Received 25 August 1997/Returned for modification 7 October
1997/Accepted 26 January 1998
Under conditions of environmental stress, prokaryotes and lower
eukaryotes such as the yeast Saccharomyces cerevisiae
selectively utilize particular subunits of RNA polymerase II (pol II)
to alter transcription to patterns favoring survival. In S. cerevisiae, a complex of two such subunits, RPB4 and RPB7,
preferentially associates with pol II during stationary phase; of these
two subunits, RPB4 is specifically required for survival under
nonoptimal growth conditions. Previously, we have shown that RPB7
possesses an evolutionarily conserved human homolog, hsRPB7, which was
capable of partially interacting with RPB4 and the yeast
transcriptional apparatus. Using this as a probe in a two-hybrid
screen, we have now established that hsRPB4 is also conserved in higher
eukaryotes. In contrast to hsRPB7, hsRPB4 has diverged so that it no
longer interacts with yeast RPB7, although it partially complements
rpb4
phenotypes in yeast. However, hsRPB4 associates
strongly and specifically with hsRPB7 when expressed in yeast or in
mammalian cells and copurifies with intact pol II. hsRPB4 expression in humans parallels that of hsRPB7, supporting the idea that the two
proteins may possess associated functions. Structure-function studies
of hsRPB4-hsRPB7 are used to establish the interaction interface
between the two proteins. This identification completes the set of
human homologs for RNA pol II subunits defined in yeast and should
provide the basis for subsequent structural and functional characterization of the pol II holoenzyme.
 |
INTRODUCTION |
Selective control of mRNA
transcription in response to intracellular and extracellular signals
occurs at multiple levels, with targets for regulation including
gene-specific transcription factors, general transcription factors, and
the RNA polymerase II holoenzyme (15, 18, 38, 55, 63). This
last mechanism of regulation, involving modification of core RNA
polymerase II (pol II) structural composition by altering incorporation
of subunits or regulated phosphorylation, has been well documented in
prokaryotes and in yeast (17, 31, 59, 62, 70). In
higher eukaryotes, the majority of transcriptional control studies
have focused on characterizing the expression and modification of
gene-specific and general transcription factors. However, a growing
body of work on mammalian transcriptional control has demonstrated that mammalian pol II is also subject to modification by phosphorylation of
the largest subunit, presumably as a means of regulation (10, 24,
41, 42, 49). In contrast, the issue of subunit variation has not
been actively investigated.
Studies of eukaryotic pol II function have depended heavily on
paradigms developed through detailed characterization of the yeast
Saccharomyces cerevisiae pol II (reviewed in reference
70). Yeast pol II contains 12 subunits (RPB1-12),
all of which have been cloned and sequenced and many of which have been
subjected to genetic and biochemical functional analysis. Five of these subunits, the common subunits (RPB5, RPB6, RPB8, RPB10, and RPB12), are
also incorporated into RNA polymerases I and III (64, 69). Mutational analysis indicates that 10 of the 12 subunits are essential for growth, whereas two, RPB4 and RPB9, are dispensable under moderate
growth conditions but required under various suboptimal growth
conditions (67, 68). Ten of the 12 subunits are obligate components of all intact RNA pol II molecules, whereas two (RPB4 and
RPB7) form a subcomplex that is preferentially incorporated under
suboptimal growth conditions such as stationary phase (16, 17,
20). The RPB4-RPB7 subcomplex has been hypothesized to play a
stress-protective role (16, 17), potentially by redirecting transcriptional specificity in a manner analogous to sigma factors in
prokaryotes (31).
Although human RNA polymerase II is much less well characterized than
its yeast counterpart, biochemical and genetic assays of human pol II
as well as exploration of the expanding sequence databases have
identified homologs for 11 of the 12 defined yeast RNA pol II subunits
(1-3, 23, 37, 46, 47, 50, 51, 60, 66). The sole exception,
a putative hsRPB4 (human RPB4), evaded detection by the standard
approaches used to identify most of the other subunits. In an earlier
study, we cloned hsRPB7 based on its ability to induce hyperpolarized
budding when overexpressed in S. cerevisiae as part of a
screen we performed to identify novel human genes which could regulate
cell growth controls (37, 40). In a series of functional
characterizations, we demonstrated that hsRPB7 could complement
lethality of an rpb7
deletion and weakly conserved the
ability to interact with yeast RPB4 (37). Based on
this conservation, it seemed likely that RPB4 would similarly
have been evolutionarily conserved. We therefore used hsRPB7 as bait in
a two-hybrid screen in an attempt to establish the existence of hsRPB4.
Here we describe the cloning of hsRPB4 and characterize the hsRPB4
interaction with yeast pol II and hsRPB7, thus completing the set of
human homologs of yeast RNA polymerase II subunits and providing the
basis for subsequent functional studies.
 |
MATERIALS AND METHODS |
Bacterial and yeast strains and mammalian cell lines.
The
Escherichia coli DH5
F' [F'/endA1
hsdR17(rK
mK+)supE44 thi-1 recA1 gyrA
(Nalr)
relA1
(lacZYA-argF)
U169 (f80lacD(lacZ)M15)]
was used as a host for all cloning constructions. E. coli KC8 [hsdR leuB600 trpC9830 pyrF::Tn5 hisB463 lacDX74 strA galUK]
(constructed by K. Struhl [described in references
28 and 29]) was used for
purification of library plasmids following two-hybrid library
screening. S. cerevisiae EGY191 (MATa
ura3 his3 trp131exAop-leu2) was used for library screen and
two-hybrid assays (21). The yeast strain WY-4
(MATa his3
200 leu2-3 leu2-112 ura3-52
RPB4
1::His3), a derivative of N114 (68), was
used for hsRPB4 complementation studies. Yeast cells were grown either
on YPD rich medium or on complete minimal medium lacking combinations
of amino acids or containing zeocin to select for the presence of
plasmids (7).
The African green monkey kidney cell line Cos-1 was used for
transfection, immunoprecipitation, and immunofluorescence studies of
hsRBP4. The HeLa human cervical carcinoma cell line was used for
fractionation experiments. All cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf serum.
Cloning of hsRPB4.
Two-hybrid screening was performed as
described in standard protocols (28). The HeLa cell yeast
expression library in the vector pJG4-5 which was used for two-hybrid
screening has been described previously (29). Briefly, the
two-hybrid library was transformed by lithium acetate (56)
into the yeast strain EGY191, along with the pEG202-hsRPB7 plasmid
(37) as bait and JK103 as LacZ reporter (28). A
total of 3.5 × 105 primary transformants were
screened, resulting in the identification of five positive clones.
Purified library plasmids were sequenced, and two independent clones
with homology to yeast RPB4 were identified (4).
To extend a full-length hsRPB4 cDNA, the 1,870-bp cDNA fragment of
hsRPB4 obtained by a two-hybrid screen was used as a template for 5'
rapid amplification of cDNA ends (5'-RACE). For this purpose, EG177
(AGCTGCGCTTTGTCTGGATATCATC) and EG185
(GAAGTGTCTCAGCTGTTTCAAACTC) primers were used for
amplification from human kidney and human heart 5'-RACE-ready cDNA
(Clontech), human fetal brain (a gift of D. Krainc), HL-60 cells,
and human heart tissue (gifts of G. Kruh). In additional screening, the
32P-labeled hsRPB4 cDNA was used to directly probe cDNA
libraries from human placenta (a gift of J. Chernoff) and HeLa
cells (a gift of J. Gyuris). Finally, the hsRPB4 cDNA sequence was used to screen expressed sequence tag (EST) databases maintained by the
Institute of Genome Research (33a) and GenBank with the
BLAST algorithm (5).
Genomic analysis of hsRPB4.
A cDNA fragment containing the
complete open reading frame (ORF) of hsRPB4 was labeled with
[
-32P]dCTP (DuPont) with a Random prime II kit
(Clontech) and used to probe a human placenta-derived genomic library
in the Lambda FIX II vector (Stratagene). Of 11 independent phage,
VII contained the largest insert (~11 kbp) and encompassed the
carboxy-terminal ~75% of the hsRPB4 cDNA. To obtain more 5' genomic
sequence, a 500-bp DNA fragment from the most upstream intronic
sequence present in genomic
VII was labeled as above to reprobe the
library, resulting in the isolation of overlapping clone
3.2A,
allowing further upstream sequencing but not reaching the 5' end of the
hsRPB4 cDNA. Finally, oligonucleotides based on the most upstream
intronic sequence of
3.2A were used to isolate an hsRPB4 genomic
clone from a human PAC1 library (Genome Systems, Inc.). From this, an 8-kb BamHI-BamHI fragment was subcloned into
pBluescript and sequenced by an automated sequencer (Applied
Biosystems) in both orientations. The 5' endpoint of the first exon of
hsRPB4 was contained in this PAC1 clone; sequencing was continued for
>1 kb upstream of the initiating methionine.
For chromosomal assignment of hsRPB4, metaphase spreads from
phytohemagglutinin-stimulated lymphocytes of a healthy male donor were
prepared as described by Fan et al. (22). Fluorescence in
situ hybridization and detection of immunofluorescence were carried out
essentially as previously described (11), with a 1.9-kb cDNA
insert encompassing the RBP4 gene. Hybridization sites were
detected with fluorescein-labeled avidin (Oncor) and amplified by
addition of anti-avidin antibody (Oncor) and a second layer of
fluorescein-labeled avidin. The metaphase preparations were counterstained with 4',6-diamidino-2-phenylindole (DAPI) and observed with a Zeiss Axiophot epifluorescence microscope equipped with a cooled
charge-coupled-device camera (Photometrics, Tucson, Ariz.) operated by
a Macintosh computer work station. Digitized images of DAPI staining
and fluorescein signals were captured, pseudocolored, and merged with
Oncor Image version 1.6 software.
Plasmid constructions.
To assemble a full-length hsRPB4
cDNA, the 116-bp cDNA fragment of hsRPB4 obtained by 5'-RACE,
containing the 5' coding sequence of hsRPB4 and the anchor primer from
the 5'-RACE kit, was subcloned into pUC119 at SmaI (pVK12).
This PCR DNA fragment was reamplified from pVK12 to insert usable
restriction sites and recloned into pUC119 at SmaI (pVK14).
Finally, pVK14 was digested with HindIII and
PvuII to obtain this 5' end fragment, the original clone
pJG4-5-hsRPB4 (described in Results) obtained by two-hybrid screen was
digested with PvuII and EcoRI to obtain 3' coding
sequence, the two fragments were subcloned into pUC119 digested with
HindIII and EcoRI (pUC-hsRPB4), and the whole
was completely sequenced. pUC-hsRPB4, matching the genomic amino acid
sequence, has been used as a general plasmid to construct all other
plasmids containing hsRPB4 described in this study.
For two-hybrid analysis, the LexA-hsRPB7, LexA-RPB7 and pJG4-5/RPB4
(37); LexA-B42 (27); LexA-GAL4 (pSH17-4) and
LexA-bicoid (RFHMI) (29) plasmids have been described
previously. The pEG202-hsRPB4 clone contains a fusion protein in which
LexA protein sequence was followed by amino acids ELGS, followed by the
sequence of hsRPB4. Truncations of hsRPB4 (1-47, 1-92, 1-118, and
55-142) and hsRPB7 (1-54, 1-94, and 54-172) described in the text
were generated by PCR and inserted into the pEG202 and/or pJG4-5
plasmids and sequenced.
For yeast complementation experiments, the plasmid pYES2-RPB4 was
kindly provided by N. Woychik and has been described previously (37, 68). To construct pYES2-hsRPB4, pUC-hsRPB4 was digested with BamHI and EcoRI and subcloned into the
similarly digested vector pYES2 (Invitrogen). pZeo-hsRPB7 was
constructed by digesting the zeocin-selectable plasmid pHybLex/Zeo
(Hybrid Hunter; Invitrogen) to remove LexA and insert hsRPB7 coding
sequences. As a negative control for complementation, digested
pHybLex/Zeo lacking LexA was additionally self-ligated to create the
plasmid pZeoV.
For mammalian expression, to make the pCMV6-HA-hsRPB4 and the
pCMV6-HA-hsRPB7 plasmids, a BamHI-EcoRI
hsRPB4 DNA fragment from pUC-hsRPB4 and a
BamHI-EcoRI hsRPB7 DNA fragment from pUC-hsRPB7 (37) were subcloned into the similarly digested vector
pCMV6-HA (a gift of J. Chernoff). To make pCMV6-Myc-hsRPB4, a
BamHI-EcoRI hsRPB4 DNA fragment from
pUC-hsRPB4 was subcloned into a similarly digested vector, pCMV6-Myc (a
gift of J. Chernoff). To make pCMV6-hsRPB7, the DNA fragment
encoding the hemagglutinin (HA) tag was removed from plasmid
pCMV6-HA-hsRPB7 by digestion with SalI and XbaI, and the ends were filled in with Klenow and religated.
Interaction analysis.
In general, the two-hybrid assay of
protein interaction was performed by standard protocols
(28). Plasmids expressing appropriate sets of LexA-fused
protein, activation-domain fused protein, and LexA operator-LacZ
reporter were cotransformed into EGY191 yeast. For all fusion proteins,
synthesis of comparable levels of fusion proteins of correct size in
yeast was confirmed by Western blot analysis of yeast extracts with
polyclonal antiserum specific for LexA (14) or HA (Babco,
Richmond, Calif.) as appropriate. Four to six independent colonies for
each pair of proteins were tested in analysis of interactions, as
indicated.
-Galactosidase assays were performed as described
previously (48). Growth on medium without leucine was scored
over a period of 5 days.
Northern analysis.
Two oligonucleotides representing
antisense to hsRPB4 coding sequence, as well as the 1.9-kb hsRPB4 cDNA,
were used sequentially as probes to determine expression of hsRPB4 mRNA
in different human tissues by hybridization under standard conditions
with a commercially available multiple tissue Northern blot (MTN1; Clontech). Similar loading of lanes was confirmed by reprobing with a
32P-labeled 2.0-kb cDNA fragment of actin (40).
Finally, to confirm signals did not represent nonspecific
cross-hybridization with contaminating rRNA, a blot containing mRNAs
from cell lines used in this study was stained with ethidium bromide to
visualize rRNA localization; by subsequent radioactive probe, this was
confirmed to be different from the location of the hsRPB4-hybridizing
transcripts.
Complementation analysis.
The S. cerevisiae WY-4
strain was transformed with pYES2 vector DNA (Invitrogen), pYES2-RPB4,
or pYES2-hsRPB4 DNA by electroporation with a standard protocol and BTX
Electro cell manipulator model ECM 600. After transformation, cells
were plated on glucose-containing media without uracil and incubated at
23°C for 72 h to select colonies. In two independent assays,
three to six colonies from each transformation were resuspended in
distilled water, and an equivalent number of cells was spotted on each
of four galactose-raffinose plates without uracil, which were then
incubated at 23, 30, 34, and 37°C for 1 week to determine growth.
Expression of the hsRPB4 protein was confirmed by Western analysis.
Expression and association of hsRPB7 and hsRPB4 in mammalian
cells.
Cos cells were transfected with combinations of plasmids as
described in Results with DEAE-dextran under standard transfection conditions (7). Coimmunoprecipitations were performed at
approximately 48 h following transfection of cells. All steps were
carried out at 4°C. To prepare cell lysates, cells were washed twice
with 1× phosphate-buffered saline and then lysed in 900 µl of buffer A {5.0 mM MgCl2, 1.0 mM EGTA (pH 7.5), 50 mM Tris (pH
7.8), 10 mM
3-[(3-cholamidopropyl)-dimethyl-ammonio]-1-propanesulfonate (CHAPS), 1 mM Na3VO4, 1 mM
phenylmethylsulfonyl fluoride, 0.01 mg of aprotinin per ml, 0.01 mg of
leupeptin per ml, 0.01 mg of epibestatin per ml} with rotation at
4°C for 30 min. Cells were scraped into the buffer A, and lysates
were centrifuged in an Eppendorf microcentrifuge at 10,000 rpm for 10 min to remove insoluble debris. Supernatant from the centrifugation was
used in the immunoprecipitation experiments. Protein concentration of
the supernatant was measured by bovine serum albumin assay (with a kit
from Pierce), and 0.5 mg of total protein in cell lysates was incubated
with precipitating antibody (10 µl of anti-HA antiserum) plus 50 µl
of 50% protein A-Sepharose beads (Sigma) overnight at 4°C. Beads and
associated protein complexes were washed four times in 500 µl of
buffer A and analyzed by immunoblotting. A sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel (12%
polyacrylamide) was used to analyze the products of the
immunoprecipitation, which were visualized with antibody to hsRPB7.
To confirm expression of transfected or endogenous hsRPB4 and hsRPB7
proteins in cell lysates, Cos-1 cells were transfected and grown to
~80% confluence. Five micrograms of cell lysates prepared as for
immunoprecipitation was boiled in 2× Laemmli buffer and resolved on an
SDS-12% PAGE gel as for immunoprecipitates. Whether for
coimmunoprecipitation or direct assay of expression from cell lysates,
protein gels were blotted to Immobilon (nylon membrane; Millipore).
hsRPB7 and HA-hsRPB4 proteins were detected with either a 1:2,000
dilution of rabbit polyclonal anti-hsRPB7 antiserum (37) or
a 1:1,000 dilution of rabbit polyclonal anti-HA antiserum as primary
antibody and goat anti-rabbit antibody conjugated to horseradish
peroxidase (Amersham) for visualization by enhanced chemiluminescence
(DuPont).
Subcellular fractionation.
Cell fractionation was performed
essentially as described previously for HeLa cells (25).
Protein was assayed with a bovine serum albumin assay (Pierce). Purity
of respective fractions was assayed by standard means. To characterize
nuclear fraction purity, DNA content was assayed with a Hoefer Model
TKO 100 microfluorometer with Hoechst 33258 as described previously
(39). 5' nucleotidase activity, an indicator of the Golgi
fraction, was assayed as described previously (7) except
that the buffer consisted of 50 mM Tris (pH 7.5), 2 mM
MgCl2, 20 mM
-glycerophosphate, 1 mM adenosine, and 0.2 mM AMP. NADPH cytochrome c reductase, an indicator of the endoplasmic
reticulum (ER)-containing fraction (61), and lactate
dehydrogenase activities, as a measure of cytoplasmic fraction purity
(19), were measured as described previously. Following
fractionation, equivalent quantities of protein from each fraction (2.5 µg) were run out on an SDS-12% PAGE gel, and hsRPB7 levels were
detected by Western analysis as described above.
Immunofluorescence staining.
Cos-1 cells were plated on
coverslips 24 h before fixation for immunofluorescence or 24 h before transfection and subsequent immunofluorescence by standard
procedures. Primary antibody incubation was performed with anti-hsRPB7
rabbit polyclonal antiserum or with anti-Myc mouse monoclonal antiserum
at a dilution of 1:200 for 1 h at room temperature. Secondary
antibody for anti-hsRPB7 was biotinylated anti-rabbit antibody (Vector
Laboratories), with protein visualized with Texas Red streptavidin
(Vector Laboratories). Secondary antibody for coverslips treated with
primary anti-Myc antiserum was rhodamine-conjugated anti-mouse
antibody. Immunofluorescence pictures were taken with a Zeiss
fluorescence microscope.
Preparation of antibody to hsRPB4.
To prepare antibody to
hsRPB4, a carboxy terminally derived peptide was sythesized with a
leading cysteine to allow conjugation (C-EGRFEDEELQQILD) and
was conjugated to KLH as the carrier protein with a kit (Imject;
Pierce), as described in the kit protocol. Conjugated peptide was
injected into rabbits, and immunoreactive antibody was characterized by
standard procedures (30).
Purification of human RNA polymerase II complex.
Human RNA
polymerase II complex was purified from a fraction derived from HeLa
cell nuclear pellets with an immunoaffinity protocol with
anti-carboxy-terminal domain (CTD) monoclonal antibodies as described
previously (44). Duplicate samples were resolved by
SDS-PAGE; one set was visualized by silver stain by standard methods,
while a second set was used for Western analysis with antibody to
hsRPB4, and the blot was stripped and reprobed with antibody to hsRPB7.
As a second approach, RNA polymerase II was also purified by
conventional chromatography, with the protocol outlined in reference 44 with minor modifications. Approximately 5.5 g of solubilized nuclear pellets was used as starting material.
Following purification by a high-pressure liquid chromatography
DEAE-5PW column, 50-µl samples of representative fractions were
separated by 5 to 20% gradient gel followed by silver stain to
identify predominant RNA pol II-containing fractions. Simultaneously,
15-µl samples of matching fractions were used for SDS-PAGE and
Western blot analysis with combined antibodies to hsRPB7 and hsRPB4
with goat anti-rabbit alkaline phosphatase-conjugated secondary
antibody for visualization. Finally, representative fractions were also assayed for RNA pol II enzymatic activity with the assay for
nonspecific transcriptional activity described in reference
54. Assays were carried out in the presence or
absence of
-amanitin (2 µl/ml) to confirm activity dependence on
RNA pol II.
Nucleotide sequence accession numbers.
The hsRPB4 cDNA
sequence and partial flanking genomic sequence have been submitted to
GenBank under accession no. U85510. The hsRPB4 genomic sequence has
been submitted to GenBank under accession no. U89387.
 |
RESULTS AND DISCUSSION |
Cloning of hsRPB4 as a partner protein for the human
RNA polymerase II subunit hsRPB7.
We used a LexA-fused
hsRPB7 gene as a probe to perform a two-hybrid screen of a HeLa cDNA
library. Two of the nine positive clones following a screen of 3.5 × 105 primary transformants demonstrated significant
homology to the carboxy-terminal region of yeast RPB4 compared to
sequences in the GenBank database (Fig.
1). These library clones represented two
independent isolates of a cDNA of 1,855 bp in length, encoding an ORF
of 381 bp (127 amino acids). This cDNA was designated hsRPB4. Because
this ORF did not contain an initiating methionine and encoded a protein
shorter than yeast RPB4, we performed a series of experiments to
determine the complete coding sequence of hsRPB4 and to obtain a
full-length clone.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of the hsRPB4 protein and gene. (A) Comparison
of hsRPB4 predicted protein sequence with yeast RPB4 and putative mouse
RPB4 subunits. Identical amino acid residues are shown in consensus.
Conserved hydrophobic amino acids are indicated with . (B) Genomic
structure of hsRPB4. The full-length assembled cDNA for hsRPB4 is 1,902 bp. The genomic structure consists of four exons, which span ~12 kb.
Exons are represented as boxes, with translated sequence filled in
black; introns are represented as lines. Underlined numbers represent
the size of introns. Italicized numbers above the sequence represent
amino acid positions relative to exon endpoints. Numbers below the
sequence represent nucleotides of the hsRPB4 cDNA relative to
exon-intron boundaries: in this case, 1 is taken to represent the first
nucleotide of the longest cDNA obtained. The ORF encoding the hsRPB4
protein commences at 23 bp on this scale and extends 426 bp to position
449, followed by 1,453 bp of 3' untranslated sequences. An Alu J family
repeat is present at positions 919 to 1199 bp. The DNA sequence between
1498 and 1822 bp (shown hatched) is strongly homologous to the 40S
ribosomal protein S26 and appears to be a novel S26 human pseudogene.
An in-frame stop codon is present 65 bp upstream of position 1 of the
cDNA, with no intervening splice sequences. The approximate endpoints
of the three genomic clones used to generate sequence are shown above
the diagram.
|
|
With a combination of library screening and PCR-based approaches
(Materials and Methods), the hsRPB4 sequence was extended an additional
34 bp of continuous ORF. These were supplemented by overlapping EST
databases identified in GenBank and the Institute of Genomic Research,
yielding an additional 26 bp of 5' sequence which incorporated 22 bp of
putative 5' untranslated sequence and an in-frame methionine starting
translation of 15 additional amino acids upstream of the start point of
the hsRPB4 cDNA isolated in the two-hybrid screen. Supporting the idea
that this represented the true 5' end of the hsRPB4 gene, we
additionally identified multiple sequences derived from a related
murine cDNA (here designated mmRPB4, Fig. 1A) by scanning the EST
databases; of these, the most-5'-extended sequence contained a cDNA
endpoint almost identical to that of hsRPB4. Based on these screening
results and on Northern analysis in which an hsRPB4 probe hybridized to
an mRNA species of ~2 kb (Fig. 2), it
appeared that the human assembled cDNA corresponded to a complete or
near-complete hsRPB4 cDNA, with a transcript of 1,902 bp [exclusive of
the poly(A) tail] and a 142-amino-acid ORF, encoding a protein with a
calculated molecular size of 16.3 kDa. However, because the 5'
untranslated sequence did not contain a stop codon in-frame to the
initiating methionine, and because the predicted hsRPB4 protein was
substantially shorter than the yeast RPB4 protein (221 amino acids),
this did not constitute complete proof of a full-length amino acid
sequence.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
hsRPB4 RNA expression. A multitissue RNA blot was probed
with either random primed hsRPB4 coding sequence (shown) or
oligonucleotides specific to hsRPB4, with similar results. Reprobe of
the same blot with an actin probe (40) confirmed equal load
of all lanes.
|
|
Therefore, to complement the analysis of the hsRPB4 cDNA and gain
additional evidence that we possessed a full-length clone, we undertook
an analysis of the genomic structure of the hsRPB4 gene.
Using probes based on the hsRPB4 cDNA (see Materials and Methods), we
obtained a series of overlapping genomic clones. Sequence analysis of
these clones allowed us to establish intron-exon boundaries for the
hsRPB4 gene (Fig. 1B), revealing that the hsRPB4 cDNA
encompasses four exons and three introns dispersed over 13 kb.
Significantly, through this sequencing, we have established that the
exon containing the putative hsRPB4 methionine contains an in-frame
stop codon 88 bp upstream, confirming that the described hsRPB4 cDNA is
full length. Through S1 nuclease assays (37a), we
tentatively assign the start site of transcription to a region 118 to
111 bp upstream of the hsRPB4 ATG, although we have not characterized the promoter. Finally, fluorescence in situ hybridization mapping was used to assign the hsRPB4 gene to chromosome 2q21 (results
not shown).
The expression pattern of the hsRPB4 mRNA by multitissue Northern
blotting reiterates a pattern seen with a number of previously defined
subunits of RNA polymerase II (Fig. 2). The hsRPB4 probe hybridized to
an mRNA species of ~2 kb, corresponding to the assembled cDNA, and to
a second mRNA species of ~5.5 kb, which may represent a 5' or 3'
extended or alternatively spliced form of our current cDNA. While these
species are present in all tissues, they are most abundant in skeletal
muscle and heart. This pattern is similar to the one we had previously
identified for the hsRPB7 transcript (37) as well as those
reported for hsRPB6 (47), hsRPB5 (50), and
hsRPB11 (23) when similar blots were used. However, this pattern does not correspond to a defective loading of the commercially available blot, as other probes on the same blot yield discrete patterns (40, 58); instead, it suggests that there is a
moderate tissue-specific bias to a coordinate regulation of a number of RNA pol II subunits.
Conservation of hsRPB4, mmRPB4, and RPB4 subunits.
Comparison
of the aligned RPB4, hsRPB4, and mmRPB4 sequences reveals several
features which might be particularly relevant to their functional
analysis (Fig. 1). First, the hsRPB4 gene is very highly conserved with
its murine homolog, with 98% amino acid identity compared to an
average of 85% identity between human and mouse sequences
(43). In contrast, because of their shared amino-terminal
truncation, both the human and mouse sequences diverge significantly
from the yeast RPB4 gene, maintaining only 31% identity (56%
similarity) over the entire sequence. This conserved sequence is
concentrated in the carboxy-terminal 80 amino acids of the respective
proteins. If this is the only region considered, homology rises to 40%
identity and 63% similarity. This suggests that evolutionarily
conserved essential functions such as docking to the pol II holoenzyme
might be predicted to localize to the carboxy-terminal end of the
proteins, while the amino-terminal end would contact more divergent
proteins.
Second, in spite of their overall sequence divergence,
hsRPB4, mmRPB4, and RPB4 conserve a similar charge profile, with total charges in the second percentile of all surveyed proteins
(35) and extremely acidic character, with a pI of 4.6 to
4.7. Such a charged, acidic profile has been shown to be present in the transcriptional activation domains of many transcriptional regulatory proteins (52) and is strikingly possessed by a number of
other previously defined subunits of RNA polymerase II (hsRPB3, hsRPB6, and hsRPB8), possibly implying interaction with cognate positively charged protein partners, including additional pol II subunits (hsRPB12) or chromatin-associated histones.
hsRPB4 interacts specifically with hsRPB7 and partially complements
rpb4
defects in yeast.
A number of the human
homologs of yeast RNA pol II subunits are sufficiently conserved
evolutionarily as to complement mutations in their yeast counterparts
(37, 46, 60). We sought to determine whether hsRPB4 is
able to functionally complement an rpb4 null mutation (Fig.
3). Deletion of RPB4 in S. cerevisiae is not lethal but does result in characteristic heat
and cold sensitivity (68) as well as loss of viability at
stationary phase (16, 17). In parallel, we transformed the
rpb4
strain WY-4 (RPB4
1::His3) (a gift
of N. Woychik) with vector pYES2, pYES2-RPB4, or pYES2-hsRPB4 and
compared the ability of RPB4 and hsRPB4 to support growth at 23°C
(permissive for rpb4
), 30°C (semipermissive for
rpb4
), 34°C, and 37°C. After 48 to 72 h, all
yeast containing RPB4 grew at all temperatures. All yeasts containing
only vector were viable at 23°C (although they grew somewhat more
slowly than yeast with RPB4) and showed marginal growth at 30 and
34°C and no growth at 37°C. Yeast expressing hsRPB4 displayed an
intermediate phenotype, being identical to yeast expressing RPB4 at
23°C and only slightly reduced in growth rate at 30 and 34°C but
generally inviable at 37°C. Some degree of colony heterogeneity was
observed, with 20 to 30% of hsRPB4-expressing yeast colonies
eventually growing at 37°C after several additional days (data not
shown). We took this data to be an indication of a partial
complementation.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 3.
hsRPB4 partial complementation of rpb4 null yeast. WY-4
containing pYES2 vector, pYES2-RPB4, or pYES2-hsRPB4 were diluted in
suspension, and identical inocula dotted to plates were maintained for
2 days at 23, 30, 34, or 37°C as indicated.
|
|
S. cerevisiae RPB4 and RPB7 have previously been shown to
associate with pol II as a subcomplex (20), leading us to
consider the hypothesis that the partial complementation by hsRPB4 of
the rpb4
mutation might derive from poor association with
yeast RPB7. Supporting this possibility, in previous work we showed
that while yeast RPB4 interacts strongly with RPB7, it interacts only
weakly with hsRPB7; perhaps for this reason, hsRPB7 only partially
complemented deletions of the rpb7
gene, rescuing
lethality but acquiring a heat and cold sensitivity reminiscent of an
rpb4
mutation (37).
To test the possibility that the partial ability of hsRPB4 to rescue
rpb4
mutation might involve reduced ability or inability
of hsRPB4 to interact with RPB7, we used two approaches. First, we
repeated the complementation experiment with the addition of human
hsRPB7, transforming WY-4 yeast with pYES2 plus pZeoV, pYES2-RPB4 plus pZeoV, pYES2-hsRPB4 plus pZeoV, or pYES2-hsRPB4 plus pZeoV-hsRPB7. In
general, it appeared that a slightly higher percentage of pYES-hsRPB4 colonies were viable at 37°C with coexpressed hsRPB7 (data not shown); however, because of the colony heterogeneity of the hsRPB4 phenotype, results of this experiment were equivocal. Second, we used a
two-hybrid approach to compare the interactions between RPB4-RPB7,
hsRPB4-hsRPB7, RPB4-hsRPB7, and hsRPB4-RPB7 (Table 1). The results indicate that
while the RPB4-RPB7 and hsRPB4-hsRPB7 pairs interact strongly and
RPB4-hsRPB7 pairs interact weakly, hsRPB4 and RPB7 do not
detectably interact, even though all proteins are expressed at
equivalent levels in yeast (37a). This finding suggested the
human pair of subunits have codiverged from their yeast homologs,
maintaining the ability to form a high-affinity subcomplex.
From these results, we conclude that hsRPB4 maintains some ability to
associate with the pol II complex in the absence of, or with minimal
contribution from, association with an RPB7 or hsRPB7 partner, but that
the hsRPB7 partner is likely to enhance this association. hsRPB4 is
able to associate with hsRPB7 in the absence of any additional
mammalian pol II subunits, suggesting that these proteins form a
subcomplex similar to RPB4-RPB7. Further, these results demonstrate
that hsRPB4 is a functionally conserved homolog of RPB4 and hence is
likely to function as a previously undescribed subunit of human RNA
polymerase II.
Functional analysis of hsRPB4 protein interaction domains.
The
relatively poor homology observed between amino acids 1 and 140 of RPB4
and amino acids 1 to 60 of hsRPB4 and mmRPB4 suggested that this region
might be a good candidate for encompassing the binding site for the
interaction with diverged partner proteins RPB7 and hsRPB7. Conversely,
the well-conserved carboxy-terminal domain of the proteins might
reasonably correspond to a docking site for hsRPB4 with the pol II
large complex. We used a two-hybrid approach to examine these issues.
To assign the site of interaction between hsRPB4 and hsRPB7, we
analyzed a series of trunctions of the two proteins
(hsRPB71-172 [full length], hsRPB71-54,
hsRPB71-94, hsRPB754-172; hsRPB41-142 [full length], hsRPB41-47, hsRPB41-92,
hsRPB41-118, and hsRPB455-142) for the
ability to associate (Table 2).
This study indicated that amino acids 1 to 92 on hsRPB4 were
sufficient for efficient interaction with hsRPB7, while amino acids 1 to 47 and 55 to 142 were not, suggesting that hsRPB7 association with
hsRPB4 required sequences spanning the amino-terminal half of the
hsRPB4 protein, as predicted based on the RPB4 and hsRPB4 sequence
divergence in this region. In contrast, no truncation of hsRPB7 was
observed to associate with hsRPB4, suggesting either that the structure
of the hsRPB7 protein was grossly deformed by truncation or that hsRPB4
interacted with multiple regions of the protein.
Endogenous hsRPB4 and hsRPB7 associate with pol II in the mammalian
cell nucleus.
We next characterized the association of hsRPB4 and
hsRPB7 in mammalian cells. First we used antibodies to the two proteins to attempt to determine the subcellular localization of the endogenous proteins by immunofluorescence. By this means, anti-hsRPB7 antiserum indicated that while the majority of signal was detected in the cell
nuclei, as would be expected for a subunit of RNA pol II, diffuse
staining also was noticeable in the cytoplasm, while anti-hsRPB4 signal
appeared to be primarily nuclear; it was only marginally detectable
(data not shown). We had previously used anti-hsRPB7 antiserum to probe
cell lysates and showed that the antibody detected three protein
species: a doublet migrating at approximately 17 to 18 kDa (in the
expected range for the calculated molecular size of hsRPB7) and a
higher-migrating band of approximately 24 to 26 kDa (37). To
clarify the immunofluorescence results, we used subcellular
fractionation (Fig. 4A) to determine that
the larger species, migrating at ~26-27 kDa was predominantly
present in the nuclear fraction with minor localization to cytoplasmic and endoplasmic reticulum (ER) fractions, while the 17-kDa species localized predominantly to the ER. Transfection of mammalian cells with
vectors expressing hsRPB7 as native protein or tagged with the HA
epitope tag (Fig. 4B and C), followed by visualization with either
hsRPB7 or HA-specific antiserum (data not shown), confirmed that the 26 to 27 kDa nuclear species corresponded to the hsRPB7 protein, while the
17 to 18 kDa species was likely to reflect a cross-reactive ER protein
unrelated to hsRPB7. To clarify the hsRPB4 localization, we used a
second approach, transfecting cells with Myc-tagged (Fig. 4C) or
HA-tagged (not shown) hsRPB4 into Cos cells, and confirmed specific
expression of the tagged protein as an ~21 to 23 kDa species.
Immunofluorescence visualization of cells transfected with tagged
hsRPB4 indicated that at 24 h after transfection, hsRPB4 was
entirely nuclear (Fig. 4D).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
Nuclear colocalization of hsRPB7 and hsRPB4. (A) Human
HeLA cells which were starved (incubation in DMEM media with 0.5%
fetal bovine serum for 72 h) (S) or exponentially growing (DMEM
media with 10% of fetal bovine serum) (E), were fractionated as
described in Materials and Methods. Total protein (2.5 µg) in the
fractions indicated was resolved on an SDS-12% PAGE gel, and proteins
were visualized by with rabbit polyclonal antibody against hsRPB7
followed by goat anti-rabbit antibody conjugated to horseradish
peroxidase with enhanced chemiluminescence. The relative mobilities of
the molecular size standards are indicated in kilodaltons. (B and C)
Whole-cell lysates from Cos-1 cells transiently transfected with a pCMV
vector (lane 1) or with pCMV vector expressing HA-tagged hsRPB4 (lane
2), native hsRPB7 (lane 3), HA-tagged hsRPB7 (lane 4), or both
pCMV-hsRPB7 and pCMV-HA-hsRPB4 (lane 5) were resolved on duplicate
SDS-12% PAGE gels. Blots were probed with rabbit anti-hsRPB7
polyclonal antibody (B) or rabbit polyclonal antibody against the HA
tag (C). Proteins were visualized with goat anti-rabbit antibody
conjugated to horseradish peroxidase as described in Materials and
Methods. The estimated size for hsRPB7 is ~27 kDa, that for HA-hsRPB7
is ~32 kDa, and that for HA-hsRPB4 is ~22 kDa. The mobilities of
the molecular size standards are indicated in kilodaltons. (D) Cos-1
cells, transiently transfected with pCMV vector expressing a Myc-hsRPB4
fusion, were incubated 24 h in standard media and stained with
DAPI (left) to visualize nuclei and with mouse monoclonal anti-Myc
antibody followed by goat anti-mouse immunoglobulin G-rhodamine
conjugate. Note that in approximately 10 to 20% of transfected cells
HA-hsRPB4 localized to large granular structures in the nucleus. At
this time, the most likely explanation for these structures is that
they represent aggregates of overexpressed protein, although the
possibility that they indicate the association of hsRPB4 with
particular nuclear compartments, as reported for other pol II subunits
(12, 65), has not been rigorously excluded.
|
|
To confirm hsRPB7-hsRPB4 interaction in mammalian cells in vivo,
whole-cell lysates were prepared from cells expressing HA-hsRPB4. We
then used antibody to HA to perform coimmunoprecipitation, visualizing
with antibody to hsRPB7 (Fig. 5).
HA-hsRPB4 and endogenous hsRPB7 coimmunoprecipitated efficiently and
specifically, supporting the idea that these two proteins function
coordinately in vivo. Similar results were subsequently obtained with
antibody to hsRPB4, in untransfected cells (data not shown).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Association of hsRPB4 and hsRPB7 in mammalian cells.
Cos-1 cells transiently transfected with pCMV vector alone or with pCMV
vector containing HA-hsRPB4 were immunoprecipitated with rabbit
polyclonal antibody specific for HA. Whole-cell lysates (lanes 1 and 2)
or immunoprecipitates (lanes 3 and 4) from Cos-1 cells transfected with
pCMV vector (lanes 1 and 3) or with pCMV vector expressing HA-hsRPB4
fusion protein (lanes 2 and 4) were resolved on an SDS-12% PAGE gel.
Endogenous and coimmunoprecipitated hsRPB7 proteins were visualized
with rabbit polyclonal antibody to hsRPB7 as described above. The
species migrating at ~32 kDa in the two lanes of immunoprecipitation
is nonspecific.
|
|
Finally, RPB4 and RPB7 in yeast have been reported to associate
substoichiometrically with the remainder of the pol II subunits, with
only 10 to 20% of purified pol II complexes containing RPB4-RPB7 in
actively growing cells but with 100% of such complexes containing RPB4-RPB7 in stressed or stationary-phase cells (20).
Although endogenous hsRPB4 and hsRPB7 were detectable in mammalian
cells, it was also of interest to determine if appreciable quantities of these proteins could be detected in association with pol II in
cultured mammalian cells. Accordingly, antibody to the CTD of the
largest subunit of RNA pol II was used to immunoaffinity purify pol II
from HeLa cell nuclei, allowing scrutiny with antibodies to hsRPB4 and
hsRPB7 (Fig. 6). By this means, strong
signal was observed for both of the proteins. To confirm this result,
we additionally utilized conventional chromatographic purification to
isolate RNA polymerase II (Fig. 7).
Fractions of column-purified pol II were resolved by gradient gel and
silver stained to identify the peak of pol II subunit purification
(Fig. 7A), while matching fractions were probed in Western analysis
with antibodies to hsRPB4 and hsRPB7 (Fig. 7B). Finally,
fractions were assayed for nonspecific transcriptional activity in
the presence and absence of
-amanitin to confirm the purification of
biologically active RNA pol II (Fig. 7C). These assays indicated that
peak pol II activity and the hsRPB7 and hsRPB4 subunits cosegregated.
Cumulatively, these assays demonstrate that hsRPB4 and hsRPB7 are
associated with pol II in actively growing human cells.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
hsRPB4 and hsRPB7 are constituents of anti-CTD
immunoaffinity-purified human pol II holoenzyme. Parallel samples of
purified human polymerase II complex isolated by immunoprecipitation
with anti-CTD (as described in reference 44) were
resolved by SDS-PAGE. Left, silver stain of molecular size markers
(MWM) and pol II to confirm purification; right, sample was blotted to
membrane, probed with antibody to hsRPB4, and then reprobed without
intervening strip with antibody to hsRPB7, confirming the presence of
these proteins in the complex.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 7.
hsRPB4 and hsRPB7 are constituents of
chromatographically purified transcriptionally active human pol II. (A)
Fractions of high-pressure liquid chromatography DEAE-5PW column
purified RNA polymerase II (44) were resolved by gradient
gel and silver stained. M, molecular size marker; I, input; F, flow-
through. The numbers across the top indicate fraction numbers. To the
right are shown the positions of marker pol II subunits and approximate
migration of hsRPB4 and hsRPB7 (compare with banding pattern in Fig.
6). (B) Parallel fractions resolved by SDS-PAGE and Western blotted,
probed with combined antibodies to hsRPB4 and hsRPB7, and visualized
with alkaline-phosphatase-conjugated secondary antibody. (C) Assay of
nonspecific transcription activity of fractions based on incorporation
of UTP into acid-insoluble material in 20 min with X174 DNA as
template, as described in reference 54.
|
|
Conclusion.
In this work we report the cloning of hsRPB4
based on interaction with its partner protein, hsRPB7. Through
two-hybrid and complementation assays, we establish that
hsRPB4 has diverged amino terminally from its yeast homolog RPB4 to the
extent that it does not detectably associate with yeast RPB7 and only
partially rescues an rpb4
mutation. However, hsRPB4
interacts strongly with hsRPB7 following coexpression of the two
proteins in yeast or with endogenous hsRPB7 in the nuclei of human
cells. hsRPB4 is also a significant component of RNA polymerase II
purified from mammalian cells; we propose that the interaction with the
pol II complex is mediated by conserved residues on the
carboxy-terminal end of hsRPB4. This characterization completes the
identification of human homologs of yeast pol II subunits, a
comprehensive summary of whose properties is presented in Table
3.
The biochemistry of pol II is better established in S. cerevisiae than in human cells. While a number of groups have
purified human pol II and associated proteins (26, 32, 36, 45, 51; also reviewed in references 57 and
70), it has been clear from a comparison of results
that the number, molecular weight, and quantity of copurified proteins
are somewhat variable between different groups and starting sources of
material, and it was previously uncertain whether a human RPB4 homolog
existed. The ~27 kDa hsRPB7 species and ~18- to 19-kDa native
hsRPB4 species described in this work are now shown to be present in
affinity-purified pol II, conclusively demonstrating their
functionality in mammalian cells. The question of what their function
might be remains to be answered.
RPB4 and RPB9 are the only subunits of yeast RNA polymerase II that
have been shown to possess a null phenotype of viability with cold and
temperature sensitivity (67, 68). In subsequent functional
studies, RPB9 has been shown to function as a regulator of start site
selection in transcriptional initiation (33) and elongation
(9), and incorporation of RPB4-RPB7 into yeast pol II has
been shown to regulate transcriptional initiation (20). In a
further intriguing development, hsRPB7 has recently been identified by
two groups as an interacting factor for two proteins involved in
transcription, the EWS-Fli oncogenic fusion and the retinoic acid
receptor (38a, 59a). In each case, regulation of the levels
of hsRPB7 was demonstrated to modulate the activity of the
associated transcription factor (38a, 59a). Together, these results support the idea that hsRPB4-hsRPB7 may function as a site of interaction between enhancer-binding transcription factors
and the central pol II complex. Because of the variable incorporation
of RPB4-RPB7 into pol II in stationary phase, we and other groups have
hypothesized that these proteins might act in a manner analogous to
bacterial sigma factors (59), to modulate transcription in a
manner conducive to promoting stress survival (13, 16, 17,
37). Finally, recent structural studies of yeast RNA pol II in
the presence and absence of the RPB4-RPB7 subcomplex have indicated
that addition of RPB4-RPB7 to pol II acts to convert pol II from an
open complex which allows entry of the enzyme to DNA to a closed
complex which is more stably retained during transcriptional elongation
(6, 34), leading to the proposal (34) that these
proteins may enhance resistance to cellular stresses by facilitating
the accumulation of paused transcripts proximal to heat shock promoters
(53). If a similar function and mechanism of activity are
retained in mammalian cells, as seems likely, then further study of the
hsRPB4 and hsRPB7 proteins will be of particular interest in future
analyses of the modulation of transcription in response to stress.
This study was supported in part by a grant from the Elsa U. Pardee Foundation and NIH grant CA-70841 (to E.A.G.), by the core NIH
grant CA-06927 (to E.A.G. and J.R.T.), and by an appropriation from the
Commonwealth of Pennsylvania.
We thank Susan Law, Feng Liu, and Dennis Gately for help with
subcellular fractionation, Ilya Serebriiskii for help with the complementation study, and Vadim Bichko for advice and reagents. We are
very grateful to Nancy Woychik for reagents and advice and to Danny
Reinberg for invaluable help with the pol II purification. We thank
Glenn Rall, Claude Kedinger, Marc Vigneron, and Susan Law for helpful
comments on the manuscript.
| 1.
|
Acker, J.,
M. Wintzerith,
M. Vigneron, and C. Kedinger.
1992.
Primary structure of the second largest subunit of human RNA polymerase II (or B).
J. Mol. Biol.
226:1295-1299[Medline].
|
| 2.
|
Acker, J.,
M. Wintzerith,
M. Vigneron, and C. Kedinger.
1993.
Structure of the gene encoding the 14.5 kDa subunit of human RNA polymerase II.
Nucleic Acids Res.
21:5345-5350[Abstract/Free Full Text].
|
| 3.
|
Acker, J.,
M. Wintzerith,
M. Vigneron, and C. Kedinger.
1994.
A 14.4 KDa acidic subunit of human RNA polymerase II with a putative leucine-zipper.
DNA Sequence
4:329-331[Medline].
|
| 4.
|
Acker, J.,
O. Murroni,
M. G. Mattei,
C. Kedinger, and M. Vigneron.
1996.
The gene (POLR2L) encoding the hRPB7.6 subunit of human RNA polymerase.
Genomics
32:86-90[Medline].
|
| 5.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 6.
|
Asturias, F. J.,
G. D. Meredith,
C. L. Poglitsch, and R. D. Kornberg.
1997.
Two conformations of RNA polymerase II revealed by electron crystallography.
J. Mol. Biol.
272:536-540[Medline].
|
| 7.
|
Ausubel, F. M.,
R. Brent,
R. Kingston,
D. Moore,
J. Seidman,
J. A. Smith, and K. Struhl.
1987.
.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 8.
|
Avruch, J., and D. Wallach.
1971.
Preparation and properties of plasma membrane and endoplasmic reticulum fragments from isolated rat fat cells.
Biochim. Biophys. Acta
233:334-347[Medline].
|
| 9.
|
Awrey, D. E.,
R. G. Weilbaecher,
S. A. Hemming,
S. M. Orlicky,
C. M. Kane, and A. M. Edwards.
1997.
Transcriptional elongation through DNA arrest sites: a multistep process involving both RNA polymerase II subunit RPB9 and TFIIS*.
J. Biol. Chem.
272:14747-14754[Abstract/Free Full Text].
|
| 10.
|
Baskaran, R.,
M. E. Dahmus, and J. Y. J. Wang.
1993.
Tyrosine phosphorylation of mammalian RNA polymerase II carboxy-terminal domain.
Proc. Natl. Acad. Sci. USA
90:11167-11171[Abstract/Free Full Text].
|
| 11.
|
Bell, D. W.,
T. Taguchi,
N. A. Jenkins,
D. J. Gilbert,
N. G. Copeland,
C. B. Gilks,
P. Zweidler-McKay,
H. L. Grimes,
P. N. Tsichlis, and J. R. Testa.
1995.
Chromosomal localization, in man and rodents, of a gene (GFl1) encoding a novel zinc finger protein reveals a new syntenic region between mouse and man.
Cytogenet. Cell Genet.
70:263-267[Medline].
|
| 12.
|
Bregman, D. B.,
L. Du,
S. van der Zee, and S. L. Warren.
1995.
Transcription-dependent redistribution of the large subunit of RNA polymerase II to discrete nuclear domains.
J. Cell Biol.
129:287-298[Abstract/Free Full Text].
|
| 13.
|
Brendel, V., and S. Karlin.
1994.
Applications of statistical criteria in protein sequence analysis: case study of yeast RNA polymerase II subunits.
Comput. Chem.
18:251-253[Medline].
|
| 14.
|
Brent, R., and M. Ptashne.
1980.
The lexA gene product represses its own promoter.
Proc. Natl. Acad. Sci. USA
77:1932-1936[Abstract/Free Full Text].
|
| 15.
|
Buratowski, S.
1994.
The basics of basal transcription by RNA polymerase II.
Cell
77:1-3[Medline].
|
| 16.
|
Choder, M.
1993.
A growth rate-limiting process in the last growth phase of the yeast life cycle involves RPB4, a subunit of RNA polymerase II.
J. Bacteriol.
175:6358-6363[Abstract/Free Full Text].
|
| 17.
|
Choder, M., and R. A. Young.
1993.
A portion of RNA polymerase II molecules has a component essential for stress responses and stress survival.
Mol. Cell. Biol.
13:6984-6991[Abstract/Free Full Text].
|
| 18.
|
Conaway, R. C., and J. W. Conaway.
1993.
General initiation factors for RNA polymerase II.
Annu. Rev. Biochem.
62:161-190[Medline].
|
| 19.
|
Deutscher, M. P.
1990.
Guide to protein purification.
Methods Enzymol.
182:62-63.
|
| 20.
|
Edwards, A. M.,
C. M. Kane,
R. A. Young, and R. D. Kornberg.
1991.
Two dissociable subunits of yeast RNA polymerase II stimulate the initiation of transcription at a promoter in vitro.
J. Biol. Chem.
266:71-75[Abstract/Free Full Text].
|
| 21.
|
Estojak, J.,
R. Brent, and E. A. Golemis.
1995.
Correlation of two-hybrid affinity data with in vitro measurements.
Mol. Cell. Biol.
15:5820-5829[Abstract].
|
| 22.
|
Fan, Y.-S.,
L. M. Davis, and T. B. Shows.
1990.
Mapping small DNA sequences by fluorescence in situ hybridization directly on banded metaphase chromosomes.
Proc. Natl. Acad. Sci. USA
87:6223-6227[Abstract/Free Full Text].
|
| 23.
|
Fanciulli, M.,
T. Bruni,
C. Cerboni,
F. Bonetto,
C. Iacobini,
L. Frati,
M. Piccoli,
A. Floridi,
A. Santoni, and A. Punturieri.
1996.
Cloning of a novel human RNA polymerase II subunit downregulated by doxorubicin: new potential mechanisms of drug related toxicity.
FEBS Lett.
384:48-52[Medline].
|
| 24.
|
Feaver, W. J.,
J. W. Svejstrup,
N. L. Henry, and R. D. Kornberg.
1994.
Relationship of CDK-activating kinase and RNA polymerase II CTD kinase TFIIH/TFIIK.
Cell
79:1103-1109[Medline].
|
| 25.
|
Frangioni, J. V.,
P. H. Beahm,
V. Shifrin,
C. A. Jost, and B. G. Neel.
1992.
The non-transmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence.
Cell
68:545-560[Medline].
|
| 26.
|
Freund, E., and P. M. McGuire.
1986.
Characterization of RNA polymerase type II from human term placenta.
J. Cell. Physiol.
127:432-438[Medline].
|
| 27.
|
Golemis, E. A., and R. Brent.
1992.
Fused protein domains inhibit DNA binding by LexA.
Mol. Cell. Biol.
12:3006-3014[Abstract/Free Full Text].
|
| 28.
|
Golemis, E. A.,
J. Gyuris, and R. Brent.
1996.
Interaction trap/two-hybrid system to identify interacting proteins, p. 20.1.1-20.1.28. In
F. M. Ausubel, R. Brent, R. Kingston, et al. (ed.), Current protocols in molecular biology.
John Wiley and Sons, New York, N.Y.
|
| 29.
|
Gyuris, J.,
E. A. Golemis,
H. Chertkov, and R. Brent.
1993.
Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2.
Cell
75:791-803[Medline].
|
| 30.
|
Harlow, E., and D. Lane.
1988.
.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 31.
|
Hengge-Aronis, R.
1993.
Survival of hunger and stress: the role of rpoS in early stationary phase gene regulation in E. coli.
Cell
72:165-168[Medline].
|
| 32.
|
Hodo, H. G., III, and S. P. Blatti.
1977.
Purification using polyethylenimine precipitation and low molecular weight subunit analyses of calf thymus and wheat germ DNA-dependent RNA polymerase II.
Biochemistry
16:2334-2343[Medline].
|
| 33.
|
Hull, M. W.,
K. McKune, and N. A. Woychik.
1995.
RNA polymerase II subunit RPB9 is required for accurate start site selection.
Genes Dev.
99:481-490.
|
| 33a.
|
Institute for Genomic Research Consortium.
1995.
Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence.
Nature
377:3-174[Medline].
|
| 34.
| Jensen, G. J., G. Meredith, D. A. Bushnell,
and R. D. Kornberg. Structure of wild type yeast RNA
polymerase II and location of Rpb4 and Rpb7. Submitted for publication.
|
| 35.
|
Karlin, S., and V. Brendel.
1992.
Chance and statistical significance in protein and DNA sequence analysis.
Science
257:39-49[Abstract/Free Full Text].
|
| 36.
|
Kedinger, C.,
F. Gissinger, and P. Chambon.
1974.
Animal DNA-dependent RNA polymerases.
Eur. J. Biochem.
44:421-436[Medline].
|
| 37.
|
Khazak, V.,
N. Woychik,
P. Sadhale,
R. Brent, and E. A. Golemis.
1995.
Human RNA polymerase II subunit hsRPB7 functions in yeast and influences yeast cell morphology and stress survival.
Mol. Biol. Cell
6:759-775[Abstract].
|
| 37a.
| Khazak, V., and E. A. Golemis. Unpublished
data.
|
| 38.
|
Koleske, A. J., and R. A. Young.
1995.
The RNA polymerase II holoenzyme and its implications for gene regulation.
Trends Biochem. Sci.
20:113-116[Medline].
|
| 38a.
| Kovar, H. Personal communication.
|
| 39.
|
Labarca, C., and K. Paigen.
1980.
A simple, rapid, and sensitive DNA assay procedure.
Anal. Biochem.
102:344-352[Medline].
|
| 40.
|
Law, S. F.,
J. Estojak,
B. Wang,
T. Mysliwiec,
G. D. Kruh, and E. A. Golemis.
1996.
Human enhancer of filamentation 1, a novel p130cas-like docking protein, associates with focal adhesion kinase and induces pseudohyphal growth in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:3327-3337[Abstract].
|
| 41.
|
Liao, S.-M.,
J. Zhang,
D. A. Jeffery,
A. J. Koleske,
C. M. Thompson,
D. M. Chao,
M. Viljoen,
H. J. J. van Vuuren, and R. A. Young.
1995.
A kinase-cyclin pair in the RNA polymerase II holoenzyme.
Nature
374:193-196[Medline].
|
| 42.
|
Lu, H.,
O. Glores,
R. Weinman, and D. Reinberg.
1991.
The nonphosphorylated form of RNA polymerase II preferentially associates with the preinitiation complex.
Proc. Natl. Acad. Sci. USA
88:10004-10008[Abstract/Free Full Text].
|
| 43.
|
Makalowski, W.,
J. Zhang, and M. S. Boguski.
1996.
Comparative analysis of 1196 orthologous mouse and human full-length mRNA and protein sequences.
Genome Res.
6:846-857[Abstract/Free Full Text].
|
| 44.
|
Maldonado, E.,
R. Drapkin, and D. Reinberg.
1996.
Purification of human RNA polymerase II and general transcription factors.
Methods Enzymol.
274:72-100[Medline].
|
| 45.
|
Maldonado, E.,
R. Shiekhattar,
M. Sheldon,
H. Cho,
R. Drapkin,
P. Rickert,
E. Lees,
C. W. Anderson,
S. Linn, and D. Reinberg.
1996.
A human RNA polymerase II complex associated with SRB and DNA-repair proteins.
Nature
381:86-89[Medline].
|
| 46.
|
McKune, K.,
P. A. Moore,
M. W. Hull, and N. A. Woychik.
1995.
Six human RNA polymerase subunits functionally substitute for their yeast counterparts.
Mol. Cell. Biol.
15:6895-6900[Abstract].
|
| 47.
|
McKune, K., and N. A. Woychik.
1994.
Functional substitution of an essential yeast RNA polymerase subunit by a highly conserved mammalian counterpart.
Mol. Cell. Biol.
14:4155-4159[Abstract/Free Full Text].
|
| 48.
|
Miller, J. H.
1972.
.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 49.
|
Mortillaro, M. J.,
B. J. Blencowe,
X. Wei,
H. Nakayasu,
L. Du,
S. L. Warren,
P. A. Sharp, and R. Berezney.
1996.
A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix.
Proc. Natl. Acad. Sci. USA
93:8253-8257[Abstract/Free Full Text].
|
| 50.
|
Pati, U. K., and S. M. Weissman.
1989.
Isolation and molecular characterization of a cDNA encoding the 23 kDa subunit of human RNA polymerase II.
J. Biol. Chem.
264:13114-13121[Abstract/Free Full Text].
|
| 51.
|
Pati, U. K., and S. M. Weissman.
1990.
The amino acid sequence of the human RNA polymerase II 33 kDa subunit hRPB 33 is highly conserved among eukaryotes.
J. Biol. Chem.
265:8400-8403[Abstract/Free Full Text].
|
| 52.
|
Ptashne, M., and A. Gann.
1997.
Transcriptional activation by recruitment.
Nature
386:569-577[Medline].
|
| 52a.
|
Pusch, C.,
Z. Wang,
B. Roe, and N. Blin.
1996.
Genomic structure of the RNA polymerase II small subunit (hRPB14.4) locus (POLRF) and mapping to 22q13.1 by sequence identity.
Genomics
34:440-442[Medline].
|
| 53.
|
Rasmussen, E. B., and J. T. Lis.
1995.
Short transcripts of the ternary complex provide insight into RNA polymerase II elongational pausing.
J. Mol. Biol.
252:522-535[Medline].
|
| 54.
|
Reinberg, D., and R. G. Roeder.
1987.
Factors involved in specific transcription by mammalian RNA polymerase II: purification and functional analysis of initiation factors IIB and IIE*.
J. Biol. Chem.
262:3310-3321[Abstract/Free Full Text].
|
| 55.
|
Sawadogo, M., and A. Sentenac.
1990.
RNA polymerase B (II) and general transcription factors.
Annu. Rev. Biochem.
59:711-754[Medline].
|
| 56.
|
Schiestl, R. H., and R. D. Gietz.
1989.
High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier.
Curr. Genet.
16:339-346[Medline].
|
| 57.
|
Sentenac, A.
1985.
Eukaryotic RNA polymerases.
Crit. Rev. Biochem.
18:31-91[Medline].
|
| 58.
|
Serebriiskii, I.,
J. Estojak,
G. Sonoda,
J. R. Testa, and E. A. Golemis.
1997.
Association of Krev-1/rap1a with Krit1, a novel ankyrin repeat-containing protein encoded by a gene mapping to 7q21-22.
Oncogene
15:1043-1049[Medline].
|
| 59.
|
Shapiro, L.
1993.
Protein localization and asymmetry in the bacterial cell.
Cell
73:841-855[Medline].
|
| 59a.
| Shemshedini, L. Submitted for publication.
|
| 60.
|
Shpakovski, G. V.,
J. Acker,
M. Wintzerith,
J.-F. Lacroix,
P. Thuriaux, and M. Vigneron.
1995.
Four subunits that are shared by the three classes of RNA polymerase are functionally interchangeable between Homo sapiens and Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:4702-4710[Abstract].
|
| 61.
|
Sottocasa, G. L.,
B. Kuylenstierna,
L. Ernster, and A. Bergstrand.
1967.
An electron-transport system associated with the outer membrane of liver mitochondria.
J. Cell Biol.
32:415-438[Abstract/Free Full Text].
|
| 62.
|
Tanaka, K.,
Y. Takayanagi,
N. Fujita,
A. Ishihama, and H. Takahashi.
1993.
Heterogeneity of the principal factor in Escherichia coli: the rpoS gene product 38 is a second principal factor of RNA polymerase in stationary-phase Escherichia coli.
Proc. Natl. Acad. Sci. USA
90:3511-3515[Abstract/Free Full Text].
|
| 63.
|
Tjian, R., and T. Maniatis.
1994.
Transcriptional activation: a complex puzzle with few easy pieces.
Cell
77:5-8[Medline].
|
| 64.
|
Treich, I.,
C. Carles,
M. Riva, and A. Sentenac.
1992.
RPC10 encodes a new mini subunit shared by yeast nuclear RNA polymerases.
Gene Expr.
2:31-37[Medline].
|
| 65.
|
Warren, S. L.,
A. S. Landolfi,
C. Curtis, and J. S. Morrow.
1992.
Cytostellin: a novel, highly conserved protein that undergoes continuous redistribution during the cell cycle.
J. Cell Sci.
103:381-388[Abstract].
|
| 66.
|
Wintzerith, M.,
J. Acker,
S. Vicaire,
M. Vigneron, and C. Kedinger.
1992.
Complete sequence of the human RNA polymerase II largest subunit.
Nucleic Acids Res.
20:910[Free Full Text].
|
| 67.
|
Woychik, N. A.,
W. S. Lane, and R. A. Young.
1991.
Yeast RNA polymerase II subunit RPB9 is essential for growth at temperature extremes.
J. Biol. Chem.
266:19053-19055[Abstract/Free Full Text].
|
| 68.
|
Woychik, N. A., and R. A. Young.
1989.
RNA polymerase II subunit RPB4 is essential for high- and low-temperature yeast cell growth.
Mol. Cell. Biol.
9:2854-2859[Abstract/Free Full Text].
|
| 69.
|
Woychik, N. A., and R. A. Young.
1990.
RNA polymerase II: subunit structure and function.
Trends Biochem. Sci.
15:347-351[Medline].
|
|