Previous Article | Next Article 
Mol Cell Biol, April 1998, p. 1835-1843, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Multiple Developmental Requirements of Noisette,
the Drosophila Homolog of the U2 snRNP-Associated
Polypeptide SF3a60
Valérie
Meyer,
Brian
Oliver,
and
Daniel
Pauli*
Department of Zoology and Animal Biology,
University of Geneva, 1211 Geneva 4, Switzerland
Received 8 September 1997/Returned for modification 19 November
1997/Accepted 20 January 1998
 |
ABSTRACT |
We report the cloning of the noisette gene
(noi), which encodes the Drosophila
melanogaster ortholog of a U2 snRNP-associated splicing factor,
SF3a60 (SAP61) in humans and PRP9p in Saccharomyces
cerevisiae. Antibodies raised against human SF3a60
recognized NOI in flies, showing a nuclear localization in all the
stages examined, including the embryo, the dividing cells of imaginal
discs, and the larval polyploid nuclei. NOI is expressed in somatic and
germinal cells of both male and female gonads. By mobilization of P
transposons, we have generated a large number of noi
mutations. Complete loss of function resulted in lethality at the end
of embryogenesis, without obvious morphological defects. Hypomorphic
alleles revealed multiple roles of noi for the survival and
differentiation of male germ cells, the differentiation of female germ
cells, and the development of several adult structures.
 |
INTRODUCTION |
The active spliceosome is assembled
on pre-mRNAs through an ordered and regulated succession of steps,
complexes E, A, B, and finally C, which involve the function of five
small nuclear ribonucleoprotein particles (U1, U2, U4, U5, and U6
snRNPs), as well as several non-snRNP polypeptides (for a review, see
reference 30). Many of the proteins associated with
spliceosome intermediates have been identified and called
spliceosome-associated proteins (SAPs) (6, 62). Among them,
SAP 61, 62, and 114 were isolated in all the splicing complexes
containing the U2 snRNP (6). Fractionation of splicing
extracts showed that two fractions associated with U2 snRNP, SF3a and
SF3b, are required for the binding of U2 snRNP to pre-mRNAs (10,
31). SF3a contains three tightly associated subunits of 60, 66, and 120 kDa. Biochemical, immunological, and sequence analyses have
revealed the correspondence of these three polypeptides with SAP 61, 62, and 114, respectively, and their homology to the essential yeast
splicing proteins PRP9p, PRP11p, and PRP21p (4, 7, 9, 13, 32,
33). In yeast, evidence of direct interaction of these
polypeptides as well as synthetic lethality between several U2 snRNA
mutations and prp9, prp11, or prp21
mutations supports the hypothesis that these three polypeptides
physically interact with stem-loop IIa of U2 snRNA and act
interdependently to mediate the binding of U2 snRNP to pre-mRNA
(36, 38, 53, 67). In addition, the invariant nucleotides
located between the branchpoint interaction sequence and the beginning
of stem IIa may also contribute to splicing via interaction with SF3a
(68) instead of by base pairing with U6 snRNA as originally
proposed (65). RNA-protein UV-cross-linking assays
demonstrated that six U2 snRNP-associated proteins, including the three
subunits of SF3a, contact the pre-mRNA around the intron branch site in
a sequence-independent manner during assembly of spliceosomal complex A
(22). This binding of U2 snRNP appears to allow base pairing
between the U2 snRNA and the intron sequence leading to the bulging of
the adenosine branch residue (43).
In Drosophila melanogaster, a few proteins involved in
splicing have been identified. The gene sans fille
(snf) encodes an essential nuclear protein thought to be the
homolog of both U1A and U2B", which are associated with the U1 and U2
snRNPs, respectively (17, 24, 48). Genetic analysis of
amorphic, hypomorphic, and antimorphic mutations revealed a prominent
role of SNF in the regulation of alternative splicing of pre-mRNAs of
the sex determination switch gene Sex-lethal (2, 42,
55, 56, 63). Another gene encoding a U1 snRNP polypeptide has
been cloned in Drosophila, U1-70K (39). The U2
snRNP auxiliary factor, U2AF, composed of two subunits, assembles with
U1 snRNP into prespliceosome complex E and is involved in the
recruitment of U2 snRNP into complex A (for a review, see reference
30). The genes encoding both subunits,
dU2AF50, homologous to human U2AF65
(26), and dU2AF38, homologous to
human U2AF35 (54), have been cloned. Null
mutations showed that both genes are essential for viability.
Furthermore, a hypomorphic allele of dU2AF38
showed reduced viability and fertility as well as morphological defects
(54).
Several genes encoding proteins involved in splice site selection and
regulation of spliceosome assembly have also been characterized in
Drosophila, including two members of the SR family (for
reviews, see references 19 and
66): B52, the homolog of human SRp55 (12,
51), and RBP1, the homolog of human SRp20 (28).
B52 is an essential gene (45, 49) whose precise
levels of expression appear to be critical for the proper
differentiation of various tissues (34). Although it has not
been possible to detect splicing defects in null alleles of
B52 (45, 49), effects on the splicing of several
transcripts, including the alternatively spliced dsx pre-mRNA, were revealed with a dominant allele characterized by a
single amino acid substitution in one of the RNA binding domains (45). In vitro, RBP1 was shown to affect both the efficiency of splicing and splice site selection (28). Further analysis in transfected tissue culture cells implicated RBP1 as a coregulator of
dsx pre-mRNA alternative splicing, together with the
products of the sex determination genes tra and
tra-2 (25).
Several other genes encoding polypeptides related to SR proteins have
been characterized. Genetic studies of sex determination have led to
the detailed analysis of three genes, Sxl, tra,
and tra-2, whose products are required in females to control
a cascade of alternative splicing events (for reviews, see references
3 and 15). Two genes, which were
identified as suppressors of various mutations, have been found to
encode RNA binding proteins, which could regulate splice site selection
of some pre-mRNAs: Su(s) (18, 41; but see
also reference 20) and
su(wa), which autoregulates its own expression
by alternative splicing (68). In the latter case, a
mammalian homolog has also been shown to be a regulator of alternative
splicing (16, 57). Finally, the restriction of P elements'
transposition to the germ line occurs by inhibition of removal of the
P-element third intron in somatic cells, an inhibition mediated by a
ribonucleoprotein complex containing a tissue-specific regulator called
PSI (1, 60).
The cloning of the noisette gene (noi) allowed us
to isolate the Drosophila homolog of the 60-kDa (SAP 61)
subunit of the U2 snRNP-associated splicing factor SF3a. This is the
third gene encoding an snRNP-associated polypeptide cloned in
Drosophila. Antibodies raised against human
SF3a60 (32) showed ubiquitous expression and
nuclear localization of NOI during fly development. Analysis of various
noi mutations revealed multiple requirements of the gene for
fly viability, morphology, and fertility.
 |
MATERIALS AND METHODS |
Genetics.
The noi1 and
noi2 alleles were identified by screening a
collection of homozygous male sterile mutations provided by M. Fuller (Stanford University). These mutations had been generated by
mobilization of the P-lacW transposon, which is marked with
a mini-white+ gene (8). The
endogenous white locus was the w1118
allele. Precise and imprecise excisions of the
noi1 and noi2 transposons
were induced in the presence of the Sb
P[ry+
2-3] source of transposase
(50) and selected on the basis of the loss of the eye color
marker.
Genomic and cDNA clones.
A genomic library from the
noi1 mutant was constructed by insertion of
genomic DNA partially digested with Sau3A into the
BamHI site of the
EMBL3 vector. Phages containing part of
the P-lacW transposon were identified using a probe from the
white gene, the 1.9-kb SacI fragment from CaSpeR
(47), which is deleted in the w1118
allele. Genomic DNA of region 83B from the mutant phages was used to
screen a wild-type genomic library (40). Ovarian
(64) and 4- to 8-h embryonic (11) cDNA libraries
were screened according to the authors' instructions.
Southern and Northern blotting.
Genomic DNA was isolated as
described by Bender et al. (5). RNA extraction and
electrophoresis were done according to Cléard et al.
(14). Poly(A)+ RNA was purified by using an
Oligotex-dT kit (Qiagen). Blotting onto nylon membranes (Hybond-N+;
Amersham) and hybridization were performed following the
manufacturer's instructions.
Germ line transformation and rescue of noi
mutations.
Germ line transformation was performed with a 3.6-kb
PstI genomic fragment subcloned into the transformation
vector CaSpeR (47). To test for the rescue of the
noi phenotypes, lines with insertions on the X or on the
second chromosome were used.
Sequencing.
Sequencing of cDNAs and of the 3.6-kb
PstI genomic fragment was performed with Sequenase version
2.0 (U.S. Biochemicals) following the manufacturer's instructions,
either on subclones in pBluescript KS+ with the T3 or T7 primers or
with internal oligonucleotide primers. The homology search was carried
out with the BLAST program.
The site of the P-element insertion in the noi1
allele was determined by amplification and sequencing of a fragment
spanning the insertion site. DNA from one of the mutant phages was
digested with BamHI and PCR amplified with a primer from the
P element (5'TTCCTTTCACTCGCACTTATTG, position 775 to 796 [52]) and a primer from the noi coding
region, 300 bp upstream of the BamHI site (5'GGAGCAGGTAGTCGTTG). The amplified fragment was cloned
into pBluescript KS+ and sequenced as described above.
The breakpoints of
Df(3R)noi-D were determined by direct
sequencing of a PCR-amplified mutant fragment. Amplification was
performed with a primer located 400 bp upstream of the P-element
insertion site (5'TACTTTTGCCTTCTGCC) and a primer located on
the
other side, near the stop codon (5'GAACGTCTTTCGGTTGAC).
Direct
sequencing of the PCR product was performed as above, in
the presence
of 10% dimethyl sulfoxide and 4 U of pyrophosphatase, by
using
5 pmol of the latter primer and about 1 µg of the PCR product.
Antibody stainings.
Embryos and tissues were prepared as
described by Pauli et al. (44) and Pennetta and Pauli
(46). Methanol washing was omitted for testes stained
against NOI. PBTX (phosphate-balanced buffer with 0.3% bovine serum
albumin and 0.2% Triton X-100) was used for both primary and secondary
antibody incubations. Antibodies preadsorbed on embryos were used at
the following dilutions: rat anti-VASA (61), 1:500; and
rabbit anti-human SF3a60 (32), 1:2,000.
Secondary antibodies coupled to horseradish peroxidase (Bio-Rad) or
fluorescein (Jackson Laboratory) were diluted 1:1,000.
Nucleotide sequence accession numbers.
The nucleotide
sequence accession number for noi is AJ23042.
 |
RESULTS |
Isolation of the noisette (noi) gene.
In our study of germ line sex determination in D. melanogaster, we were interested in mutations with a male-specific
germ cell death phenotype. The screening of a collection of
P-element-induced male sterile mutations (kindly provided by M. Fuller)
allowed us to identify two noncomplementing recessive mutations,
noi1 and noi2, in which
adult males showed very small testes, almost completely devoid of germ
cells (for a detailed description of the phenotype, see below).
Homozygous mutant females did not appear affected and were fertile at
25°C. Viability of both sexes was normal. At 18°C, both males and
females were sterile.
The
noi1 and
noi2 had
been generated by the mobilization of a
mini-
white+-marked P-transposon,
P-
lacW (
8). In situ hybridization on
polytene
chromosomes located a single P-element insertion at 83B
on the right
arm of the third chromosome for both strains. The
two alleles appeared
to have an insertion at the same site, or
at very close sites, as
Southern blotting of genomic DNA showed
junction fragments of identical
size for the two lines (data not
shown). To clone the genomic region
encompassing the
noi locus,
a genomic library of
noi1 was generated. Twelve phages with inserts
covering the region
of interest were isolated by screening the library
with a fragment
of the
white gene. Appropriate fragments
from these clones were
then used to obtain approximately 38 kb of
wild-type genomic DNA
flanking the insertion site (Fig.
1).

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 1.
Molecular map of the noi region. (A) Thirteen
kilobases around the site of the P-lacW insertions in
noi1 and noi2, which are
indicated by the triangle, is shown. Below the line, the arrows show
the three transcription units located in the region. The two left
arrows are interrupted to indicate that the position is approximate.
(B) The four lines depict the deleted sequences in four imprecise
excisions of the P elements. The uncertainties for three of the
deletions are indicated by the broken lines. (C) The PstI
genomic fragment, which rescues the noi mutations. The black
box indicates the position of the open reading frame. B,
BamHI; E, EcoRI; P, PstI.
|
|
In the next step, the transcript pattern was studied by using Northern
blotting of poly(A)
+ RNA extracted from ovaries, testes,
and carcasses of adult wild-type
flies. Genomic probes spanning the
region surrounding the P-element
insertion site hybridized with several
transcripts between 1.5
and 2.5 kb in size. We could classify
transcripts into three main
groups according to their position, size,
and pattern of expression,
suggesting the presence of three different
genes in the region.
A more accurate localization of the three
transcription units
was obtained after screening of a cDNA library and
mapping of
those clones onto the
noi genomic region. One of
the transcription
units lies on the proximal side (toward the
centromere) of the
P-transposon insertion, and the two others are
located distally
(Fig.
1). The two genes surrounding the insertion site
are transcribed
in opposite directions away from the transposon. Given
that P
elements frequently insert at the promoter region of genes,
either
of the flanking transcription units could be affected by the
P-element
insertion to yield the
noi1 and
noi2 male sterile phenotype. None of the three
genes showed a testis-limited
expression; they were also expressed in
ovaries and gonadectomized
adults. The identification of
noi
was pursued by two approaches:
the generation and molecular
characterization of new alleles,
including deletions, and the rescue of
the mutations by transformation
with a genomic fragment.
Generation of additional alleles of noi.
The transposons
in noi1 and noi2 were
mobilized by crosses to a strain providing a source of transposase
(50). Screening for excision or modification of the
transposon was based on the loss of the white+
eye color marker. Over 400 independent lines were generated. They
showed a variety of phenotypes. Several broad categories could be
defined on the basis of their phenotype at 25°C.
The first class, comprising close to two-thirds of the lines, showed
reversion of the male sterility to wild-type fertility
in homozygotes.
Some lines still showed reduced fertility or sterility
when tested over
a deficiency. Within the limit of resolution
of our Southern analysis
(about 50 bp) this class corresponds
to the precise excision of the
transposon. These revertants confirmed
that the insertion of a P
element at 83B was the cause of the
noi1 and
noi2 mutations.
About 15% of the strains fell into the second category, whose strains
exhibited a phenotype similar to the original alleles,
homozygous male
sterility and female fertility. All 10 lines analyzed
at the molecular
level showed internal deletions of the transposon
(both ends still
present). An opposite phenotype, male fertility
but female sterility
(or reduced fertility), was observed for
1% of the lines (class 3).
Another 2% of the strains (class 4)
were homozygous sterile (or almost
sterile) in both sexes. The
latter two classes also appeared to bear
internal deletions of
the P element. In these three categories,
viability was good.
A fifth class, composed of close to 15% of the lines, showed
homozygous lethality. A variety of molecular alterations was
found in
these strains. In some cases, part of the P element was
still present
(both or only one of the extremities). In other
lines, we could not
detect any obvious alteration such as the
presence of a piece of the
transposon or the deletion of genomic
DNA. Finally, four lines showed
deletion of genomic sequences
and no remains of the transposon (Fig.
1). Three lines, carrying
Df(3R)noi-A,
Df(3R)noi-B, and
Df(3R)noi-D, had genomic
sequences
deleted from approximately the insertion site toward the
centromere.
The fourth line, carrying
Df(3R)noi-C, had
mainly distal sequences
deleted.
The final category of lines, class 6, was quite heterogeneous in terms
of viability (good to poor) and fertility (male sterile
or sterile in
both sexes). In some cases, females were less viable
than males. They
had visible phenotypes in common, such as a loss
of macrochaetes and a
reduction in the number of bristles of the
male sex combs. These lines
have not been analyzed at the molecular
level.
Crosses between representative alleles of each class were performed at
two temperatures and will be described elsewhere. Data
relevant to the
present study are presented in Table
1.
Several
deductions could be made from crosses between alleles of class
2 and the proximal and distal deletions. First, the mutations
show
clear cold sensitivity, the phenotypes being stronger at
18°C than at
25°C. Second, although male sterile alleles (class
2) show good
viability and female fertility at 25°C as homozygotes,
they are in
fact affected in both aspects. In
trans-heterozygotes
with a
deficiency, viability can be strongly reduced and even
null for some
crosses at 18°C. Lethality appears polyphasic, with
some progeny
being lost during the larval stages, others being
lost during pupation,
and some undergoing death soon after eclosion.
In addition, development
can be very slow (up to 50% slower) compared
to heterozygous siblings.
We conclude from these data that the
male sterile mutations are
hypomorphic and that
noisette is an
essential gene.
Alteration of oogenesis was revealed by comparison
of the progeny from
heterozygous and homozygous females: phenotypes
were always worse in
the latter case, suggesting a strong maternal
contribution. Similar
conclusions could be made from the analysis
of class 3, 4, and 6 alleles. Third, slight differences between
the three proximal deletions
and the distal one were observed
at least in some crosses. For
instance, viability, lethal phase,
rates of development, or fertility
were worse when class 2 or
class 3 mutations were in
trans
with
Df(3R)noi-A or
Df(3R)noi-D (proximal) than
with
Df(3R)noi-C (distal). This suggested that
noi lies proximal to the P-element insertion site.
Rescue of noisette mutations.
We tested the
hypothesis that noi corresponded to the transcription unit
proximal to the P-transposon insertion site by germ line
transformation, to see whether a 3.6-kb genomic fragment could rescue
noi mutant phenotypes. This fragment encompasses the entire
proximal transcript but only a fraction of the distal transcription
unit (Fig. 1). Several independent transformed lines were obtained and
crossed to various noi alleles. All the phenotypes described
above, lethality, sterility (sex specific or not), and visible defects
were rescued by the transgene. The only unrescued phenotype was the
lethality caused by homozygosity of the deletions Df(3R)noi-A, Df(3R)noi-B, and
Df(3R)noi-C. We have evidence that either these deficiencies
uncover additional essential genes or these chromosomes bear another
lethal mutation elsewhere (data not shown). These rescue experiments
clearly identified noi as the proximal transcription unit.
noi is homologous to the human
SF3a60 gene.
cDNA clones corresponding to
the 1.8-kb RNA of the proximal transcription unit were isolated from
ovarian and 4- to 8-h embryonic libraries. They were found to be
essentially the same, except for two polymorphisms in the 3'
untranslated region and different 5' ends. We assume that the
differences at the 5' ends were likely to be due to incomplete reverse
transcription. Differences in the coding region were not found.
Comparison of the cDNA and genomic sequences showed an absence of
introns. The P-element insertion in noi1 was
found to lie 92 nucleotides upstream of the translation initiation codon. The longest three cDNA clones, whose sizes were close to those
expected for full-length clones, as judged by comparison to the mRNA
length, extended upstream of the insertion site. Another clone stopped
one nucleotide downstream of the insertion site. Although we have not
mapped more precisely the transcription initiation site(s), these data
suggested that the P-element insertion in noi1
(and probably also noi2) was in the 5'
untranslated region.
The deduced amino acid sequence revealed a polypeptide of 503 amino
acids with extensive homology to an essential U2 snRNP-associated
polypeptide, the 60-kDa subunit of human splicing factor SF3a
(
32), also called SAP 61 (
13) (66% identity),
and to the
Saccharomyces cerevisiae PRP9p protein
(
37) (26% identity) (Fig.
2).
Identity
among the three proteins is 23%. Homology runs along the
entire
length of the polypeptides with a few particularly noticeable
regions. The highest conservation, close to 50% identity among
the
three species, resides in an about-120-residue C-terminal
region, which
contains a conserved C
2H
2 zinc finger-like
motif.
Another putative zinc finger found in PRP9p but not in
SF3a
60 (
32) is also absent in NOI. Instead, this
region shows a striking
conservation between human and
Drosophila (98% identity between
amino acids 241 and 292).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 2.
Alignments of the deduced amino acid sequences of human
SF3a60 (H s), Drosophila NOI (D m), and S. cerevisiae PRP9p (S c). Identical amino acids between
SF3a60 and NOI or between NOI and PRP9p are indicated by a
vertical line, and conservative changes (D and E; K and R; N and Q; I,
L, and V; S and T; F and Y) are indicated by a colon. Identities
between SF3a60 and PRP9p not found in NOI are underlined.
Stars above the sequences indicate identical residues among the three
species. Conservative changes are shown by the plus signs. The amino
acids substituted in the two yeast prp9 thermosensitive
alleles are shown in bold. Residue 78 mutated in prp9-1
(37) is conserved in human but not in Drosophila,
while residue 177 mutated in prp9-2 (38) is
conserved in the three species. The putative zinc finger is doubly
underlined.
|
|
Expression pattern of NOI.
Given the high level of
conservation described above, a polyclonal antibody raised against
human SF3a60 (32) was tested on
Drosophila tissues. Immunostainings on wild-type embryos
showed a prominent and ubiquitous nuclear localization throughout
embryogenesis (Fig. 3), except during the
very early syncytial stages, during which strong cytoplasmic staining
was also observed. Specificity of the antiserum was verified on embryos which were homozygous mutants for one of the proximal deficiencies. No
difference was seen during early embryogenesis, a fact that we
attributed to the large amount of protein coming from maternal contribution. However, starting at the beginning of germ band retraction, staining of homozygous embryos started to fade and had
almost completely disappeared by the end of germ band retraction (data
not shown), thus confirming that the antibody recognized NOI. In
addition, Western blots of wild-type embryonic nuclear extracts
revealed a single band of about 60 kDa, which is almost exactly the
expected size (data not shown).

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of NOI during embryogenesis as revealed by
whole-mount immunostaining with an antibody against human
SF3a60. Four stages are shown. (A) Syncytial blastoderm,
early stage 4. (B) Beginning of gastrulation, stage 6. Note that all
the cells contain NOI, including the pole cells. (C) Slow phase of germ
band elongation, stage 9. (D) End of germ band retraction, late stage
12 to early stage 13. Insets are fourfold enlargements showing the
predominantly nuclear localization.
|
|
NOI protein was detected in the nuclei of all the cells examined,
although the levels of expression were variable. Expression
was strong
and at a rather uniform level in all the cells of larval
imaginal discs
(Fig.
4A). Strong staining was observed
in the
germ cells of larval testes, but expression appeared weaker in
fat body cells surrounding the gonads (Fig.
4B). Relatively weak
expression was also found in other larval tissues, including the
polyploid nuclei of salivary glands and the diploid nuclei of
the brain
(data not shown). Because of the phenotypes described
below, we also
examined the expression of NOI in adult gonads.
In ovaries, expression
was detected in all the germ cells and
probably all the somatic cells
(Fig.
4C to E). In testes, the
protein was also found in somatic and
germ line cells. In particular,
strong staining was detected in all the
premeiotic stages, including
the stem cells, the spermatogonia, and the
spermatocytes (Fig.
4F). It should be noted that the nuclear staining
was not uniform
and that NOI appeared to be completely excluded from
nucleoli
(Fig.
4G to I).

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of NOI in wild-type third-instar larval
tissues and adult gonads. (A) A larval leg imaginal disc. Note that all
the nuclei show staining at a similar intensity. (B) A larval testis,
surrounded by a piece of fat body. Very intense staining was observed
in germ cells. (C to E) Different stages from an adult ovary. (C) A
germarium containing the germ line and follicle stem cells and
assembling egg chambers. (D) Late previtellogenic egg chambers
containing the germ line nurse cells surrounded by a layer of follicle
cells. (E) A stage 10 egg chamber. (F) Tip of an adult testis showing
the expression of NOI in germ line stem cells, spermatogonia, and
primary spermatocytes. (G to I) Enlargements of nuclei from nurse cells
(G), follicle cells (H), and primary spermatocytes (I), showing the
nonuniform nuclear distribution of NOI and its absence from nucleoli.
|
|
Mutant phenotypes.
The null phenotype of noi was
determined by using the deletions described in Fig. 1. Combinations of
mutations that could be rescued to viability with the
noi+ transgene, that is,
trans-heterozygotes between proximal and distal deletions or
homozygotes Df(3R)noi-D, were used and gave identical
results. Embryonic development seemed completely normal, producing
embryos of apparently wild-type morphology. Nevertheless, these embryos
failed to hatch, although they stayed alive and moved in the egg shell
for a few hours. This phenotype certainly corresponds to a complete
zygotic loss of function of noisette, since
Df(3R)noi-D was found to be a DNA null allele, having 1,485 bp of genomic DNA entirely proximal to the P-element site of insertion deleted, that is, 92 nucleotides upstream of the start codon to 117 nucleotides upstream of the stop codon.
The consequence of loss of
noisette in the male germline was
studied in detail for three of the male sterile (class 2) alleles,
noi1 and
noi2, the
original mutations, and
noi12, one of the
derivatives showing an internal deletion of P-element
sequences.
Homozygous adult males showed small testes of a size
comparable to that
found in mutants completely devoid of a germ
line. By phase-contrast
microscopy only rare spermatocytes could
be found. Exceptionally, some
scarce nonmotile sperm were also
present. The phenotype observed in
homozygous males was probably
close to a complete zygotic loss of
function of
noi in the male
germ line, since it appeared
almost as severe as the phenotype
observed for the same alleles in
hemizygotes.
Staining with an antibody against the germ cell-specific VASA protein
(
35) was used to analyze more precisely the germinal
content
of the testes. Figure
5 illustrates the
phenotype observed
in 3- to 4-day-old homozygous adults. In the worst
case, germ
cells were completely absent. In less defective gonads, stem
cells
at the tip of the testes were missing, but a few groups of
spermatogonia
and/or spermatocytes could be found. No complete cysts of
16 spermatocytes
or 64 spermatids have been seen, although the
occasional presence
of sperm suggests that normal cysts probably exist
at low frequency,
possibly earlier during development. Additional
evidence of a
degradation of the germ line with aging is provided by
the percentage
of completely empty gonads. In one experiment at 25°C,
homozygous
noi2 males showed 32% of empty
testes 1 to 2 days after eclosion and
63% after 5 to 6 days. The
noi12 allele appeared even more defective, with
88% of testes completely
devoid of germ cells at 1 to 2 days and 99%
after 5 to 6 days.
Cysts of spermatocytes were also less numerous and
contained fewer
cells in
noi12 than
noi2 homozygotes. The loss of germ cells is
probably due to autonomous
lack of
noi activity, since
testis somatic cells appeared normal.
In particular, the cells of the
hub, which are in very close contact
with the germ line stem cells,
were present as revealed by staining
with an antibody against fasciclin
III, and the hub was slightly
larger and displaced from the testis
apex, as was shown for gonads
completely devoid of germ cells
(
21) (data not shown).

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 5.
noi male sterile phenotype. Germ cells were
stained with an antibody against the VASA protein. (A) Low
magnification of a wild-type adult testis. Note the elongated coiled
morphology which accommodates the long sperm tails. (B) Same
magnification of a mutant adult testis. Note the small size of the
gonad, the absence of posterior coiling, and the rare germ cells. (C
and D) Higher magnification of mutant adult testes showing the range of
germ line defects: one gonad completely empty (C, right), one gonad
with two isolated spermatocytes (arrowheads, C, left), and one gonad
with several incomplete cysts containing fewer than 16 spermatocytes
(D). (E through G) A wild-type (E) and two mutant (F and G) testes from
late third-instar larvae (anterior ends up). Mutant genotypes were
homozygous w1118;noi2 (B,
C, D, and F) and homozygous
w1118;noi12 (G).
|
|
The effect of these mutations could be detected earlier in development.
The size of testes from third-instar larvae was at
best half that of a
wild type (Fig.
5). The pool of stem cells
at the distal tip of the
gonad was already depleted or reduced.
A reduced number of primary
spermatocytes was also observed, and
cysts appeared incomplete and more
or less disorganized. Like
in adults, defects in
noi12 were slightly more pronounced than in the
original
noi1 and
noi2
alleles.
Sterility or reduced fertility was observed in females homozygous for a
few of the P-element excision derivatives as well
as in several
trans-allelic combinations, such as the class 2
male sterile
mutations over a deficiency. In no case have we observed
female germ
line death or any evidence of overall decreased numbers
of germ cells.
However, this does not rule out a requirement of
noi for the
survival of the female germ cells, because we probably
do not have null
mutations specific for the female germ line.
Oogenic defects ranged
from arrest before vitellogenesis to the
production of apparently
normal eggs, which were laid but did
not develop. The strongest
phenotype that we observed was a block
of oogenesis around stage 6 or
7, leading to the accumulation
of egg chambers showing several striking
defects. The number of
nurse cells per cyst was sometimes reduced and
their nuclei contained
a few spherical or elongated aggregates, instead
of the normal
filamentous appearance seen under phase microscopy (Fig.
6). It
should be noted that those
aggregates did not exactly resemble
any of the different types of
chromosome condensation seen during
the previtellogenic stages of
differentiation (
27,
29). The
oocyte nucleus was sometimes
absent or mislocalized, which could
lead to yolk accumulation in the
middle of the egg chamber (Fig.
6). Late defects included short and/or
flaccid eggs, showing fused,
short, or no dorsal appendages.

View larger version (145K):
[in this window]
[in a new window]
|
FIG. 6.
noi female sterile phenotype. A stage 8 wild-type egg chamber showing the posterior localization of the oocyte
nucleus (arrow) and the beginning of yolk accumulation (arrowhead). (B)
A mutant egg chamber with central oocyte nucleus (arrow) and yolk
accumulation (delimitated by arrowheads). (C) The posterior end of a
stage 7 wild-type egg chamber showing the oocyte nucleus (arrow) and
the filamentous aspect of chromatin in nurse cell nuclei. (D and E)
Examples of abnormal chromatin condensation in mutant nurse cells. The
mutant genotype was
w1118;noi22/Df(3R)noi-A.
|
|
Finally, some homozygous lines showed several morphologic adult
abnormalities. A common theme was the partial loss of several
types of
the largest body bristles (Fig.
7).
Typically, a variable
number of the head and thoracic macrochaetes were
missing. We
did not notice a strict order of disappearance, although
some
bristles appeared to be absent more frequently than others. For
example, the posterior scutellar macrochaetes may be more sensitive
than the anterior scutellar macrochaetes. The affected bristles
were
either absent or, occasionally, short and thin. In addition,
the socket
could also be missing. Another structure showing a
striking reduction
in the number of bristles was the male sex
comb. Finally, medial
bristles of the triple row at the anterior
wing margin could be absent
or short. These alterations were clearly
not due to complete loss of
function of
noi in the affected cells
since the frequency of
missing bristles increased dramatically
when the same alleles were
tested in hemizygotes.

View larger version (126K):
[in this window]
[in a new window]
|
FIG. 7.
Bristle loss in homozygous noi20
adults. (A and B) Wild-type and mutant heads, respectively. Note the
loss of several macrochaetes on the dorsal side. (C and D) Wild-type
and mutant dorsal thoraxes, respectively. (E and F) Wild-type and
mutant first legs of males, respectively. Note that this mutant sex
comb showed only 4 bristles instead of 12 to 14 (sex combs are
indicated with brackets). (G) Part of the anterior margin of a mutant
wing. The arrowhead points to a missing bristle from the median row.
Note that in this example, the socket was present.
|
|
 |
DISCUSSION |
While many genes encoding proteins involved in splice site
selection in constitutive and/or alternative splicing have been analyzed in Drosophila (see the introduction), only two
genes encoding snRNP-associated proteins have been identified so far, U1-70K (39) and snf (17,
24). Close homology to both the U1A and U2B" polypeptides
suggested that SNF is one of the tightly associated components of
either the U1 snRNP or the U2 snRNP, or both, and recent biochemical
analysis indicates that it is part of the U1 and U2 snRNPs
(48). We describe the cloning and genetic characterization
of a third gene, noi, encoding an snRNP-associated polypeptide.
Drosophila NOI and human SF3a60 have similar
sizes and show a high level of homology throughout their entire length.
The Drosophila and human polypeptides appear to be equally
distant from the yeast homolog PRP9p (26 and 27% identity,
respectively). Most of the residues conserved between yeast and
Drosophila or between yeast and human are in fact identical
in the three species. This comparison may identify a basic structural
and functional core. However, we also noticed that the amino acid
mutated in one of the yeast mutations, prp9-1
(37), is conserved in SF3a60 but not in NOI. The
highest domain of homology among the three species corresponds to the
120 C-terminal residues. This region includes a putative zinc finger,
which has been shown by site-directed mutagenesis to be essential
(37). Functionality across species was demonstrated by
swapping a fragment of 46 amino acids including the putative zinc
finger from SF3a60 into PRP9p (32). The role of
the putative zinc finger is unknown although binding to the partner
SF3a120 (SAP 114)-yeast PRP21p
has been excluded
(13, 36, 38). An obvious alternative is the binding to the
U2 snRNA or to pre-mRNA. The latter possibility seems particularly
attractive since experiments of UV cross-linking of partially purified
splicing complexes showed strong binding of SAP 61 at about 15 nucleotides upstream of the branchpoint (22). Strong
conservation between Drosophila and human is observed along
the entire length of the polypeptides, unlike PRP9, which shows about
50% identity in the C-terminal domain but less than 20% in the rest
of the protein. In particular, a domain of 52 amino acids in the middle
of the sequence is completely conserved between Drosophila
and human, but absent in yeast. It would be interesting to test whether
the human protein is functional in Drosophila.
Our genetic analysis suggests a surprising complexity in the
requirement for noi during fly development. Complete zygotic loss of function resulted in a simple phenotype, lethality at the end
of embryogenesis, without obvious morphological defects. This late
stage of lethality is probably due to the large and quite stable
maternal contribution. In fact, NOI antigen could be detected in mutant
embryos for at least half of embryogenesis. Embryonic lethality was
also found in snf null mutants (17), while
lethality was observed during the first larval stage in mutants with
mutations in other splicing factors, such as dU2AF50
(26), dU2AF38 (54), B52
(49), or hrp48 (23).
Hypomorphic alleles showed a variety of phenotypes, which may reflect
different sensitivities of different tissues to partial loss of
function of noi. Hints of the existence of variable
quantitative requirements were provided by the observation that the
level of expression of NOI was not completely uniform. For instance,
the male germ cells were found to contain very large amounts of NOI. Our mutation analysis suggested that the survival of the male germ
cells may be very sensitive to the lack of noi. One trivial hypothesis would be that this apparent sensitivity of the male germ
line is a bias of the mutations that were analyzed. It is possible that
the P-element insertions reduce noi activity more strongly
in the male germ line than in other tissues. However, it is plausible
that the development of the male germ line requires very large amounts
of some spliceosomal components. In mammals, extremely high levels of
overexpression, close to 3 orders of magnitude, have been found in male
germ cells for some components of the transcriptional machinery
(58, 59), but it is not known whether this overexpression is
functionally significant. A third possibility would be that the
processing of some transcripts encoding products required for male germ
cell survival is very sensitive to the level of the U2 snRNP.
The morphological phenotypes produced by some noi alleles
are reminiscent of those produced by altered expression of other splicing factors. Abnormal sex combs with fewer and thinner bristles have been reported for a partial loss of function of
dU2AF38 and has been interpreted to be due to an
inability to splice one or more pre-mRNAs needed for sex comb
differentiation (54). It is interesting that U2AF is the
factor that recruits the U2 snRNP during the transition from the E to
the A spliceosomal complexes. Decreased amounts of U2AF could therefore
lead to an effect similar to that of reduced U2 snRNP activity.
A hypomorphic mutation of the hrp48 gene, which encodes a
heterogeneous nuclear ribonucleoprotein particle protein, was found to
cause the absence of one specific macrochaete, the posterior supra alar
(23). Alteration of noi activity had a broader
effect, deleting more bristles, without evidence of a stronger
sensitivity of the posterior supra alar macrochaete. Strong loss of
macrochaetes has been produced by overexpression of the SR protein B52
(34). SR proteins have been implicated in splice site
selection during spliceosome assembly in both constitutive and
alternative splicing, and the balance between various SR proteins in
different cell types appears to strongly influence the selection (for
reviews, see references 19 and
66). As for the sex combs, the loss of macrochaetes
might be due to decreased splicing of one or a few pre-mRNAs encoding
key products necessary for bristle differentiation. Alternatively, the
occasional thin macrochaetes and the low growth rates could also be
explained by a general reduction of metabolism. The fact that the
larger bristles in various regions of the body are affected, but not
smaller bristles, would support this hypothesis. Of course this idea is
compatible with the possibility that some pre-mRNAs could be very
sensitive to a decreased activity of U2 snRNP. Finally, it should be
noted that the noi morphological defects are unlike the
phenotype caused by Minute mutations, which consists of
delayed development and short slender bristles, already observed in
heterozygous conditions. Further work will be needed to understand the
exact effect of particular noi mutations during fly
development.
 |
ACKNOWLEDGMENTS |
This work was supported by a grant of the Swiss Science
Foundation to D.P.
We thank Margaret T. Fuller for allowing us to screen her collection of
P-element-induced male sterile mutants. We are grateful to Angela
Krämer and Paul Macdonald for antibodies and to Angela Krämer for critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Zoology and Animal Biology, University of Geneva, 30 Quai
Ernest-Ansermet, 1211 Geneva 4, Switzerland. Phone: (41 22) 702 6346. Fax: (41 22) 702 6439. E-mail: pauli{at}sc2a.unige.ch.
Present address: Laboratory of Cellular and Developmental Biology,
NIDDK, National Institutes of Health, Bethesda, MD 20892.
 |
REFERENCES |
| 1.
|
Adams, M. D.,
R. S. Tarng, and D. C. Rio.
1997.
The alternative splicing factor PSI regulates P-element third intron splicing in vivo.
Genes Dev.
11:129-138[Abstract/Free Full Text].
|
| 2.
|
Albrecht, E. B., and H. K. Salz.
1993.
The Drosophila sex determination gene snf is utilized for the establishment of the female-specific splicing pattern of Sex-lethal.
Genetics
134:801-807[Abstract].
|
| 3.
|
Baker, B. S.
1989.
Sex in flies: the splice of life.
Nature (London)
340:521-524[Medline].
|
| 4.
|
Behrens, S. E.,
F. Galisson,
P. Legrain, and R. Lührmann.
1993.
Evidence that the 60-kDa protein of 17S U2 small nuclear ribonucleoprotein is immunologically and functionally related to the yeast PRP9 splicing factor and is required for the efficient formation of prespliceosomes.
Proc. Natl. Acad. Sci. USA
90:8229-8233[Abstract/Free Full Text].
|
| 5.
|
Bender, W.,
P. Spierer, and D. S. Hogness.
1983.
Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila melanogaster.
J. Mol. Biol.
168:17-33[Medline].
|
| 6.
|
Bennett, M.,
S. Michaud,
J. Kingston, and R. Reed.
1992.
Protein components specifically associated with prespliceosome and spliceosome complexes.
Genes Dev.
6:1986-2000[Abstract/Free Full Text].
|
| 7.
|
Bennett, M., and R. Reed.
1993.
Correspondence between a mammalian spliceosome component and an essential yeast splicing factor.
Science
262:105-108[Abstract/Free Full Text].
|
| 8.
|
Bier, E.,
H. Vaessin,
S. Shepherd,
K. Lee,
K. McCall,
S. Barbel,
L. Ackerman,
R. Carretto,
T. Uemura,
E. Grell,
L. Y. Jan, and Y. N. Jan.
1989.
Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector.
Genes Dev.
3:1273-1287[Abstract/Free Full Text].
|
| 9.
|
Brosi, R.,
K. Gröning,
S. E. Behrens,
R. Lührmann, and A. Krämer.
1993.
Interaction of mammalian splicing factor SF3a with U2 snRNP and relation of its 60-kD subunit to yeast PRP9.
Science
262:102-105[Abstract/Free Full Text].
|
| 10.
|
Brosi, R.,
H. P. Hauri, and A. Krämer.
1993.
Separation of splicing factor SF3 into two components and purification of SF3a activity.
J. Biol. Chem.
268:17640-17646[Abstract/Free Full Text].
|
| 11.
|
Brown, N. H., and F. C. Kafatos.
1988.
Functional cDNA libraries from Drosophila embryos.
J. Mol. Biol.
203:425-437[Medline].
|
| 12.
|
Champlin, D. T.,
M. Frasch,
H. Saumweber, and J. T. Lis.
1991.
Characterization of a Drosophila protein associated with boundaries of transcriptionally active chromatin.
Genes Dev.
5:1611-1621[Abstract/Free Full Text].
|
| 13.
|
Chiara, M. D.,
P. Champion-Arnaud,
M. Buvoli,
B. Nadal-Ginard, and R. Reed.
1994.
Specific protein-protein interactions between the essential mammalian spliceosome-associated proteins SAP 61 and SAP 114.
Proc. Natl. Acad. Sci. USA
91:6403-6407[Abstract/Free Full Text].
|
| 14.
|
Cléard, F.,
M. Matsarskaia, and P. Spierer.
1995.
The modifier of position-effect variegation Suvar(3)7 of Drosophila: there are two alternative transcripts and seven scattered zinc fingers, each preceded by a tryptophan box.
Nucleic Acids Res.
23:796-802[Abstract/Free Full Text].
|
| 15.
|
Cline, T. W., and B. J. Meyer.
1996.
Vive la difference: males vs females in flies vs worms.
Annu. Rev. Genet.
30:637-702[Medline].
|
| 16.
|
Denhez, F., and R. Lafyatis.
1994.
Conservation of regulated alternative splicing and identification of functional domains in vertebrate homologs to the Drosophila splicing regulator, suppressor-of-white-apricot.
J. Biol. Chem.
269:16170-16179[Abstract/Free Full Text].
|
| 17.
|
Flickinger, T. W., and H. K. Salz.
1994.
The Drosophila sex determination gene snf encodes a nuclear protein with sequence and functional similarity to the mammalian U1A snRNP protein.
Genes Dev.
8:914-925[Abstract/Free Full Text].
|
| 18.
|
Fridell, R. A., and L. L. Searles.
1994.
Evidence for a role of the Drosophila melanogaster suppressor of sable gene in the pre-mRNA splicing pathway.
Mol. Cell. Biol.
14:859-867[Abstract/Free Full Text].
|
| 19.
|
Fu, X. D.
1995.
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[Medline].
|
| 20.
|
Geyer, P. K.,
A. J. Chien,
V. G. Corces, and M. M. Green.
1991.
Mutations in the su(s) gene affect RNA processing in Drosophila melanogaster.
Proc. Natl. Acad. Sci. USA
88:7116-7120[Abstract/Free Full Text].
|
| 21.
|
Gönczy, P.,
S. Viswanathan, and S. DiNardo.
1992.
Probing spermatogenesis in Drosophila with P-element enhancer detectors.
Development
114:89-98[Abstract].
|
| 22.
|
Gozani, O.,
R. Feld, and R. Reed.
1996.
Evidence that sequence-independent binding of highly conserved U2 snRNP proteins upstream of the branch site is required for assembly of spliceosomal complex A.
Genes Dev.
10:233-243[Abstract/Free Full Text].
|
| 23.
|
Hammond, L. E.,
D. Z. Rudner,
R. Kanaar, and D. C. Rio.
1997.
Mutations in the hrp48 gene, which encodes a Drosophila heterogeneous nuclear ribonucleoprotein particle protein, cause lethality and developmental defects and affect P-element third-intron splicing in vivo.
Mol. Cell. Biol.
17:7260-7267[Abstract].
|
| 24.
|
Harper, D. S.,
L. D. Fresco, and J. D. Keene.
1992.
RNA binding specificity of a Drosophila snRNP protein that shares sequence homology with mammalian U1-A and U2-B" proteins.
Nucleic Acids Res.
20:3645-3650[Abstract/Free Full Text].
|
| 25.
|
Heinrichs, V., and B. S. Baker.
1995.
The Drosophila SR protein RBP1 contributes to the regulation of doublesex alternative splicing by recognizing RBP1 RNA target sequences.
EMBO J.
14:3987-4000[Medline].
|
| 26.
|
Kanaar, R.,
S. E. Roche,
E. L. Beall,
M. R. Green, and D. C. Rio.
1993.
The conserved pre-mRNA splicing factor U2AF from Drosophila: requirement for viability.
Science
262:569-573[Abstract/Free Full Text].
|
| 27.
|
Keyes, L. N., and A. C. Spradling.
1997.
The Drosophila gene fs(2)cup interacts with otu to define a cytoplasmic pathway required for the structure and function of germ-line chromosomes.
Development
124:1419-1431[Abstract].
|
| 28.
|
Kim, Y. J.,
P. Zuo,
J. L. Manley, and B. S. Baker.
1992.
The Drosophila RNA-binding protein RBP1 is localized to transcriptionally active sites of chromosomes and shows a functional similarity to human splicing factor ASF/SF2.
Genes Dev.
6:2569-2579[Abstract/Free Full Text].
|
| 29.
|
King, R. C.
1970.
.
Ovarian development in Drosophila melanogaster.
Academic Press, New York, N.Y.
|
| 30.
|
Krämer, A.
1996.
The structure and function of proteins involved in mammalian pre-mRNA splicing.
Annu. Rev. Biochem.
65:367-409[Medline].
|
| 31.
|
Krämer, A., and U. Utans.
1991.
Three protein factors (SF1, SF3 and U2AF) function in pre-splicing complex formation in addition to snRNPs.
EMBO J.
10:1503-1509[Medline].
|
| 32.
|
Krämer, A.,
P. Legrain,
F. Mulhauser,
K. Gröning,
R. Brosi, and G. Bilbe.
1994.
Splicing factor SF3a60 is the mammalian homologue of PRP9 of S. cerevisiae: the conserved zinc finger-like motif is functionally exchangeable in vivo.
Nucleic Acids Res.
22:5223-5228[Abstract/Free Full Text].
|
| 33.
|
Krämer, A.,
F. Mulhauser,
C. Wersig,
K. Gröning, and G. Bilbe.
1995.
Mammalian splicing factor SF3a120 represents a new member of the SURP family of proteins and is homologous to the essential splicing factor PRP21p of Saccharomyces cerevisiae.
RNA
1:260-272[Abstract].
|
| 34.
|
Kraus, M. E., and J. T. Lis.
1994.
The concentration of B52, an essential splicing factor and regulator of splice site choice in vitro, is critical for Drosophila development.
Mol. Cell. Biol.
14:5360-5370[Abstract/Free Full Text].
|
| 35.
|
Lasko, P. F., and M. Ashburner.
1990.
Posterior localization of vasa protein correlates with, but is not sufficient for, pole cell development.
Genes Dev.
4:905-921[Abstract/Free Full Text].
|
| 36.
|
Legrain, P., and C. Chapon.
1993.
Interaction between PRP11 and SPP91 yeast splicing factors and characterization of a PRP9-PRP11-SPP91 complex.
Science
262:108-110[Abstract/Free Full Text].
|
| 37.
|
Legrain, P., and A. Choulika.
1990.
The molecular characterization of PRP6 and PRP9 yeast genes reveals a new cysteine/histidine motif common to several splicing factors.
EMBO J.
9:2775-2781[Medline].
|
| 38.
|
Legrain, P.,
C. Chapon, and F. Galisson.
1993.
Interactions between PRP9 and SPP91 splicing factors identify a protein complex required in prespliceosome assembly.
Genes Dev.
7:1390-1399[Abstract/Free Full Text].
|
| 39.
|
Mancebo, R.,
P. C. H. Lo, and S. M. Mount.
1990.
Structure and expression of the Drosophila melanogaster gene for the U1 small nuclear ribonucleoprotein particle 70K protein.
Mol. Cell. Biol.
10:2492-2502[Abstract/Free Full Text].
|
| 40.
|
Maniatis, T.,
R. C. Hardison,
E. Lacy,
J. Lauer,
C. O'Connell,
D. Quon,
G. K. Sim, and A. Efstratiadis.
1978.
The isolation of structural genes from libraries of eucaryotic DNA.
Cell
15:687-701[Medline].
|
| 41.
|
Murray, M. V.,
M. A. Turnage,
K. J. Williamson,
W. R. Steinhauer, and L. L. Searles.
1997.
The Drosophila Suppressor of sable protein binds to RNA and associates with a subset of polytene chromosome bands.
Mol. Cell. Biol.
17:2291-2300[Abstract].
|
| 42.
|
Oliver, B.,
N. Perrimon, and A. P. Mahowald.
1988.
Genetic evidence that the sans fille locus is involved in Drosophila sex determination.
Genetics
120:159-171[Abstract/Free Full Text].
|
| 43.
|
Pascolo, E., and B. Séraphin.
1997.
The branchpoint residue is recognized during commitment complex formation before being bulged out of the U2 snRNA-pre-mRNA duplex.
Mol. Cell. Biol.
17:3469-3476[Abstract].
|
| 44.
|
Pauli, D.,
C.-H. Tonka,
A. Tissières, and A.-P. Arrigo.
1990.
Tissue-specific expression of the heat shock protein HSP27 during Drosophila melanogaster development.
J. Cell Biol.
111:817-828[Abstract/Free Full Text].
|
| 45.
|
Peng, X., and S. M. Mount.
1995.
Genetic enhancement of RNA-processing defects by a dominant mutation in B52, the Drosophila gene for an SR protein splicing factor.
Mol. Cell. Biol.
15:6273-6282[Abstract].
|
| 46.
|
Pennetta, G., and D. Pauli.
1997.
stand still, a Drosophila gene involved in the female germline for proper survival, sex determination and differentiation.
Genetics
145:975-987[Abstract].
|
| 47.
|
Pirrotta, V.
1988.
Vectors for P-mediated transformation in Drosophila, p. 437-456. In
R. L. Rodriguez, and D. T. Denhardt (ed.), Vectors: a survey of molecular cloning vectors and their uses.
Butterworths, Boston, Mass.
|
| 48.
|
Polycarpou-Schwarz, M.,
S. I. Gunderson,
S. Kandels-Lewis,
B. Seraphin, and I. W. Mattaj.
1996.
Drosophila SNF/D25 combines the functions of the two snRNP proteins U1A and U2B" that are encoded separately in human, potato, and yeast.
RNA
2:11-23[Abstract].
|
| 49.
|
Ring, H. Z., and J. T. Lis.
1994.
The SR protein B52/SRp55 is essential for Drosophila development.
Mol. Cell. Biol.
14:7499-7506[Abstract/Free Full Text].
|
| 50.
|
Robertson, H. M.,
C. R. Preston,
R. W. Phillis,
D. M. Johnson-Schlitz,
W. K. Benz, and W. R. Engels.
1988.
A stable genomic source of P element transposase in Drosophila melanogaster.
Genetics
118:461-470[Abstract/Free Full Text].
|
| 51.
|
Roth, M. B.,
A. M. Zahler, and J. A. Stolk.
1991.
A conserved family of nuclear phosphoproteins localized to sites of polymerase II transcription.
J. Cell Biol.
115:587-596[Abstract/Free Full Text].
|
| 52.
|
Rubin, G. M., and A. C. Spradling.
1983.
Vectors for P element-mediated gene transfer in Drosophila.
Nucleic Acids Res.
11:6341-6351[Abstract/Free Full Text].
|
| 53.
|
Ruby, S. W.,
T. H. Chang, and J. Abelson.
1993.
Four yeast spliceosomal proteins (PRP5, PRP9, PRP11, and PRP21) interact to promote U2 snRNP binding to pre-mRNA.
Genes Dev.
7:1909-1925[Abstract/Free Full Text].
|
| 54.
|
Rudner, D. Z.,
R. Kanaar,
K. S. Breger, and D. C. Rio.
1996.
Mutations in the small subunit of the Drosophila U2AF splicing factor cause lethality and developmental defects.
Proc. Natl. Acad. Sci. USA
93:10333-10337[Abstract/Free Full Text].
|
| 55.
|
Salz, H. K.
1992.
The genetic analysis of snf: a Drosophila sex determination gene required for activation of Sex-lethal in both the germline and the soma.
Genetics
130:547-554[Abstract].
|
| 56.
|
Salz, H. K., and T. W. Flickinger.
1996.
Both loss-of-function and gain-of-function mutations in snf define a role for snRNP proteins in regulating Sex-lethal pre-mRNA splicing in Drosophila development.
Genetics
144:95-108[Abstract].
|
| 57.
|
Sarkissian, M.,
A. Winne, and R. Lafyatis.
1996.
The mammalian homolog of suppressor-of-white-apricot regulates alternative mRNA splicing of CD45 exon 4 and fibronectin IIICS.
J. Biol. Chem.
271:31106-31114[Abstract/Free Full Text].
|
| 58.
|
Schmidt, E. E., and U. Schibler.
1995.
High accumulation of components of the RNA polymerase II transcription machinery in rodent spermatids.
Development
121:2373-2383[Abstract].
|
| 59.
|
Schmidt, E. E., and U. Schibler.
1997.
Developmental testis-specific regulation of mRNA levels and mRNA translational efficiencies for TATA-binding protein mRNA isoforms.
Dev. Biol.
184:138-149[Medline].
|
| 60.
|
Siebel, C. W.,
A. Admon, and D. C. Rio.
1995.
Soma-specific expression and cloning of PSI, a negative regulator of P element pre-mRNA splicing.
Genes Dev.
9:269-283[Abstract/Free Full Text].
|
| 61.
|
Smith, J. L.,
J. E. Wilson, and P. M. Macdonald.
1992.
Overexpression of oskar directs ectopic activation of nanos and presumptive pole cell formation in Drosophila embryos.
Cell
70:849-859[Medline].
|
| 62.
|
Staknis, D., and R. Reed.
1994.
Direct interactions between pre-mRNA and six U2 small nuclear ribonucleoproteins during spliceosome assembly.
Mol. Cell. Biol.
14:2994-3005[Abstract/Free Full Text].
|
| 63.
|
Steinmann-Zwicky, M.
1988.
Sex determination in Drosophila: the X-chromosomal gene liz is required for Sxl activity.
EMBO J.
7:3889-3898[Medline].
|
| 64.
|
Stroumbakis, N. D.,
Z. Li, and P. P. Tolias.
1994.
RNA- and single-stranded DNA-binding (SSB) proteins expressed during Drosophila melanogaster oogenesis: a homolog of bacterial and eukaryotic mitochondrial SSBs.
Gene
143:171-177[Medline].
|
| 65.
|
Sun, J. S., and J. L. Manley.
1995.
A novel U2-U6 snRNA structure is necessary for mammalian mRNA splicing.
Genes Dev.
9:843-854[Abstract/Free Full Text].
|
| 66.
|
Valcárcel, J., and M. R. Green.
1996.
The SR protein family: pleiotropic functions in pre-mRNA splicing.
Trends Biochem. Sci.
21:296-301[Medline].
|
| 67.
|
Wells, S. E., and M. Ares, Jr.
1994.
Interactions between highly conserved U2 small nuclear RNA structures and Prp5p, Prp9p, Prp11p, and Prp21p proteins are required to ensure integrity of the U2 small nuclear ribonucleoprotein in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:6337-6349[Abstract/Free Full Text].
|
| 68.
|
Yan, D., and M. Ares, Jr.
1996.
Invariant U2 RNA sequences bordering the branchpoint recognition region are essential for interaction with yeast SF3a and SF3b subunits.
Mol. Cell. Biol.
16:818-828[Abstract].
|
| 69.
|
Zachar, Z.,
T. B. Chou,
J. Kramer,
I. P. Mims, and P. M. Bingham.
1994.
Analysis of autoregulation at the level of pre-mRNA splicing of the suppressor-of-white-apricot gene in Drosophila.
Genetics
137:139-150[Abstract].
|
Mol Cell Biol, April 1998, p. 1835-1843, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rawls, J. M. Jr.
(2006). Analysis of Pyrimidine Catabolism in Drosophila melanogaster Using Epistatic Interactions With Mutations of Pyrimidine Biosynthesis and {beta}-Alanine Metabolism. Genetics
172: 1665-1674
[Abstract]
[Full Text]
-
Tanackovic, G., Kramer, A.
(2005). Human Splicing Factor SF3a, but Not SF1, Is Essential for Pre-mRNA Splicing In Vivo. Mol. Biol. Cell
16: 1366-1377
[Abstract]
[Full Text]
-
Nesic, D., Kramer, A.
(2001). Domains in Human Splicing Factors SF3a60 and SF3a66 Required for Binding to SF3a120, Assembly of the 17S U2 snRNP, and Prespliceosome Formation. Mol. Cell. Biol.
21: 6406-6417
[Abstract]
[Full Text]
-
Nagengast, A. A., Salz, H. K.
(2001). The Drosophila U2 snRNP protein U2A' has an essential function that is SNF/U2B'' independent. Nucleic Acids Res
29: 3841-3847
[Abstract]
[Full Text]
-
Cline, T. W., Rudner, D. Z., Barbash, D. A., Bell, M., Vutien, R.
(1999). Inaugural Article: Functioning of the Drosophila integral U1/U2 protein Snf independent of U1 and U2 small nuclear ribonucleoprotein particles is revealed by snf+ gene dose effects. Proc. Natl. Acad. Sci. USA
96: 14451-14458
[Abstract]
[Full Text]