INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Much of the work on microtubules has focused on the assembly reaction from /-tubulin heterodimer to polymer. This reaction is well characterized in vitro, and genetic and pharmacological studies demonstrate its importance and possible in vivo mechanisms for its regulation. Less well understood are the steps leading to the formation of the heterodimer in the cell. There is now considerable evidence that these steps are themselves subject to cellular controls crucial for microtubule function.

The proper folding of the tubulin chains in vivo (22, 23) and in vitro (6, 12, 26) apparently requires the action of chaperone complexes (variously abbreviated as TriC/CCT/TCP/c-cpn). Unlike other proteins that are TriC substrates, however, - and -tubulin require other proteins in vitro to exchange into exogenous heterodimers, as assayed by native gel electrophoresis (2, 7, 8). The extent to which this in vitro reaction is applicable to the in vivo situation is unknown, beginning as it does with fully denatured protein rather than newly synthesized protein (5). Comparison of elements of the in vitro reaction with cellular activities reveals both similarities and differences. For example, yeast strains with altered forms of TCP-1 genes do exhibit cytoskeleton defects (3, 15, 22-24). On the other hand, a protein that is required for the in vitro reaction is the homolog of a yeast protein, Cin1p, that is not essential in vivo but which may be involved in microtubule functions (10, 20, 21).

A recent study of the in vitro folding reaction identified cofactor A, which promotes the recovery of -tubulin, as a monomer from the chaperonin (7). However, in this assay, the form of -tubulin released by cofactor A does not exchange into exogenous dimer. A genetic analysis of cellular responses to -tubulin levels identified Rbl2p as a yeast structural homolog of cofactor A; Rbl2p is a nonessential protein that suppresses the lethality associated with overexpression of -tubulin (1). The murine cofactor A was shown to partially replace Rbl2p in this in vivo assay (1). Although results of the in vitro assay first suggested that cofactor A was a co-chaperonin, the yeast experiments demonstrated that Rbl2p interacts with -tubulin directly, rather than with TCP-1. Results of a revised version of the in vitro assay agree with the observation that Rbl2p/cofactor A interacts with -tubulin rather than with TriC and that Rbl2p is not essential for -tubulin folding (21). More recently, Melki and colleagues (14) have shown that cofactor A, like Rbl2p, binds noncovalently to -tubulin. This cofactor A--tubulin complex elutes from a gel filtration column in a position consistent with it being a 1:1 heterodimer.

To analyze the function of Rbl2p in the cell, we have isolated and characterized a stable complex of Rbl2p and -tubulin, formed both in vivo and in vitro, that lacks -tubulin. The data suggest that Rbl2p binds to a folded form of -tubulin and predict possible roles for Rbl2p in the regulation of tubulin assembly.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Plasmids, strains, and media. pQE-60/RBL2 was used to produce recombinant His₆-Rbl2p in Escherichia coli. This plasmid was constructed by PCR to add NcoI and BglII sites to the RBL2 gene just before the start codon and just after the penultimate codon, respectively. The PCR primers were 5'TAGGACACCATGGCACCCACACAATTG3' and 5'AATCTGAGATCTTTTAGAATCGAGTAATTC3'. The PCR product was cloned into the NcoI and BglII sites of Qiagen vector pQE-60.

tub1 tub3

Purification of His₆-tagged proteins. The Ni-nitrilotriacetic acid (NTA) slurry and column materials were from Qiagen. We used protocols that are slight modifications of both those described earlier (13) and those recommended by the manufacturer. Immunoblot signals were quantified from multiple burns within the linear range by using the IS-1000 Digital Imaging System (Alpha Innotech Corporation).

In vivo association experiments. We grew LTY292 overnight in selective raffinose medium and then induced expression with galactose for 10 to 16 h. We harvested protein by glass bead smash (19), using approximately 4 × 10⁹ cells per experiment. We used a volume of PME buffer plus protease inhibitors (19) equal to the volume of the cell pellet. After centrifugation (13,000 × g, 30 min), 850 µl of extract was mixed with 130 µl of Ni-NTA slurry that had been preincubated with buffer I (20 mM imidazole, 300 mM NaCl, 50 mM sodium phosphate buffer [pH 8.0]). After a 1-h incubation at 4°C, we washed the Ni-NTA beads three times with 10 ml of buffer I plus 10% glycerol. Bound proteins were eluted by incubation with an equal volume of buffer I containing 400 mM imidazole or with 2× gel sample buffer (4% sodium dodecyl sulfate [SDS], 0.2 M dithiothreitol, 20% glycerol).

In vitro association experiments. We harvested protein from FSY185 (wild-type) cells. After breaking the cells in PME buffer with a French press, we immediately added 300 to 500 µl of bacterial lysate containing recombinant His₆-Rbl2p and then proceeded as described above. The lysate was prepared from E. coli cells containing pQE-60/RBL2 which had been induced with isopropyl--D-thiogalactopyranoside for 6 h. Approximately 2.5 ml of packed cells were opened by sonication in 20 ml of buffer I, followed by centrifugation at 31,000 × g for 20 min. To assay denatured proteins, we brought 1 ml of extract to a final concentration of 6 M guanidine hydrochloride for 5 min at 0°C. We diluted the sample (or untreated control) 100-fold into PME buffer plus protease inhibitors plus 500 µl of recombinant His₆-Rbl2p (~0.1 mg/ml), incubated the mixture for 1 h at 4°C, and then isolated the complex as described for the in vivo association experiments.

Dissociation experiments. We prepared His₆-Rbl2p--tubulin complex from JAY570 protein extracts, and His₆-/-tubulin heterodimer from LTY333 protein extracts. Cells were opened in PME buffer by French press as described above, and the extracts were centrifuged at 13,000 × g and then mixed with Ni-NTA slurries also as described above. Unbound proteins were washed away by three washes (15 ml per 130 µl of resin), and we resuspended the samples in PME buffer plus protease inhibitors (25-fold dilution). At various times, we centrifuged aliquots of the samples, removed the supernatant, and eluted bound proteins with buffer I containing 400 mM imidazole or with 2× gel sample buffer.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Characterization of a His₆-Rbl2p--tubulin complex formed in vivo. Previous work demonstrated that Rbl2p can form a complex with -tubulin but not -tubulin in vivo, demonstrating the existence of a second pool of -tubulin in the cell in addition to that of the /-tubulin heterodimer (1). We originally isolated this complex by immunoprecipitation with anti--tubulin or anti-Rbl2p antibodies. However, this isolation method has drawbacks. First, the monoclonal anti--tubulin antibody has only a modest level of affinity, so the immunoprecipitates are somewhat unstable. Second, on SDS-polyacrylamide gels, the sizes of the tubulin polypeptides are similar to those of the immunoglobulin G heavy chains, which are abundant in the precipitate and interfere with analyses.

View larger version (43K): [in this window] [in a new window]   FIG. 1.   The His6-Rbl2p--tubulin complex formed in vivo is devoid of -tubulin. LTY292 cells carrying a plasmid-borne gene specifying His6-Rbl2p under control of the GAL promoter were grown for 2 h in medium containing raffinose (uninduced) or galactose (induced). The His6-Rbl2p was separated from extracts by using Ni-NTA beads. The whole-cell extracts (W.C.E.) and bound proteins were analyzed by immunoblotting for -tubulin, -tubulin, and Rbl2p as shown. The bottom film was exposed six times longer than the top two. The presence of -tubulin in the bound proteins required expression of His6-Rbl2p, but no -tubulin was detected in the bound proteins under either condition.

Ordering the formation of Rbl2p--tubulin complex and /-tubulin heterodimer in vivo. To order the formation of these two -tubulin complexes with respect to one another, we constructed yeast strains that would allow us to monitor the compartmentalization of newly synthesized -tubulin relative to that of the steady-state pool. In FSY820 cells, the only source of Rbl2p is a low-copy-number plasmid that constitutively expresses His₆-Rbl2p under the control of the RBL2 promoter. On the chromosome the constitutively expressed -tubulin gene is wild-type TUB2. An inducibly expressed -tubulin gene, tub2-590, is on a second plasmid under control of the GAL promoter. The product of that gene, Tub2-590p, is a fully functional -tubulin protein. Because it lacks the carboxy-terminal 12 amino acids, we could distinguish between the -tubulin proteins by using two antibodies (206 and 339) that bind specifically to the wild-type and truncated forms, respectively (11). In addition, Tub2-590p migrates faster on SDS-polyacrylamide gels than the wild-type Tub2p.

View larger version (25K): [in this window] [in a new window]   FIG. 2.   Newly synthesized -tubulin can bind to Rbl2p in vivo. Distribution of -tubulin between the Rbl2p and -tubulin pools in FSY 820 cells is shown. (A) Immunoblots of whole-cell extracts (W.C.E.), anti--tubulin immunoprecipitates (I.P.), and proteins bound to His6-Rbl2p either at steady state (s.s.) or after a brief (galactose for 10 min followed by glucose for 10 min) induction of Tub2-590p (pulse) are shown. The blots were probed with antibodies specific for either wild-type Tub2p (206) or the faster-migrating Tub2-590p (339). Sample volumes and exposure times were adjusted to give detectable signals from all fractions. (B) Analysis of the data shown in panel A. The ratios represent the proportions of the induced -tubulin (Tub2-590p) relative to the constitutive -tubulin (Tub2p) present as the /-tubulin heterodimer or associated with Rbl2p from uninduced cells (steady state) and after a brief induction of Tub2-590p expression (pulse).

Formation of Rbl2p--tubulin in vitro. To determine if Rbl2p could bind only to newly synthesized -tubulin or if instead it could bind to -tubulin that had previously been in /-tubulin heterodimers, we used an in vitro assay. We expressed His₆-Rbl2p in E. coli and incubated it with extracts of wild-type yeast cells and then assayed for bound proteins by using Ni-NTA beads. We found that Rbl2p bound -tubulin in a time-dependent fashion (Fig. 3). Like the complex formed in vivo, this in vitro complex contained only a trace amount of -tubulin, which amount did not increase with time. Therefore, it is likely that the -tubulin detected represents adventitious binding.

View larger version (12K): [in this window] [in a new window]   FIG. 3.   Formation of His6-Rbl2p--tubulin complex in vitro. Bacterial extract containing His6-Rbl2p was incubated with wild-type yeast cell extracts at 4°C. At various times, an aliquot was removed and added to Ni-NTA beads for 15 min. The beads were washed, and the bound proteins were assayed by elution followed by immunoblotting with anti-tubulin antibodies. The data are reported as percent -tubulin and -tubulin bound as a function of time.

View larger version (22K): [in this window] [in a new window]   FIG. 4.   Rbl2p does not bind to denatured -tubulin. Extracts from wild-type cells (W.C.E.) were incubated either with control buffer () or with 6 M guanidine hydrochloride (+) for 5 min, diluted 100-fold, and then incubated with His6-Rbl2p plus Ni-NTA beads. The specifically bound proteins were eluted from the beads and assayed for the presence of both -tubulin and -tubulin by immunoblotting. The binding of -tubulin to Rbl2p was essentially abolished by the preincubation with denaturing agent. No bound -tubulin was detected under either condition.

Stability of the Rbl2p--tubulin complex. The in vitro experiment described above suggests that -tubulin can transfer from -tubulin to Rbl2p. The in vivo experiment suggests that -tubulin can interact with Rbl2p before it interacts with -tubulin. A crucial issue for understanding Rbl2p function is how these two complexes of -tubulin compare to one another. Accordingly, we measured their stabilities in vitro.

5

1

View larger version (10K): [in this window] [in a new window]   FIG. 5.   Dissociation of His6-Rbl2p--tubulin and -His6--tubulin in vitro. The dissociation rates of these two complexes were measured by incubating cell extracts with Ni-NTA beads, resuspending the beads in PME buffer at 4°C, and then measuring the levels of the complexes remaining at various times by immunoblotting. The data are reported as semi-log plots of -tubulin (circles) and -tubulin (squares) dissociation. Extracts from cells expressing either Tub2p and His6-Rbl2p or His6-Tub2p alone were used to measure the dissociation of -tubulin or -tubulin, respectively.

7

1

1

1

1

10

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

That -tubulin can interact specifically with a protein other than -tubulin suggests several possible functions for such a complex. The results presented above characterize the formation and properties of the Rbl2p--tubulin complex.

The results demonstrate that the formation in vitro of the Rbl2p--tubulin complex is dependent upon the conformation of -tubulin. Although there may be conformational alterations of -tubulin prior or subsequent to binding Rbl2p, the form of -tubulin that binds Rbl2p is at least in equilibrium with the form that binds -tubulin. That both the in vivo and in vitro complexes are essentially devoid of -tubulin argues that Rbl2p competes with -tubulin for binding to -tubulin, perhaps because both ligands bind to similar sites on -tubulin. These characteristics of the Rbl2p--tubulin complex are consistent with the comparable efficiencies of Rbl2p and -tubulin in rescuing cells from -tubulin lethality. In cell extracts, it is clear that much more -tubulin is associated with -tubulin than with Rbl2p, reflecting not only relative stabilities but also the likelihood that there is much less Rbl2p than -tubulin in wild-type cells. We note that the overproduction of Rbl2p is modestly toxic (1), a phenotype that may be explained by the ability of high levels to compete successfully with -tubulin and so to sequester -tubulin.

Two results are consistent with a role for Rbl2p in the pathway leading to heterodimer formation. First, the in vitro data suggest that the /-tubulin heterodimer is more stable than the Rbl2p--tubulin complex. Of course this comparison is of dissociation rates that need not reflect conditions in vivo. For example, that the tubulin heterodimer can have an alternative fate to dissociation, i.e., polymerization, may affect its apparent stability in the cytoplasm. In addition, there may be effectors that modify the stability of either -tubulin complex. Second, the pulse induction experiment shows that -tubulin can interact with Rbl2p before it interacts with -tubulin. This result is consistent with the interactions in vitro reported for the refolding of completely denatured -tubulin (21), which suggest that the murine homolog of Rbl2p, cofactor A, binds -tubulin shortly after its release from the Tcp-1 complex. However, at steady state the amount of -tubulin available for dimerization with the newly synthesized material may be limiting. Under that circumstance, the induced -tubulin may be forced into association with uncomplexed Rbl2p. Therefore, this experiment does not permit us to conclude that this sequence of formation of the two -tubulin complexes is obligatory or that -tubulin ordinarily passes through the Rbl2p complex as part of dimer formation. The experiment does establish that Rbl2p may be on the pathway of heterodimer formation for newly synthesized -tubulin.

These results do encourage further comparisons with the in vitro assay for Rbl2p/cofactor A in heterodimer formation. We show here that Rbl2p can bind to -tubulin that has been in the /-tubulin heterodimer. In contrast, Gao et al. originally reported that -tubulin bound to cofactor A fails to exchange into exogenous heterodimer in the in vitro reaction (7). That result could mean that the formation of Rbl2p--tubulin from tubulin heterodimer is not reversible. Alternatively, the inability to detect this exchange reaction may reflect the slow dissociation of -tubulin from the Rbl2p complex relative to the length of the in vitro assay. It may also reflect the fact that the level of -tubulin available to bind the released -tubulin in that assay may be very low, limited by the rate of dissociation from the heterodimer.

What might Rbl2p do in cells? We can consider here two possible roles. First, the demonstration that Rbl2p--tubulin can form from newly synthesized protein, before that -tubulin is incorporated into heterodimer, demonstrates that Rbl2p may participate as a scaffolding protein for -tubulin in the assembly of the tubulin heterodimer. If so, it obviously does not define the sole pathway for formation of this essential protein, since RBL2 is itself not essential in wild-type cells. Alternatively, Rbl2p could serve as a buffer to sequester free -tubulin. Even modest excesses of -tubulin are deleterious to the cell. For example, strains deleted for the TUB3 gene, and so lacking about 15% of their normal -tubulin complement, show distinct microtubule phenotypes (17), which are completely suppressed by an extra copy of RBL2 under control of its own promoter (1). Experimentally, the extreme toxicity of -tubulin is best remedied by two proteins that bind to it specifically, -tubulin and Rbl2p. The cell could find an advantage in using Rbl2p rather than excess -tubulin in this role. Increased levels of -tubulin would have the consequence of changing the level of heterodimer, which in turn could affect the balanced dynamics likely to be an important part of successful microtubule function.

In some genetic backgrounds, including those carrying mutations in -tubulin genes, RBL2 function is essential (1). Detailed analysis of these situations may provide more insight both into Rbl2p function and into cellular mechanisms for regulating tubulin assembly.