Previous Article | Next Article 
Mol Cell Biol, March 1998, p. 1757-1762, Vol. 18, No. 3
Department of Biology and Center for Cancer
Research, Massachusetts Institute of Technology, Cambridge,
Massachusetts 02139
Received 3 July 1997/Returned for modification 22 August
1997/Accepted 22 December 1997
The yeast protein Rbl2p suppresses the deleterious effects of
excess Much of the work on microtubules has
focused on the assembly reaction from The proper folding of the tubulin chains in vivo (22, 23)
and in vitro (6, 12, 26) apparently requires the action of
chaperone complexes (variously abbreviated as TriC/CCT/TCP/c-cpn). Unlike other proteins that are TriC substrates, however, A recent study of the in vitro folding reaction identified cofactor A,
which promotes the recovery of To analyze the function of Rbl2p in the cell, we have isolated and
characterized a stable complex of Rbl2p and Plasmids, strains, and media.
pQE-60/RBL2 was used to
produce recombinant His6-Rbl2p in Escherichia
coli. This plasmid was constructed by PCR to add NcoI and BglII sites to the RBL2 gene just before the
start codon and just after the penultimate codon, respectively. The PCR
primers were 5'TAGGACACCATGGCACCCACACAATTG3' and
5'AATCTGAGATCTTTTAGAATCGAGTAATTC3'. The PCR product was
cloned into the NcoI and BglII sites of Qiagen vector pQE-60.
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Formation and Function of the
Rbl2p-
-Tubulin Complex
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-tubulin as efficiently as does 
-tubulin. Both in vivo and
in vitro, Rbl2p forms a complex with -tubulin that does not contain
-tubulin, thus defining a second pool of -tubulin in the cell.
Formation of the complex depends upon the conformation of -tubulin.
Newly synthesized -tubulin can bind to Rbl2p before it binds to
-tubulin. Rbl2p can also bind -tubulin from the /-tubulin
heterodimer, apparently by competing with -tubulin. The
Rbl2p--tubulin complex has a half-life of ~2.5 h and is less stable than the /-tubulin heterodimer. The results of our
experiments explain both how excess Rbl2p can rescue cells
overexpressing -tubulin and how it can be deleterious in a wild-type
background. They also suggest that the Rbl2p--tubulin complex is
part of a cellular mechanism for regulating the levels and dimerization of tubulin chains.
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
/-tubulin heterodimer to
polymer. This reaction is well characterized in vitro, and genetic and
pharmacological studies demonstrate its importance and possible in vivo
mechanisms for its regulation. Less well understood are the steps
leading to the formation of the heterodimer in the cell. There is now considerable evidence that these steps are themselves subject to
cellular controls crucial for microtubule function.
- and -tubulin require other proteins in vitro to exchange into exogenous heterodimers, as assayed by native gel electrophoresis (2, 7,
8). The extent to which this in vitro reaction is applicable to
the in vivo situation is unknown, beginning as it does with fully
denatured protein rather than newly synthesized protein (5).
Comparison of elements of the in vitro reaction with cellular activities reveals both similarities and differences. For example, yeast strains with altered forms of TCP-1 genes do exhibit cytoskeleton defects (3, 15, 22-24). On the other hand, a protein that is required for the in vitro reaction is the homolog of a yeast protein, Cin1p, that is not essential in vivo but which may be involved
in microtubule functions (10, 20, 21).
-tubulin, as a monomer from the
chaperonin (7). However, in this assay, the form of -tubulin released by cofactor A does not exchange into exogenous dimer. A genetic analysis of cellular responses to -tubulin levels identified Rbl2p as a yeast structural homolog of cofactor A; Rbl2p is
a nonessential protein that suppresses the lethality associated with
overexpression of -tubulin (1). The murine cofactor A was
shown to partially replace Rbl2p in this in vivo assay (1).
Although results of the in vitro assay first suggested that cofactor A
was a co-chaperonin, the yeast experiments demonstrated that Rbl2p
interacts with -tubulin directly, rather than with TCP-1. Results of
a revised version of the in vitro assay agree with the observation that
Rbl2p/cofactor A interacts with -tubulin rather than with TriC and
that Rbl2p is not essential for -tubulin folding (21).
More recently, Melki and colleagues (14) have shown that
cofactor A, like Rbl2p, binds noncovalently to -tubulin. This
cofactor A--tubulin complex elutes from a gel filtration column in
a position consistent with it being a 1:1 heterodimer.
-tubulin, formed both in
vivo and in vitro, that lacks -tubulin. The data suggest that Rbl2p
binds to a folded form of -tubulin and predict possible roles for
Rbl2p in the regulation of tubulin assembly.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
rbl2
allele (by the URA3 gene) and the tub2-590 allele
by Western blotting. These segregants were plated on 5-fluoro-orotic
acid, and cells that had looped out the URA3 sequence were
recovered. Finally, these cells were transformed with plasmids pBW54,
containing GAL-TUB2 (25), and pJA33, a
CEN plasmid encoding His6-Rbl2p under control of
the RBL2 promoter. LTY333 contains the pMM11 plasmid in
FSY182 (tub1 tub3 PRB539) (16). LTY292 is
FSY182 plus pGRH (16).
We used standard methods and media (18, 19).
Purification of His6-tagged proteins. The Ni-nitrilotriacetic acid (NTA) slurry and column materials were from Qiagen. We used protocols that are slight modifications of both those described earlier (13) and those recommended by the manufacturer. Immunoblot signals were quantified from multiple burns within the linear range by using the IS-1000 Digital Imaging System (Alpha Innotech Corporation).
In vivo association experiments. We grew LTY292 overnight in selective raffinose medium and then induced expression with galactose for 10 to 16 h. We harvested protein by glass bead smash (19), using approximately 4 × 109 cells per experiment. We used a volume of PME buffer plus protease inhibitors (19) equal to the volume of the cell pellet. After centrifugation (13,000 × g, 30 min), 850 µl of extract was mixed with 130 µl of Ni-NTA slurry that had been preincubated with buffer I (20 mM imidazole, 300 mM NaCl, 50 mM sodium phosphate buffer [pH 8.0]). After a 1-h incubation at 4°C, we washed the Ni-NTA beads three times with 10 ml of buffer I plus 10% glycerol. Bound proteins were eluted by incubation with an equal volume of buffer I containing 400 mM imidazole or with 2× gel sample buffer (4% sodium dodecyl sulfate [SDS], 0.2 M dithiothreitol, 20% glycerol).
In vitro association experiments.
We harvested protein from
FSY185 (wild-type) cells. After breaking the cells in PME buffer with a
French press, we immediately added 300 to 500 µl of bacterial lysate
containing recombinant His6-Rbl2p and then proceeded as
described above. The lysate was prepared from E. coli cells
containing pQE-60/RBL2 which had been induced with
isopropyl--D-thiogalactopyranoside for 6 h.
Approximately 2.5 ml of packed cells were opened by sonication in 20 ml
of buffer I, followed by centrifugation at 31,000 × g
for 20 min. To assay denatured proteins, we brought 1 ml of extract to
a final concentration of 6 M guanidine hydrochloride for 5 min at
0°C. We diluted the sample (or untreated control) 100-fold into PME
buffer plus protease inhibitors plus 500 µl of recombinant
His6-Rbl2p (~0.1 mg/ml), incubated the mixture for 1 h at 4°C, and then isolated the complex as described for the in vivo
association experiments.
Dissociation experiments.
We prepared
His6-Rbl2p--tubulin complex from JAY570 protein
extracts, and His6-/-tubulin heterodimer from LTY333
protein extracts. Cells were opened in PME buffer by French press as
described above, and the extracts were centrifuged at 13,000 × g and then mixed with Ni-NTA slurries also as described
above. Unbound proteins were washed away by three washes (15 ml per 130 µl of resin), and we resuspended the samples in PME buffer plus
protease inhibitors (25-fold dilution). At various times, we
centrifuged aliquots of the samples, removed the supernatant, and
eluted bound proteins with buffer I containing 400 mM imidazole or with
2× gel sample buffer.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Characterization of a His6-Rbl2p--tubulin
complex formed in vivo.
Previous work demonstrated that
Rbl2p can form a complex with -tubulin but not -tubulin in vivo,
demonstrating the existence of a second pool of -tubulin in the cell
in addition to that of the /-tubulin heterodimer (1).
We originally isolated this complex by immunoprecipitation with
anti--tubulin or anti-Rbl2p antibodies. However, this isolation
method has drawbacks. First, the monoclonal anti--tubulin antibody
has only a modest level of affinity, so the immunoprecipitates are
somewhat unstable. Second, on SDS-polyacrylamide gels, the sizes of the
tubulin polypeptides are similar to those of the immunoglobulin G heavy
chains, which are abundant in the precipitate and interfere with
analyses.
-tubulin complex,
we constructed a version of the RBL2 gene encoding a form of
the protein with six histidines at its carboxy terminus. By several
criteria, this modified form of Rbl2p has the same activities as does
the unmodified form.
First, overexpressed His6-Rbl2p suppresses the lethality
associated with overexpression of -tubulin with an efficiency of 49%, under conditions where only 0.01% of cells containing the YCpGAL
control plasmid survive. This value is only slightly less than the
70% efficiency achieved with unmodified Rbl2p (1).
Second, like Rbl2p, His6-Rbl2p overexpression confers
resistance to the microtubule-depolymerizing drug benomyl.
Third, protein binding to His6-Rbl2p is similar to that of
unmodified Rbl2p. We mixed extracts of cells that inducibly overexpress His6-Rbl2p with Ni-NTA beads (see Materials and Methods).
-Tubulin binding to the beads strictly depended upon
His6-Rbl2p expression (Fig.
1). This complex, like the one previously
characterized by immunoprecipitation, contains no detectable
-tubulin.
|
-tubulin complex increases when both of its
components are co-overexpressed (data not shown), although we detected
no increase in Rbl2p levels when -tubulin alone was overexpressed.
Analysis of extracts from the co-overexpressing strains by gel
filtration identified a peak containing -tubulin and Rbl2p which
eluted at an apparent molecular mass of ~60 kDa (3a),
consistent with the finding by Melki and colleagues that cofactor A and
-tubulin form a 1:1 heterodimer (14). As shown in
Fig. 2 below, we also detected this complex in extracts of wild-type
cells, but the level of the complex was extremely low. To estimate the
relative sizes of the two pools, we used immunoprecipitation to measure
the proportion of the cellular -tubulin not associated with
-tubulin. The anti--tubulin antibody was covalently attached to
beads and was incubated with wild-type extract. Under conditions where
that antibody leaves ~1% of the total -tubulin in the
supernatant, we found that <2% of the -tubulin also remained. We
can therefore place a limit on the proportion of -tubulin associated
with Rbl2p as being no greater than 2% of the total -tubulin.
Ordering the formation of Rbl2p--tubulin complex and
/-tubulin heterodimer in vivo.
To order the formation of
these two -tubulin complexes with respect to one another, we
constructed yeast strains that would allow us to monitor the
compartmentalization of newly synthesized -tubulin relative to that
of the steady-state pool. In FSY820 cells, the only source of Rbl2p is
a low-copy-number plasmid that constitutively expresses
His6-Rbl2p under the control of the RBL2 promoter. On the chromosome the constitutively expressed -tubulin gene is wild-type TUB2. An inducibly expressed -tubulin
gene, tub2-590, is on a second plasmid under control of the
GAL promoter. The product of that gene, Tub2-590p, is a
fully functional -tubulin protein. Because it lacks the
carboxy-terminal 12 amino acids, we could distinguish between the
-tubulin proteins by using two antibodies (206 and 339) that bind
specifically to the wild-type and truncated forms, respectively
(11). In addition, Tub2-590p migrates faster on
SDS-polyacrylamide gels than the wild-type Tub2p.
-tubulin, a culture
of FSY820 cells grown in raffinose was exposed to galactose for 10 min
and then to glucose for an additional 10 min. We fractionated extracts
of these cells with anti--tubulin antibodies to isolate the
/-tubulin heterodimers and with Ni-NTA beads to bind the His6-Rbl2p--tubulin complexes. As a steady-state
control, an identical culture of raffinose-grown FSY820 cells was
shifted to glucose for 20 min. The distributions of the two -tubulin proteins in whole-cell extracts and in the two fractions were assayed
by SDS-polyacrylamide gel electrophoresis followed by immunoblotting.
Results from a representative experiment are shown in Fig.
2A. The different fractions are
represented by very different exposures because they are so different
in abundance. Some Tub2-590p, the induced -tubulin protein, is
detectable in the steady-state cell extracts because the GAL
promoter is weakly expressed in raffinose medium.
|
-tubulin, we recovered the
fractions associated with -tubulin and with Rbl2p and normalized the
recoveries using the constitutively expressed Tub2p. Figure 2B presents
an analysis of the results shown in Fig. 2A. The short exposure to
galactose increased the level of Tub2-590p approximately fourfold,
while the levels of wild-type -tubulin were unaffected. The ratio of
Tub2-590p to Tub2p associated with Rbl2p increased about 5.4-fold after
the induction. In contrast, the ratio for the two -tubulin proteins
present as /-tubulin heterodimer increased only about
1.6-fold.
This difference in partitioning of newly synthesized -tubulin
is not the consequence of a subtle difference in the properties of the two proteins. We repeated this experiment using FSY821 cells, in which the constitutive and inducible -tubulin genes are
switched. In this experiment, the levels of the inducible Tub2p
increased sixfold after the same induction protocol. After the
induction, the relative proportion of this newly synthesized -tubulin protein to the constitutive Tub2-590p was 10-fold higher in
the Rbl2p pool but only about 1.5-fold higher in the /-tubulin heterodimer (data not shown).
These data demonstrate that newly synthesized -tubulin can bind to
Rbl2p before it incorporates into /-tubulin. If the opposite were
true, i.e., if -tubulin could bind to Rbl2p only after it had been
in heterodimer, we would not detect any enrichment for the
induced protein in the Rbl2p pool, since the heterodimer pool
is at least 50-fold larger than the Rbl2p pool. It is important to
note, however, that this result does not demonstrate that this order is
obligatory (see Discussion).
Formation of Rbl2p--tubulin in vitro.
To determine if
Rbl2p could bind only to newly synthesized -tubulin or if instead it
could bind to -tubulin that had previously been in /-tubulin
heterodimers, we used an in vitro assay. We expressed
His6-Rbl2p in E. coli and incubated it with
extracts of wild-type yeast cells and then assayed for bound proteins
by using Ni-NTA beads. We found that Rbl2p bound -tubulin in a
time-dependent fashion (Fig. 3). Like the
complex formed in vivo, this in vitro complex contained only a trace
amount of -tubulin, which amount did not increase with time.
Therefore, it is likely that the -tubulin detected represents
adventitious binding.
|
-tubulin for at least 4 h. Extrapolated back to zero time,
the kinetics give evidence for a small but reproducible initial burst
of complex formation. One interpretation of this biphasic time course
is that it represents reaction with two distinct in vitro pools of
-tubulin. The low rate at which the majority of the complex forms
may represent a rate-determining release of free -tubulin from the
heterodimer, by far the predominant population of tubulin in
the extract. The initial burst could represent the diffusion-controlled
reaction of a small equilibrium population of undimerized -tubulin
in the yeast extracts, which should bind to Rbl2p at the
diffusion-controlled limit. The level of -tubulin that reacts at
this high rate fits well with our estimate of the level of
-tubulin not associated with -tubulin in extracts (see above).
These results suggest that Rbl2p can interact with -tubulin
molecules that have previously been dimerized and hence completely folded. Conversely, the ability of -tubulin to bind to Rbl2p in
vitro is abolished by denaturation. We treated wild-type yeast protein
extracts with 6 M guanidine hydrochloride and then diluted the protein
into solutions containing His6-Rbl2p. Conventional chaperone binding and folding assays often make use of substrates that
are denatured by treatment with 6 M guanidine hydrochloride. Relative
to the control reaction mixtures that were diluted but not
exposed to denaturing agent, the amount of -tubulin bound to
Rbl2p was only barely detectable (Fig.
4). In contrast, virtually no bound
-tubulin was detected in either the denatured or untreated samples.
Immunoblots of these samples with anti-Rbl2p demonstrated that the
amounts of Rbl2p bound to beads were the same in the treated and
untreated samples. This result is consistent with the failure of
-tubulin denatured in this fashion to bind the murine Rbl2p homolog,
cofactor A, in the in vitro system (7, 8).
|
) or with 6 M guanidine hydrochloride (+) for 5 min, diluted
100-fold, and then incubated with His6-Rbl2p plus Ni-NTA
beads. The specifically bound proteins were eluted from the beads and
assayed for the presence of both Stability of the Rbl2p--tubulin complex.
The in vitro
experiment described above suggests that -tubulin can transfer from
-tubulin to Rbl2p. The in vivo experiment suggests that -tubulin
can interact with Rbl2p before it interacts with -tubulin. A crucial
issue for understanding Rbl2p function is how these two complexes of
-tubulin compare to one another. Accordingly, we measured their
stabilities in vitro.
-tubulin complex from
extracts of yeast cells that overproduce both proteins and then
measured the dissociation of the complex by monitoring the loss of
-tubulin from the Ni-NTA beads (see Materials and Methods). Under
the conditions of this experiment, the His6-Rbl2p protein
does not dissociate from the beads. As shown in Fig.
5, the Rbl2p--tubulin complex dissociates exponentially through about two half-lives. These results
are consistent with a simple dissociation reaction with a half-life of
about 2.5 h, corresponding to a dissociation rate constant,
koff, of 8 × 10
5
s1.
|
/-tubulin heterodimer with which it can interact. The
equilibrium dissociation constant for that heterodimer is
reported to be ~8 × 107 M (4). We
cannot measure the comparable constant for the Rbl2p--tubulin complex, either directly or indirectly (by measuring its association rate constant), since we do not have a source of native monomeric -tubulin. However, the bimolecular association constants for molecules of similar sizes are on the order of 107 to
108 M1 s1 (9). If we
choose the conservative value of 106 M1
s1, the Rbl2p--tubulin complex would have a
Kd of ~1010. That value would
make the Rbl2p--tubulin complex significantly more stable than the
/-tubulin heterodimer. To compare the stabilities of the
complexes more directly by similar assays, we prepared /-tubulin
heterodimer from cells expressing His6-Tub2p (see Materials and Methods). We isolated this complex on Ni-NTA beads and
then monitored its dissociation by assaying for loss of the -tubulin
polypeptide. The rate of -tubulin loss from the beads is low,
consistent with a half-life for the heterodimer of about 10 h (Fig. 5). Therefore, by using essentially the same method to
assay the stabilities of the two complexes, it can be concluded that
the /-tubulin heterodimer dissociates much more slowly than does the Rbl2p--tubulin complex.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
That -tubulin can interact specifically with a protein other
than -tubulin suggests several possible functions for such a
complex. The results presented above characterize the formation and
properties of the Rbl2p--tubulin complex.
The results demonstrate that the formation in vitro of the
Rbl2p--tubulin complex is dependent upon the conformation of
-tubulin. Although there may be conformational alterations of
-tubulin prior or subsequent to binding Rbl2p, the form of
-tubulin that binds Rbl2p is at least in equilibrium with the form
that binds -tubulin. That both the in vivo and in vitro complexes
are essentially devoid of -tubulin argues that Rbl2p competes with
-tubulin for binding to -tubulin, perhaps because both ligands
bind to similar sites on -tubulin. These characteristics of the
Rbl2p--tubulin complex are consistent with the comparable
efficiencies of Rbl2p and -tubulin in rescuing cells from
-tubulin lethality. In cell extracts, it is clear that much more
-tubulin is associated with -tubulin than with Rbl2p, reflecting
not only relative stabilities but also the likelihood that there is
much less Rbl2p than -tubulin in wild-type cells. We note that the
overproduction of Rbl2p is modestly toxic (1), a phenotype
that may be explained by the ability of high levels to compete
successfully with -tubulin and so to sequester -tubulin.
Two results are consistent with a role for Rbl2p in the pathway leading
to heterodimer formation. First, the in vitro data suggest that
the /-tubulin heterodimer is more stable than the Rbl2p--tubulin complex. Of course this comparison is of
dissociation rates that need not reflect conditions in vivo. For
example, that the tubulin heterodimer can have an alternative
fate to dissociation, i.e., polymerization, may affect its apparent
stability in the cytoplasm. In addition, there may be effectors that
modify the stability of either -tubulin complex. Second, the pulse
induction experiment shows that -tubulin can interact with Rbl2p
before it interacts with -tubulin. This result is consistent with
the interactions in vitro reported for the refolding of completely denatured -tubulin (21), which suggest that the murine
homolog of Rbl2p, cofactor A, binds -tubulin shortly after its
release from the Tcp-1 complex. However, at steady state the amount of -tubulin available for dimerization with the newly synthesized material may be limiting. Under that circumstance, the induced -tubulin may be forced into association with uncomplexed Rbl2p. Therefore, this experiment does not permit us to conclude that this
sequence of formation of the two -tubulin complexes is obligatory or
that -tubulin ordinarily passes through the Rbl2p complex as part of
dimer formation. The experiment does establish that Rbl2p may be on the
pathway of heterodimer formation for newly synthesized
-tubulin.
These results do encourage further comparisons with the in vitro assay
for Rbl2p/cofactor A in heterodimer formation. We show here
that Rbl2p can bind to -tubulin that has been in the /-tubulin heterodimer. In contrast, Gao et al. originally reported that -tubulin bound to cofactor A fails to exchange into exogenous heterodimer in the in vitro reaction (7). That
result could mean that the formation of Rbl2p--tubulin from tubulin
heterodimer is not reversible. Alternatively, the inability to
detect this exchange reaction may reflect the slow dissociation of
-tubulin from the Rbl2p complex relative to the length of the in
vitro assay. It may also reflect the fact that the level of -tubulin available to bind the released -tubulin in that assay may be very
low, limited by the rate of dissociation from the heterodimer.
What might Rbl2p do in cells? We can consider here two possible roles.
First, the demonstration that Rbl2p--tubulin can form from newly
synthesized protein, before that -tubulin is incorporated into
heterodimer, demonstrates that Rbl2p may participate as a scaffolding protein for -tubulin in the assembly of the tubulin heterodimer. If so, it obviously does not define the sole
pathway for formation of this essential protein, since RBL2
is itself not essential in wild-type cells. Alternatively, Rbl2p could
serve as a buffer to sequester free -tubulin. Even modest excesses of -tubulin are deleterious to the cell. For example, strains deleted for the TUB3 gene, and so lacking about 15% of
their normal -tubulin complement, show distinct microtubule
phenotypes (17), which are completely suppressed by an extra
copy of RBL2 under control of its own promoter
(1). Experimentally, the extreme toxicity of -tubulin is
best remedied by two proteins that bind to it specifically, -tubulin
and Rbl2p. The cell could find an advantage in using Rbl2p rather than
excess -tubulin in this role. Increased levels of -tubulin would
have the consequence of changing the level of heterodimer,
which in turn could affect the balanced dynamics likely to be an
important part of successful microtubule function.
In some genetic backgrounds, including those carrying mutations in
-tubulin genes, RBL2 function is essential
(1). Detailed analysis of these situations may provide more
insight both into Rbl2p function and into cellular mechanisms for
regulating tubulin assembly.
| |
ACKNOWLEDGMENTS |
|---|
We thank R. Williams (Vanderbilt University) and M. Caplow (University of North Carolina) for discussions of heterodimer dissociation and the members of our laboratory for critical contributions.
J.E.A. was supported in part by an NSF predoctoral fellowship. L.R.V. was supported in part by a predoctoral fellowship from HHMI. This work was supported by a grant from the NIH to F.S.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology and Center for Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139. Phone: (617) 253-3026. Fax: (617) 253-6272. E-mail: solomon{at}mit.edu.
Present address: Department of Biological Sciences, California
Institute of Technology, Pasadena, Calif.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Archer, J. E.,
L. R. Vega, and F. Solomon.
1995.
Rbl2p, a yeast protein that binds to -tubulin and participates in microtubule function in vivo.
Cell
82:425-434[Medline].
|
| 2. | Campo, R., A. Fontalba, L. Sanchez, and J. Zabala. 1994. A 14kDa release factor is involved in GTP-dependent beta-tubulin folding. FEBS Lett. 353:162-166[Medline]. |
| 3. |
Chen, X.,
D. Sullivan, and T. Huffaker.
1994.
Two yeast genes with similarity to TCP-1 are required for microtubule and actin function in vivo.
Proc. Natl. Acad. Sci. USA
91:9111-9115 |
| 3a. | Compton, K., and F. Solomon. Unpublished results. |
| 4. | Detrich, H. W., and R. C. Williams. 1978. Reversible dissociation of the alpha-beta dimer of tubulin from bovine brain. Biochemistry 17:3900-3907[Medline]. |
| 5. | Frydman, J., and F. Hartl. 1996. Principles of chaperone-assisted protein folding: differences between in vitro and in vivo mechanism. Science 272:1497-1502[Abstract]. |
| 6. | Frydman, J., E. Nimmesgern, H. Erdjument-Bromage, J. Wall, P. Tempst, and F.-U. Hartl. 1992. Function in protein folding of TRiC, a cytosolic ring complex containing TCP-1 and structurally related subunits. EMBO J. 11:4767-4778[Medline]. |
| 7. | Gao, Y., R. Melki, P. Walden, S. Lewis, C. Ampe, H. Rommelaere, J. Vandekerckhove, and N. Cowan. 1994. A novel cochaperonin that modulates the ATPase activity of cytoplasmic chaperonin. Cell 125:989-996. |
| 8. |
Gao, Y.,
I. Vainberg,
R. Chow, and N. Cowan.
1993.
Two cofactors and cytoplasmic chaperonin are required for the folding of - and -tubulin.
Mol. Cell. Biol.
13:2478-2485 |
| 9. | Halford, S. E., and N. P. Johnson. 1983. Single turnovers of the EcoRI restriction endonuclease. Biochem. J. 211:405-415[Medline]. |
| 10. |
Hoyt, M.,
T. Stearns, and D. Botstein.
1990.
Chromosome instability mutants of Saccharomyces cerevisiae that are defective in microtubule-mediated processes.
Mol. Cell. Biol.
10:223-234 |
| 11. |
Katz, W., and F. Solomon.
1988.
Diversity among -tubulins: a carboxy-terminal domain of yeast -tubulin is not essential in vivo.
Mol. Cell. Biol.
8:2730-2736 |
| 12. | Lewis, V., G. Hynes, D. Zheng, H. Saibil, and K. Willison. 1992. T-complex polypeptide-1 is a subunit of the heteromeric particle in the eukaryotic cytosol. Nature 358:249-252[Medline]. |
| 13. |
Magendantz, M.,
M. Henry,
A. Lander, and F. Solomon.
1995.
Inter-domain interactions of radixin in vitro.
J. Biol. Chem.
270:25324-25327 |
| 14. | Melki, R., H. Rommelaere, R. Leguy, J. Vandekerckhove, and C. Ampe. 1996. Cofactor A is a molecular chaperone required for beta-tubulin folding: functional and structural characterization. Biochemistry 35:10422-10435[Medline]. |
| 15. |
Miklos, D.,
S. Caplan,
D. Mertens,
G. Hynes,
Z. Pitluk,
Y. Kashi,
K. Harrison-Lavoie,
S. Stevenson,
C. Brown,
B. Barrell,
A. Horwich, and K. Willison.
1994.
Primary structure and function of a second essential member of the heterooligomeric TCP1 chaperonin complex of yeast, TCP1 beta.
Proc. Natl. Acad. Sci. USA
91:2743-2747 |
| 16. |
Schatz, P.,
F. Solomon, and D. Botstein.
1988.
Isolation and characterization of conditional-lethal mutation in the TUB1 a-tubulin gene of the yeast Saccharomyces cerevisiae.
Genetics
120:681-695 |
| 17. |
Schatz, P. J.,
F. Solomon, and D. Botstein.
1986.
Genetically essential and nonessential -tubulin genes specify functionally interchangeable proteins.
Mol. Cell. Biol.
6:3722-3733 |
| 18. | Sherman, F., G. Fink, and J. Hicks. 1986. . Laboratory course manual for methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 19. | Solomon, F., L. Connell, D. Kirkpatrick, V. Praitis, and B. Weinstein. 1992. Methods for studying the yeast cytoskeleton, p. 197-222. In K. Carraway, and C. Carraway (ed.), The cytoskeleton. Oxford University Press, Oxford, United Kingdom. |
| 20. | Stearns, T., M. Hoyt, and D. Botstein. 1990. Yeast mutants sensitive to antimicrotubule drugs define three genes that affect microtubule function. Genetics 124:251-262[Abstract]. |
| 21. |
Tian, G.,
Y. Huang,
H. Rommelaere,
J. Vandekerckhove,
C. Ampe, and N. Cowan.
1996.
Pathway leading to correctly folded -tubulin.
Cell
86:287-296[Medline].
|
| 22. |
Ursic, D., and M. Culbertson.
1991.
The yeast homolog to mouse Tcp-1 affects microtubule-mediated processes.
Mol. Cell. Biol.
11:2629-2640 |
| 23. | Ursic, D., J. Sedbrook, K. Himmel, and M. Culbertson. 1994. The essential yeast Tcp1 protein affects actin and microtubules. Mol. Biol. Cell 5:1065-1080[Abstract]. |
| 24. |
Vinh, D., and D. Drubin.
1994.
A yeast TCP-1-like protein is required for actin function in vivo.
Proc. Natl. Acad. Sci. USA
91:9116-9120 |
| 25. |
Weinstein, B., and F. Solomon.
1990.
Phenotypic consequences of tubulin overproduction in Saccharomyces cerevisiae: differences between alpha-tubulin and beta-tubulin.
Mol. Cell. Biol.
10:5295-5304 |
| 26. | Yaffe, M., G. Farr, D. Miklos, A. Horwich, M. Sternlicht, and H. Sternlich. 1992. TCP-1 complex is a molecular chaperone in tubulin biogenesis. Nature 358:245-248[Medline]. |
Mol Cell Biol, March 1998, p. 1757-1762, Vol. 18, No. 3
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lacefield, S., Magendantz, M., Solomon, F.
(2006). Consequences of Defective Tubulin Folding on Heterodimer Levels, Mitosis and Spindle Morphology in Saccharomyces cerevisiae. Genetics
173: 635-646
[Abstract] [Full Text] -
Gell, D., Kong, Y., Eaton, S. A., Weiss, M. J., Mackay, J. P.
(2002). Biophysical Characterization of the alpha -Globin Binding Protein alpha -Hemoglobin Stabilizing Protein. J. Biol. Chem.
277: 40602-40609
[Abstract] [Full Text] -
Caplow, M., Fee, L.
(2002). Dissociation of the Tubulin Dimer Is Extremely Slow, Thermodynamically Very Unfavorable, and Reversible in the Absence of an Energy Source. Mol. Biol. Cell
13: 2120-2131
[Abstract] [Full Text] -
Hoffner, G., Kahlem, P., Djian, P.
(2002). Perinuclear localization of huntingtin as a consequence of its binding to microtubules through an interaction with {beta}-tubulin: relevance to Huntington's disease. J. Cell Sci.
115: 941-948
[Abstract] [Full Text] -
Abruzzi, K. C., Smith, A., Chen, W., Solomon, F.
(2002). Protection from Free {beta}-Tubulin by the {beta}-Tubulin Binding Protein Rbl2p. Mol. Cell. Biol.
22: 138-147
[Abstract] [Full Text] -
Fleming, J. A., Vega, L. R., Solomon, F.
(2000). Function of Tubulin Binding Proteins in Vivo. Genetics
156: 69-80
[Abstract] [Full Text] -
Radcliffe, P. A., Garcia, M. A., Toda, T.
(2000). The Cofactor-Dependent Pathways for {alpha}- and {beta}-Tubulins in Microtubule Biogenesis Are Functionally Different in Fission Yeast. Genetics
156: 93-103
[Abstract] [Full Text] -
Feierbach, B., Nogales, E., Downing, K. H., Stearns, T.
(1999). Alf1p, a CLIP-170 Domain-containing Protein, Is Functionally and Physically Associated with {alpha}-Tubulin. JCB
144: 113-124
[Abstract] [Full Text] -
Grishchuk, E., McIntosh, J.
(1999). Sto1p, a fission yeast protein similar to tubulin folding cofactor E, plays an essential role in mitotic microtubule assembly. J. Cell Sci.
112: 1979-1988
[Abstract] -
Vega, L. R., Fleming, J., Solomon, F.
(1998). An alpha -Tubulin Mutant Destabilizes the Heterodimer: Phenotypic Consequences and Interactions with Tubulin-binding Proteins. Mol. Biol. Cell
9: 2349-2360
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»