Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1642-1651, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
ZIP Kinase, a Novel Serine/Threonine Kinase Which
Mediates Apoptosis
Taro
Kawai,
Makoto
Matsumoto,
Kiyoshi
Takeda,
Hideki
Sanjo, and
Shizuo
Akira*
Department of Biochemistry, Hyogo College of
Medicine, Nishinomiya, Hyogo 663, Japan
Received 25 September 1997/Returned for modification 30 October
1997/Accepted 11 December 1997
 |
ABSTRACT |
We have identified a novel serine/threonine kinase, designated ZIP
kinase, which mediates apoptosis. ZIP kinase contains a leucine zipper
structure at its C terminus, in addition to a kinase domain at its N
terminus. ZIP kinase physically binds to ATF4, a member of the
activating transcription factor/cyclic AMP-responsive element-binding
protein (ATF/CREB) family, through interaction between their leucine
zippers. The leucine zipper domain is necessary for the
homodimerization of ZIP kinase as well as for the activation of kinase.
Immunostaining study showed that ZIP kinase localizes in the nuclei.
Overexpression of intact ZIP kinase but not catalytically inactive
kinase mutants led to the morphological changes of apoptosis in NIH 3T3
cells, suggesting that the cell death-inducing activity of ZIP kinase
depends on its intrinsic kinase activity. Interestingly, the catalytic
domain of ZIP kinase is closely related to that of death-associated
protein kinase (DAP kinase), which is a mediator of apoptosis induced
by gamma interferon. Therefore, both ZIP and DAP kinases represent a
novel kinase family, which mediates apoptosis through their catalytic
activities.
 |
INTRODUCTION |
Apoptosis, a genetically controlled
cell death to eliminate unwanted cells from an organism, plays a
central role in embryogenesis and tissue homeostasis, but its
deregulation is associated with various human diseases including
autoimmune diseases, neurodegenerative disorders, and cancers (7,
27, 30, 32). Apoptosis is also triggered when cells are exposed
to external stimuli including cytokines, X rays, heat shock, UV
irradiation, and certain drugs. Apoptotic cell death is characterized
by a series of morphological changes such as cytoplasmic shrinkage,
chromatin condensation, membrane blebbing, endonucleolytic degradation
of genomic DNA, and the formation of apoptotic bodies (21).
Although the morphological changes are well defined, a precise
mechanism which regulates the process of apoptosis is still unclear. In
some cases, it appears that apoptosis is initiated by a cascade of
protease activation followed by the cleavage of a specific substrate(s)
(25). This proteolytic pathway is mediated by the conserved
group of cysteine proteases, now designated caspases (2,
26). This family has at least 10 members, and they are related to
the mammalian interleukin-1
-converting enzyme and to the nematode
Caenorhabditis elegans CED-3, which is necessary for
apoptotic cell death during development (40). Ectopic
expression of caspases promotes apoptosis, while inhibition of caspases
by specific tetrapeptides blocks apoptosis. These findings demonstrate
that caspases are essential for the induction of apoptosis.
In addition to activation of caspases, signaling events such as
increases in cytosolic Ca2+ concentrations (22),
activation of protein kinases (3), and production of
ceramide (14, 17, 31, 36) are involved in apoptosis. Studies
on responses to cytotoxic stresses have implicated the catalytic
activities of Jun N-terminal kinases (JNKs) in signaling for apoptosis
(10, 19). JNKs are rapidly activated in response to stresses
such as UV irradiation, X ray, nerve growth factor withdrawal, tumor
necrosis factor alpha (TNF-
), and Fas (13, 36, 38, 39).
Furthermore, inhibitors of the JNK pathway block apoptosis induced by
such stresses (36). In addition, other kinases such as ASK1
and RIP have been shown to induce apoptosis (20, 29).
However, at present only a few kinases which mediate apoptosis have
been identified, and there is no clear picture of the apoptotic pathway
mediated by such protein kinases.
In this report, we describe the cloning and characterization of ZIP
kinase, a novel serine/threonine kinase which is a mediator of
apoptosis. ZIP kinase contains an N-terminal kinase domain and a
C-terminal leucine zipper domain that is necessary for homodimerization as well as for heterodimerization with ATF4, a member of the activating transcription factor/cyclic AMP-responsive element-binding protein (ATF/CREB) family of transcription factors (15, 33, 35). Overexpression of ZIP kinase induces the morphological changes of
apoptosis in mammalian cells, suggesting that it may play an important
role in the induction of apoptosis.
 |
MATERIALS AND METHODS |
Two-hybrid screening.
Yeast two-hybrid screening was
performed by the Matchmaker two-hybrid system (Clontech). To construct
a bait plasmid, the leucine zipper domain of murine ATF4 (amino acids
[aa] 298 to 349) amplified from mouse spleen cDNA by reverse
transcription-PCR was cloned in frame into the DNA binding domain of
GAL4 in the pAS2-1 plasmid. Saccharomyces cerevisiae Y190
cells were transformed with the ATF4 bait plasmid by a modified lithium
acetate method, and the transformants were selected on synthetic
dextrose medium lacking tryptophan (SD
Trp). The transformants grown
on SD
Trp were further transformed with a mouse brain or a human
placenta cDNA library fused to the GAL4 transactivation domain in pACT2 (Clontech). A total of 2 × 106 transformants were
screened on plates lacking tryptophan, leucine, and histidine but
containing 25 mM 3-aminotriazole (nacalai tesque) and were then assayed
for
-galactosidase activity. Positive clones were picked, and the
pACT2 library plasmids were recovered from individual clones and
expanded in Escherichia coli. The cDNA inserts obtained in
the plasmid were characterized by nucleotide sequence analysis with an
automated DNA sequence analyzer (Applied Biosystems model 377).
Plasmid construction.
Expression plasmids for hemagglutinin
(HA)-tagged ZIP kinase, FLAG-tagged ZIP kinase (mouse; aa 1 to 448),
Myc-tagged ZIP kinase (mouse; aa 309 to 448), and FLAG-tagged ATF4
(human; full length) were constructed as follows. An expression
plasmid, pEF-BOS, was digested with XbaI to remove the
stuffer sequence, blunted with T4 polymerase, and ligated with
SalI linker (24). Fragments which were epitope
tagged at their NH2 terminus were generated by PCR,
digested with SalI, and inserted into pEF-BOS. The sequence of each primer will be provided upon request.
To construct the deletion mutants containing ZIP kinase fused to the
GAL4 DNA binding domain or transactivation domain, fragments were
amplified by PCR and inserted in frame into the BamHI site of pAS2-1 or pACT2.
The mutant expression vectors, pEF-BOS-HA-ZIP kinase K42A and HA-ZIP
kinase LA, were constructed by site-directed mutagenesis
with a
Transformer site-directed mutagenesis kit (Clontech). The
mutagenic
primer sequences are as follows: HA-ZIP kinase K42A,
5'-GGCATGGAGTATGCAGCTGCGTTCATCAAGAAGCGGCGC-3'; HA-ZIP kinase
LA,
5'-GACGCGCTAGCCGCTCAGGCGGCCGCTGAGGTGCAATTCGCGCGCGACCTGGTGCGTGCGGC
GGAGCAGGAACGGCTGCAG-3'.
Other mutant expression vectors, pEF-BOS-FLAG-ZIP
kinase K42A,
pEF-BOS-FLAG-ZIP kinase K42A

LZ (aa 1 to 397), and
pEF-BOS-FLAG-ZIP
kinase K42A KD (aa 1 to 275), were constructed
by PCR from
pEF-BOS-HA-ZIP kinase K42A as the template.
The sequences of DNA fragments obtained by PCR were confirmed by DNA
sequencing.
Transfection, immunoprecipitation, and Western blot
analysis.
COS-7 cells were maintained in Dulbecco's modified
Eagle's medium (Gibco BRL) supplemented with 10% bovine calf serum.
The COS-7 cells were transiently transfected with 5 µg of either
pEF-BOS-mock, pEF-BOS-FLAG-ATF4, pEF-BOS-Myc-ZIP kinase, or a
combination by lipofection as specified by the
manufacturer (TaKaRa). For immunoprecipitation, 106 cells were harvested 36 h after transfection and
lysed in 0.5% Nonidet P-40 lysis buffer (0.5% Nonidet P-40, 150 mM
NaCl, 10 mM Tris HCl [pH 7.5], 1 mM EDTA). Cell lysates were
precleared with protein A-Sepharose beads (Pharmacia) for several hours
and then incubated with protein A-Sepharose together with either 10 µg of anti-FLAG M2 monoclonal antibody (MAb) (Eastman Kodak Co.) per
ml or 4.0 µg of anti-Myc 9E10 MAb (Genosys Biotechnologies) per ml
for 12 h by rotation. The beads were washed four times with lysis
buffer. Immune complexes were eluted with Laemmli sample buffer,
separated on a 4 to 20% polyacrylamide gradient gel, and transferred
onto a nitrocellulose filter membrane. The filter was incubated with
anti-FLAG MAb or anti-Myc MAb for 1 h before being washed three
times in TBS-T (25 mM Tris HCl [pH 7.4], 137 mM NaCl, 2.7 mM KCl,
0.1% Tween 20), and then incubated with sheep anti-mouse
peroxidase-conjugated secondary antibody (Amersham). After further
washing with TBS-T, peroxidase activity was detected with the enhanced
chemiluminescence system (Dupont).
Northern blot analysis.
Murine ZIP kinase cDNA was
radiolabeled by the random-priming method and assayed by mouse
multiple-tissue Northern blotting (Clontech) as specified by the
manufacturer.
In vitro kinase assay.
COS-7 cells transiently transfected
with HA epitope-tagged murine ZIP kinase or ZIP kinase mutants were
lysed with 0.5% Nonidet P-40 lysis buffer. Following preclearing, the
lysates were immunoprecipitated with 5 µg of anti-HA MAb 12CA5
(Boehringer Mannheim) per ml plus protein G-Sepharose beads
(Pharmacia). The immunoprecipitates were washed four times with lysis
buffer and once with kinase reaction buffer (10 mM MgCl2, 3 mM MnCl2, 10 mM Tris HCl [pH 7.2]). The in vitro kinase
reaction was performed for 10 min at 30°C with kinase reaction buffer
containing 10 µCi of [
-32P]ATP (Amersham). Laemmli
sample buffer was added to terminate the kinase reaction, and after
being boiled, the samples were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Phosphorylated
proteins were visualized by autoradiography.
Immunostaining of cells.
Transfected COS-7 cells were seeded
on glass plates at a density of 20,000 cells/ml. After 48 h, the
cells were washed twice with phosphate-buffered saline (PBS) before
being incubated in a mixture of 3% paraformaldehyde and 0.3% Triton
X-100 in PBS for 5 min for simultaneous fixing and permeabilization and
then in 3% paraformaldehyde for 20 min. The cells were washed three times in PBS and blocked with 3% bovine serum albumin in PBS for 60 min. The cells were incubated with anti-FLAG M2 MAb (1:300) for 60 min.
They were then washed three times in PBS and incubated with goat
anti-mouse fluorescein-conjugated secondary antibodies (Tago) and 0.5 µg of 4',6-diamidino-2-phenylindole (DAPI; Wako) per ml for an
additional 30 min. The glass plates were washed three times in PBS and
drained. Microscopy was carried out under fluorescent light.
X-Gal staining of cells.
NIH 3T3 cells were seeded at a
density of 106 cells/100-mm dish in Dulbecco's modified
Eagle's medium supplemented with 10% bovine calf serum. After 12 h, the cells were cotransfected with 9.0 µg of a ZIP kinase
expression vector (pEF-BOS-HA-ZIP kinase, pEF-BOS-HA-ZIP kinase K42A,
or pEF-BOS-HA-ZIP kinase LA) and 1.0 µg of a
-galactosidase
expression vector (pEF-BOS-lacZ) by lipofection. To identify
-galactosidase activity, the cells were washed once with PBS and
fixed with 2.0% formaldehyde plus 0.2% glutaraldehyde in PBS for 5 min at 4°C. After being further washed with PBS, the cells were
overlaid with a histochemical reaction mixture containing 1 mg of
5-chloro-4-bromo-3-indolyl-
-D-galactopyranoside (X-Gal)
per ml, 5 mM K3Fe(CN)6, 5 mM
K4Fe(CN)6, and 2 mM MgCl2 in PBS.
Photographs of stained cells were taken with an Olympus IX70
microscope.
Nucleotide sequence accession number.
The nucleotide
sequence data reported in this paper will appear in the DDBJ, EMBL and
GenBank nucleotide sequence databases with accession no. AB007143
(mouse ZIP kinase) and AB007144 (human ZIP kinase).
 |
RESULTS |
Screening of proteins interacting with ATF4.
To identify
proteins that interact with ATF4, we performed a yeast two-hybrid
screening procedure with the leucine zipper portion of mouse ATF4 fused
to the DNA binding domain of GAL4 as bait (11). We screened
mouse brain and human placenta cDNA libraries that expressed proteins
fused to the GAL4 transcriptional activation domain. From 2 × 106 yeast transformants, we identified about 100 clones
that could activate reporter genes. As expected, most of these clones
encoded bZip transcription factors. These include C/EBP
(NF-IL6),
which is known to associate with ATF4 in mammalian cells (1,
35), C/EBP
, C/EBP
(NF-IL6
), CHOP, JunB, JunD, and ATF3
(15, 16, 28). These results indicate that this bait plasmid
can specifically detect interactions between ATF4 and its
heterodimerizing partners within yeast cells. The yeast two-hybrid
screening also yielded seven cDNA clones from a mouse brain cDNA
library and two from a human placenta cDNA library with novel
nucleotide sequences. These clones contained independent cDNAs derived
from the same mRNA. Full-length cDNA clones were isolated from mouse
liver and human placenta
gt11 libraries. Their nucleotide sequences
and conceptual translations are shown in Fig.
1. The
lengths of the cDNA clones obtained matched those of the mRNAs detected
by Northern blotting, although no preceding in-frame stop codons were
noted. Taken together, these results suggest that these sequences
harbor full-length cDNAs. The mouse ZIP kinase mRNA contains an open reading frame of 1,344 bp and is predicted to encode a protein of 448 aa with a calculated molecular mass of 51.4 kDa (Fig. 1A). On the other
hand, the human ZIP kinase cDNA is 1,362 bp and encodes a protein of
454 aa with a calculated molecular mass of 52.5 kDa (Fig. 1B). In the
3' untranslated region of both ZIP kinases, a typical polyadenylation
signal, AATAAA, is found upstream of the poly(A) tail. A comparison
study reveals 85% identity between mouse and human ZIP kinases at the
amino acid level (Fig. 1C).

View larger version (64K):
[in this window]
[in a new window]

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 1.
(A and B) Nucleotide and deduced amino acid sequences of
murine ZIP kinase (A) and human ZIP kinase (B). Initiation (ATG) and
stop (TGA) codons are boxed. Polyadenylation signals (AATAAA) are
underlined. (C) Comparison of the amino acid sequences of murine and
human ZIP kinases. Identical amino acid residues are indicated by
boxes. The putative kinase domains and the regions of the leucine
zipper domains are indicated.
|
|
ZIP kinase is a serine/threonine kinase and carries the
leucine zipper domain in the C-terminal region.
Comparative
analysis of the deduced amino acid sequences of the murine and human
ZIP kinases revealed that ZIP kinase contained several known domains.
The N-terminal region showed homology to the catalytic domain of
serine/threonine kinases. The domain spans 263 aa from positions 13 to
275 in both mouse and human ZIP kinases (Fig. 1C). Furthermore, this
domain is classically composed of 11 subdomains and contains all of the
residues that are normally conserved in serine/threonine kinases
(18) (Fig. 2).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the catalytic domain of ZIP kinase with
that of DAP kinase. A catalytic domain of the mouse ZIP kinase is
aligned with the corresponding domain of the human ZIP kinase, mouse
DAP kinase, and human DAP kinase. The kinase subdomains numbered I to
XI are indicated. The conserved amino acid residues within the kinase
domain are indicated by asterisks. The solid backgrounds indicate
identical amino acid residues.
|
|
Secondary-structure predictions showed that the C terminus of ZIP
kinase forms an

-helical structure from positions 408 to
445 in the
mouse ZIP kinase and 413 to 450 in human ZIP kinase.
These
portions showed homology to myosin heavy chain, which contains
coiled-coil structures (
6). In addition, these domains
contained
heptad repeats of three hydrophobic amino acid residues with
a
potential leucine zipper. These residues are conserved within
the
mouse and human ZIP kinases (Fig.
1C). Thus, the leucine zipper
structure in the ZIP kinase may be important for interactions
with ATF4
and other leucine zipper proteins or for homodimerization.
Therefore,
we termed this novel serine/threonine kinase zipper-interacting
protein
kinase (ZIP kinase).
A catalytic domain of ZIP kinase is closely related to that of DAP
kinase, which is a mediator of cell death induced by gamma
interferon.
When aligned with sequences from the protein sequence
database by using the BLAST and FASTA programs, the ZIP kinase
catalytic domain showed the highest similarity to that of the recently
cloned death-associated protein kinase (DAP kinase) (9). DAP
kinase was initially identified as the protein encoded by the gene
whose reduced expression by antisense cDNA transfection protected HeLa cells from gamma interferon-induced cell death. A catalytic domain of
mouse ZIP kinase has 79.0% of its amino acid sequence identical to
that of mouse DAP kinase, and human ZIP kinase has 79.5% of its
sequence identical to that of human DAP kinase (Fig. 2). In subdomain
IX, all the residues were identical between ZIP kinase and DAP kinase.
The deduced amino acid structure of DAP kinase predicts several
functional motifs. The N terminus is composed of a serine/threonine
kinase domain followed by a region with homology to the calmodulin
regulatory domains. However, the region immediately C-terminal to the
catalytic domain of ZIP kinase showed no homology to any calmodulin
regulatory proteins. In addition, it is interesting that both genes
have distinct domains in their C-terminal regions. ZIP kinase has a
leucine zipper domain, in contrast to DAP kinase, which contains an
ankyrin repeat motif and a death domain. Both proteins are expected to
dimerize with other proteins through these domains.
The ZIP kinase expression profile was examined by Northern blot
analysis. As shown in Fig.
3, the single
prominent 1.4-kbp
band of mouse ZIP kinase mRNA was detected
ubiquitously in various
tissues, although the level of ZIP kinase mRNA
was lower in spleen.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Expression profile of ZIP kinase mRNA by Northern blot
analysis. Poly(A) RNAs (2 µg) from various murine tissues were loaded
in each lane. The filter was hybridized with the radiolabeled mouse ZIP
kinase probe and exposed to X-ray film. The major transcript of 1.4 kbp
is indicated by an arrow.
|
|
ZIP kinase interacts with ATF4 in vitro and in vivo.
To
confirm that ZIP kinase associates with ATF4 in mammalian cells, COS-7
cells were transiently transfected with expression plasmids for a Myc
epitope-tagged ZIP kinase (Myc-ZIP kinase) and FLAG-tagged ATF4
(FLAG-ATF4). COS-7 cells were lysed, immunoprecipitated with anti-Myc
or anti-FLAG MAb, and blotted with anti-FLAG or anti-Myc MAb. Western
blot analysis with anti-FLAG MAb revealed that FLAG-ATF4 was
coimmunoprecipitated with anti-Myc MAb when the cells were
cotransfected with FLAG-ATF4 and Myc-ZIP kinase expression vectors
(Fig. 4). To verify the interaction
further, we carried out reciprocal experiments. The results of an
immunoblotting study with anti-Myc MAb indicate that Myc-ZIP kinase was
also coimmunoprecipitated with anti-FLAG MAb.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
ZIP kinase interacts with ATF4 in mammalian cells. COS-7
cells were transiently transfected with 5 µg of the plasmids
indicated. The cells were harvested 36 h after transfection and
lysed in the lysis buffer. Whole-cell extracts (WCE) were separated by
SDS-PAGE and then immunoblotted with anti-FLAG M2 MAb (lanes 1 through
3) or anti-Myc 9E10 MAb (lanes 7 through 9). The same lysates were
immunoprecipitated with either anti-Myc MAb or anti-FLAG MAb, and the
immunoprecipitates were blotted with either anti-FLAG MAb (lane 4 through 6) or anti-Myc MAb (lanes 10 through 12). The bands
corresponding to Myc-ZIP kinase and FLAG-ATF4 proteins are indicated by
arrows.
|
|
To determine which portions of the ZIP kinase are necessary for
interaction with ATF4, we determined the ability of ATF4 to
interact
with several ZIP kinase mutants in the two-hybrid system.
As shown in
Fig.
5, ATF4 interacts with the leucine
zipper domain
of ZIP kinase (ZIP kinase LZ), but not when there are
mutations
within this domain (ZIP kinase LA, in which valine 422, valine
429, and leucine 436 are changed to alanines). These results
demonstrate
that ZIP kinase interacts with ATF4 in vivo via its leucine
zipper
domain.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
ZIP kinase and ATF4 interact via their leucine zippers.
The C-terminal region (mouse ZIP kinase 278-448), the leucine zipper
domain (ZIP kinase LZ), and the mutant with substitutions in the
leucine zipper domain (ZIP kinase LA) were constructed in pACT2 to
express the fusion protein with the GAL4 transactivation domain. Each
construct was cotransformed into yeast Y190 cells with a plasmid
expressing the leucine zipper domain of ATF4 fused to the GAL4 DNA
binding domain. Growth of yeast on a synthetic dextrose agar plate
lacking leucine, tryptophan, and histidine (His ) is
indicative of a protein-protein interaction, while growth in the
absence of leucine and tryptophan (His+) indicates a
control.
|
|
The leucine zipper domain is required for self-association of ZIP
kinase.
The C-terminal region of ZIP kinase contains a leucine
zipper motif which mediates protein-protein interactions. The yeast two-hybrid assay was used to investigate whether ZIP kinase can self-associate through the C-terminal regions. The reporter genes were
activated when the ZIP kinase leucine zipper bait was expressed together with the ZIP kinase leucine zipper domain. On the other hand,
the ZIP kinase LA mutant construct could not activate the reporter
genes when cotransformed with the ZIP kinase leucine zipper bait
plasmid (Fig. 6). Taken together, these
results demonstrate that ZIP kinase can self-associate and that this
ability is dependent on the intact structure of the leucine zipper
motif.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
Leucine zipper-mediated self-association of ZIP kinase.
A plasmid expressing the leucine zipper domain of murine ZIP kinase
fused to the GAL4 DNA binding domain was cotransformed with a plasmid
expressing either the ZIP kinase LZ or ZIP kinase LA mutant fused to
the GAL4 transactivation domain. Growth in the absence of leucine,
tryptophan, and histidine (His ) is indicative of the
interaction, while growth in the absence of leucine and tryptophan
(His+) indicates a control.
|
|
An in vitro kinase assay confirmed that ZIP kinase possesses a
kinase activity.
To begin to assess the biochemical functions and
regulation of ZIP kinase, we developed an in vitro kinase assay. To
express ZIP kinase, an expression vector for an HA-tagged ZIP kinase
cloned into pEF-BOS was prepared. Two versions of ZIP kinase mutants were also prepared in this assay. The ZIP kinase K42A mutant carried a
mutation in which a conserved lysine in the kinase subdomain II was
changed to alanine. A point mutation of this portion in a number of
kinases was shown to block the phosphotransfer reaction, giving rise to
a catalytically inactive protein kinase (18). Another mutant
version, a ZIP kinase LA mutant, had valine 422, valine 429, and
leucine 436 changed to alanines in the leucine zipper domain, which
would result in the loss of homodimerization. All the constructs were
transiently transfected into COS-7 cells by lipofection. Lysates of the
transfected cells were immunoprecipitated with anti-HA MAb and
subjected to an in vitro kinase reaction in the presence of
Mg2+ and Mn2+. A single prominent band at the
expected size of 52 kDa was detected by SDS-PAGE only in the cell
lysate transfected with the wild-type ZIP kinase (Fig.
7, upper panel). In contrast,
phosphorylation of the ZIP kinase K42A mutant was not detected, and the
in vitro kinase activity of the ZIP kinase LA mutant was dramatically
decreased compared with that of wild-type ZIP kinase. These results
indicate that ZIP kinase displays an intrinsic kinase activity,
undergoes autophosphorylation, and acts as an active kinase when it
homodimerizes through its leucine zipper structure. The amounts of
protein loaded were determined by Western blot analysis with anti-HA
MAb (Fig. 7, lower panel).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 7.
Kinase activity of ZIP kinase. HA-tagged ZIP kinase and
its mutants were transiently transfected into COS-7 cells. Cell lysates
were immunoprecipitated with anti-HA MAb (12CA5) and assayed for in
vitro kinase activity. The upper panel shows the autophosphorylation of
ZIP kinase. Relative molecular mass standards are indicated on the
left. The amounts of HA-ZIP kinase and mutant proteins were shown to be
the same by Western blotting with anti-HA MAb (lower panel).
|
|
ZIP kinase is localized to the nuclei.
To define the
subcellular localization of ZIP kinase, we transiently transfected the
FLAG-tagged ZIP kinase K42A mutant expression vector into COS-7 cells.
The ZIP kinase K42A construct was chosen to avoid morphological changes
of the cells. Transfected COS-7 cells were double stained with
anti-FLAG M2 MAb (for ZIP kinase) and DAPI (for nuclei). Subsequent
microscopy analysis demonstrated that the FLAG-ZIP kinase K42A protein
was localized exclusively to the nucleus (Fig.
8, K42A). Furthermore, we also tested the cellular localization of two deletion mutants and found that the deletion mutant lacking the leucine zipper domain (ZIP kinase K42A aa 1 to 397), which is not able to form the homodimer, was localized to the
nuclei, as in the case of full-length ZIP kinase (Fig. 8,
LZ).
Furthermore, the nuclear localization was also detected in cells which
expressed only the kinase domain (ZIP kinase K42A aa 1 to 275),
suggesting that the kinase domain is sufficient to direct the nuclear
localization in cells (Fig. 8, KD). These results demonstrate that ZIP
kinase is a nuclear serine/threonine kinase and that catalytic activity
or leucine zipper-mediated homodimerization is not required for nuclear
localization.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 8.
Cellular localization of ZIP kinase. COS-7 cells
transiently transfected with the indicated FLAG-tagged ZIP kinase
mutant plasmids were indirectly immunostained with anti-FLAG MAb and
fluorescein-conjugated secondary antibody and simultaneously stained
with DAPI to locate the nucleus. LZ, mouse ZIP-kinase K42A aa 1 to
397; KD, ZIP kinase K42A aa 1 to 275.
|
|
Ectopic expression of ZIP kinase induces cell death in the NIH 3T3
line.
DAP kinase was first identified as a positive mediator of
cell death. This was based on the findings that the reduced expression of DAP kinase by antisense mRNA protected HeLa cells from apoptotic cell death induced by gamma interferon (9) and that an
elevated level of DAP kinase expression induced the death of HeLa cells without external stimuli (8). For this reason, it was very interesting to examine whether ectopic expression of ZIP kinase directly causes cell death. To express ZIP kinase in mammalian cells,
we prepared expression vectors for the HA epitope-tagged wild-type ZIP
kinase (HA-ZIP kinase), the catalytically inactive form of ZIP kinase
(HA-ZIP kinase K42A), and the mutant with alterations in the leucine
zipper domain so that it was not able to self-associate (HA-ZIP kinase
LA). NIH 3T3 fibroblasts were transiently cotransfected with each ZIP
kinase construct and a plasmid containing the
-galactosidase gene
(pEF-BOS-lacZ). Transfected cells were identified by histochemical staining with an X-Gal solution. As shown in Fig.
9A, it
was found that the blue-stained cells transfected with wild-type ZIP
kinase exhibited the morphological changes of apoptotic cells, as
characterized by their shrunken appearance, condensed chromatin, and
membrane blebbing (44.9% of blue cells [Fig. 9B]). By contrast, a
background level of 3.7% apoptotic cells was detected in the mock
plasmid-transfected control. This indicates that ZIP kinase positively
regulates apoptotic cell death. The transfectants with the ZIP kinase
K42A mutant displayed mainly normal-appearing cells, and the number of
apoptotic cells was almost the same (1.0%) as that of the mock
transfectants. This result suggests that the catalytic activity of ZIP
kinase is required for its ability to mediate apoptotic cell death.
Furthermore, the number of apoptotic cells (17.8% of blue cells) was
slightly decreased when NIH 3T3 cells were transfected with the ZIP
kinase LA mutant plasmid, indicating that the leucine zipper-mediated homodimerization of ZIP kinase was required for the induction of
apoptosis. These results strongly suggest that the catalytic activity
of ZIP kinase correlates with the induction of cell death.

View larger version (131K):
[in this window]
[in a new window]

View larger version (19K):
[in this window]
[in a new window]

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 9.
Ectopic expression of ZIP kinase causes the
morphological changes of apoptotic cell death in NIH 3T3 cells. (A) An
expression plasmid of ZIP kinase or ZIP kinase mutants was transiently
cotransfected together with a plasmid expressing the -galactosidase
gene into NIH 3T3 cells. After 36 h of transfection, the cells
were stained with a X-Gal solution to visualize the cells expressing
the -galactosidase gene. Cells with the apoptotic phenotype are
indicated by the arrows. (B) Quantitative representation of ZIP
kinase-induced cell death in NIH 3T3 cells. The data presented shows
the percentage of blue-stained cells with the apoptotic phenotype
relative to the total number of blue cells counted. The results are
from three independent experiments. (C) NIH 3T3 cells transiently
transfected with wild-type FLAG-ZIP kinase were doubly stained with
anti-FLAG MAb and DAPI 48 h after transfection. The nuclei of
transfected cells were significantly condensed (arrow).
|
|
To investigate the nuclear morphology of cells expressing wild-type ZIP
kinase, we doubly stained the cells with anti-FLAG
MAb (for ZIP kinase)
and DAPI (for nuclei). As seen in Fig.
9C,
the nuclei of cells
transiently transfected with active ZIP kinase
were significantly
condensed compared with those of nontransfected
cells, indicating the
apoptotic changes in the nuclei.
 |
DISCUSSION |
The known function of the leucine zipper domain is to mediate
homodimerization or heterodimerization with other proteins containing this domain. We performed a yeast two-hybrid screening assay with the
leucine zipper domain of ATF4, a member of the ATF/CREB family, to
identify novel ATF-interacting proteins. Here we report the cloning and
characterization of a novel leucine zipper protein, ZIP kinase, that is
a regulator of cell death. ZIP kinase is composed of a C-terminal
leucine zipper domain and an N-terminal catalytic domain of
serine/threonine protein kinase. Mutation studies indicate that an
intact leucine zipper structure is required for homodimerization or
heterodimerization with ATF4. An in vitro kinase assay shows that ZIP
kinase has an intrinsic kinase activity. This catalytic activity is
abolished by a point mutation in which a critical lysine residue in
subdomain II is changed to alanine. Moreover, the activity is also
abolished by mutations within the leucine zipper domain, indicating
that leucine zipper-mediated homodimerization is necessary for
activation of the kinase. We have found that ectopic expression of ZIP
kinase induces the morphological changes of apoptosis in NIH 3T3 cells.
This indicates that the function of this gene is linked to cell death.
The kinase-negative ZIP kinase mutant with substitutions in the
catalytic domain does not promote cell death, indicating that the
catalytic activity is critical for the induction of cell death.
Interestingly, the catalytic domain of ZIP kinase is closely related to
that of the recently identified DAP kinase (9). DAP kinase
was initially identified as being encoded by a gene whose reduced
expression, mediated by antisense cDNA transfection, protects HeLa
cells from gamma interferon-induced cell death. Overexpression of DAP
kinase induces apoptosis in HeLa cells, while the kinase-negative
mutant protects HeLa cells from gamma interferon-induced cell death
(8). Thus, both ZIP kinase and DAP kinase represent a novel
class of cell death-related kinases. Although both kinases are closely related in their catalytic domains, other regions are distinct and do
not share any amino acid homology. DAP kinase is a
Ca2+/calmodulin-dependent serine/threonine protein kinase
and possesses two known major domains characterized by eight ankyrin
repeats and a death domain but lacks the leucine zipper domain. The
domains may mediate the interaction with putative effector molecules or downstream substrates. Although ZIP kinase homodimerizes, it is not
known whether DAP kinase can self-associate through its own ankyrin
repeats or its death domain. In addition, these kinases differ in their
patterns of intracellular localization. ZIP kinase localizes in the
nuclei, suggesting that nuclear proteins are the potential downstream
substrates. In contrast, DAP kinase associates tightly with
cytoskeletal elements. These results suggest that they play distinct
roles in the regulation of apoptosis in vivo and associate with
distinct downstream substrates or regulators. Regarding the nuclear
localization of ZIP kinase, it is noteworthy that there is a stretch of
basic residues in subdomain II of ZIP kinase which was conserved
between ZIP kinase and DAP kinase. In fact, a deletion mutant lacking
the C-terminal region of ZIP kinase was localized to the nucleus.
Furthermore, deletion studies of DAP kinase demonstrated that the
N-terminal kinase domain, but not the full-length kinase, was localized
exclusively to the nuclei (8). It is likely that the highly
conserved sequences in subdomain II are sufficient for the nuclear
localization, although further mutagenesis experiments are required for
confirmation.
Although there are many kinases which mediate cell growth, only a few
protein kinases related to apoptosis, besides DAP and ZIP kinase, have
been identified. Recently, JNKs were shown to be involved in apoptosis.
Apoptotic stimuli such as TNF-
, Fas, ceramide, and UV irradiation
activate JNKs (36). Expression of the molecular inhibitor of
the JNK pathway could block apoptosis (36, 38). A major
substrate of JNK, c-Jun, promotes apoptosis of NIH 3T3 cells
(5). ASK1 is also a protein kinase involved in apoptosis
(20). ASK1 was identified as a member of the
mitogen-activated protein kinase kinase kinase (MAPKKK) family that
activated two distinct signals involved in SEK1-JNK and
MKK3/MAPKK6-p38 pathways. Inducible expression of ASK1 by
stable transfection with metallothionein promoter-based expression
plasmids induced apoptotic cell death. Moreover, ASK1 was activated
by proinflammatory cytokines such as TNF-
, and a catalytically
inactive form of ASK1 prevented TNF-
-induced cell death.
A major challenge for the future is to clarify the signaling pathway
mediated by ZIP kinase, i.e., to identify the specific substrates for
ZIP kinase which are phosphorylated during cell death as well as the
signaling molecules upstream of ZIP kinase. Furthermore, considering
that ZIP kinase homodimerizes to be activated, it is necessary to
understand how formation of the homodimer might be controlled. One
hypothesis is that the ZIP kinase normally interacts with a
regulator(s) that interferes with the homodimerization. The inhibitory
action of the regulator(s) may be blocked by events such as ligand
binding, phosphorylation of a certain residue(s), or cleavage by a
protease. ATF4 may be one of the candidates that participates in the
negative regulation of ZIP kinase, since ATF4 binds to the leucine
zipper domain of ZIP kinase and may interfere with the homodimerization
of the kinase. In fact, both proteins colocalize to the nucleus.
Cotransfection of the expression vectors for these proteins, along with
the neomycin resistance gene, showed that ATF4 expression increased the
number of neomycin-resistant colonies, suggesting that ATF4 blocks the
apoptotic activity mediated by ZIP kinase (unpublished data). However,
we do not have any direct evidence indicating that ATF4 is a
physiological inhibitor of ZIP kinase in vivo.
It has been implied that tumorigenesis is controlled by the mutations
of death-controlling genes such as bcl-2 and p53
(23, 34, 37). Furthermore, deregulated c-Myc can induce
apoptosis in certain cancer cell lines (4, 12). Further
expression studies in different cancer cell lines and chromosomal
mapping of ZIP kinase should be performed to investigate its possible role in tumorigenesis. With a view to the role of ZIP kinase in the
regulation of apoptosis, it seems important to design drugs that can
activate ZIP kinase, since such drugs could be used for cancer therapy
by inducing apoptosis of cancer cells.
 |
ACKNOWLEDGMENTS |
We thank Kin-ichi Nakashima for various suggestions and K. Ohgishi and T. Aoki for excellent secretarial assistance.
This work was supported by CREST (Core Research for Evolutional Science
and Technology) of Japan Science and Technology Corporation (JST) and
grants from the Ministry of Education of Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663, Japan. Phone: 81-798-45-6357. Fax: 81-798-46-3164. E-mail:
akira{at}hyo-med.ac.jp.
 |
REFERENCES |
| 1.
|
Akira, S.,
H. Issiki,
T. Sugita,
O. Tanabe,
S. Kinoshita,
Y. Nishio,
T. Nakajima,
T. Hirano, and T. Kishimoto.
1990.
A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family.
EMBO J.
9:1897-1906[Medline].
|
| 2.
|
Alnemri, E. S.,
D. J. Livingston,
D. W. Nicholson,
G. Salvesen,
N. A. Thornberry,
W. W. Wong, and J. Yuan.
1996.
Human ICE/CED-3 protease nomenclature.
Cell
87:171[Medline].
|
| 3.
|
Anderson, P.
1997.
Kinase cascades regulating entry into apoptosis.
Microbiol. Mol. Biol. Rev.
61:33-46.
[Abstract] |
| 4.
|
Askew, D.,
R. Ashmun,
B. Simmons, and J. Cleveland.
1991.
Constitutive c-myc expression in an IL-3-dependent myeloid cell line supresses cell cycle arrest and accelerates apoptosis.
Oncogene
6:1915-1922[Medline].
|
| 5.
|
Bossy-Wetzel, E.,
L. Bakiri, and M. Yaniv.
1997.
Induction of apoptosis by the transcription factor c-Jun.
EMBO J.
16:1695-1709[Medline].
|
| 6.
|
Cohen, C., and D. A. D. Parry.
1986.
-helical coiled-coils: a wide-spread motif in proteins.
Trends Biochem. Sci.
11:245-248.
|
| 7.
|
Cohen, J. J.,
R. C. Duke,
V. A. Fadok, and K. S. Sellins.
1992.
Apoptosis and programmed cell death in immunity.
Annu. Rev. Immunol.
10:267-293[Medline].
|
| 8.
|
Cohen, O.,
E. Feinstein, and A. Kimchi.
1997.
DAP-kinase is a Ca2+/calmodulin-dependent, cytoskeletal-associated protein kinase, with cell death-inducing functions that depend on its catalytic activity.
EMBO J.
16:998-1008[Medline].
|
| 9.
|
Deiss, L. P.,
E. Feinstein,
H. Berissi,
O. Cohen, and A. Kimchi.
1995.
Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the interferon-induced cell death.
Genes Dev.
9:15-30[Abstract/Free Full Text].
|
| 10.
|
Derijard, B.,
M. Hibi,
I. H. Wu,
T. Barrett,
B. Su,
T. Deng,
M. Karin, and R. J. Davis.
1994.
JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain.
Cell
76:1025-1037[Medline].
|
| 11.
|
Durfee, T.,
K. Becherer,
P. L. Chen,
S. H. Yeh,
Y. Yang,
A. E. Kilburn,
W. H. Lee, and S. J. Elledge.
1993.
The retinoblastoma protein associates with the protein phosphatase type I catalytic subunit.
Genes Dev.
7:555-569[Abstract/Free Full Text].
|
| 12.
|
Evan, G. I.,
A. H. Wyllie,
C. S. Gilbert,
T. D. Littlewood,
H. Land,
M. Brooks,
C. M. Waters,
L. Z. Penn, and D. C. Hancock.
1992.
Induction of apoptosis in fibroblasts by c-myc protein.
Cell
69:119-128[Medline].
|
| 13.
|
Goillot, E.,
J. Raingeaud,
A. Ranger,
R. I. Tepper,
R. J. Davis,
E. Harlow, and I. Sanchez.
1997.
Mitogen-activated protein kinase-mediated Fas apoptotic signaling pathway.
Proc. Natl. Acad. Sci. USA
94:3302-3307[Abstract/Free Full Text].
|
| 14.
|
Gulbins, E. R.,
R. Bissonnette,
A. Mahboubi,
S. Martin,
W. Nishioka,
T. Brunner,
G. Baier,
G. Baier-Bitterlich,
C. Byrd,
F. Lang,
R. Kolesnick,
A. Altman, and D. Green.
1995.
Fas-induced apoptosis is mediated via a ceramide-initiated Ras signaling pathway.
Immunity
2:341-351[Medline].
|
| 15.
|
Hai, T.,
F. Liu,
W. J. Coukos, and M. R. Green.
1989.
Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers.
Genes Dev.
3:2083-2090[Abstract/Free Full Text].
|
| 16.
|
Hai, T., and T. Curran.
1991.
Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity.
Proc. Natl. Acad. Sci. USA
88:3720-3724[Abstract/Free Full Text].
|
| 17.
|
Haimovitz-Friedman, A.,
C. C. Kan,
D. Ehleiter,
R. S. Persaud,
M. McLoughlin,
Z. Fuks, and R. N. Kolensnick.
1994.
Ionizing radiation acts on cellular membranes to generate ceramide and initiate apoptosis.
J. Exp. Med.
180:525-535[Abstract/Free Full Text].
|
| 18.
|
Hanks, S. K., and A. M. Quinn.
1991.
Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members.
Methods Enzymol.
200:38-62[Medline].
|
| 19.
|
Hibi, M.,
A. Lin,
T. Smeal,
A. Minden, and M. Karin.
1993.
Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain.
Genes Dev.
7:2135-2148[Abstract/Free Full Text].
|
| 20.
|
Ichijo, H.,
E. Nishida,
K. Irie,
P. T. Dijke,
M. Saitoh,
T. Moriguchi,
M. Takagi,
K. Matsumoto,
K. Miyazono, and Y. Gotoh.
1997.
Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways.
Science
275:90-94[Abstract/Free Full Text].
|
| 21.
|
Kerr, J. F. R.,
A. H. Wyllie, and A. R. Currie.
1972.
Apoptosis: a basic biological phenomenon with ranging implications in tissue kinetics.
Br. J. Cancer
26:239-257[Medline].
|
| 22.
|
Lee, S.,
S. Christakos, and M. B. Small.
1993.
Apoptosis and signal transduction: clues to molecular mechanism.
Curr. Opin. Cell Biol.
5:286-291[Medline].
|
| 23.
|
Lowe, S. W.,
E. M. Schmitt,
S. W. Smith,
B. A. Osborne, and T. Jacks.
1993.
p53 is required for radiation induced apoptosis in mouse thymocytes.
Nature
362:847-849[Medline].
|
| 24.
|
Mizushima, S., and S. Nagata.
1990.
pEF-BOS, a powerful mammalian expression vector.
Nucleic Acids Res.
18:5322[Free Full Text].
|
| 25.
|
Nagata, S.
1997.
Apoptosis by death factor.
Cell
88:355-365[Medline].
|
| 26.
|
Nicholson, D. W., and N. A. Thornberry.
1997.
Caspases: killer proteases.
Trends Biochem. Sci.
22:299-306[Medline].
|
| 27.
|
Raff, M. C.,
B. A. Barres,
J. F. Burne,
H. S. Coles,
Y. Ishizaki, and M. D. Jacobson.
1993.
Programmed cell death and the control of cell survival: lessons from the nervous system.
Science
262:695-700[Abstract/Free Full Text].
|
| 28.
|
Ron, D., and J. F. Habener.
1992.
CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription.
Genes Dev.
6:439-453[Abstract/Free Full Text].
|
| 29.
|
Stanger, B. Z.,
P. Leder,
T.-H. Lee,
E. Kim, and B. Seed.
1995.
RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death.
Cell
81:513-523[Medline].
|
| 30.
|
Steller, H.
1995.
Mechanisms and genes of cellular suicide.
Science
267:1445-1449[Abstract/Free Full Text].
|
| 31.
|
Tepper, C. G.,
S. Jayadev,
B. Liu,
A. Bielawska,
R. Wolff,
S. Yonehara,
Y. A. Hannun, and M. F. Seldin.
1995.
Role for ceramide as an endogenous mediator of Fas-induced cytotoxicity.
Proc. Natl. Acad. Sci. USA
92:8443-8447[Abstract/Free Full Text].
|
| 32.
|
Thompson, C. B.
1995.
Apoptosis in the pathogenesis and treatment of disease.
Science
267:1456-1462[Abstract/Free Full Text].
|
| 33.
|
Tsujimoto, A.,
H. Nyunoya,
T. Morita,
T. Sato, and K. Shimotohno.
1991.
Isolation of cDNAs for DNA-binding proteins which specifically bind to a tax-responsive enhancer element in the long terminal repeat of human T-cell leukemia virus type I.
J. Virol.
65:1420-1426[Abstract/Free Full Text].
|
| 34.
|
Tsujimoto, Y.,
J. Cossman,
E. Jaffe, and C. M. Croce.
1985.
Involvement of bcl-2 in human follicular lymphoma.
Science
228:1440-1443[Abstract/Free Full Text].
|
| 35.
|
Vallejo, M.,
D. Ron,
C. P. Miller, and J. F. Habener.
1993.
C/ATF, a member of the activating transcription factor family of DNA-binding proteins, dimerizes with CAAT/enhancer-binding proteins and directs their binding to cAMP response elements.
Proc. Natl. Acad. Sci. USA
90:4679-4683[Abstract/Free Full Text].
|
| 36.
|
Verheij, M.,
R. Bose,
X. H. Lin,
B. Yao,
W. D. Jarvis,
S. Grant,
M. J. Birrer,
E. Szabo,
L. I. Zon,
J. M. Kyriakis,
A. Haimovitz-Freidman,
Z. Fuks, and R. N. Kolesnick.
1996.
Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis.
Nature
380:75-79[Medline].
|
| 37.
|
White, E.
1996.
Life, death and the pursuit of apoptosis.
Genes Dev.
10:1-15[Free Full Text].
|
| 38.
|
Xia, Z.,
M. Dickens,
J. Raingeaud,
R. J. Davis, and M. E. Greenberg.
1995.
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
|
| 39.
|
Yang, X.,
R. Khosravi-Far,
H. Y. Chang, and D. Baltimore.
1997.
Daxx, a novel Fas-binding protein that activates JNK and apoptosis.
Cell
89:1067-1076[Medline].
|
| 40.
|
Yuan, J.,
L. Shaham,
S. Ledoux,
H. M. Ellis, and H. R. Horvitz.
1993.
The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 -converting enzyme.
Cell
75:641-652[Medline].
|
Mol Cell Biol, March 1998, p. 1642-1651, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Boosen, M., Vetterkind, S., Kubicek, J., Scheidtmann, K.-H., Illenberger, S., Preuss, U.
(2009). Par-4 Is an Essential Downstream Target of DAP-like Kinase (Dlk) in Dlk/Par-4-mediated Apoptosis. Mol. Biol. Cell
20: 4010-4020
[Abstract]
[Full Text]
-
Mao, J., Luo, H., Han, B., Bertrand, R., Wu, J.
(2009). Drak2 Is Upstream of p70S6 Kinase: Its Implication in Cytokine-Induced Islet Apoptosis, Diabetes, and Islet Transplantation. J. Immunol.
182: 4762-4770
[Abstract]
[Full Text]
-
Ramos, S. J., Hernandez, J. B., Gatzka, M., Walsh, C. M.
(2008). Enhanced T Cell Apoptosis within Drak2-Deficient Mice Promotes Resistance to Autoimmunity. J. Immunol.
181: 7606-7616
[Abstract]
[Full Text]
-
Houle, F., Poirier, A., Dumaresq, J., Huot, J.
(2007). DAP kinase mediates the phosphorylation of tropomyosin-1 downstream of the ERK pathway, which regulates the formation of stress fibers in response to oxidative stress. J. Cell Sci.
120: 3666-3677
[Abstract]
[Full Text]
-
Rizzi, M., Tschan, M. P., Britschgi, C., Britschgi, A., Hugli, B., Grob, T. J., Leupin, N., Mueller, B. U., Simon, H.-U., Ziemiecki, A., Torbett, B. E., Fey, M. F., Tobler, A.
(2007). The death-associated protein kinase 2 is up-regulated during normal myeloid differentiation and enhances neutrophil maturation in myeloid leukemic cells. J. Leukoc. Biol.
81: 1599-1608
[Abstract]
[Full Text]
-
Ihara, E., Edwards, E., Borman, M. A., Wilson, D. P., Walsh, M. P., MacDonald, J. A.
(2007). Inhibition of zipper-interacting protein kinase function in smooth muscle by a myosin light chain kinase pseudosubstrate peptide. Am. J. Physiol. Cell Physiol.
292: C1951-C1959
[Abstract]
[Full Text]
-
Versteeg, G. A., Slobodskaya, O., Spaan, W. J. M.
(2006). Transcriptional profiling of acute cytopathic murine hepatitis virus infection in fibroblast-like cells. J. Gen. Virol.
87: 1961-1975
[Abstract]
[Full Text]
-
Mao, J., Qiao, X., Luo, H., Wu, J.
(2006). Transgenic Drak2 Overexpression in Mice Leads to Increased T Cell Apoptosis and Compromised Memory T Cell Development. J. Biol. Chem.
281: 12587-12595
[Abstract]
[Full Text]
-
Sato, N., Kawai, T., Sugiyama, K., Muromoto, R., Imoto, S., Sekine, Y., Ishida, M., Akira, S., Matsuda, T.
(2005). Physical and functional interactions between STAT3 and ZIP kinase. Int Immunol
17: 1543-1552
[Abstract]
[Full Text]
-
Friedrich, M. L., Wen, B. G., Bain, G., Kee, B. L., Katayama, C., Murre, C., Hedrick, S. M., Walsh, C. M.
(2005). DRAK2, a lymphoid-enriched DAP kinase, regulates the TCR activation threshold during thymocyte selection. Int Immunol
17: 1379-1390
[Abstract]
[Full Text]
-
Graves, P. R., Winkfield, K. M., Haystead, T. A. J.
(2005). Regulation of Zipper-interacting Protein Kinase Activity in Vitro and in Vivo by Multisite Phosphorylation. J. Biol. Chem.
280: 9363-9374
[Abstract]
[Full Text]
-
Shani, G., Marash, L., Gozuacik, D., Bialik, S., Teitelbaum, L., Shohat, G., Kimchi, A.
(2004). Death-Associated Protein Kinase Phosphorylates ZIP Kinase, Forming a Unique Kinase Hierarchy To Activate Its Cell Death Functions. Mol. Cell. Biol.
24: 8611-8626
[Abstract]
[Full Text]
-
Endo, A., Surks, H. K., Mochizuki, S., Mochizuki, N., Mendelsohn, M. E.
(2004). Identification and Characterization of Zipper-interacting Protein Kinase as the Unique Vascular Smooth Muscle Myosin Phosphatase-associated Kinase. J. Biol. Chem.
279: 42055-42061
[Abstract]
[Full Text]
-
Komatsu, S., Ikebe, M.
(2004). ZIP kinase is responsible for the phosphorylation of myosin II and necessary for cell motility in mammalian fibroblasts. JCB
165: 243-254
[Abstract]
[Full Text]
-
Kuo, J.-C., Lin, J.-R., Staddon, J. M., Hosoya, H., Chen, R.-H.
(2003). Uncoordinated regulation of stress fibers and focal adhesions by DAP kinase. J. Cell Sci.
116: 4777-4790
[Abstract]
[Full Text]
-
Kawai, T., Akira, S., Reed, J. C.
(2003). ZIP Kinase Triggers Apoptosis from Nuclear PML Oncogenic Domains. Mol. Cell. Biol.
23: 6174-6186
[Abstract]
[Full Text]
-
Albayrak, T., Scherhammer, V., Schoenfeld, N., Braziulis, E., Mund, T., Bauer, M. K.A., Scheffler, I. E., Grimm, S.
(2003). The Tumor Suppressor cybL, a Component of the Respiratory Chain, Mediates Apoptosis Induction. Mol. Biol. Cell
14: 3082-3096
[Abstract]
[Full Text]
-
Medley, Q. G., Buchbinder, E. G., Tachibana, K., Ngo, H., Serra-Pages, C., Streuli, M.
(2003). Signaling between Focal Adhesion Kinase and Trio. J. Biol. Chem.
278: 13265-13270
[Abstract]
[Full Text]
-
PETRACHE, I., BIRUKOV, K., ZAIMAN, A. L., CROW, M. T., DENG, H., WADGAONKAR, R., ROMER, L. H., GARCIA, J. G. N.
(2003). Caspase-dependent cleavage of myosin light chain kinase (MLCK) is involved in TNF-{alpha}-mediated bovine pulmonary endothelial cell apoptosis. FASEB J.
17: 407-416
[Abstract]
[Full Text]
-
Preuss, U., Landsberg, G., Scheidtmann, K. H.
(2003). Novel mitosis-specific phosphorylation of histone H3 at Thr11 mediated by Dlk/ZIP kinase. Nucleic Acids Res
31: 878-885
[Abstract]
[Full Text]
-
Wittig, R., Nessling, M., Will, R. D., Mollenhauer, J., Salowsky, R., Munstermann, E., Schick, M., Helmbach, H., Gschwendt, B., Korn, B., Kioschis, P., Lichter, P., Schadendorf, D., Poustka, A.
(2002). Candidate Genes for Cross-Resistance against DNA-damaging Drugs. Cancer Res.
62: 6698-6705
[Abstract]
[Full Text]
-
Wang, W.-J., Kuo, J.-C., Yao, C.-C., Chen, R.-H.
(2002). DAP-kinase induces apoptosis by suppressing integrin activity and disrupting matrix survival signals. JCB
159: 169-179
[Abstract]
[Full Text]
-
Borman, M. A., MacDonald, J. A., Muranyi, A., Hartshorne, D. J., Haystead, T. A. J.
(2002). Smooth Muscle Myosin Phosphatase-associated Kinase Induces Ca2+ Sensitization via Myosin Phosphatase Inhibition. J. Biol. Chem.
277: 23441-23446
[Abstract]
[Full Text]
-
Engemann, H., Heinzel, V., Page, G., Preuss, U., Scheidtmann, K. H.
(2002). DAP-like kinase interacts with the rat homolog of Schizosaccharomyces pombe CDC5 protein, a factor involved in pre-mRNA splicing and required for G2/M phase transition. Nucleic Acids Res
30: 1408-1417
[Abstract]
[Full Text]
-
Jin, Y., Blue, E. K., Dixon, S., Hou, L., Wysolmerski, R. B., Gallagher, P. J
(2001). Identification of a New Form of Death-associated Protein Kinase That Promotes Cell Survival. J. Biol. Chem.
276: 39667-39678
[Abstract]
[Full Text]
-
Velentza, A. V., Schumacher, A. M., Weiss, C., Egli, M., Watterson, D. M.
(2001). A Protein Kinase Associated with Apoptosis and Tumor Suppression. STRUCTURE, ACTIVITY, AND DISCOVERY OF PEPTIDE SUBSTRATES. J. Biol. Chem.
276: 38956-38965
[Abstract]
[Full Text]
-
Petrache, I., Verin, A. D., Crow, M. T., Birukova, A., Liu, F., Garcia, J. G. N.
(2001). Differential effect of MLC kinase in TNF-{alpha}-induced endothelial cell apoptosis and barrier dysfunction. Am. J. Physiol. Lung Cell. Mol. Physiol.
280: L1168-L1178
[Abstract]
[Full Text]
-
Lassot, I., Ségéral, E., Berlioz-Torrent, C., Durand, H., Groussin, L., Hai, T., Benarous, R., Margottin-Goguet, F.
(2001). ATF4 Degradation Relies on a Phosphorylation-Dependent Interaction with the SCF{beta}TrCP Ubiquitin Ligase. Mol. Cell. Biol.
21: 2192-2202
[Abstract]
[Full Text]
-
MacDonald, J. A., Borman, M. A., Muranyi, A., Somlyo, A. V., Hartshorne, D. J., Haystead, T. A. J.
(2001). Identification of the endogenous smooth muscle myosin phosphatase-associated kinase. Proc. Natl. Acad. Sci. USA
98: 2419-2424
[Abstract]
[Full Text]
-
Hewes, R. S., Schaefer, A. M., Taghert, P. H.
(2000). The cryptocephal Gene (ATF4) Encodes Multiple Basic-Leucine Zipper Proteins Controlling Molting and Metamorphosis in Drosophila. Genetics
155: 1711-1723
[Abstract]
[Full Text]
-
Gachon, F., Thebault, S., Peleraux, A., Devaux, C., Mesnard, J.-M.
(2000). Molecular Interactions Involved in the Transactivation of the Human T-Cell Leukemia Virus Type 1 Promoter Mediated by Tax and CREB-2 (ATF-4). Mol. Cell. Biol.
20: 3470-3481
[Abstract]
[Full Text]
-
Inbal, B., Shani, G., Cohen, O., Kissil, J. L., Kimchi, A.
(2000). Death-Associated Protein Kinase-Related Protein 1, a Novel Serine/Threonine Kinase Involved in Apoptosis. Mol. Cell. Biol.
20: 1044-1054
[Abstract]
[Full Text]
-
Sabourin, L. A., Seale, P., Wagner, J., Rudnicki, M. A.
(2000). Caspase 3 Cleavage of the Ste20-Related Kinase SLK Releases and Activates an Apoptosis-Inducing Kinase Domain and an Actin-Disassembling Region. Mol. Cell. Biol.
20: 684-696
[Abstract]
[Full Text]
-
Bartkiewicz, M., Houghton, A., Baron, R.
(1999). Leucine Zipper-mediated Homodimerization of the Adaptor Protein c-Cbl. A ROLE IN c-Cbl's TYROSINE PHOSPHORYLATION AND ITS ASSOCIATION WITH EPIDERMAL GROWTH FACTOR RECEPTOR. J. Biol. Chem.
274: 30887-30895
[Abstract]
[Full Text]
-
Knuutila, S., Aalto, Y., Autio, K., Bjorkqvist, A.-M., El-Rifai, W.'e., Hemmer, S., Huhta, T., Kettunen, E., Kiuru-Kuhlefelt, S., Larramendy, M. L., Lushnikova, T., Monni, O., Pere, H., Tapper, J., Tarkkanen, M., Varis, A., Wasenius, V.-M., Wolf, M., Zhu, Y.
(1999). DNA Copy Number Losses in Human Neoplasms. Am. J. Pathol.
155: 683-694
[Abstract]
[Full Text]
-
Tanaka, H., Yoshimura, Y., Nozaki, M., Yomogida, K., Tsuchida, J., Tosaka, Y., Habu, T., Nakanishi, T., Okada, M., Nojima, H., Nishimune, Y.
(1999). Identification and Characterization of a Haploid Germ Cell-specific Nuclear Protein Kinase (Haspin) in Spermatid Nuclei and Its Effects on Somatic Cells. J. Biol. Chem.
274: 17049-17057
[Abstract]
[Full Text]
-
Fry, A. M., Arnaud, L., Nigg, E. A.
(1999). Activity of the Human Centrosomal Kinase, Nek2, Depends on an Unusual Leucine Zipper Dimerization Motif. J. Biol. Chem.
274: 16304-16310
[Abstract]
[Full Text]
-
Rothbarth, K, Spiess, E, Juodka, B, Yavuzer, U, Nehls, P, Stammer, H, Werner, D
(1999). Induction of apoptosis by overexpression of the DNA-binding and DNA-PK-activating protein C1D. J. Cell Sci.
112: 2223-2232
[Abstract]
-
Martins, L. M., Kottke, T. J., Kaufmann, S. H., Earnshaw, W. C.
(1998). Phosphorylated Forms of Activated Caspases Are Present in Cytosol From HL-60 Cells During Etoposide-Induced Apoptosis. Blood
92: 3042-3049
[Abstract]
[Full Text]
-
Sanjo, H., Kawai, T., Akira, S.
(1998). DRAKs, Novel Serine/Threonine Kinases Related to Death-associated Protein Kinase That Trigger Apoptosis. J. Biol. Chem.
273: 29066-29071
[Abstract]
[Full Text]
-
Kim, S., Lee, S.-H., Park, D.
(2001). Leucine Zipper-mediated Homodimerization of the p21-activated Kinase-interacting Factor, beta Pix. IMPLICATION FOR A ROLE IN CYTOSKELETAL REORGANIZATION. J. Biol. Chem.
276: 10581-10584
[Abstract]
[Full Text]
-
Peters, C. S., Liang, X., Li, S., Kannan, S., Peng, Y., Taub, R., Diamond, R. H.
(2001). ATF-7, a Novel bZIP Protein, Interacts with the PRL-1 Protein-tyrosine Phosphatase. J. Biol. Chem.
276: 13718-13726
[Abstract]
[Full Text]
-
Kojima, H., Nemoto, A., Uemura, T., Honma, R., Ogura, M., Liu, Y.-k.
(2001). rDRAK1, a Novel Kinase Related to Apoptosis, Is Strongly Expressed in Active Osteoclasts and Induces Apoptosis. J. Biol. Chem.
276: 19238-19243
[Abstract]
[Full Text]
-
Niiro, N., Ikebe, M.
(2001). Zipper-interacting Protein Kinase Induces Ca2+-free Smooth Muscle Contraction via Myosin Light Chain Phosphorylation. J. Biol. Chem.
276: 29567-29574
[Abstract]
[Full Text]