This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, Z.-S.
Right arrow Articles by Lim, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, Z.-S.
Right arrow Articles by Lim, L.

 Previous Article  |  Next Article 

Mol Cell Biol, April 1998, p. 2153-2163, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

A Conserved Negative Regulatory Region in alpha PAK: Inhibition of PAK Kinases Reveals Their Morphological Roles Downstream of Cdc42 and Rac1

Zhou-Shen Zhao,1 Edward Manser,1 Xiang-Qun Chen,1 Claire Chong,1 Thomas Leung,1 and Louis Lim1,2,*

Glaxo-IMCB Group, Institute of Molecular & Cell Biology, Singapore 117609, Singapore,1 and Institute of Neurology, London WC1N 1PJ, United Kingdom2

Received 17 September 1997/Returned for modification 24 November 1997/Accepted 22 December 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

alpha PAK in a constitutively active form can exert morphological effects (E. Manser, H.-Y. Huang, T.-H. Loo, X.-Q. Chen, J.-M. Dong, T. Leung, and L. Lim, Mol. Cell. Biol. 17:1129-1143, 1997) resembling those of Cdc42G12V. PAK family kinases, conserved from yeasts to humans, are directly activated by Cdc42 or Rac1 through interaction with a conserved N-terminal motif (corresponding to residues 71 to 137 in alpha PAK). alpha PAK mutants with substitutions in this motif that resulted in severely reduced Cdc42 binding can be recruited normally to Cdc42G12V-driven focal complexes. Mutation of residues in the C-terminal portion of the motif (residues 101 to 137), though not affecting Cdc42 binding, produced a constitutively active kinase, suggesting this to be a negative regulatory region. Indeed, a 67-residue polypeptide encoding alpha PAK83-149 potently inhibited GTPgamma S-bound Cdc42-mediated kinase activation of both alpha PAK and beta PAK. Coexpression of this PAK inhibitor with Cdc42G12V prevented the formation of peripheral actin microspikes and associated loss of stress fibers normally induced by the p21. Coexpression of PAK inhibitor with Rac1G12V also prevented loss of stress fibers but not ruffling induced by the p21. Coexpression of alpha PAK83-149 completely blocked the phenotypic effects of hyperactive alpha PAKL107F in promoting dissolution of focal adhesions and actin stress fibers. These results, coupled with previous observations with constitutively active PAK, demonstrate that these kinases play an important role downstream of Cdc42 and Rac1 in cytoskeletal reorganization.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The small GTP-binding proteins of the Rho subfamily, in particular the ubiquitous Rho, Rac, and Cdc42 proteins, act through a variety of downstream targets which bind to the GTP forms of these p21s (reviewed in references 27 and 54). RhoA signalling is required for maintenance of actin stress fibers and focal adhesions in cultured mammalian cells (46), these activities being mediated by Rho-associated kinases (ROKs) (13, 24, 25, 37). Rac activation produces lamellipodia or membrane ruffles and associated peripheral focal complexes (FCs) perhaps by binding POR1 (47, 56). Cdc42 promotes formation of peripheral actin microspikes, which are structural components of filopodia and retraction fibers, followed by its activation of Rac (19, 39). Cdc42 can antagonize Rho (20, 34), while Rac can promote leukotriene-mediated activation of Rho (43). In addition to their roles in cell morphology, Cdc42, Rac, and Rho participate in regulating transcription both through JNK/stress-activated protein kinase (SAPK)- and p38 mitogen-activated protein (MAP) kinase-regulated pathways (8, 38). Activated forms of these p21s can also stimulate cell cycle progression to promote DNA synthesis in fibroblasts (41). In the yeast Saccharomyces cerevisiae, Cdc42p is required for the control of cell polarity during budding and pseudohyphal growth (28, 62) but plays a role in transcriptional activation via the mating-response MAP kinase pathway (51, 61). Both budding and pheromone-induced signalling in yeast require participation of the PAK-like kinases Cla4p and Ste20p (22, 23).

Mammalian targets of Cdc42 and Rac1 include a number of recently identified proteins, of which the best characterized are PAK kinases (27, 49). Upon binding to either GTP-bound Cdc42 (GTP-Cdc42) or GTP-Rac, PAK undergoes autophosphorylation on multiple sites and is activated (32, 34, 36). PAK function in vivo probably includes activation of JNK/SAPK and p38 MAP kinase pathways (2, 45). Since Rho-p21s are closely linked to cytoskeletal reorganization, the ubiquitously expressed PAKs (32, 36) have been candidate effectors in mediating certain aspects of morphology regulated by Cdc42 and Rac. Expression of constitutively active forms of alpha PAK causes drastic loss of actin stress fibers and focal adhesions with retraction of the cell periphery, consistent with PAK acting downstream of Cdc42 and Rac (34). Microinjected PAK1 protein has also been shown to promote FC formation and membrane ruffling through N-terminal (nonkinase) interactions (50). The control of the cellular activities of PAK containing various functional domains appears to be complex; p21 activation of PAK is not the only mode of regulation, as capsase-mediated cleavage of PAK2 can generate a catalytically active fragment which regulates morphological changes associated with apoptosis (48).

Comparison of the primary sequences of divergent PAKs revealed two highly conserved functional domains: the serine/threonine kinase domain at the C terminus and a region that includes the p21-binding domain toward the N terminus of the kinase. In this study, we used site-directed mutagenesis to determine that while the N-terminal half of this region binds p21, the C-terminal half is involved in negatively regulating kinase activity. A PAK inhibitor sequence was derived from the conserved region by deletion analysis and then used to analyze the morphological activities of endogenous PAK. Cytoskeletal reorganization in cells expressing Cdc42G12V or RacG12V are markedly affected when the PAK inhibitor is coexpressed, demonstrating that endogenous PAKs can indeed play defined morphological roles downstream of these p21s.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

PAK subcloning and site-directed mutagenesis. Mutations to the alpha PAK N-terminal region were constructed by a PCR-based mutagenesis procedure. The 0.75-kb cDNA fragment encoding alpha PAK1-250 was amplified in two parts with desired mutations introduced at the junction from one PCR primer. The two primers at the central position (~300 bp from BamHI) were phosphorylated prior to the PCRs to facilitate ligation. The two PCR products were joined with T4 DNA ligase, and the complete mutant 0.75-kb cDNA fragment was reamplified by PCR using PAK complementary primers at the 5' end (ATGGATCCCGGGATCCATGTCAAATAACGGC; BamHI site underlined) and at the 3' end, corresponding to the position of an internal BglII site (CCGCTCGAGCTAAGATCTCCTCATCAGACA; XhoI and BglII sites underlined). PCR products were subcloned into the BamHI and XhoI sites of the Bluescript SK(+) vector and sequenced.

The polypeptides encoding alpha PAK residues 83 to 131, 83 to 149, 89 to 131, and 89 to 149 were expressed from cDNAs amplified by PCR and introduced into pGEX-4T-1 (BamHI and XhoI sites). alpha PAK83-149 was introduced into the BamHI and XhoI sites in the mammalian pXJ hemagglutinin (HA)-epitope-tagged vectors (34). The primers used to generate PAK mutants and truncation constructs are listed in Table 1.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Mutagenesis primers

Bacterial expression and purification of recombinant PAK proteins. The plasmid expressing the glutathione S-transferase (GST)/PAK1-250 fusion proteins of each mutant as well as the wild type were constructed by cloning the 750-bp BamHI-XhoI fragments into pGEX-4T-1 (Pharmacia). The full-length PAK mutants were then constructed by adding the BglII-XhoI cDNA fragment encoding alpha PAK251-544 into the GST/alpha PAK1-250 mutant plasmids. pGEX plasmids were transformed into Escherichia coli BL21 for protein expression. Recombinant GST fusion proteins from 200-ml cultures were purified by glutathione-Sepharose affinity chromatography (Pharmacia) in a 300-µl column of glutathione-Sepharose. Eluted proteins were stored with 5% glycerol at -70°C.

Expression and purification of GST/alpha PAK from COS-7 cells. COS-7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. The pXJ-GST mammalian cell expression vector was constructed by replacing the pXJ-HA epitope tag (34) with the coding sequence of GST (amplified by PCR as an EcoRI/BamHI fragment). The 1.6-kb BamHI-XhoI fragment containing the coding region of alpha PAK (33) was cloned into the BamHI/XhoI sites of pXJ-GST. COS-7 cells were transfected with 5 µg of pXJ-GST vectors by the Lipofectamine (Bethesda Research Laboratories) method. The cells were harvested after 18 h and lysed in buffer containing 40 mM HEPES (pH 7.5), 1% Nonidet P-40, 100 mM NaCl, 1 mM EDTA, 25 mM NaF, 1 mM sodium orthovanadate, and 10 µg each of leupeptin and aprotinin/ml. After centrifugation (12,000 × g) for 10 min at 4°C, supernatant fractions were passed through columns containing 50 µl of glutathione-Sepharose beads. Columns were washed with phosphate-buffered saline containing 50 mM Tris-HCl (pH 8.0) and 0.1% Triton X-100, and GST/PAK fusion proteins were eluted in the same buffer containing 10 mM glutathione and 5% glycerol.

Overlays with [gamma -32P]GTP-Cdc42. Purified GST fusion proteins (0.4 µg) were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) on 10% polyacrylamide gels and transferred to nitrocellulose membranes. The filter was blocked for 16 h (4°C) in phosphate-buffered saline containing 1% bovine serum albumin, 5 mM dithiothreitol, 0.5 mM MgCl2, and 0.1% Triton X-100 prior to p21 overlay analysis. Cdc42 labeling with [gamma -32P]GTP and Western overlays were carried out as described previously (30). The [gamma -32P]GTP-Cdc42 signals on the filter were detected at -20°C and quantified by PhosphorImager (Molecular Dynamics) analysis.

Protein kinase assays. Each 50-µl reaction mix contained 0.5 µg of GST/alpha PAK, 10 µCi of [gamma -33P]ATP (~6,000 mCi/mmol), and 10 µg of myelin basic protein (MBP) in kinase assay buffer (50 mM HEPES [pH 7.3], 10 mM MgCl2, 2 mM MnCl2, 1 mM dithiothreitol, 0.05% Triton X-100). PAK activation was carried out with 4 µg of GTPgamma S-Cdc42. The mixture was incubated at 30°C for 30 min. Samples were resolved on 12% polyacrylamide gels and processed for autoradiography.

Microinjection and cell staining. HeLa cells were cultured in minimal essential medium with 10% fetal bovine serum. Subconfluent cells were microinjected into the nucleus with 50 ng of each expression plasmid DNA/µl, using an Eppendorf microinjector. After 2 or 4 h, cells were fixed in 3% paraformaldehyde for 20 min and stained as described previously (34).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Flanking sequences influence the p21-binding CRIB motif of alpha PAK. PAK sequences contain two functional domains, the C-terminal kinase domain and the p21-binding domain near the N terminus whose binding of Cdc42/Rac1 markedly stimulates autophosphorylation (32). In alpha PAK, a region encompassing residues 67 to 149 (the conserved PAK amino-terminal [PAN] motif) was first found to be functional as the Cdc42/Rac binding domain (32). Burbelo et al. (7) subsequently showed that among a larger family of Cdc42 and Rac1 binders, only a region (the core Cdc42-Rac interaction and binding [CRIB] motif) corresponding to alpha PAK75-87 shows significant conservation of amino acid residues. In spite of this, a beta PAK29-90 construct containing all of these conserved residues (equivalent to alpha PAK34-95) exhibited extremely weak p21 binding (7).

In light of these observations, we investigated further the requirement for efficient p21 binding by performing [gamma -32P]GTP-Cdc42 overlays on six deletion constructs containing portions of the N-terminal region of alpha PAK (Fig. 1A). For this purpose, cDNA constructs were bordered on the C-terminal sides by BstXI (position 101) and PvuII (position 149) restriction sites present in the alpha PAK cDNA (32). These E. coli-expressed polypeptides were purified as GST fusion proteins (Fig. 1B, left) and analyzed by using 10 pmol of proteins (Fig. 1B, right), which is within the range for a linear p21-binding response (55). All of these deletion constructs (but not GST) bound Cdc42 with lower affinity than full-length GST/alpha PAK (whose breakdown fragments also showed robust binding activity [Fig. 1B]). Deletion construct 1 (alpha PAK1-149) retained 70% of the Cdc42-binding activity of full-length alpha PAK (Fig. 1C, lane 2). Construct 2 (alpha PAK1-101), extending the C-terminal limits of the weakly binding construct described by Burbelo et al. (7), still bound GTP-Cdc42 threefold more weakly than alpha PAK1-149 (lane 3), indicating that residues 102 to 149 enhance binding affinity. Since levels of alpha PAK61-149 and PAK1-149 binding were similar (Fig. 1C, lane 3), we conclude that the first 60 residues in alpha PAK do not contribute to p21 binding. Deletion of a further 10 residues N terminal (71 to 149; construct 5) slightly decreased binding further. Surprisingly, alpha PAK69-149(P73H) exhibited binding eightfold lower than this (Fig. 1C, lanes 4 and 5) (the additional two residues in the mutant construct were added so as not to place the altered residue too close to the GST-PAK junction). Proline 73 is not present in yeast PAK-like kinases or in other CRIB motif-containing proteins (7). From these results, it is apparent that residues 102 to 149, in the region well beyond the CRIB motif (residues 75 to 87), contribute in some way to p21 binding. However, construct alpha PAK83-149, lacking part of this core binding sequence, is devoid of p21-binding activity (Fig. 4E), indicating that these flanking sequences have no intrinsic binding activity. Comparison of the N-terminal sequences in PAK-like kinases from mammals, invertebrates, and yeast showed that in the region corresponding to alpha PAK71-131, residues are uniformly conserved (Fig. 2A). This encompasses the CRIB motif and flanking C-terminal sequences; there is no apparent bias of conservation in the N-terminal CRIB motif. The C-terminal sequences are not found in other classes of Cdc42/Rac1 binding proteins, such as ACK, WASP, and MLK3 (1, 7, 31).


View larger version (26K):
[in this window]
[in a new window]
  		FIG. 1.   Sequences affecting efficiency of p21 binding to alpha PAK. (A) Schematic diagram representing regions of alpha PAK expressed and purified from E. coli. Amino acid numbers at the beginning and the end of each fragment are indicated on the right. The point mutation present in construct 4 is marked by "x." FL, full length. (B) GST/alpha PAK constructs were expressed and purified as GST fusion proteins, and 1 µg of each protein was resolved by SDS-PAGE (12% gel) and stained with Coomassie brilliant blue (left); 10 pmol of each of these proteins was analyzed by an overlay binding assay using [gamma -32P]GTP-Cdc42 (right). (C) The Cdc42-binding signals shown in panel B (right) were quantified on a PhosphorImager (Molecular Dynamics). The means of data from two independent experiments are shown.


View larger version (53K):
[in this window]
[in a new window]
  		FIG. 2.   Mutations in the N terminus of the PAN motif abolish p21 binding. (A) Sequence alignment of PAN motifs of PAK-related proteins from rat (alpha -, beta -, and gamma -PAK), Drosophila (DPAK), Caenorhabditis elegans (Ce-PAK), S. cerevisiae (Ste20p, Cla4p, and Sc-PAK), and Schizosaccharomyces pombe (Shk1p). Accession numbers are given elsewhere (27). The conserved residues are boxed in black, and a consensus of these is shown below. Amino acid substitutions corresponding to each of the mutant constructs are shown. (B) The first 250 amino acids of each alpha PAK mutant and wild-type (Wt) construct were purified as GST fusion proteins, and 1 µg of each protein was resolved by SDS-PAGE (11% gel) and stained with Coomassie brilliant blue (top); p21 binding to bands containing 0.4 µg of each protein was determined by overlays with [gamma -32P]GTP-Cdc42 (bottom). (C) The Cdc42 binding signals in panel B (bottom) were quantified on a PhosphorImager; the means of two independent experiments are shown. (D) Expression constructs encoding HA-alpha PAK mutants as indicated were transfected into HeLa cells alone or with FLAG-Cdc42G12V. Typical cells stained for alpha PAK are shown; in all cases, the cells were also stained with antipaxillin to confirm that peripherally located PAK was in FCs. Bar, 10 µm.

Amino acid substitutions that affect p21 binding do not prevent PAK recruitment to Cdc42-driven FCs. To investigate the function of the conserved residues in the PAN motif, we introduced amino acid substitutions at beginning, middle, and end positions indicated in Fig. 2A. To analyze their p21-binding activities, residues 1 to 250 of each mutant were purified and subjected to Western overlay with [gamma -32P]GTP-labeled Cdc42 (Fig. 2B); mutants M10 and M11 could not be recovered as stable GST fusion proteins. As shown in Fig. 2C, substitutions of conserved residues in the N-terminal portion of the PAN motif, M1 (I75N), M2 (S76P), M3 (P78A), and M4 (H83/86L), caused drastic loss of p21 binding; M6 (M100K) also showed reduced binding, but the C-terminal mutants had normal p21 binding. These amino acid substitution results concur with previously published data (7) showing that the N-terminal portion of the PAN motif functions as the core p21-binding region.

Recent reports that Cdc42-binding-deficient Ste20p mutants are functionally competent (23, 44) led us to consider whether the cellular activities of PAK could occur without its directly binding Cdc42. The normally cytoplasmic wild-type kinase is translocated to FCs by activated Cdc42 or Rac1 (34). We therefore tested whether Cdc42G12V could relocalize the p21-binding-deficient PAK mutants described above. alpha PAK mutant M4 was not investigated due to its partially activated state (see Fig. 4 and references 48 and 50). As shown in Fig. 2D, wild-type alpha PAK and the alpha PAK mutants M2 (S76P) and M3 (P78A), which were distributed throughout the cytoplasm and nucleus, became associated with peripheral FCs in a manner indistinguishable from that of wild-type alpha PAK when coexpressed with Cdc42G12V. These kinases were not activated by Cdc42G12V when coexpressed in COS-7 cells (data not shown) or by GTPgamma S-Cdc42 when tested in vitro (Fig. 3). Thus, PAK recruitment to FCs can be independent of direct association with Cdc42.


View larger version (36K):
[in this window]
[in a new window]
  		FIG. 3.   Mutations in the C-terminal portion of the PAN motif activate alpha PAK. (A) Activity of bacterially expressed GST/alpha PAK and GST/alpha PAKL404S in the presence or absence of GTP-Cdc42. Purified GST/alpha PAK or GST/alpha PAKL404S was assayed for kinase activity with MBP at 20 µM [gamma -33P]ATP in the presence or absence of GTP-Cdc42. The kinase reaction was carried out at 30°C for 30 min. WT, wild type. (B) The GST/alpha PAKL404S mutants containing additional mutations in the PAN motif were expressed and purified from E. coli. The GST/PAK bands (arrows) correspond to 1 µg of the purified proteins stained with Coomassie brilliant blue. (C) Proteins shown in panel B were assayed for kinase activity to MBP in the presence or absence of GTP-Cdc42. Arrows indicate positions of autophosphorylated PAK and phosphorylated MBP bands. (D) Quantification of the MBP phosphorylation shown in panel C.

The C-terminal portion of the PAN motif may negatively regulate the kinase. The wild-type alpha PAK is toxic in E. coli, probably due to its constitutive kinase activity in this bacterium (34). We were able to obtain, by serendipitous in vivo selection, an attenuated form of alpha PAK where leucine 404 is replaced by serine; this mutant exhibited low intrinsic kinase activity when purified as a GST fusion protein and was activated in vitro by GTP-bound Cdc42 or Rac1, albeit with slower than wild-type activation kinetics (33). A comparison of purified recombinant wild-type alpha PAK with alpha PAKL404S is shown in Fig. 3A. This alpha PAKL404S enabled us to assess the effects of additional mutations on kinase activation.

Those mutants that could be expressed as full-length GST/alpha PAKL404S fusion proteins were purified and analyzed on SDS-8% polyacrylamide gels (Fig. 3B). Mutants M1, M2, M3, and M5 showed the same electrophoretic migration as the inactive alpha PAKL404S (lane 1); part of the M4 protein appeared as a higher band (lane 5). By contrast, M6, M7, and M9, with mutations in the C-terminal portion of the PAN motif, exhibited a retarded electrophoretic mobility indistinguishable from that of constitutively active wild-type (autophosphorylated) alpha PAK protein (lane 10). Since equivalent mutations in PAK1-250 did not affect its electrophoretic mobility (Fig. 2B), the retarded mobility of these mutant full-length kinases probably reflects kinase autophosphorylation. Indeed, all of the shifted mutants had elevated activity toward MBP in the absence of p21 (Fig. 3C and D). Mutants M1, M2, and M3, with amino acid substitutions which abolished p21-binding activity, showed only a basal level of kinase activity, which was not stimulated by GTPgamma S-Cdc42 (Fig. 3C and D). PAK mutants M4, M7, and M9, which were apparently constitutively phosphorylated, showed robust kinase activity toward MBP even without GTP-Cdc42 (Fig. 3C and D). Mutant M6 was an exception; despite being fully shifted, it exhibited a rather low constitutive activity which was increased by GTPgamma S-Cdc42. Taken together, these results indicated an autoinhibitory role for the residues in the C-terminal portion of the PAN motif.

Constructing a minimal PAK-inhibitory polypeptide. We then determined whether the N-terminal half of the kinase harbored inhibitory sequences by testing GST/alpha PAK1-250 (S76P), deficient in Cdc42 binding (Fig. 2C), for its ability to inhibit PAK activation in vitro. Increasing amounts of GST/alpha PAK1-250(S76P) were added into the kinase assay reactions in the presence of excess GTP-Cdc42 (Fig. 4A, lanes 2 to 5). Both autophosphorylation and kinase activities were inhibited (Fig. 4A and B). Additional GTP-Cdc42 did not overcome this inhibition (Fig. 4B, lanes 6 to 8). Thus, alpha PAK activation can be directly inhibited by an excess of N-terminal regulatory sequences. To localize the autoinhibitory region, four smaller fusion proteins covering different lengths of the C-terminal region of the PAN motif were similarly tested (Fig. 4C and D). alpha PAKL404S activation by GTPgamma S-Cdc42 was clearly prevented by GST/alpha PAK83-149 and GST/alpha PAK83-131 but not by the smaller GST/alpha PAK99-149 and GST/alpha PAK99-131. GST/alpha PAK83-149 did not bind p21 (Fig. 4E) since it lacks critical residues 71 to 82. 


View larger version (38K):
[in this window]
[in a new window]
  		FIG. 4.   The C terminus of the PAN motif inhibits PAK activation by GTP-Cdc42. (A) The PAK N-terminal fusion protein GST/alpha PAK1-250(S76P) inhibits PAK activation by GTP-Cdc42. The kinase activity of bacterially expressed GST/alpha PAKL404S was assayed in the absence (lane 1) or presence (lane 2 to 8) of the indicated amounts of GTP-Cdc42. The autoradiograph shows inhibition due to the indicated amounts of GST/alpha PAK1-250(S76P) added during the kinase reactions. Signals of alpha PAK autophosphorylation and MBP phosphorylation are indicated by arrows. (B) Quantification of the MBP phosphorylation shown in panel A. (C) Schematic diagram of four peptides in the PAN motif region. The corresponding amino acid sequence is shown at the top. These peptides were expressed as GST fusion proteins. SDS-PAGE analysis of 1 µg of each purified protein showed single appropriately sized bands (not shown). (D) One microgram of bacterially expressed GST/alpha PAKL404S was assayed for kinase activity to MBP in the presence of excess GTP-Cdc42 (4 µg) and 4 µg of each inhibitory peptide. The MBP phosphorylation signals were quantified on a PhosphorImager. (E) One microgram each of GST/alpha PAK and GST proteins was resolved by SDS-PAGE (11% gel) and blotted onto a polyvinylidene difluoride membrane. The proteins were stained with Coomassie blue (left), and their p21 binding was analyzed by overlay with [gamma -32P]GTP-Cdc42 (right). Asterisks indicate positions of protein bands.

To test whether this inhibitory domain could suppress wild-type alpha PAK activation, we used purified wild-type alpha PAK and beta PAK expressed in COS-7 cells, which are recovered in forms exhibiting basal kinase activity (34). Excess GST/alpha PAK83-149 was highly effective in inhibiting alpha PAK and beta PAK activation in vitro by GTP-Cdc42, whereas GST/alpha PAK83-131 was not (Fig. 5A). However, GST/alpha PAK83-149 did not inhibit kinase activity of E. coli-expressed active wild-type (autophosphorylated) GST/alpha PAK or GST/beta PAK (Fig. 5B). This finding suggests that the inhibitory domain functions primarily by preventing autophosphorylation (Fig. 4A) and consequential activation of the kinase. Replacing D126 with R resulted in substantial loss of the inhibitory function of alpha PAK83-148 (Fig. 5C; compare lanes 4 and 5). The inhibitor was highly potent in vitro, with an apparent Ki of 90 nM (Fig. 5D). When a cDNA encoding GST/alpha PAK83-149 was cotransfected with alpha PAK and Cdc42G12V into COS-7 cells, it completely blocked PAK activation (Fig. 5E; compare lanes 3 and 4), while the equivalent D126R mutant was ineffective (lane 5). This was evident in terms of both alpha PAK mobility and its activity toward MBP (as quantified at the bottom of Fig. 5E). The GST/inhibitor construct was detected as a single 35-kDa band, indicating its stability under in vivo expression conditions.


View larger version (47K):
[in this window]
[in a new window]
  		FIG. 5.   Specific inhibition of alpha PAK and beta PAK activation by the GST/alpha PAK83-149 polypeptide. (A) In each assay, 0.2 µg of alpha PAK or beta PAK purified from COS-7 cells was assayed for kinase activity toward MBP in the absence (lane 1) or presence of 2 µg of GTPgamma S-Cdc42 (lanes 2 to 6) and 2 µg of indicated PAK-derived polypeptides (lanes 4 to 6). GST was used as a control (lane 3). Kinase reactions were carried out with 10 µM [gamma -33P]ATP and 10 µg of MBP in a final volume of 30 µl; half of the reaction was analyzed on 12% polyacrylamide gels. The MBP region of the autoradiograph is shown. (B) Bacterially expressed (active) GST/alpha PAK (1 µg) and GST/beta PAK (1 µg) were assayed for MBP kinase activity (as described above) in the absence (lanes 1 and 3) or presence (lanes 2 and 4) of 5 µg of GST/alpha PAK83-149. (C) A mutation (D126R) in GST/alpha PAK83-148 interferes with its inhibitory activity. Top, Coomassie blue-stained gel (12%); bottom, corresponding autoradiograph of the MBP region. Each reaction was carried out with 0.2 µg of alpha PAK which was activated in the presence of 2 µg of Cdc42-GTPgamma S. Lanes 4 and 5 contained 1.5 µg of GST/alpha PAK83-148 or GST/alpha PAK83-148(D126R), a level ~15-fold higher than the calculated Ki of the wild-type inhibitor (D). GST alone has no effect on activation (the larger GST form contains attached polylinker-derived sequence). Kinase reactions were as for panel A. (D) Concentration dependence of alpha PAK inhibition was determined by using 50 ng of kinase (=18 nM) under activation conditions as for panel A while varying the GST/alpha PAK83-148 concentration. MBP phosphorylation was quantified on a PhosphorImager. For reference, the data of MBP phosphorylation is shown in the inset. (E) Inhibition of alpha PAK activation by coexpression of GST/alpha PAK83-149 in COS-7 cells. Cells (in 100-mm-diameter dishes) were transfected with 3 µg of FLAG-alpha PAK (lanes 2 to 5) with or without 3 µg of HA-Cdc42G12V expression plasmid as indicated. Expression of GST, GST/alpha PAK83-149, or the mutant (D126R) version (6 µg of plasmid per dish) was detected in the total extract by using anti-GST antibodies. The activity of the anti-FLAG immunoprecipitates, recovering equivalent amounts of the kinase (top), was determined by phosphorylation of MBP (counts quantified at the bottom).

PAK inhibitor prevents certain cytoskeletal rearrangements induced by Cdc42 and Rac1. In HeLa cells, expression of Cdc42G12V induces formation of filopodia and cell retraction (34); stress fibers and Rho-dependent focal adhesions disappear with production of new peripheral FCs. Rac1G12V-expressing cells, which are characterized by cell flattening, membrane ruffling, and formation of bead-like FCs at the cell periphery, also lose stress fibers (39). In (human) HeLa cells, gamma PAK represents the predominant form corresponding to hPAK65 (36). Injection of a plasmid expressing the PAK83-149 inhibitor sequence had no effect on the morphology of HeLa cells; the inhibitor was cytosolic, and its disposition was apparently unaffected by Cdc42 or Rac (data not shown). However, its expression dramatically affects cytoskeletal reorganization elicited by Cdc42 and Rac1 (Fig. 6). In each field, we show a typical p21-injected cell, a cell doubly injected with p21 plus PAK inhibitor, and uninjected control cells. Compared with HA-Cdc42G12V injection alone (Fig. 6a and b), cells coinjected with plasmid encoding alpha PAK83-149 did not exhibit a clear reorganization of actin to the periphery 2 h after injection. Peripheral actin microspikes were always absent in the doubly injected cells. Typically both Cdc42G12V- and Rac1G12V-injected cells coexpressing alpha PAK83-149 (Fig. 6c and d) retained internal Rho-type FCs while forming peripherally located FCs. With Cdc42G12V plus alpha PAK83-149, these peripheral complexes were clearly larger than with Cdc42G12V alone (Fig. 6c). The formation of these new FCs indicates that the p21s are functional in the presence of the kinase inhibitor and that PAK kinase activity is not required for FC formation. We monitored the behavior of cells to 4 h postinjection (Fig. 6e to h); over this time period, coexpression of alpha PAK83-149 still prevented the production of peripheral actin microspikes in Cdc42G12V-expressing cells (Fig. 6e and f) but did not block membrane ruffles due to RacG12V (Fig. 6g and h). This lack of effect on ruffles, seen here as a stained and wavy outline, was also observed on phase-contrast microscopy (data not shown). PAK inhibition also prevented the loss of actin stress fibers in both Cdc42G12V- and Rac1G12V-expressing cells (Fig. 6f and h).


View larger version (85K):
[in this window]
[in a new window]
  		FIG. 6.   Morphological effects of Cdc42 and Rac are blocked by inhibitory PAK83-149. HeLa cells were examined 2 h (a to d) or 4 h (e to h) after plasmid microinjection. In each case, a constitutively active mutant (G12V) form of Cdc42 or Rac1 was used. The top panels show that coinjection of the PAK inhibitor (arrowheads) blocks the reorganization of actin stress fibers normally seen with Cdc42 (arrows). Analysis of FCs by paxillin staining (c and d) shows production of peripherally located FCs to occur in the presence of the PAK inhibitor (arrowheads), but the resultant structures are thicker and there is no apparent loss of the existing internal focal adhesions. Even after 4 h, Cdc42G12V-expressing cells (e) do not form filopodia or retraction fibers when injected with the PAK inhibitor: with both Cdc42G12V and RacG12V, PAK inhibition leads to an overall increase in the intensity of stress fiber staining (f and h).

Expression of alpha PAK83-149 blocks PAK function in vivo. We then tested whether alpha PAK83-149 could block the morphological effects of alpha PAK itself. Certain mutant forms of alpha PAK require no binding of Cdc42 to be fully activated in cultured cells, and their expression results in loss of actin stress fibers and focal adhesions and in the concomitant retraction of peripheral membranes (34). We found that alpha PAKL107F (6) has greater activity when recovered from COS-7 cells than HAalpha PAKEQ116/117KK (M7) and HA-alpha PAKD126R (M9) proteins (data not shown) or the chimeric PAK-CC that we reported previously (34). Injection of a plasmid encoding alpha PAKL107F elicited rapid changes in cell morphology, in line with our previous observations. HeLa cells injected with plasmid encoding alpha PAKL107F (Fig. 7) behaved very differently from those coinjected with an alpha PAKL107F plasmid and with a plasmid encoding the inhibitory alpha PAK83-149. Notably, the coinjected cells did not undergo the characteristic retraction (Fig. 7a), nor was there any evident loss of stress fibers or focal adhesions (Fig. 7b and c), although both cells clearly expressed alpha PAKL107F (Fig. 7a). Injection with plasmid encoding HA-alpha PAK83-149 showed that expression of the inhibitor by itself led to no distinct changes in actin or vinculin staining (data not shown). These results show that inhibitory alpha PAK83-149 is able to block PAK activity in vivo. The inhibitor presumably interferes with intracellular activation of kinase, since alpha PAKL107F recovered from COS-7 cells displayed the retardation in mobility characteristic of hyperphosphorylated and activated PAK only when the inhibitor was not coexpressed (data not shown).


View larger version (56K):
[in this window]
[in a new window]
  		FIG. 7.   The PAK inhibitor can block effects of constitutively active PAK in vivo. The effects of microinjected alpha PAKL107F on HeLa cells (arrows) include cell retraction (a) seen in cells stained for expressed PAK, loss of actin stress fibers (b), and dissolution of paxillin-stained focal adhesions (c). All three effects could be blocked by coinjection of an expression construct encoding alpha PAK83-149 (arrowheads).

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Activation of PAK. PAK kinases can be directly and potently activated by the GTP-bound forms of Cdc42 and Rac1, unlike Rho-binding kinases such as ROK or PKN, which are activated only weakly on binding to Rho-GTP (13, 25, 37, 59). Our results indicate that the PAK N-terminal PAN motif integrates two functions, p21 binding and kinase inhibition. Binding of Cdc42/Rac initiates release of a negative constraint embodied in sequences immediately C terminal of the binding site to allow autophosphorylation and kinase activation. The autoinhibitory sequence, like the kinase domain, is highly conserved among PAKs from yeasts to humans but is absent from other Cdc42 effectors, including ACK (31) and WASP (1, 18, 53). Native purified PAKs are regulatable kinases with low intrinsic activity (4, 32); however, for reasons that are not apparent, wild-type PAKs are constitutively active when expressed in E. coli (34). This precludes use of recombinant protein for regulatory studies unless a suitable derivative such as alpha PAKL404S is employed. Use of this attenuated kinase, which undergoes autophosphorylation identical to that of the wild type upon Cdc42 activation in vitro (34), revealed that amino acid substitutions in the autoinhibitory sequence produce activated kinases (Fig. 3). PAK1L107F (6) and mPAK3, containing mutations equivalent to positions F96, G98, and P100 in alpha PAK (2), are similarly active. The effects of mutations dispersed throughout alpha PAK83-131 suggest that they act by altering the conformation of the inhibitory region. The behavior of the H83/86L mutant may reflect overlapping of p21-binding and inhibitory domains. The data suggest a model in which the inhibitory region forms a complex with the kinase domain, rendering it inactive, but does not do so when the domain is already activated (with phosphorylated T422).

Other studies have pointed to a role for N-terminal regions of PAK-related proteins in negatively regulating kinase activity. Expression of PAK1 (alpha PAK) lacking the first 231 amino acids, but not of full-length PAK1, yielded active kinase (45). S6/H4 (gamma PAK-like) kinase can be proteolytically cleaved in vitro to yield an activated catalytic fragment (~40 kDa) (4). Caspase-mediated cleavage of PAK2 (gamma PAK) at position 212 during apoptosis activates the kinase (49) and may play an important part in the morphological changes seen during cell death. By specifically inhibiting PAK, it should be possible to dissect the role of PAK in apoptosis.

Many protein kinases are regulated by autoinhibition in which substrate-like sequences complex with the catalytic site to block substrate binding and in some cases autophosphorylation. Binding of an allosteric activator can disrupt conformation in the autoinhibitory domain (16, 52). Residues 580 to 595 in myosin light-chain kinase resemble a consensus substrate site and constitute an autoinhibitory domain (10, 14); a corresponding synthetic peptide inactivates the proteolytically activated kinase (17). The N-terminally located autoinhibitory domain of protein kinase C (PKC) is well documented (9, 12, 42). In these cases, the pseudosubstrate inhibitory domain primarily blocks phosphorylation of exogenous substrates. In contrast, the alpha PAK inhibitor sequence (83 to 149) cannot inhibit active (autophosphorylated) forms of alpha PAK and beta PAK (Fig. 5C). Its mechanism of action therefore probably involves blocking autophosphorylation events. If a pseudosubstrate-like peptide exists within PAK83-149, its conformation must be stabilized by flanking sequences since we cannot derive a smaller inhibitory peptide (Fig. 3). The PAK autoinhibitory domain may partially overlap and be stabilized by the p21-binding domain (Fig. 4), resembling yeast PKC1, where the Rho1-binding domain lies within a pseudosubstrate sequence (40).

Morphological roles for PAK downstream of Cdc42 and Rac. The finding that PAK83-149 can potently inhibit PAK kinase activity has allowed us to assess PAK function without overexpressing the kinase itself or mutant forms. Larger N-terminal regions of PAK or kinase-dead full-length PAK have been used as dominant negatives in cotransfection experiments (2, 60). Use of these larger constructs is compromised by their potential to sequester Cdc42/Rac and by the PAK N-terminal protein itself acting as an adapter potentially recruiting proteins such as Nck (3, 5, 11, 29). Expression of the PAK inhibitor in Cdc42G12V-expressing HeLa cells blocked both cell retraction and rounding and the induction of peripheral actin microspikes (Fig. 6) normally seen in epithelial, fibroblastic, and neuroblastoma cells (20, 34, 39). Similar effects of the PAK inhibitor were observed with Swiss 3T3 cells (data not shown) in terms of both reorganization of FCs and production of peripheral actin microspikes. Since coexpression of alpha PAK83-149 completely blocks Cdc42-mediated activation of cotransfected PAK (Fig. 5), endogenous PAK must be similarly affected. The ability of the inhibitor to block the phenotypic effects of alpha PAKL107F further confirms this conclusion.

Although PAK is clearly involved in Cdc42- and Rac-type morphological changes (34, 50), studies using effector mutants of Rac1 and Cdc42 that fail to interact with PAK (primarily substitutions at Y40) have been interpreted as showing that PAK is not necessary for Rac-driven membrane ruffling (15, 57) or for Cdc42 to form filopodia (21). From our results, we suggest the PAK activity is required to generate filopodia. One can reconcile these apparently contradictory observations because under some circumstances (Fig. 2), direct binding to Cdc42 is not essential for PAK recruitment to membrane-apposed Cdc42-driven focal complexes. This process does require its interaction with the focal complex protein PIX (35). Upon translocation to the plasma membrane, there is consequential activation of PAK (29). This model is supported by our data showing that PIX, the ubiquitous Rac guanine nucleotide exchange factor tightly associated with PAK, can mediate kinase activation by Cdc42(Y40C), which does not directly bind the kinase (35). The identification of this PAK-associated guanine nucleotide exchange factor might also explain the Rac-like phenotypes seen with microinjected PAK (50).

We previously showed that expression of constitutionally active PAK can antagonize Rho function. In this study, we demonstrate that PAK does indeed play such a role downstream of Cdc42 (Fig. 8). The recent identification of a ROK-like kinase lying downstream of Cdc42 termed MRCK (26) provides a Cdc42 target that promotes focal complex formation. MRCK and PAK apparently play synergistic roles in promoting filopodia and dynamic FC structures. Cdc42G12V-expressing HeLa cells form peripheral actin microspikes and become devoid of intracellular stress fibers (Fig. 6b and f), but cells coexpressing the PAK inhibitor show no such formation of microspikes and display an increased stress fiber content. In the case of Rac1G12V expression, it is clear that blocking PAK prevents the loss of stress fibers, but otherwise we do not observe any perturbation to the Rac-induced phenotype (cell spreading and ruffling). Thus, we conclude that the primary morphological role of PAK is to facilitate turnover of actin stress fibers and dissolve focal adhesions and that Cdc42 requires PAK kinase activity for production of filopodia and for cell rounding and retraction (Fig. 8).


View larger version (31K):
[in this window]
[in a new window]
  		FIG. 8.   A model of PAK function in relation to known effectors of Rho-p21s. The targets of Cdc42, Rac, and Rho which have known morphological roles are shown. MRCK is the myotonin kinase-related Cdc42-binding kinase (26); p140mDia is the mammalian homolog of Drosophila diaphanous (58); the other Rho-binding kinase, PKN (59), has no known morphological function. PAK acts downstream of both Cdc42 and Rac to break down actin cytoskeletal structures and focal adhesions (FAs). This function could be particularly important in remodeling the cytoskeleton to allow dynamic events such as filopodial extension and subsequent formation of lamellipodia, ultimately leading to cell migration or growth cone extension (20). MLC, myosin light chain; MLCK, myosin light-chain kinase.

    ACKNOWLEDGMENT

This work was supported by the Glaxo Singapore Research Fund.

    FOOTNOTES

* Corresponding author. Mailing address: Glaxo-IMCB Group, Institute of Molecular & Cell Biology, 30 Medical Dr., Singapore 117609, Singapore. Phone: (65) 874-6167. Fax: (65) 774-0742. E-mail: L.Lim{at}ion.ucl.ac.uk.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Aspenstrom, P., U. Lindberg, and A. Hall. 1995. Two GTPases, Cdc42 and Rac, bind directly to a protein implicated in the immunodeficiency disorder Wiskott-Aldrich syndrome. Curr. Biol. 6:70-75.
2. Bagrodia, S., B. Derijard, R. J. Davis, and R. A. Cerione. 1995. Cdc42 and PAK-mediated signalling leads to JNK and p38 mitogen-activated protein kinase activation. J. Biol. Chem. 270:27995-27998[Abstract/Free Full Text].
3. Bagrodia, S., S. J. Taylor, C. L. Creasy, J. Chernoff, and R. A. Cerione. 1995. Identification of a mouse p21cdc42/rac activated kinase. J. Biol. Chem. 270:22731-22737[Abstract/Free Full Text].
4. Benner, G. E., P. B. Dennis, and R. A. Masaracchia. 1995. Activation of an S6/H4 kinase (PAK 65) from human placenta by intramolecular and intermolecular autophosphorylation. J. Biol. Chem. 270:21121-21128[Abstract/Free Full Text].
5. Bokoch, G. M., Y. Wang, B. P. Bohl, M. A. Sells, L. A. Quilliam, and U. G. Knaus. 1996. Interaction of the Nck adapter protein with p21-activated kinase (PAK1). J. Biol. Chem. 271:25746-25749[Abstract/Free Full Text].
6. Brown, J. L., L. Stowers, M. Baer, J. A. Trejo, S. Coughlin, and J. Chant. 1996. Human Ste20 homologue hPAK1 links GTPases to the JNK MAP kinase pathway. Curr. Biol. 6:598-605[Medline].
7. Burbelo, P. D., D. Drechsel, and A. Hall. 1995. A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rac GTPases. J. Biol. Chem. 270:29071-29074[Abstract/Free Full Text].
8. Coso, O. A., M. Chiariello, J. C. Yu, H. Teramoto, P. Crespo, N. Xu, T. Miki, and J. S. Gutkind. 1995. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signalling pathway. Cell 81:1137-1146[Medline].
9. Coussens, L., P. J. Parker, L. Rhee, T. L. Yang-Feng, E. Chen, M. D. Waterfield, U. Francke, and A. Ullrich. 1986. Multiple, distinct forms of bovine and human protein kinase C suggest diversity in cellular signalling pathways. Science 233:859-866[Abstract/Free Full Text].
10. Edelman, A. M., K. Takio, D. K. Blumenthal, R. S. Hansen, K. A. Walsh, K. Titani, and E. G. Krebs. 1985. Characterization of the calmodulin-binding and catalytic domains in skeletal muscle myosin light chain kinase. J. Biol. Chem. 260:11275-11285[Abstract/Free Full Text].
11. Galisteo, M. L., J. Chernoff, Y.-C. Su, E. Y. Skolnik, and J. Schlessinger. 1996. The adaptor protein Nck links receptor tyrosine kinases with the serine-threonine kinase Pak1. J. Biol. Chem. 271:20997-21000[Abstract/Free Full Text].
12. House, C., and B. E. Kemp. 1987. Protein kinase C contains a pseudosubstrate prototype in its regulatory domain. Science 238:1726-1728[Abstract/Free Full Text].
13. Ishizaki, T., M. Maekawa, K. Fujisawa, K. Okawa, A. Iwamatsu, A. Fujita, N. Watanabe, Y. Saito, A. Kakizuka, N. Morii, and S. Narumiya. 1996. The small GTP-binding protein Rho binds to and activates a 160 kda Ser/Thr protein kinase homologous to myotonic dystrophy kinase. EMBO J. 15:1885-1893[Medline].
14. Ito, M., V. Guerriero, Jr., X. M. Chen, and D. J. Hartshorne. 1991. Definition of the inhibitory domain of smooth muscle myosin light chain kinase by site-directed mutagenesis. Biochemistry 30:3498-3503[Medline].
15. Joneson, T., M. McDonough, D. Bar-Sagi, and L. Van Aelst. 1996. RAC regulation of actin polymerization and proliferation by a pathway distinct from Jun kinase. Science 274:1374-1376[Abstract/Free Full Text].
16. Kemp, B. E., M. W. Parker, S. Hu, T. Tiganis, and C. House. 1994. Substrate and pseudosubstrate interactions with protein kinases: determinants of specificity. Trends Biochem. Sci. 19:440-444[Medline].
17. Kennelly, P. J., A. M. Edelman, D. K. Blumenthal, and E. G. Krebs. 1987. Rabbit skeletal muscle myosin light chain kinase. The calmodulin binding domain as a potential active site-directed inhibitory domain. J. Biol. Chem. 262:11958-11963[Abstract/Free Full Text].
18. Kolluri, R., K. F. Tolias, C. L. Carpenter, F. S. Rosen, and T. Kirchhausen. 1996. Direct interaction of the Wiskott-Aldrich syndrome protein with the GTPase Cdc42. Proc. Natl. Acad. Sci. USA 93:5615-5618[Abstract/Free Full Text].
19. Kozma, R., S. Ahmed, A. Best, and L. Lim. 1995. The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Mol. Cell. Biol. 15:1942-1952[Abstract].
20. Kozma, R., S. Sarner, S. Ahmed, and L. Lim. 1997. Rho family GTPases and neuronal growth cone remodelling: relationship between increased complexity induced by Cdc42Hs, Rac1, and acetylcholine and collapse induced by RhoA and lysophosphatidic acid. Mol. Cell. Biol. 17:1201-1211[Abstract].
21. Lamarche, N., N. Tapon, L. Stowers, P. D. Burbelo, P. Aspenstrom, T. Bridges, J. Chant, and A. Hall. 1996. Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade. Cell 87:519-529[Medline].
22. Leberer, E., D. Dignard, D. Harcus, D. Y. Thomas, and M. Whiteway. 1992. The protein kinase homologue Steo20p is required to link the yeast pheromone response G-protein beta gamma subunits to downstream signalling components. EMBO J. 11:4815-4824[Medline].
23. Leberer, E., C. Wu, T. Leeuw, A. Fourest-Lieuvin, J. E. Segall, and D. Y. Thomas. 1997. Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase. EMBO J. 16:83-97[Medline].
24. Leung, T., E. Manser, L. Tan, and L. Lim. 1995. A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes. J. Biol. Chem. 270:29051-29054[Abstract/Free Full Text].
25. Leung, T., X.-Q. Chen, E. Manser, and L. Lim. 1996. The p160 RhoA-binding kinase ROKalpha is a member of a kinase family and is involved in the reorganization of the cytoskeleton. Mol. Cell. Biol. 16:5313-5327[Abstract].
26. Leung, T., X.-Q. Chen, I. Tan, E. Manser, and L. Lim. 1998. Myotonic dystrophy kinase-related Cdc42-binding kinase acts as a Cdc42 effector in promoting cytoskeletal reorganization. Mol. Cell. Biol. 18:130-140[Abstract/Free Full Text].
27. Lim, L., E. Manser, T. Leung, and C. Hall. 1996. Regulation of phosphorylation pathways by p21 GTPases. Eur. J. Biochem. 242:171-185[Medline].
28. Liu, H., C. Styles, and G. R. Fink. 1993. Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 262:1741-1744[Abstract/Free Full Text].
29. Lu, W., S. Katz, R. Gupta, and B. J. Mayer. 1997. Activation of Pak by membrane localization mediated by an SH3 domain from the adaptor protein Nck. Curr. Biol. 7:85-94[Medline].
30. Manser, E., T. Leung, C. Monfries, M. Teo, C. Hall, and L. Lim. 1992. Diversity and versatility of GTPase activating proteins for the p21rho subfamily of ras G proteins detected by a novel overlay assay. J. Biol. Chem. 267:16025-16028[Abstract/Free Full Text].
31. Manser, E., T. Leung, H. Salihuddin, L. Tan, and L. Lim. 1993. A non-receptor tyrosine kinase that inhibits the GTPase activity of p21cdc42. Nature 363:364-367[Medline].
32. Manser, E., T. Leung, H. Salihuddin, Z.-S. Zhao, and L. Lim. 1994. A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature 367:40-46[Medline].
33. Manser, E., C. Chong, Z.-S. Zhao, T. Leung, G. Michael, C. Hall, and L. Lim. 1995. Molecular cloning of a new member of the p21-Cdc42/Rac-activated kinase (PAK) family. J. Biol. Chem. 270:25070-25078[Abstract/Free Full Text].
34. Manser, E., H.-Y. Huang, T.-H. Loo, X.-Q. Chen, J.-M. Dong, T. Leung, and L. Lim. 1997. Expression of constitutively active alpha -PAK reveals effects of the kinase on actin and focal complexes. Mol. Cell. Biol. 17:1129-1143[Abstract].
35. Manser, E., T.-H. Loo, C.-G. Koh, Z.-S. Zhao, I. Tan, T. Leung, and L. Lim. 1998. A family of guanine nucleotide exchange factors (PIXs) is directly coupled to the p21(Cdc42 and Rac)-activated kinase alpha PAK. Mol. Cell 1:183-192[Medline].
36. Martin, G. A., G. Bollag, F. A. McCormick, and A. Abo. 1995. A novel serine kinase activated by rac/Cdc42Hs-dependent autophosphorylation is related to PAK65 and Ste20. EMBO J. 14:1970-1978[Medline].
37. Matsui, T., M. Amano, T. Yamamoto, K. Chilhara, M. Nakafuku, M. Ito, T. Nakano, K. Okawa, A. Iwamamatsu, and K. Kaibuchi. 1996. Rho-associated kinase, a novel serine threonine kinase, as a putative target for the small GTP-binding protein Rho. EMBO J. 15:2208-2216[Medline].
38. Minden, A., A. Lin, F.-X. Claret, A. Abo, and M. Karin. 1995. Selective activation of the JNK signalling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell 81:1147-1157[Medline].
39. Nobes, C. D., and A. Hall. 1995. Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibres, lamellipodia, and filopodia. Cell 81:53-62[Medline].
40. Nonaka, H., K. Tanaka, H. Hirano, T. Fujiwara, H. Kohno, M. Umikawa, A. Mino, and Y. Takai. 1995. A downstream target of RHO1 small GTP-binding protein is PKC1, a homolog of protein kinase C, which leads to activation of the MAP kinase cascade in Saccharomyces cerevisiae. EMBO J. 14:5931-5938[Medline].
41. Olson, M. F., A. Ashworth, and A. Hall. 1995. An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1. Science 269:1270-1272[Abstract/Free Full Text].
42. Parker, P. J., L. Coussens, N. Totty, L. Rhee, S. Young, E. Chen, S. Stabel, M. D. Waterfield, and A. Ullrich. 1986. The complete primary structure of protein kinase C---the major phorbol ester receptor. Science 233:853-859[Abstract/Free Full Text].
43. Peppelenbosch, M. P., R.-G. Qiu, A. M. M. de Vries-Smits, L. G. J. Tertoolen, S. W. de Laat, F. McCormick, A. Hall, M. H. Symons, and J. L. Bos. 1995. Rac mediates growth factor-induced arachidonic acid release. Cell 81:849-856[Medline].
44. Peter, M., A. M. Neiman, H.-O. Park, M. van Lohuizen, and I. Herskowitz. 1996. Functional analysis of the interaction between the small GTP binding protein Cdc42 and the Ste20 protein kinase in yeast. EMBO J. 15:7046-7059[Medline].
45. Polverino, A., J. Frost, P. Yang, M. Hutchison, A. M. Neiman, M. H. Cobb, and S. Marcus. 1995. Activation of mitogen-activated protein kinase cascades by p21-activated protein kinases in cell-free extracts of Xenopus oocytes. J. Biol. Chem. 270:26067-26070[Abstract/Free Full Text].
46. Ridley, A. J., and A. Hall. 1992. The small GTP-binding protein Rho regulates the assembly of focal adhesions and actin stress fibres in response to growth factors. Cell 70:389-399[Medline].
47. Ridley, A. J., H. F. Paterson, C. L. Johnston, D. Diekmann, and A. Hall. 1992. The small GTP-binding protein Rac regulates growth factor-induced membrane ruffling. Cell 70:401-410[Medline].
48. Rudel, T., and G. M. Bokoch. 1997. Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science 276:1571-1574[Abstract/Free Full Text].
49. Sells, M. A., and J. Chernoff. 1997. Emerging from the Pak: the p21-activated protein kinase family. Trends Cell Biol. 7:162-167.
50. Sells, M. A., U. G. Knaus, S. Bagrodia, D. M. Ambrose, G. M. Bokoch, and J. Chernoff. 1997. Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Curr. Biol. 7:202-210.
51. Simon, M. N., C. Devirgilio, B. Souza, J. R. Pringle, A. Abo, and S. I. Reed. 1995. Role for the Rho-family GTPase Cdc42 in yeast mating pheromone signal pathway. Nature 376:702-705[Medline].
52. Soderling, T. R. 1990. Protein kinases. Regulation by autoinhibitory domains. J. Biol. Chem. 265:1823-1826[Free Full Text].
53. Symons, M., J. M. J. Derry, B. Karlak, S. Jiang, V. Lemahieu, F. McCormick, U. Francke, and A. Abo. 1996. Wiskott-Aldrich syndrome protein, a novel effector for the GTPase Cdc42Hs, is implicated in actin polymerization. Cell 84:723-734[Medline].
54. Tapon, N., and A. Hall. 1997. Rho, Rac and Cdc42 GTPases regulate the organization of the actin cytoskeleton. Curr. Opin. Cell Biol. 9:86-92[Medline].
55. Teo, M., E. Manser, and L. Lim. 1995. Identification and molecular cloning of a p21cdc42/rac1-activated serine/threonine kinase that is rapidly activated by thrombin in platelets. J. Biol. Chem. 270:26690-26697[Abstract/Free Full Text].
56. Van Aelst, L., T. Joneson, and D. Bar-Sagi. 1996. Identification of a novel Rac1-interacting protein involved in membrane ruffling. EMBO J. 15:3778-3786[Medline].
57. Watanabe, G., Y. Saito, P. Madaule, T. Ishizaki, K. Fujisawa, N. Morii, H. Mukai, Y. Ono, A. Kakizuka, and S. Narumiya. 1996. Protein kinase N (PKN) and PKN-related protein rhophilin as targets of the small GTPase Rho. Science 271:645-648[Abstract].
58. Watanabe, N., P. Madaule, T. Reid, T. Ishizaki, G. Watanabe, A. Kakizuka, Y. Saito, K. Nakao, B. M. Jockusch, and S. Narumiya. 1997. p140mDia, a mammalian homolog of Drosophila diaphanous, is a target protein for Rho small GTPase and is a ligand for profilin. EMBO J. 16:3044-3056[Medline].
59. Westwick, J. K., Q. T. Lambert, G. J. Clarke, M. Symons, L. Van Aelst, R. G. Pestell, and C. J. Der. 1997. Rac regulation of transformation, gene expression, and actin organization by multiple, PAK-independent pathways. Mol. Cell. Biol. 17:1324-1335[Abstract].
60. Zhang, S., J. Han, M. A. Sells, J. Chernoff, U. G. Knaus, R. J. Ulevitch, and G. M. Bokoch. 1995. Rho family GTPases regulate p38 mitogen-activated protein kinase through the downstream mediator Pak1. J. Biol. Chem. 270:23934-23936[Abstract/Free Full Text].
61. Zhao, Z.-S., T. Leung, E. Manser, and L. Lim. 1995. Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24. Mol. Cell. Biol. 15:5246-5257[Abstract].
62. Ziman, M., J. M. O'Brien, L. A. Ouellette, W. R. Church, and D. I. Johnson. 1991. Mutational analysis of CDC42Sc, a Saccharomyces cerevisiae gene that encodes a putative GTP-binding protein involved in the control of cell polarity. Mol. Cell. Biol. 11:3537-3544[Abstract/Free Full Text].

Mol Cell Biol, April 1998, p. 2153-2163, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Teng, T. S., Lin, B., Manser, E., Ng, D. C. H., Cao, X. (2009). Stat3 promotes directional cell migration by regulating Rac1 activity via its activator {beta}PIX. J. Cell Sci. 122: 4150-4159 [Abstract] [Full Text]  
  • Parrini, M. C., Camonis, J., Matsuda, M., de Gunzburg, J. (2009). Dissecting Activation of the PAK1 Kinase at Protrusions in Living Cells. J. Biol. Chem. 284: 24133-24143 [Abstract] [Full Text]  
  • Van den Broeke, C., Radu, M., Deruelle, M., Nauwynck, H., Hofmann, C., Jaffer, Z. M., Chernoff, J., Favoreel, H. W. (2009). Alphaherpesvirus US3-mediated reorganization of the actin cytoskeleton is mediated by group A p21-activated kinases. Proc. Natl. Acad. Sci. USA 106: 8707-8712 [Abstract] [Full Text]  
  • Hsu, Y.-H., Johnson, D. A., Traugh, J. A. (2008). Analysis of Conformational Changes during Activation of Protein Kinase Pak2 by Amide Hydrogen/Deuterium Exchange. J. Biol. Chem. 283: 36397-36405 [Abstract] [Full Text]  
  • Chan, P. M., Lim, L., Manser, E. (2008). PAK Is Regulated by PI3K, PIX, CDC42, and PP2C{alpha} and Mediates Focal Adhesion Turnover in the Hyperosmotic Stress-induced p38 Pathway. J. Biol. Chem. 283: 24949-24961 [Abstract] [Full Text]  
  • Parsons, M., Adams, J. C. (2008). Rac regulates the interaction of fascin with protein kinase C in cell migration. J. Cell Sci. 121: 2805-2813 [Abstract] [Full Text]  
  • Hasegawa, Y., Tribble, G. D., Baker, H. V., Mans, J. J., Handfield, M., Lamont, R. J. (2008). Role of Porphyromonas gingivalis SerB in Gingival Epithelial Cell Cytoskeletal Remodeling and Cytokine Production. Infect. Immun. 76: 2420-2427 [Abstract] [Full Text]  
  • Lozano, E., Frasa, M. A. M., Smolarczyk, K., Knaus, U. G., Braga, V. M. M. (2008). PAK is required for the disruption of E-cadherin adhesion by the small GTPase Rac. J. Cell Sci. 121: 933-938 [Abstract] [Full Text]  
  • Ayala, I., Baldassarre, M., Giacchetti, G., Caldieri, G., Tete, S., Luini, A., Buccione, R. (2008). Multiple regulatory inputs converge on cortactin to control invadopodia biogenesis and extracellular matrix degradation. J. Cell Sci. 121: 369-378 [Abstract] [Full Text]  
  • Rendon, B. E., Roger, T., Teneng, I., Zhao, M., Al-Abed, Y., Calandra, T., Mitchell, R. A. (2007). Regulation of Human Lung Adenocarcinoma Cell Migration and Invasion by Macrophage Migration Inhibitory Factor. J. Biol. Chem. 282: 29910-29918 [Abstract] [Full Text]  
  • Kreis, P., Thevenot, E., Rousseau, V., Boda, B., Muller, D., Barnier, J.-V. (2007). The p21-activated Kinase 3 Implicated in Mental Retardation Regulates Spine Morphogenesis through a Cdc42-dependent Pathway. J. Biol. Chem. 282: 21497-21506 [Abstract] [Full Text]  
  • Partridge, M. A., Marcantonio, E. E. (2006). Initiation of Attachment and Generation of Mature Focal Adhesions by Integrin-containing Filopodia in Cell Spreading. Mol. Biol. Cell 17: 4237-4248 [Abstract] [Full Text]  
  • Moldovan, L., Mythreye, K., Goldschmidt-Clermont, P. J., Satterwhite, L. L. (2006). Reactive oxygen species in vascular endothelial cell motility. Roles of NAD(P)H oxidase and Rac1. Cardiovasc Res 71: 236-246 [Abstract] [Full Text]  
  • ten Klooster, J. P., Jaffer, Z. M., Chernoff, J., Hordijk, P. L. (2006). Targeting and activation of Rac1 are mediated by the exchange factor {beta}-Pix. JCB 172: 759-769 [Abstract] [Full Text]  
  • Jung, J.-H., Traugh, J. A. (2005). Regulation of the Interaction of Pak2 with Cdc42 via Autophosphorylation of Serine 141. J. Biol. Chem. 280: 40025-40031 [Abstract] [Full Text]  
  • Martyn, K. D., Kim, M.-J., Quinn, M. T., Dinauer, M. C., Knaus, U. G. (2005). p21-activated kinase (Pak) regulates NADPH oxidase activation in human neutrophils. Blood 106: 3962-3969 [Abstract] [Full Text]  
  • Li, C., Beal, M. F. (2005). Leucine-rich repeat kinase 2: A new player with a familiar theme for Parkinson's disease pathogenesis. Proc. Natl. Acad. Sci. USA 102: 16535-16536 [Full Text]  
  • Beeser, A., Jaffer, Z. M., Hofmann, C., Chernoff, J. (2005). Role of Group A p21-activated Kinases in Activation of Extracellular-regulated Kinase by Growth Factors. J. Biol. Chem. 280: 36609-36615 [Abstract] [Full Text]  
  • Webb, B. A., Eves, R., Crawley, S. W., Zhou, S., Cote, G. P., Mak, A. S. (2005). PAK1 induces podosome formation in A7r5 vascular smooth muscle cells in a PAK-interacting exchange factor-dependent manner. Am. J. Physiol. Cell Physiol. 289: C898-C907 [Abstract] [Full Text]  
  • He, H., Pannequin, J., Tantiongco, J.-P., Shulkes, A., Baldwin, G. S. (2005). Glycine-extended gastrin stimulates cell proliferation and migration through a Rho- and ROCK-dependent pathway, not a Rac/Cdc42-dependent pathway. Am. J. Physiol. Gastrointest. Liver Physiol. 289: G478-G488 [Abstract] [Full Text]  
  • Cau, J., Hall, A. (2005). Cdc42 controls the polarity of the actin and microtubule cytoskeletons through two distinct signal transduction pathways. J. Cell Sci. 118: 2579-2587 [Abstract] [Full Text]  
  • Callow, M. G., Zozulya, S., Gishizky, M. L., Jallal, B., Smeal, T. (2005). PAK4 mediates morphological changes through the regulation of GEF-H1. J. Cell Sci. 118: 1861-1872 [Abstract] [Full Text]  
  • Yang, Z., Rayala, S., Nguyen, D., Vadlamudi, R. K., Chen, S., Kumar, R. (2005). Pak1 Phosphorylation of Snail, a Master Regulator of Epithelial-to-Mesenchyme Transition, Modulates Snail's Subcellular Localization and Functions. Cancer Res. 65: 3179-3184 [Abstract] [Full Text]  
  • Alberts, A. S., Qin, H., Carr, H. S., Frost, J. A. (2005). PAK1 Negatively Regulates the Activity of the Rho Exchange Factor NET1. J. Biol. Chem. 280: 12152-12161 [Abstract] [Full Text]  
  • de la Roche, M., Mahasneh, A., Lee, S.-F., Rivero, F., Cote, G. P. (2005). Cellular Distribution and Functions of Wild-Type and Constitutively Activated Dictyostelium PakB. Mol. Biol. Cell 16: 238-247 [Abstract] [Full Text]  
  • Koeppel, M. A., McCarthy, C. C., Moertl, E., Jakobi, R. (2004). Identification and Characterization of PS-GAP as a Novel Regulator of Caspase-activated PAK-2. J. Biol. Chem. 279: 53653-53664 [Abstract] [Full Text]  
  • Pulkkinen, K., Renkema, G. H., Kirchhoff, F., Saksela, K. (2004). Nef Associates with p21-Activated Kinase 2 in a p21-GTPase-Dependent Dynamic Activation Complex within Lipid Rafts. J. Virol. 78: 12773-12780 [Abstract] [Full Text]  
  • Lee, S., Rivero, F., Park, K. C., Huang, E., Funamoto, S., Firtel, R. A. (2004). Dictyostelium PAKc Is Required for Proper Chemotaxis. Mol. Biol. Cell 15: 5456-5469 [Abstract] [Full Text]  
  • Zhou, G., Boomer, J. S., Tan, T.-H. (2004). Protein Phosphatase 4 Is a Positive Regulator of Hematopoietic Progenitor Kinase 1. J. Biol. Chem. 279: 49551-49561 [Abstract] [Full Text]  
  • Turner, L. J., Nicholls, S., Hall, A. (2004). The Activity of the Plexin-A1 Receptor Is Regulated by Rac. J. Biol. Chem. 279: 33199-33205 [Abstract] [Full Text]  
  • Chu, P. C., Wu, J., Liao, X. C., Pardo, J., Zhao, H., Li, C., Mendenhall, M. K., Pali, E., Shen, M., Yu, S., Taylor, V. C., Aversa, G., Molineaux, S., Payan, D. G., Masuda, E. S. (2004). A Novel Role for p21-Activated Protein Kinase 2 in T Cell Activation. J. Immunol. 172: 7324-7334 [Abstract] [Full Text]  
  • Stofega, M. R., Sanders, L. C., Gardiner, E. M., Bokoch, G. M. (2004). Constitutive p21-activated Kinase (PAK) Activation in Breast Cancer Cells as a Result of Mislocalization of PAK to Focal Adhesions. Mol. Biol. Cell 15: 2965-2977 [Abstract] [Full Text]  
  • Loo, T.-H., Ng, Y.-W., Lim, L., Manser, E. (2004). GIT1 Activates p21-Activated Kinase through a Mechanism Independent of p21 Binding. Mol. Cell. Biol. 24: 3849-3859 [Abstract] [Full Text]  
  • Wild, A. C., Yu, J. W., Lemmon, M. A., Blumer, K. J. (2004). The p21-activated Protein Kinase-related Kinase Cla4 Is a Coincidence Detector of Signaling by Cdc42 and Phosphatidylinositol 4-Phosphate. J. Biol. Chem. 279: 17101-17110 [Abstract] [Full Text]  
  • Chen, W., Yazicioglu, M., Cobb, M. H. (2004). Characterization of OSR1, a Member of the Mammalian Ste20p/Germinal Center Kinase Subfamily. J. Biol. Chem. 279: 11129-11136 [Abstract] [Full Text]  
  • Ke, Y., Wang, L., Pyle, W. G., de Tombe, P. P., Solaro, R. J. (2004). Intracellular Localization and Functional Effects of P21-Activated Kinase-1 (Pak1) in Cardiac Myocytes. Circ. Res. 94: 194-200 [Abstract] [Full Text]  
  • Wu, R. F., Gu, Y., Xu, Y. C., Mitola, S., Bussolino, F., Terada, L. S. (2004). Human Immunodeficiency Virus Type 1 Tat Regulates Endothelial Cell Actin Cytoskeletal Dynamics through PAK1 Activation and Oxidant Production. J. Virol. 78: 779-789 [Abstract] [Full Text]  
  • Balasenthil, S., Sahin, A. A., Barnes, C. J., Wang, R.-A., Pestell, R. G., Vadlamudi, R. K., Kumar, R. (2004). p21-activated Kinase-1 Signaling Mediates Cyclin D1 Expression in Mammary Epithelial and Cancer Cells. J. Biol. Chem. 279: 1422-1428 [Abstract] [Full Text]  
  • Hoshino, M., Nakamura, S. (2003). Small GTPase Rin induces neurite outgrowth through Rac/Cdc42 and calmodulin in PC12 cells. JCB 163: 1067-1076 [Abstract] [Full Text]  
  • Zhou, G.-L., Zhuo, Y., King, C. C., Fryer, B. H., Bokoch, G. M., Field, J. (2003). Akt Phosphorylation of Serine 21 on Pak1 Modulates Nck Binding and Cell Migration. Mol. Cell. Biol. 23: 8058-8069 [Abstract] [Full Text]  
  • Wu, H., Wang, Z.-X. (2003). The Mechanism of p21-activated Kinase 2 Autoactivation. J. Biol. Chem. 278: 41768-41778 [Abstract] [Full Text]  
  • Fournes, B., Farrah, J., Olson, M., Lamarche-Vane, N., Beauchemin, N. (2003). Distinct Rho GTPase Activities Regulate Epithelial Cell Localization of the Adhesion Molecule CEACAM1: Involvement of the CEACAM1 Transmembrane Domain. Mol. Cell. Biol. 23: 7291-7304 [Abstract] [Full Text]  
  • Cai, D., Iyer, A., Felekkis, K. N., Near, R. I., Luo, Z., Chernoff, J., Albanese, C., Pestell, R. G., Lerner, A. (2003). AND-34/BCAR3, a GDP Exchange Factor Whose Overexpression Confers Antiestrogen Resistance, Activates Rac, PAK1, and the Cyclin D1 Promoter. Cancer Res. 63: 6802-6808 [Abstract] [Full Text]  
  • Zhan, Q., Ge, Q., Ohira, T., Van Dyke, T., Badwey, J. A. (2003). p21-Activated Kinase 2 in Neutrophils Can Be Regulated by Phosphorylation at Multiple Sites and by a Variety of Protein Phosphatases. J. Immunol. 171: 3785-3793 [Abstract] [Full Text]  
  • Carton, I., Hermans, D., Eggermont, J. (2003). Hypotonicity induces membrane protrusions and actin remodeling via activation of small GTPases Rac and Cdc42 in Rat-1 fibroblasts. Am. J. Physiol. Cell Physiol. 285: C935-C944 [Abstract] [Full Text]  
  • Hood, J. D., Frausto, R., Kiosses, W. B., Schwartz, M. A., Cheresh, D. A. (2003). Differential {alpha}v integrin-mediated Ras-ERK signaling during two pathways of angiogenesis. JCB 162: 933-943 [Abstract] [Full Text]  
  • McPhie, D. L., Coopersmith, R., Hines-Peralta, A., Chen, Y., Ivins, K. J., Manly, S. P., Kozlowski, M. R., Neve, K. A., Neve, R. L. (2003). DNA Synthesis and Neuronal Apoptosis Caused by Familial Alzheimer Disease Mutants of the Amyloid Precursor Protein Are Mediated by the p21 Activated Kinase PAK3. J. Neurosci. 23: 6914-6927 [Abstract] [Full Text]  
  • Alavi, A., Hood, J. D., Frausto, R., Stupack, D. G., Cheresh, D. A. (2003). Role of Raf in Vascular Protection from Distinct Apoptotic Stimuli. Science 301: 94-96 [Abstract] [Full Text]  
  • Wittmann, T., Bokoch, G. M., Waterman-Storer, C. M. (2003). Regulation of leading edge microtubule and actin dynamics downstream of Rac1. JCB 161: 845-851 [Abstract] [Full Text]  
  • Quadri, S. K., Bhattacharjee, M., Parthasarathi, K., Tanita, T., Bhattacharya, J. (2003). Endothelial Barrier Strengthening by Activation of Focal Adhesion Kinase. J. Biol. Chem. 278: 13342-13349 [Abstract] [Full Text]  
  • Tran, N. H., Frost, J. A. (2003). Phosphorylation of Raf-1 by p21-activated Kinase 1 and Src Regulates Raf-1 Autoinhibition. J. Biol. Chem. 278: 11221-11226 [Abstract] [Full Text]  
  • Rousseau, V., Goupille, O., Morin, N., Barnier, J.-V. (2003). A New Constitutively Active Brain PAK3 Isoform Displays Modified Specificities toward Rac and Cdc42 GTPases. J. Biol. Chem. 278: 3912-3920 [Abstract] [Full Text]  
  • Xu, B.-e, Min, X., Stippec, S., Lee, B.-H., Goldsmith, E. J., Cobb, M. H. (2002). Regulation of WNK1 by an Autoinhibitory Domain and Autophosphorylation. J. Biol. Chem. 277: 48456-48462 [Abstract] [Full Text]  
  • Gallagher, E. D., Xu, S., Moomaw, C., Slaughter, C. A., Cobb, M. H. (2002). Binding of JNK/SAPK to MEKK1 Is Regulated by Phosphorylation. J. Biol. Chem. 277: 45785-45792 [Abstract] [Full Text]  
  • Shin, E.-Y., Shin, K.-S., Lee, C.-S., Woo, K.-N., Quan, S.-H., Soung, N.-K., Kim, Y. G., Cha, C. I., Kim, S.-R., Park, D., Bokoch, G. M., Kim, E.-G. (2002). Phosphorylation of p85 beta PIX, a Rac/Cdc42-specific Guanine Nucleotide Exchange Factor, via the Ras/ERK/PAK2 Pathway Is Required for Basic Fibroblast Growth Factor-induced Neurite Outgrowth. J. Biol. Chem. 277: 44417-44430 [Abstract] [Full Text]  
  • Wells, C. M., Abo, A., Ridley, A. J. (2002). PAK4 is activated via PI3K in HGF-stimulated epithelial cells. J. Cell Sci. 115: 3947-3956 [Abstract] [Full Text]  
  • Rodriguez-Pachon, J. M., Martin, H., North, G., Rotger, R., Nombela, C., Molina, M. (2002). A Novel Connection between the Yeast Cdc42 GTPase and the Slt2-mediated Cell Integrity Pathway Identified through the Effect of Secreted Salmonella GTPase Modulators. J. Biol. Chem. 277: 27094-27102 [Abstract] [Full Text]  
  • Connolly, J. O., Simpson, N., Hewlett, L., Hall, A. (2002). Rac Regulates Endothelial Morphogenesis and Capillary Assembly. Mol. Biol. Cell 13: 2474-2485 [Abstract] [Full Text]  
  • Lamson, R. E., Winters, M. J., Pryciak, P. M. (2002). Cdc42 Regulation of Kinase Activity and Signaling by the Yeast p21-Activated Kinase Ste20. Mol. Cell. Biol. 22: 2939-2951 [Abstract] [Full Text]  
  • Brown, M. C., West, K. A., Turner, C. E. (2002). Paxillin-dependent Paxillin Kinase Linker and p21-Activated Kinase Localization to Focal Adhesions Involves a Multistep Activation Pathway. Mol. Biol. Cell 13: 1550-1565 [Abstract] [Full Text]  
  • Tian, D., Litvak, V., Toledo-Rodriguez, M., Carmon, S., Lev, S. (2002). Nir2, a Novel Regulator of Cell Morphogenesis. Mol. Cell. Biol. 22: 2650-2662 [Abstract] [Full Text]  
  • Kiosses, W. B., Hood, J., Yang, S., Gerritsen, M. E., Cheresh, D. A., Alderson, N., Schwartz, M. A. (2002). A Dominant-Negative p65 PAK Peptide Inhibits Angiogenesis. Circ. Res. 90: 697-702 [Abstract] [Full Text]  
  • Kissil, J. L., Johnson, K. C., Eckman, M. S., Jacks, T. (2002). Merlin Phosphorylation by p21-activated Kinase 2 and Effects of Phosphorylation on Merlin Localization. J. Biol. Chem. 277: 10394-10399 [Abstract] [Full Text]  
  • Callow, M. G., Clairvoyant, F., Zhu, S., Schryver, B., Whyte, D. B., Bischoff, J. R., Jallal, B., Smeal, T. (2002). Requirement for PAK4 in the Anchorage-independent Growth of Human Cancer Cell Lines. J. Biol. Chem. 277: 550-558 [Abstract] [Full Text]  
  • Lee, S. R., Ramos, S. M., Ko, A., Masiello, D., Swanson, K. D., Lu, M. L., Balk, S. P. (2002). AR and ER Interaction with a p21-Activated Kinase (PAK6). Mol. Endocrinol. 16: 85-99 [Abstract] [Full Text]  
  • KIM, D., KIM, S., KOH, H., YOON, S.-O., CHUNG, A.-S., CHO, K. S., CHUNG, J. (2001). Akt/PKB promotes cancer cell invasion via increased motility and metalloproteinase production. FASEB J. 15: 1953-1962 [Abstract] [Full Text]  
  • Buchwald, G., Hostinova, E., Rudolph, M. G., Kraemer, A., Sickmann, A., Meyer, H. E., Scheffzek, K., Wittinghofer, A. (2001). Conformational Switch and Role of Phosphorylation in PAK Activation. Mol. Cell. Biol. 21: 5179-5189 [Abstract] [Full Text]  
  • West, K. A., Zhang, H., Brown, M. C., Nikolopoulos, S. N., Riedy, M.C., Horwitz, A. F., Turner, C. E. (2001). The LD4 motif of paxillin regulates cell spreading and motility through an interaction with paxillin kinase linker (PKL). JCB 154: 161-176 [Abstract] [Full Text]  
  • Xia, C., Ma, W., Stafford, L. J., Marcus, S., Xiong, W.-C., Liu, M. (2001). Regulation of the p21-activated kinase (PAK) by a human Gbeta -like WD-repeat protein, hPIP1. Proc. Natl. Acad. Sci. USA 98: 6174-6179 [Abstract] [Full Text]  
  • Lian, J. P., Toker, A., Badwey, J. A. (2001). Phosphorylation of the Activation Loop of {{gamma}} p21-Activated Kinase ({{gamma}}-Pak) and Related Kinases (MSTs) in Normal and Stressed Neutrophils. J. Immunol. 166: 6349-6357 [Abstract] [Full Text]  
  • Tan, I., Seow, K. T., Lim, L., Leung, T. (2001). Intermolecular and Intramolecular Interactions Regulate Catalytic Activity of Myotonic Dystrophy Kinase-Related Cdc42-Binding Kinase {alpha}. Mol. Cell. Biol. 21: 2767-2778 [Abstract] [Full Text]  
  • Renkema, G. H., Manninen, A., Saksela, K. (2001). Human Immunodeficiency Virus Type 1 Nef Selectively Associates with a Catalytically Active Subpopulation of p21-Activated Kinase 2 (PAK2) Independently of PAK2 Binding to Nck or {beta}-PIX. J. Virol. 75: 2154-2160 [Abstract] [Full Text]  
  • Sells, M. A., Pfaff, A., Chernoff, J. (2000). Temporal and Spatial Distribution of Activated Pak1 in Fibroblasts. JCB 151: 1449-1458 [Abstract] [Full Text]  
  • Roig, J., Tuazon, P. T., Zipfel, P. A., Pendergast, A. M., Traugh, J. A. (2000). Functional interaction between c-Abl and the p21-activated protein kinase gamma -PAK. Proc. Natl. Acad. Sci. USA 97: 14346-14351 [Abstract] [Full Text]  
  • Jimenez, C., Portela, R. A., Mellado, M., Rodriguez-Frade, J. M., Collard, J., Serrano, A., Martinez-A, C., Avila, J., Carrera, A. C. (2000). Role of the Pi3k Regulatory Subunit in the Control of Actin Organization and Cell Migration. JCB 151: 249-262 [Abstract] [Full Text]  
  • Moskow, J. J., Gladfelter, A. S., Lamson, R. E., Pryciak, P. M., Lew, D. J. (2000). Role of Cdc42p in Pheromone-Stimulated Signal Transduction in Saccharomyces cerevisiae. Mol. Cell. Biol. 20: 7559-7571 [Abstract] [Full Text]  
  • Vikis, H. G., Li, W., He, Z., Guan, K.-L. (2000). The semaphorin receptor plexin-B1 specifically interacts with active Rac in a ligand-dependent manner. Proc. Natl. Acad. Sci. USA 10.1073/pnas.220421797v1 [Abstract] [Full Text]  
  • Dharmawardhane, S., Schürmann, A., Sells, M. A., Chernoff, J., Schmid, S. L., Bokoch, G. M. (2000). Regulation of Macropinocytosis by p21-activated Kinase-1. Mol. Biol. Cell 11: 3341-3352 [Abstract] [Full Text]  
  • Zhao, Z.-s., Manser, E., Loo, T.-H., Lim, L. (2000). Coupling of PAK-Interacting Exchange Factor PIX to GIT1 Promotes Focal Complex Disassembly. Mol. Cell. Biol. 20: 6354-6363 [Abstract] [Full Text]  
  • Adams, J. C., Schwartz, M. A. (2000). Stimulation of Fascin Spikes by Thrombospondin-1 Is Mediated by the Gtpases Rac and Cdc42. JCB 150: 807-822 [Abstract] [Full Text]  
  • Zhao, Z.-s., Manser, E., Lim, L. (2000). Interaction between PAK and Nck: a Template for Nck Targets and Role of PAK Autophosphorylation. Mol. Cell. Biol. 20: 3906-3917 [Abstract] [Full Text]  
  • Bock, B. C., Vacratsis, P. O., Qamirani, E., Gallo, K. A. (2000). Cdc42-induced Activation of the Mixed-Lineage Kinase SPRK in Vivo. REQUIREMENT OF THE Cdc42/Rac INTERACTIVE BINDING MOTIF AND CHANGES IN PHOSPHORYLATION. J. Biol. Chem. 275: 14231-14241 [Abstract] [Full Text]  
  • Royal, I., Lamarche-Vane, N., Lamorte, L., Kaibuchi, K., Park, M. (2000). Activation of Cdc42, Rac, PAK, and Rho-Kinase in Response to Hepatocyte Growth Factor Differentially Regulates Epithelial Cell Colony Spreading and Dissociation. Mol. Biol. Cell 11: 1709-1725 [Abstract] [Full Text]  
  • Coghlan, M. P., Chou, M. M., Carpenter, C. L. (2000). Atypical Protein Kinases Clambda and -zeta Associate with the GTP-Binding Protein Cdc42 and Mediate Stress Fiber Loss. Mol. Cell. Biol. 20: 2880-2889 [Abstract] [Full Text]  
  • Adam, L., Vadlamudi, R., Mandal, M., Chernoff, J., Kumar, R. (2000). Regulation of Microfilament Reorganization and Invasiveness of Breast Cancer Cells by Kinase Dead p21-activated Kinase-1. J. Biol. Chem. 275: 12041-12050 [Abstract] [Full Text]  
  • Fackler, O. T., Lu, X., Frost, J. A., Geyer, M., Jiang, B., Luo, W., Abo, A., Alberts, A. S., Peterlin, B. M. (2000). p21-Activated Kinase 1 Plays a Critical Role in Cellular Activation by Nef. Mol. Cell. Biol. 20: 2619-2627 [Abstract] [Full Text]  
  • Schürmann, A., Mooney, A. F., Sanders, L. C., Sells, M. A., Wang, H. G., Reed, J. C., Bokoch, G. M. (2000). p21-Activated Kinase 1 Phosphorylates the Death Agonist Bad and Protects Cells from Apoptosis. Mol. Cell. Biol. 20: 453-461 [Abstract] [Full Text]  
  • Mira, J.-P., Benard, V., Groffen, J., Sanders, L. C., Knaus, U. G. (2000). Endogenous, hyperactive Rac3 controls proliferation of breast cancer cells by a p21-activated kinase-dependent pathway. Proc. Natl. Acad. Sci. USA 97: 185-189 [Abstract] [Full Text]  
  • Kiosses, W. B., Daniels, R. H., Otey, C., Bokoch, G. M., Schwartz, M. A. (1999). A Role for P21-Activated Kinase in Endothelial Cell Migration. JCB 147: 831-844 [Abstract] [Full Text]  
  • Holly, S. P., Blumer, K. J. (1999). Pak-Family Kinases Regulate Cell and Actin Polarization Throughout the Cell Cycle of Saccharomyces cerevisiae. JCB 147: 845-856 [Abstract] [Full Text]  
  • Zenke, F. T., King, C. C., Bohl, B. P., Bokoch, G. M. (1999). Identification of a Central Phosphorylation Site in p21-activated Kinase Regulating Autoinhibition and Kinase Activity. J. Biol. Chem. 274: 32565-32573 [Abstract] [Full Text]  
  • Roig, J., Traugh, J. A. (1999). p21-activated Protein Kinase gamma -PAK Is Activated by Ionizing Radiation and Other DNA-damaging Agents. SIMILARITIES AND DIFFERENCES TO alpha -PAK. J. Biol. Chem. 274: 31119-31122 [Abstract] [Full Text]  
  • Burbelo, P. D., Snow, D. M., Bahou, W., Spiegel, S. (1999). MSE55, a Cdc42 effector protein, induces long cellular extensions in fibroblasts. Proc. Natl. Acad. Sci. USA 96: 9083-9088 [Abstract] [Full Text]  
  • Daniels, R. H., Zenke, F. T., Bokoch, G. M. (1999). alpha Pix Stimulates p21-activated Kinase Activity through Exchange Factor-dependent and -independent Mechanisms. J. Biol. Chem. 274: 6047-6050 [Abstract] [Full Text]  
  • Johnson, D. I. (1999). Cdc42: An Essential Rho-Type GTPase Controlling Eukaryotic Cell Polarity. Microbiol. Mol. Biol. Rev. 63: 54-105 [Abstract] [Full Text]  
  • Brzeska, H., Young, R., Knaus, U., Korn, E. D. (1999). Myosin I heavy chain kinase: Cloning of the full-length gene and acidic lipid-dependent activation by Rac and Cdc42. Proc. Natl. Acad. Sci. USA 96: 394-399 [Abstract] [Full Text]  
  • Fukata, M, Nakagawa, M, Kuroda, S, Kaibuchi, K (1999). Cell adhesion and Rho small GTPases. J. Cell Sci. 112: 4491-4500 [Abstract]  
  • Tu, H., Wigler, M. (1999). Genetic Evidence for Pak1 Autoinhibition and Its Release by Cdc42. Mol. Cell. Biol. 19: 602-611 [Abstract] [Full Text]  
  • Huang, R., Lian, J. P., Robinson, D., Badwey, J. A. (1998). Neutrophils Stimulated with a Variety of Chemoattractants Exhibit Rapid Activation of p21-Activated Kinases (Paks): Separate Signals Are Required for Activation and Inactivation of Paks. Mol. Cell. Biol. 18: 7130-7138 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, Z.-S.
Right arrow Articles by Lim, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, Z.-S.
Right arrow Articles by Lim, L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»