact with DNA. This
implies that inhibition of DMP1 activity should not be mediated by
D-type cyclins in vivo under circumstances in which DMP1 is present in
excess. In most cell lines so far surveyed, DMP1 has proven to be
nonabundant and invariant throughout the cell cycle. In cycling cells,
the effects of DMP1 might well be overridden by D-type cyclins, which accumulate to much higher levels (30). Conversely, in
quiescent G0 cells in which D-type cyclin expression is low
or entirely absent, free DMP1 would be available to regulate gene
expression.
In this regard, it is intriguing that DMP1 was significantly more
active in fibroblasts that had been made quiescent by either serum
starvation or by transfection with CDK inhibitors, such as
p27Kip1. This was a consistent finding observed
in many transfected cell lines other than NIH 3T3. When endogenous DMP1
was extracted with high-salt buffer, the total DNA binding activities
recovered from proliferating and quiescent cells were similar. Low-salt
extraction of endogenous DMP1 yielded significantly more specific DNA
binding activity from quiescent than from proliferating fibroblasts,
while similar amounts of ETS DNA binding activity were recovered from both extracts. Therefore, in agreement with previous measurements, roughly equivalent amounts of DMP1 are found in quiescent and proliferating fibroblasts (17), but under conditions of
low-salt extraction, a substantial fraction of DMP1 either is not
released from the nuclei of proliferating cells or is recovered in an
inactive form. Noncovalent interactions between DMP1 and other
molecules that mask its recovery or activity might well be salt
dependent, while posttranslational modifications of DMP1 would be less
likely to account for the observed behavior. Although it is tempting to
speculate that endogenous cyclin D might itself mask the ability of
DMP1 to bind DNA and regulate gene expression, we have no evidence that
this can occur in a physiologic setting. The major limitation is that
the low levels of DMP1 protein that are normally expressed in
fibroblasts have so far precluded attempts to demonstrate direct interactions between it and other proteins.
Given the increased activity of DMP1 in quiescent cells, we were
motivated to test whether DMP1 might itself potentiate exit from the
cell cycle. Surprisingly, proliferating cells transfected with DMP1
underwent growth arrest when maintained in serum-containing medium,
whereas DMP1 mutants that could not bind DNA or activate transcription
were unable to halt cell proliferation. Moreover, when DMP1 was
transfected into cells that were subsequently made quiescent by
depriving the cultures of serum, cells expressing DMP1 did not reenter
S phase after serum restimulation, but untransfected cells from the
same cultures replicated their DNA. When DMP1 mutants were used, there
was a strict concordance between their ability to promote gene
expression and induce cell cycle arrest under either of these
experimental conditions. For example, a DMP1 point mutant (K319E) that
does not bind DNA was completely unable to stop cell proliferation.
Mutants M1 to M3 that were partially defective in transactivation were
also less able to induce cell cycle arrest. Conversely, cotransfection
of D-type cyclins overrode DMP1-induced arrest. A cyclin D1 (K114E)
mutant that does not bind CDK4 but still blocked DMP1-mediated gene
expression retained the ability to override DMP1-induced cell cycle
arrest. This again provides a strong argument that the ability of D
cyclins to antagonize DMP1 does not rely on CDK4-mediated
phosphorylation. Perhaps, DMP1 normally serves to maintain cells in a
quiescent state, and, in a manner conceptually analogous to that of
MyoD1 (41, 51), its activity is overridden by D-type cyclins
as cells are brought into cycle.
What gene products are responsible for this activity of DMP1? The
factor binds to canonical ETS sites that are commonly embedded in many
promoters. In addition, DMP1 can bind to a similar sequence (i.e.,
CCCGTATGT) which lacks the GGA core that is normally
required by ETS proteins for DNA binding (55). Therefore, at
least in principle, many genes are likely to prove to be DMP1
responsive. Nonetheless, the simplest hypothesis is that DMP1 induces
the expression of a gene product, such as a CDK inhibitor, that
enforces cell cycle arrest.
 |
ACKNOWLEDGMENTS |
We thank Hiroshi Hirai and Martine Roussel for helpful advice and
discussion, Hiroshi Hirai for communicating unpublished data,
Frederique Zindy for supplying the cyclin D1 deletion mutants, J. Alan
Diehl for preparing the D1 (K114E) mutant, Richard Bram for supplying
pFLEX1 and pBJ5 plasmids, and Jill Lahti for supplying cyclins B and C. We also thank Carol Bockhold, Joe Watson, and Shawn Hawkins for
excellent technical assistance and other members of our laboratory for
their criticisms and support.
This work was supported in part by Cancer Center CORE grant CA21765, by
Leukemia Program Project grant CA-20180, and by the American Lebanese
Syrian Associated Charities of St. Jude Children's Research Hospital.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Tumor Cell Biology, St. Jude Children's Research Hospital, 332 North Lauderdale, Memphis, TN 38105. Phone: (901) 495-3505. Fax: (901) 495-2381. E-mail: sherr{at}stjude.org.
 |
REFERENCES |
| 1.
|
Baldin, V.,
J. Lukas,
M. J. Marcote,
M. Pagano, and G. Draetta.
1993.
Cyclin D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev.
7:812-821[Abstract/Free Full Text].
|
| 2.
|
Bram, R. J., and G. R. Crabtree.
1994.
Calcium signaling in T cells stimulated by a cyclophilin B-binding protein.
Nature
371:355-358[Medline].
|
| 3.
|
Chellappan, S. P.,
S. Hiebert,
M. Mudryj,
J. M. Horowitz, and J. R. Nevins.
1991.
The E2F transcription factor is a cellular target for the RB protein.
Cell
65:1053-1061[Medline].
|
| 4.
|
Connell-Crowley, L.,
J. W. Harper, and D. W. Goodrich.
1997.
Cyclin D1/Cdk4 regulates retinoblastoma protein-mediated cell cycle arrest by site-specific phosphorylation.
Mol. Biol. Cell.
8:287-301[Abstract].
|
| 5.
|
Davis, J. N., and M. F. Roussel.
1996.
Cloning and expression of murine Elf-1 cDNA.
Gene
171:265-269[Medline].
|
| 6.
|
Ewen, M. E.,
H. K. Sluss,
C. J. Sherr,
H. Matsushime,
J. Kato, and D. M. Livingston.
1993.
Functional interactions of the retinoblastoma protein with mammalian D-type cyclins.
Cell
73:487-497[Medline].
|
| 7.
|
Fantl, V.,
G. Stamp,
A. Andrews,
I. Rosewell, and C. Dickson.
1995.
Mice lacking cyclin D1 are small and show defects in eye and mammary gland development.
Genes Dev.
9:2364-2372[Abstract/Free Full Text].
|
| 8.
|
Farnham, P. J.
1996.
.
Transcriptional control of cell growth: the E2F family.
Springer Verlag, New York, N.Y.
|
| 9.
|
Flemington, E. K.,
S. H. Speck, and W. G. Kaelin, Jr.
1993.
E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product.
Proc. Natl. Acad. Sci. USA
90:6914-6918[Abstract/Free Full Text].
|
| 10.
|
Guan, K.-L.,
C. W. Jenkins,
Y. Li,
M. A. Nichols,
X. Wu,
C. L. O'Keefe,
A. G. Matera, and Y. Xiong.
1994.
Growth suppression by p18, a p16INK4/MTS1- and p14INK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function.
Genes Dev.
8:2939-2952[Abstract/Free Full Text].
|
| 11.
|
Hamel, P. A.,
R. M. Gill,
R. A. Phillips, and B. L. Gallie.
1992.
Transcriptional repression of the E2-containing promoters EIIaE, c-myc, and RB1 by the product of the RB1 gene.
Mol. Cell. Biol.
12:3431-3438[Abstract/Free Full Text].
|
| 12.
|
Hannon, G. J., and D. Beach.
1994.
p15INK4b is a potential effector of cell cycle arrest mediated by TGF- .
Nature
371:257-261[Medline].
|
| 13.
|
Hatakeyama, M.,
J. A. Brill,
G. R. Fink, and R. A. Weinberg.
1994.
Collaboration of G1 cyclins in the functional inactivation of the retinoblastoma protein.
Genes Dev.
8:1759-1771[Abstract/Free Full Text].
|
| 14.
|
Herrera, R. E.,
V. P. Sah,
B. O. Williams,
T. P. Mäkelä,
R. A. Weinberg, and T. Jacks.
1996.
Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts.
Mol. Cell. Biol.
16:2402-2407[Abstract].
|
| 15.
|
Hinds, P. W.,
S. Mittnacht,
V. Dulic,
A. Arnold,
S. I. Reed, and R. A. Weinberg.
1992.
Regulation of retinoblastoma protein functions by ectopic expression of human cyclins.
Cell
70:993-1006[Medline].
|
| 16.
|
Hirai, H.,
M. F. Roussel,
J.-Y. Kato,
R. A. Ashmun, and C. J. Sherr.
1995.
Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6.
Mol. Cell. Biol.
15:2672-2681[Abstract].
|
| 17.
|
Hirai, H., and C. J. Sherr.
1996.
Interaction of D-type cyclins with a novel myb-like transcription factor, DMP1.
Mol. Cell. Biol.
16:6457-6467[Abstract].
|
| 18.
|
Hurford, R. K.,
D. Cobrinik,
M.-H. Lee, and N. Dyson.
1997.
pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes.
Genes Dev.
11:1447-1463[Abstract/Free Full Text].
|
| 19.
|
Jeffrey, P. D.,
A. A. Russo,
K. Polyak,
E. Gibbs,
J. Hurwitz,
J. Massague, and N. P. Pavletich.
1995.
Mechanism of CDK activation revealed by the structure of a cyclin A-CDK2 complex.
Nature
376:313-320[Medline].
|
| 20.
|
Kato, J.,
H. Matsushime,
S. W. Hiebert,
M. E. Ewen, and C. J. Sherr.
1993.
Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase, CDK4.
Genes Dev.
7:331-342[Free Full Text].
|
| 21.
|
Kato, J., and C. J. Sherr.
1993.
Inhibition of granulocyte differentiation by G1 cyclins D2 and D3 but not D1.
Proc. Natl. Acad. Sci. USA
90:11513-11517[Abstract/Free Full Text].
|
| 22.
|
Kato, J.,
M. Matsuoka,
K. Polyak,
J. Massagué, and C. J. Sherr.
1994.
Cyclic AMP-induced G1 phase arrest mediated by an inhibitor (p27Kip1) of cyclin-dependent kinase-4 activation.
Cell
79:487-496[Medline].
|
| 23.
|
Kim, K. K.,
H. M. Chamberlin,
D. O. Morgan, and S. H. Kim.
1996.
Three-dimensional structure of human cyclin H, a positive regulator of the CDK-activating kinase.
Nat. Struct. Biol.
3:849-855[Medline].
|
| 24.
|
Koh, J.,
G. H. Enders,
B. D. Dynlacht, and E. Harlow.
1995.
Tumour-derived p16 alleles encoding proteins defective in cell cycle inhibition.
Nature
375:506-510[Medline].
|
| 25.
|
Lam, E. W.-F., and R. J. Watson.
1993.
An E2F binding site mediates cell-cycle regulated repression of mouse B-myb transcription.
EMBO J.
12:2705-2713[Medline].
|
| 26.
|
Lukas, J.,
J. Bartkova,
M. Rohde,
M. Strauss, and J. Bartek.
1995.
Cyclin D1 is dispensable for G1 control in retinoblastoma gene-deficient cells, independent of cdk4 activity.
Mol. Cell. Biol.
15:2600-2611[Abstract].
|
| 27.
|
Lukas, J.,
D. Parry,
L. Aagaard,
D. J. Mann,
J. Bartkova,
M. Strauss,
G. Peters, and J. Bartek.
1995.
Retinoblastoma protein-dependent cell cycle inhibition by the tumor suppressor p16.
Nature
375:503-506[Medline].
|
| 28.
|
Matsushime, H.,
M. E. Ewen,
D. K. Strom,
J. Kato,
S. K. Hanks,
M. F. Roussel, and C. J. Sherr.
1992.
Identification and properties of an atypical catalytic subunit (p34PSKJ3/CDK4) for mammalian D-type G1 cyclins.
Cell
71:323-334[Medline].
|
| 29.
|
Matsushime, H.,
D. E. Quelle,
S. A. Shurtleff,
M. Shibuya,
C. J. Sherr, and J. Kato.
1994.
D-type cyclin-dependent kinase activity in mammalian cells.
Mol. Cell. Biol.
14:2066-2076[Abstract/Free Full Text].
|
| 30.
|
Matsushime, H.,
M. F. Roussel,
R. A. Ashmun, and C. J. Sherr.
1991.
Colony-stimulating factor 1 regulates novel cyclins during the G1 phase of the cell cycle.
Cell
65:701-713[Medline].
|
| 31.
|
Medema, R. H.,
R. E. Herrera,
F. Lam, and R. A. Weinberg.
1995.
Growth suppression by p16ink4 requires functional retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
92:6289-6293[Abstract/Free Full Text].
|
| 32.
|
Meyerson, M., and E. Harlow.
1994.
Identification of a G1 kinase activity for cdk6, a novel cyclin D partner.
Mol. Cell. Biol.
14:2077-2086[Abstract/Free Full Text].
|
| 33.
|
Neuman, E.,
M. H. Ladha,
N. Lin,
T. M. Upton,
S. J. Miller,
J. Direnzo,
R. G. Pestell,
P. W. Hinds,
S. F. Dowdy,
M. Brown, and M. E. Ewen.
1997.
Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4.
Mol. Cell. Biol.
17:5338-5347[Abstract].
|
| 34.
|
Ogata, K.,
S. Morikawa,
H. Nakamura,
A. Sekikawa,
T. Inoue,
H. Kanai,
A. Sarai,
S. Ishii, and Y. Nishimura.
1994.
Solution structure of a specific DNA complex of the myb DNA-binding domain with cooperative recognition helices.
Cell
79:639-648[Medline].
|
| 34a.
|
Owen, R. D.,
D. M. Bortner, and M. C. Ostrowski.
1990.
ras oncogene activation of a VL30 transcriptional element is linked to transformation.
Mol. Cell. Biol.
10:1-9[Abstract/Free Full Text].
|
| 35.
|
Pagano, M.,
A. M. Theodoras,
S. W. Tam, and G. F. Draetta.
1994.
Cyclin D1-mediated inhibition of repair and replicative DNA synthesis in human fibroblasts.
Genes Dev.
8:1627-1639[Abstract/Free Full Text].
|
| 36.
|
Pardee, A. B.
1989.
G1 events and regulation of cell proliferation.
Science
246:603-608[Abstract/Free Full Text].
|
| 37.
|
Polyak, K.,
J. Kato,
M. J. Solomon,
C. J. Sherr,
J. Massague,
J. M. Roberts, and A. Koff.
1994.
p27Kip1, a cyclin-cdk inhibitor, links transforming growth factor- and contact inhibition to cell cycle arrest.
Genes Dev.
8:9-22[Abstract/Free Full Text].
|
| 38.
|
Polyak, K.,
M. Lee,
H. Erdjument-Bromage,
A. Koff,
J. M. Roberts,
P. Tempst, and J. Massagué.
1994.
Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals.
Cell
78:59-66[Medline].
|
| 39.
|
Quelle, D. E.,
R. A. Ashmun,
S. A. Shurtleff,
J. Kato,
D. Bar-Sagi,
M. F. Roussel, and C. J. Sherr.
1993.
Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts.
Genes Dev.
7:1559-1571[Abstract/Free Full Text].
|
| 40.
|
Quelle, D. E.,
M. Cheng,
R. A. Ashmun, and C. J. Sherr.
1997.
Cancer-associated mutations at the INK4a locus cancel cell cycle arest by p16INK4a but not by the alternative reading frame protein p19ARF.
Proc. Natl. Acad. Sci. USA
94:3436-3440[Abstract/Free Full Text].
|
| 41.
|
Rao, S. S.,
C. Chu, and D. S. Kohtz.
1994.
Ectopic expression of cyclin D1 prevents activation of gene transcription by myogenic basic-loop-helix regulators.
Mol. Cell. Biol.
14:5259-5267[Abstract/Free Full Text].
|
| 42.
|
Resnitzky, D.,
M. Gossen,
H. Bujard, and S. I. Reed.
1994.
Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system.
Mol. Cell. Biol.
14:1669-1679[Abstract/Free Full Text].
|
| 43.
|
Resnitzky, D., and S. I. Reed.
1995.
Differential effects of cyclins D1 and E on pRb phosphorylation.
Mol. Cell. Biol.
15:3463-3469[Abstract].
|
| 44.
|
Reynisdóttir, I., and J. Massagué.
1997.
The subcellular locations of p15INK4b and p27Kip1 coordinate their inhibitory interactions with cdk4 and cdk2.
Genes Dev.
11:492-503[Abstract/Free Full Text].
|
| 45.
|
Reynisdóttir, I.,
K. Polyak,
A. Iavarone, and J. Massagué.
1995.
Kip/Cip and Ink4 cdk inhibitors cooperate to induce cell cycle arrest in response to TGF- .
Genes Dev.
9:1831-1845[Abstract/Free Full Text].
|
| 46.
|
Serrano, M.,
E. Gomez-Lahoz,
R. A. DePinho,
D. Beach, and D. Bar-Sagi.
1995.
Inhibition of ras-induced proliferation and cellular transformation by p16INK4.
Science
267:249-252[Abstract/Free Full Text].
|
| 47.
|
Sherr, C. J.
1993.
Mammalian G1 cyclins.
Cell
73:1059-1065[Medline].
|
| 48.
|
Sherr, C. J.
1994.
G1 phase progression: cycling on cue.
Cell
79:551-555[Medline].
|
| 49.
|
Sherr, C. J., and J. M. Roberts.
1995.
Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev.
9:1149-1163[Free Full Text].
|
| 50.
|
Sicinski, P.,
J. L. Donaher,
S. B. Parker,
T. Li,
A. Fazeli,
H. Gardner,
S. Z. Haslam,
R. T. Bronson,
S. J. Elledge, and R. A. Weinberg.
1995.
Cyclin D1 provides a link between development and oncogenesis in the retina and breast.
Cell
82:621-630[Medline].
|
| 51.
|
Skapek, S. X.,
J. Rhee,
D. B. Spicer, and A. B. Lassar.
1995.
Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D-dependent kinase.
Science
267:1022-1024[Abstract/Free Full Text].
|
| 52.
|
Toyoshima, H., and T. Hunter.
1994.
p27, a novel inhibitor of G1 cyclin/cdk protein kinase activity, is related to p21.
Cell
78:67-74[Medline].
|
| 53.
|
Vallance, S. J.,
H. Lee,
M. F. Roussel,
S. A. Shurtleff,
J. Kato,
D. K. Strom, and C. J. Sherr.
1993.
Monoclonal antibodies to mammalian D-type G1 cyclins.
Hybridoma
13:37-44.
|
| 54.
|
Wang, T. C.,
R. D. Cardiff,
L. Zukerberg,
E. Lees,
A. Arnold, and E. V. Schmidt.
1994.
Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice.
Nature
369:669-671[Medline].
|
| 55.
|
Wasylyk, B.,
S. L. Hahn, and A. Giovane.
1993.
The ets family of transcription factors.
Eur. J. Biochem.
211:7-18[Medline].
|
| 56.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
81:323-330[Medline].
|
| 57.
|
Weintraub, S. J.,
C. A. Prater, and D. C. Dean.
1992.
Retinoblastoma protein switches the E2F site from positive to negative element.
Nature
358:259-261[Medline].
|
| 58.
|
Zwijsen, R. M. L.,
E. Wientijens,
R. Klompmaker,
J. van der Sman,
R. Bernards, and R. J. A. M. Michalides.
1997.
CDK-independent activation of estrogen receptor by cyclin D1.
Cell
88:405-415[Medline].
|
Mol Cell Biol, March 1998, p. 1590-1600, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, T., Liu, W.-D., Saunee, N. A., Breslin, M. B., Lan, M. S.
(2009). Zinc Finger Transcription Factor INSM1 Interrupts Cyclin D1 and CDK4 Binding and Induces Cell Cycle Arrest. J. Biol. Chem.
284: 5574-5581
[Abstract]
[Full Text]
-
Wang, H.-W., Muguira, M., Liu, W.-D., Zhang, T., Chen, C., Aucoin, R., Breslin, M. B, Lan, M. S
(2008). Identification of an INSM1-binding site in the insulin promoter: negative regulation of the insulin gene transcription. J Endocrinol
198: 29-39
[Abstract]
[Full Text]
-
Inoue, K., Sugiyama, T., Taneja, P., Morgan, R. L., Frazier, D. P.
(2008). Emerging Roles of DMP1 in Lung Cancer. Cancer Res.
68: 4487-4490
[Abstract]
[Full Text]
-
Kono, A., Umeda-Hara, C., Adachi, S., Nagata, N., Konomi, M., Nakagawa, T., Uchimiya, H., Umeda, M.
(2007). The Arabidopsis D-Type Cyclin CYCD4 Controls Cell Division in the Stomatal Lineage of the Hypocotyl Epidermis. Plant Cell
19: 1265-1277
[Abstract]
[Full Text]
-
Upton, J. W., Speck, S. H.
(2006). Evidence for CDK-Dependent and CDK-Independent Functions of the Murine Gammaherpesvirus 68 v-Cyclin. J. Virol.
80: 11946-11959
[Abstract]
[Full Text]
-
Shen, R., Wang, X., Drissi, H., Liu, F., O'Keefe, R. J., Chen, D.
(2006). Cyclin D1-Cdk4 Induce Runx2 Ubiquitination and Degradation. J. Biol. Chem.
281: 16347-16353
[Abstract]
[Full Text]
-
Weroha, S.J., Li, S. A., Tawfik, O., Li, J. J.
(2006). Overexpression of cyclins D1 and D3 during estrogen-induced breast oncogenesis in female ACI rats. Carcinogenesis
27: 491-498
[Abstract]
[Full Text]
-
Zacharek, S. J., Xiong, Y., Shumway, S. D.
(2005). Negative Regulation of TSC1-TSC2 by Mammalian D-Type Cyclins. Cancer Res.
65: 11354-11360
[Abstract]
[Full Text]
-
Peterson, L. F., Boyapati, A., Ranganathan, V., Iwama, A., Tenen, D. G., Tsai, S., Zhang, D.-E.
(2005). The Hematopoietic Transcription Factor AML1 (RUNX1) Is Negatively Regulated by the Cell Cycle Protein Cyclin D3. Mol. Cell. Biol.
25: 10205-10219
[Abstract]
[Full Text]
-
Sarruf, D. A., Iankova, I., Abella, A., Assou, S., Miard, S., Fajas, L.
(2005). Cyclin D3 Promotes Adipogenesis through Activation of Peroxisome Proliferator-Activated Receptor {gamma}. Mol. Cell. Biol.
25: 9985-9995
[Abstract]
[Full Text]
-
Tsikitis, M., Zhang, Z., Edelman, W., Zagzag, D., Kalpana, G. V.
(2005). Genetic ablation of Cyclin D1 abrogates genesis of rhabdoid tumors resulting from Ini1 loss. Proc. Natl. Acad. Sci. USA
102: 12129-12134
[Abstract]
[Full Text]
-
Fu, M., Wang, C., Rao, M., Wu, X., Bouras, T., Zhang, X., Li, Z., Jiao, X., Yang, J., Li, A., Perkins, N. D., Thimmapaya, B., Kung, A. L., Munoz, A., Giordano, A., Lisanti, M. P., Pestell, R. G.
(2005). Cyclin D1 Represses p300 Transactivation through a Cyclin-dependent Kinase-independent Mechanism. J. Biol. Chem.
280: 29728-29742
[Abstract]
[Full Text]
-
Arnold, A., Papanikolaou, A.
(2005). Cyclin D1 in Breast Cancer Pathogenesis. JCO
23: 4215-4224
[Abstract]
[Full Text]
-
Sreeramaneni, R., Chaudhry, A., McMahon, M., Sherr, C. J., Inoue, K.
(2005). Ras-Raf-Arf Signaling Critically Depends on the Dmp1 Transcription Factor. Mol. Cell. Biol.
25: 220-232
[Abstract]
[Full Text]
-
Fu, M., Wang, C., Li, Z., Sakamaki, T., Pestell, R. G.
(2004). Minireview: Cyclin D1: Normal and Abnormal Functions. Endocrinology
145: 5439-5447
[Abstract]
[Full Text]
-
Emmerich, J., Meyer, C. A., de la Cruz, A. F. A., Edgar, B. A., Lehner, C. F.
(2004). Cyclin D Does Not Provide Essential Cdk4-Independent Functions in Drosophila. Genetics
168: 867-875
[Abstract]
[Full Text]
-
Tschan, M. P., Fischer, K. M., Fung, V. S., Pirnia, F., Borner, M. M., Fey, M. F., Tobler, A., Torbett, B. E.
(2003). Alternative Splicing of the Human Cyclin D-binding Myb-like Protein (hDMP1) Yields a Truncated Protein Isoform That Alters Macrophage Differentiation Patterns. J. Biol. Chem.
278: 42750-42760
[Abstract]
[Full Text]
-
Wang, C., Pattabiraman, N., Zhou, J. N., Fu, M., Sakamaki, T., Albanese, C., Li, Z., Wu, K., Hulit, J., Neumeister, P., Novikoff, P. M., Brownlee, M., Scherer, P. E., Jones, J. G., Whitney, K. D., Donehower, L. A., Harris, E. L., Rohan, T., Johns, D. C., Pestell, R. G.
(2003). Cyclin D1 Repression of Peroxisome Proliferator-Activated Receptor {gamma} Expression and Transactivation. Mol. Cell. Biol.
23: 6159-6173
[Abstract]
[Full Text]
-
Lundquist, A., Barre, B., Bienvenu, F., Hermann, J., Avril, S., Coqueret, O.
(2003). Kaposi sarcoma-associated viral cyclin K overrides cell growth inhibition mediated by oncostatin M through STAT3 inhibition. Blood
101: 4070-4077
[Abstract]
[Full Text]
-
Gladden, A. B., Diehl, J. A.
(2003). The Cyclin D1-dependent Kinase Associates with the Pre-replication Complex and Modulates RB{middle dot}MCM7 Binding. J. Biol. Chem.
278: 9754-9760
[Abstract]
[Full Text]
-
Ciemerych, M. A., Kenney, A. M., Sicinska, E., Kalaszczynska, I., Bronson, R. T., Rowitch, D. H., Gardner, H., Sicinski, P.
(2002). Development of mice expressing a single D-type cyclin. Genes Dev.
16: 3277-3289
[Abstract]
[Full Text]
-
Busk, P. K, Bartkova, J., Strom, C. C, Wulf-Andersen, L., Hinrichsen, R., Christoffersen, T. E.H, Latella, L., Bartek, J., Haunso, S., Sheikh, S. P
(2002). Involvement of cyclin D activity in left ventricle hypertrophy in vivo and in vitro. Cardiovasc Res
56: 64-75
[Abstract]
[Full Text]
-
Ratineau, C., Petry, M. W., Mutoh, H., Leiter, A. B.
(2002). Cyclin D1 Represses the Basic Helix-Loop-Helix Transcription Factor, BETA2/NeuroD. J. Biol. Chem.
277: 8847-8853
[Abstract]
[Full Text]
-
Musgrove, E. A., Hunter, L.-J. K., Lee, C. S. L., Swarbrick, A., Hui, R., Sutherland, R. L.
(2001). Cyclin D1 Overexpression Induces Progestin Resistance in T-47D Breast Cancer Cells Despite p27Kip1 Association with Cyclin E-Cdk2. J. Biol. Chem.
276: 47675-47683
[Abstract]
[Full Text]
-
Quon, K. C., Berns, A.
(2001). Haplo-insufficiency? Let me count the ways. Genes Dev.
15: 2917-2921
[Full Text]
-
Inoue, K., Zindy, F., Randle, D. H., Rehg, J. E., Sherr, C. J.
(2001). Dmp1 is haplo-insufficient for tumor suppression and modifies the frequencies of Arf and p53 mutations in Myc-induced lymphomas. Genes Dev.
15: 2934-2939
[Abstract]
[Full Text]
-
Lamb, J., Ladha, M. H., McMahon, C., Sutherland, R. L., Ewen, M. E.
(2000). Regulation of the Functional Interaction between Cyclin D1 and the Estrogen Receptor. Mol. Cell. Biol.
20: 8667-8675
[Abstract]
[Full Text]
-
Ravanko, K., Järvinen, K., Paasinen-Sohns, A., Hölttä, E.
(2000). Loss of p27Kip1 from Cyclin E/Cyclin-dependent Kinase (CDK) 2 but not from Cyclin D1/CDK4 Complexes in Cells Transformed by Polyamine Biosynthetic Enzymes. Cancer Res.
60: 5244-5253
[Abstract]
[Full Text]
-
Inoue, K., Wen, R., Rehg, J. E., Adachi, M., Cleveland, J. L., Roussel, M. F., Sherr, C. J.
(2000). Disruption of the ARF transcriptional activator DMP1 facilitates cell immortalization, Ras transformation, and tumorigenesis. Genes Dev.
14: 1797-1809
[Abstract]
[Full Text]
-
Germain, D., Russell, A., Thompson, A., Hendley, J.
(2000). Ubiquitination of Free Cyclin D1 Is Independent of Phosphorylation on Threonine 286. J. Biol. Chem.
275: 12074-12079
[Abstract]
[Full Text]
-
Cervellera, M. N., Sala, A.
(2000). Poly(ADP-ribose) Polymerase Is a B-MYB Coactivator. J. Biol. Chem.
275: 10692-10696
[Abstract]
[Full Text]
-
Kohn, K. W.
(1999). Molecular Interaction Map of the Mammalian Cell Cycle Control and DNA Repair Systems. Mol. Biol. Cell
10: 2703-2734
[Abstract]
[Full Text]
-
Albrecht, J. H., Hansen, L. K.
(1999). Cyclin D1 Promotes Mitogen-independent Cell Cycle Progression in Hepatocytes. Cell Growth Differ.
10: 397-404
[Abstract]
[Full Text]
-
McMahon, C., Suthiphongchai, T., DiRenzo, J., Ewen, M. E.
(1999). P/CAF associates with cyclin D1 and potentiates its activation of the estrogen receptor. Proc. Natl. Acad. Sci. USA
96: 5382-5387
[Abstract]
[Full Text]
-
Knudsen, K. E., Cavenee, W. K., Arden, K. C.
(1999). D-Type Cyclins Complex with the Androgen Receptor and Inhibit Its Transcriptional Transactivation Ability. Cancer Res.
59: 2297-2301
[Abstract]
[Full Text]
-
Inoue, K., Roussel, M. F., Sherr, C. J.
(1999). Induction of ARF tumor suppressor gene expression and cell cycle arrest by transcription factor DMP1. Proc. Natl. Acad. Sci. USA
96: 3993-3998
[Abstract]
[Full Text]
-
Inoue, K., Sherr, C. J., Shapiro, L. H.
(1998). Regulation of the CD13/Aminopeptidase N Gene by DMP1, a Transcription Factor Antagonized by D-Type Cyclins. J. Biol. Chem.
273: 29188-29194
[Abstract]
[Full Text]
-
Bienvenu, F., Gascan, H., Coqueret, O.
(2001). Cyclin D1 Represses STAT3 Activation through a Cdk4-independent Mechanism. J. Biol. Chem.
276: 16840-16847
[Abstract]
[Full Text]