Previous Article | Next Article 
Mol Cell Biol, April 1998, p. 2153-2163, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Conserved Negative Regulatory Region in
PAK:
Inhibition of PAK Kinases Reveals Their Morphological Roles Downstream
of Cdc42 and Rac1
Zhou-Shen
Zhao,1
Edward
Manser,1
Xiang-Qun
Chen,1
Claire
Chong,1
Thomas
Leung,1 and
Louis
Lim1,2,*
Glaxo-IMCB Group, Institute of Molecular & Cell Biology, Singapore 117609, Singapore,1
and
Institute of Neurology, London WC1N 1PJ, United
Kingdom2
Received 17 September 1997/Returned for modification 24 November
1997/Accepted 22 December 1997
 |
ABSTRACT |
PAK in a constitutively active form can exert morphological
effects (E. Manser, H.-Y. Huang, T.-H. Loo, X.-Q. Chen, J.-M. Dong, T. Leung, and L. Lim, Mol. Cell. Biol. 17:1129-1143, 1997) resembling
those of Cdc42G12V. PAK family kinases, conserved from
yeasts to humans, are directly activated by Cdc42 or Rac1 through
interaction with a conserved N-terminal motif (corresponding to
residues 71 to 137 in
PAK).
PAK mutants with substitutions in
this motif that resulted in severely reduced Cdc42 binding can be
recruited normally to Cdc42G12V-driven focal complexes.
Mutation of residues in the C-terminal portion of the motif (residues
101 to 137), though not affecting Cdc42 binding, produced a
constitutively active kinase, suggesting this to be a negative
regulatory region. Indeed, a 67-residue polypeptide encoding
PAK83-149 potently inhibited GTP
S-bound
Cdc42-mediated kinase activation of both
PAK and
PAK.
Coexpression of this PAK inhibitor with Cdc42G12V prevented
the formation of peripheral actin microspikes and associated loss of
stress fibers normally induced by the p21. Coexpression of PAK
inhibitor with Rac1G12V also prevented loss of stress
fibers but not ruffling induced by the p21. Coexpression of
PAK83-149 completely blocked the phenotypic effects of
hyperactive
PAKL107F in promoting dissolution of focal
adhesions and actin stress fibers. These results, coupled with previous
observations with constitutively active PAK, demonstrate that these
kinases play an important role downstream of Cdc42 and Rac1 in
cytoskeletal reorganization.
 |
INTRODUCTION |
The small GTP-binding proteins of
the Rho subfamily, in particular the ubiquitous Rho, Rac, and Cdc42
proteins, act through a variety of downstream targets which bind to the
GTP forms of these p21s (reviewed in references 27
and 54). RhoA signalling is required for maintenance
of actin stress fibers and focal adhesions in cultured mammalian cells
(46), these activities being mediated by Rho-associated
kinases (ROKs) (13, 24, 25, 37). Rac activation produces
lamellipodia or membrane ruffles and associated peripheral focal
complexes (FCs) perhaps by binding POR1 (47, 56). Cdc42
promotes formation of peripheral actin microspikes, which are
structural components of filopodia and retraction fibers, followed by
its activation of Rac (19, 39). Cdc42 can antagonize Rho
(20, 34), while Rac can promote leukotriene-mediated
activation of Rho (43). In addition to their roles in cell
morphology, Cdc42, Rac, and Rho participate in regulating transcription
both through JNK/stress-activated protein kinase (SAPK)- and p38
mitogen-activated protein (MAP) kinase-regulated pathways (8,
38). Activated forms of these p21s can also stimulate cell cycle
progression to promote DNA synthesis in fibroblasts (41). In
the yeast Saccharomyces cerevisiae, Cdc42p is required for
the control of cell polarity during budding and pseudohyphal growth
(28, 62) but plays a role in transcriptional activation via
the mating-response MAP kinase pathway (51, 61). Both
budding and pheromone-induced signalling in yeast require participation
of the PAK-like kinases Cla4p and Ste20p (22, 23).
Mammalian targets of Cdc42 and Rac1 include a number of recently
identified proteins, of which the best characterized are PAK kinases
(27, 49). Upon binding to either GTP-bound Cdc42 (GTP-Cdc42)
or GTP-Rac, PAK undergoes autophosphorylation on multiple sites and is
activated (32, 34, 36). PAK function in vivo probably
includes activation of JNK/SAPK and p38 MAP kinase pathways (2,
45). Since Rho-p21s are closely linked to cytoskeletal reorganization, the ubiquitously expressed PAKs (32, 36)
have been candidate effectors in mediating certain aspects of
morphology regulated by Cdc42 and Rac. Expression of constitutively
active forms of
PAK causes drastic loss of actin stress fibers and
focal adhesions with retraction of the cell periphery, consistent with PAK acting downstream of Cdc42 and Rac (34). Microinjected
PAK1 protein has also been shown to promote FC formation and membrane ruffling through N-terminal (nonkinase) interactions (50).
The control of the cellular activities of PAK containing various
functional domains appears to be complex; p21 activation of PAK is not
the only mode of regulation, as capsase-mediated cleavage of PAK2 can
generate a catalytically active fragment which regulates morphological changes associated with apoptosis (48).
Comparison of the primary sequences of divergent PAKs revealed two
highly conserved functional domains: the serine/threonine kinase domain
at the C terminus and a region that includes the p21-binding domain
toward the N terminus of the kinase. In this study, we used
site-directed mutagenesis to determine that while the N-terminal half
of this region binds p21, the C-terminal half is involved in negatively
regulating kinase activity. A PAK inhibitor sequence was derived from
the conserved region by deletion analysis and then used to analyze the
morphological activities of endogenous PAK. Cytoskeletal reorganization
in cells expressing Cdc42G12V or RacG12V are
markedly affected when the PAK inhibitor is coexpressed, demonstrating
that endogenous PAKs can indeed play defined morphological roles
downstream of these p21s.
 |
MATERIALS AND METHODS |
PAK subcloning and site-directed mutagenesis.
Mutations to
the
PAK N-terminal region were constructed by a PCR-based
mutagenesis procedure. The 0.75-kb cDNA fragment encoding
PAK1-250 was amplified in two parts with desired
mutations introduced at the junction from one PCR primer. The two
primers at the central position (~300 bp from BamHI) were
phosphorylated prior to the PCRs to facilitate ligation. The two PCR
products were joined with T4 DNA ligase, and the complete mutant
0.75-kb cDNA fragment was reamplified by PCR using PAK complementary
primers at the 5' end
(ATGGATCCCGGGATCCATGTCAAATAACGGC;
BamHI site underlined) and at the 3' end,
corresponding to the position of an internal BglII site
(CCGCTCGAGCTAAGATCTCCTCATCAGACA;
XhoI and BglII sites underlined). PCR
products were subcloned into the BamHI and XhoI sites of the Bluescript SK(+) vector and sequenced.
The polypeptides encoding
PAK residues 83 to 131, 83 to 149, 89 to
131, and 89 to 149 were expressed from cDNAs amplified by PCR and
introduced into pGEX-4T-1 (BamHI and XhoI sites).
PAK83-149 was introduced into the BamHI and
XhoI sites in the mammalian pXJ hemagglutinin
(HA)-epitope-tagged vectors (34). The primers used to
generate PAK mutants and truncation constructs are listed in Table
1.
Bacterial expression and purification of recombinant PAK
proteins.
The plasmid expressing the glutathione
S-transferase (GST)/PAK1-250 fusion proteins of
each mutant as well as the wild type were constructed by cloning the
750-bp BamHI-XhoI fragments into pGEX-4T-1 (Pharmacia). The full-length PAK mutants were then constructed by
adding the BglII-XhoI cDNA fragment encoding
PAK251-544 into the GST/
PAK1-250 mutant
plasmids. pGEX plasmids were transformed into Escherichia coli BL21 for protein expression. Recombinant GST fusion proteins from 200-ml cultures were purified by glutathione-Sepharose affinity chromatography (Pharmacia) in a 300-µl column of
glutathione-Sepharose. Eluted proteins were stored with 5% glycerol at
70°C.
Expression and purification of GST/
PAK from COS-7 cells.
COS-7 cells were maintained in Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum. The pXJ-GST mammalian cell
expression vector was constructed by replacing the pXJ-HA epitope tag
(34) with the coding sequence of GST (amplified by PCR as an
EcoRI/BamHI fragment). The 1.6-kb
BamHI-XhoI fragment containing the coding region
of
PAK (33) was cloned into the BamHI/XhoI sites of pXJ-GST. COS-7 cells were
transfected with 5 µg of pXJ-GST vectors by the Lipofectamine
(Bethesda Research Laboratories) method. The cells were harvested after
18 h and lysed in buffer containing 40 mM HEPES (pH 7.5), 1%
Nonidet P-40, 100 mM NaCl, 1 mM EDTA, 25 mM NaF, 1 mM sodium
orthovanadate, and 10 µg each of leupeptin and aprotinin/ml. After
centrifugation (12,000 × g) for 10 min at 4°C,
supernatant fractions were passed through columns containing 50 µl of
glutathione-Sepharose beads. Columns were washed with
phosphate-buffered saline containing 50 mM Tris-HCl (pH 8.0) and 0.1%
Triton X-100, and GST/PAK fusion proteins were eluted in the same
buffer containing 10 mM glutathione and 5% glycerol.
Overlays with [
-32P]GTP-Cdc42.
Purified GST
fusion proteins (0.4 µg) were separated by sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis (PAGE) on 10% polyacrylamide
gels and transferred to nitrocellulose membranes. The filter was
blocked for 16 h (4°C) in phosphate-buffered saline containing
1% bovine serum albumin, 5 mM dithiothreitol, 0.5 mM MgCl2, and 0.1% Triton X-100 prior to p21 overlay
analysis. Cdc42 labeling with [
-32P]GTP and Western
overlays were carried out as described previously (30). The
[
-32P]GTP-Cdc42 signals on the filter were detected at
20°C and quantified by PhosphorImager (Molecular Dynamics)
analysis.
Protein kinase assays.
Each 50-µl reaction mix contained
0.5 µg of GST/
PAK, 10 µCi of [
-33P]ATP
(~6,000 mCi/mmol), and 10 µg of myelin basic protein (MBP) in
kinase assay buffer (50 mM HEPES [pH 7.3], 10 mM MgCl2, 2 mM MnCl2, 1 mM dithiothreitol, 0.05% Triton X-100). PAK
activation was carried out with 4 µg of GTP
S-Cdc42. The mixture
was incubated at 30°C for 30 min. Samples were resolved on 12%
polyacrylamide gels and processed for autoradiography.
Microinjection and cell staining.
HeLa cells were cultured
in minimal essential medium with 10% fetal bovine serum. Subconfluent
cells were microinjected into the nucleus with 50 ng of each expression
plasmid DNA/µl, using an Eppendorf microinjector. After 2 or 4 h, cells were fixed in 3% paraformaldehyde for 20 min and stained as
described previously (34).
 |
RESULTS |
Flanking sequences influence the p21-binding CRIB motif of
PAK.
PAK sequences contain two functional domains, the
C-terminal kinase domain and the p21-binding domain near the N terminus whose binding of Cdc42/Rac1 markedly stimulates autophosphorylation (32). In
PAK, a region encompassing residues 67 to 149 (the conserved PAK amino-terminal [PAN] motif) was first found to be functional as the Cdc42/Rac binding domain (32). Burbelo et al. (7) subsequently showed that among a larger family of
Cdc42 and Rac1 binders, only a region (the core Cdc42-Rac interaction and binding [CRIB] motif) corresponding to
PAK75-87
shows significant conservation of amino acid residues. In spite of
this, a
PAK29-90 construct containing all of these
conserved residues (equivalent to
PAK34-95) exhibited
extremely weak p21 binding (7).
In light of these observations, we investigated further the
requirement for efficient p21 binding by performing
[

-
32P]GTP-Cdc42 overlays on six deletion
constructs containing portions
of the N-terminal region of

PAK (Fig.
1A). For this purpose,
cDNA constructs
were bordered on the C-terminal sides by
BstXI
(position
101) and
PvuII (position 149) restriction sites present
in
the

PAK cDNA (
32). These
E. coli-expressed
polypeptides
were purified as GST fusion proteins (Fig.
1B, left) and
analyzed
by using 10 pmol of proteins (Fig.
1B, right), which is within
the range for a linear p21-binding response (
55). All of
these
deletion constructs (but not GST) bound Cdc42 with lower affinity
than full-length GST/

PAK (whose breakdown fragments also showed
robust binding activity [Fig.
1B]). Deletion construct 1 (

PAK
1-149) retained 70% of the Cdc42-binding activity
of full-length

PAK
(Fig.
1C, lane 2). Construct 2 (

PAK
1-101), extending the C-terminal limits of the
weakly binding construct
described by Burbelo et al. (
7),
still bound GTP-Cdc42 threefold
more weakly than

PAK
1-149 (lane 3), indicating that residues 102 to 149 enhance binding
affinity. Since levels of

PAK
61-149 and
PAK
1-149 binding were similar (Fig.
1C, lane 3), we
conclude that the
first 60 residues in

PAK do not contribute to p21
binding. Deletion
of a further 10 residues N terminal (71 to 149;
construct 5) slightly
decreased binding further. Surprisingly,

PAK
69-149(P73H) exhibited binding eightfold lower than
this (Fig.
1C, lanes
4 and 5) (the additional two residues in the
mutant construct
were added so as not to place the altered residue too
close to
the GST-PAK junction). Proline 73 is not present in yeast
PAK-like
kinases or in other CRIB motif-containing proteins
(
7). From
these results, it is apparent that residues 102 to
149, in the
region well beyond the CRIB motif (residues 75 to 87),
contribute
in some way to p21 binding. However, construct

PAK
83-149, lacking part of this core binding sequence,
is devoid of p21-binding
activity (Fig.
4E), indicating that these
flanking sequences have
no intrinsic binding activity. Comparison of
the N-terminal sequences
in PAK-like kinases from mammals,
invertebrates, and yeast showed
that in the region corresponding to

PAK
71-131, residues are uniformly conserved (Fig.
2A). This encompasses
the CRIB motif and
flanking C-terminal sequences; there is no
apparent bias of
conservation in the N-terminal CRIB motif. The
C-terminal sequences are
not found in other classes of Cdc42/Rac1
binding proteins, such as ACK,
WASP, and MLK3 (
1,
7,
31).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Sequences affecting efficiency of p21 binding to PAK.
(A) Schematic diagram representing regions of PAK expressed and
purified from E. coli. Amino acid numbers at the beginning
and the end of each fragment are indicated on the right. The point
mutation present in construct 4 is marked by "x." FL, full length.
(B) GST/ PAK constructs were expressed and purified as GST fusion
proteins, and 1 µg of each protein was resolved by SDS-PAGE (12%
gel) and stained with Coomassie brilliant blue (left); 10 pmol of each
of these proteins was analyzed by an overlay binding assay using
[ -32P]GTP-Cdc42 (right). (C) The Cdc42-binding signals
shown in panel B (right) were quantified on a PhosphorImager
(Molecular Dynamics). The means of data from two independent
experiments are shown.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Mutations in the N terminus of the PAN motif abolish p21
binding. (A) Sequence alignment of PAN motifs of PAK-related proteins
from rat ( -, -, and -PAK), Drosophila (DPAK),
Caenorhabditis elegans (Ce-PAK), S. cerevisiae
(Ste20p, Cla4p, and Sc-PAK), and Schizosaccharomyces pombe
(Shk1p). Accession numbers are given elsewhere (27). The
conserved residues are boxed in black, and a consensus of these is
shown below. Amino acid substitutions corresponding to each of the
mutant constructs are shown. (B) The first 250 amino acids of each
PAK mutant and wild-type (Wt) construct were purified as GST fusion
proteins, and 1 µg of each protein was resolved by SDS-PAGE (11%
gel) and stained with Coomassie brilliant blue (top); p21 binding to
bands containing 0.4 µg of each protein was determined by overlays
with [ -32P]GTP-Cdc42 (bottom). (C) The Cdc42 binding
signals in panel B (bottom) were quantified on a PhosphorImager; the
means of two independent experiments are shown. (D) Expression
constructs encoding HA- PAK mutants as indicated were transfected
into HeLa cells alone or with FLAG-Cdc42G12V. Typical cells
stained for PAK are shown; in all cases, the cells were also stained
with antipaxillin to confirm that peripherally located PAK was in FCs.
Bar, 10 µm.
|
|
Amino acid substitutions that affect p21 binding do not prevent PAK
recruitment to Cdc42-driven FCs.
To investigate the function of
the conserved residues in the PAN motif, we introduced amino acid
substitutions at beginning, middle, and end positions indicated in Fig.
2A. To analyze their p21-binding activities, residues 1 to 250 of each
mutant were purified and subjected to Western overlay with
[
-32P]GTP-labeled Cdc42 (Fig. 2B); mutants M10 and M11
could not be recovered as stable GST fusion proteins. As shown in Fig.
2C, substitutions of conserved residues in the N-terminal portion of
the PAN motif, M1 (I75N), M2 (S76P), M3 (P78A), and M4 (H83/86L), caused drastic loss of p21 binding; M6 (M100K) also showed reduced binding, but the C-terminal mutants had normal p21 binding. These amino
acid substitution results concur with previously published data
(7) showing that the N-terminal portion of the PAN motif functions as the core p21-binding region.
Recent reports that Cdc42-binding-deficient Ste20p mutants are
functionally competent (
23,
44) led us to consider whether
the cellular activities of PAK could occur without its directly
binding
Cdc42. The normally cytoplasmic wild-type kinase is translocated
to FCs
by activated Cdc42 or Rac1 (
34). We therefore tested
whether
Cdc42
G12V could relocalize the p21-binding-deficient PAK
mutants described
above.

PAK mutant M4 was not investigated due to
its partially
activated state (see Fig.
4 and references
48 and
50). As
shown in Fig.
2D,
wild-type

PAK and the

PAK mutants M2 (S76P)
and M3 (P78A), which
were distributed throughout the cytoplasm
and nucleus, became
associated with peripheral FCs in a manner
indistinguishable from that
of wild-type

PAK when coexpressed
with Cdc42
G12V. These
kinases were not activated by Cdc42
G12V when coexpressed in
COS-7 cells (data not shown) or by GTP

S-Cdc42
when tested in vitro
(Fig.
3). Thus, PAK recruitment to FCs
can
be independent of direct association with Cdc42.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Mutations in the C-terminal portion of the PAN motif
activate PAK. (A) Activity of bacterially expressed GST/ PAK and
GST/ PAKL404S in the presence or absence of GTP-Cdc42.
Purified GST/ PAK or GST/ PAKL404S was assayed for
kinase activity with MBP at 20 µM [ -33P]ATP in the
presence or absence of GTP-Cdc42. The kinase reaction was carried out
at 30°C for 30 min. WT, wild type. (B) The
GST/ PAKL404S mutants containing additional mutations in
the PAN motif were expressed and purified from E. coli. The
GST/PAK bands (arrows) correspond to 1 µg of the purified proteins
stained with Coomassie brilliant blue. (C) Proteins shown in panel B
were assayed for kinase activity to MBP in the presence or absence of
GTP-Cdc42. Arrows indicate positions of autophosphorylated PAK and
phosphorylated MBP bands. (D) Quantification of the MBP phosphorylation
shown in panel C.
|
|
The C-terminal portion of the PAN motif may negatively regulate the
kinase.
The wild-type
PAK is toxic in E. coli,
probably due to its constitutive kinase activity in this bacterium
(34). We were able to obtain, by serendipitous in vivo
selection, an attenuated form of
PAK where leucine 404 is replaced
by serine; this mutant exhibited low intrinsic kinase activity when
purified as a GST fusion protein and was activated in vitro by
GTP-bound Cdc42 or Rac1, albeit with slower than wild-type activation
kinetics (33). A comparison of purified recombinant
wild-type
PAK with
PAKL404S is shown in Fig. 3A. This
PAKL404S enabled us to assess the effects of additional
mutations on kinase activation.
Those mutants that could be expressed as full-length
GST/

PAK
L404S fusion proteins were purified and analyzed
on SDS-8% polyacrylamide
gels (Fig.
3B). Mutants M1, M2, M3, and M5
showed the same electrophoretic
migration as the inactive

PAK
L404S (lane 1); part of the M4 protein appeared as a
higher band (lane
5). By contrast, M6, M7, and M9, with mutations in
the C-terminal
portion of the PAN motif, exhibited a retarded
electrophoretic
mobility indistinguishable from that of constitutively
active
wild-type (autophosphorylated)

PAK protein (lane 10). Since
equivalent
mutations in PAK
1-250 did not affect its
electrophoretic mobility (Fig.
2B), the retarded
mobility of these
mutant full-length kinases probably reflects
kinase
autophosphorylation. Indeed, all of the shifted mutants
had elevated
activity toward MBP in the absence of p21 (Fig.
3C
and D). Mutants M1,
M2, and M3, with amino acid substitutions
which abolished p21-binding
activity, showed only a basal level
of kinase activity, which was not
stimulated by GTP

S-Cdc42 (Fig.
3C and D). PAK mutants M4, M7, and
M9, which were apparently constitutively
phosphorylated, showed robust
kinase activity toward MBP even
without GTP-Cdc42 (Fig.
3C and D).
Mutant M6 was an exception;
despite being fully shifted, it exhibited a
rather low constitutive
activity which was increased by GTP

S-Cdc42.
Taken together, these
results indicated an autoinhibitory role for the
residues in the
C-terminal portion of the PAN motif.
Constructing a minimal PAK-inhibitory polypeptide.
We then
determined whether the N-terminal half of the kinase harbored
inhibitory sequences by testing GST/
PAK1-250 (S76P),
deficient in Cdc42 binding (Fig. 2C), for its ability to inhibit PAK
activation in vitro. Increasing amounts of
GST/
PAK1-250(S76P) were added into the kinase assay
reactions in the presence of excess GTP-Cdc42 (Fig.
4A, lanes 2 to 5). Both
autophosphorylation and kinase activities were inhibited (Fig. 4A and
B). Additional GTP-Cdc42 did not overcome this inhibition (Fig. 4B,
lanes 6 to 8). Thus,
PAK activation can be directly inhibited by an
excess of N-terminal regulatory sequences. To localize the
autoinhibitory region, four smaller fusion proteins covering different
lengths of the C-terminal region of the PAN motif were similarly tested (Fig. 4C and D).
PAKL404S activation by
GTP
S-Cdc42 was clearly prevented by GST/
PAK83-149 and
GST/
PAK83-131 but not by the smaller
GST/
PAK99-149 and GST/
PAK99-131.
GST/
PAK83-149 did not bind p21 (Fig. 4E) since it lacks
critical residues 71 to 82.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
The C terminus of the PAN motif inhibits PAK activation
by GTP-Cdc42. (A) The PAK N-terminal fusion protein
GST/ PAK1-250(S76P) inhibits PAK activation by GTP-Cdc42.
The kinase activity of bacterially expressed
GST/ PAKL404S was assayed in the absence (lane 1) or
presence (lane 2 to 8) of the indicated amounts of GTP-Cdc42. The
autoradiograph shows inhibition due to the indicated amounts of
GST/ PAK1-250(S76P) added during the kinase reactions.
Signals of PAK autophosphorylation and MBP phosphorylation are
indicated by arrows. (B) Quantification of the MBP phosphorylation
shown in panel A. (C) Schematic diagram of four peptides in the PAN
motif region. The corresponding amino acid sequence is shown at the
top. These peptides were expressed as GST fusion proteins. SDS-PAGE
analysis of 1 µg of each purified protein showed single appropriately
sized bands (not shown). (D) One microgram of bacterially expressed
GST/ PAKL404S was assayed for kinase activity to MBP in
the presence of excess GTP-Cdc42 (4 µg) and 4 µg of each inhibitory
peptide. The MBP phosphorylation signals were quantified on a
PhosphorImager. (E) One microgram each of GST/ PAK and GST proteins
was resolved by SDS-PAGE (11% gel) and blotted onto a polyvinylidene
difluoride membrane. The proteins were stained with Coomassie blue
(left), and their p21 binding was analyzed by overlay with
[ -32P]GTP-Cdc42 (right). Asterisks indicate positions
of protein bands.
|
|
To test whether this inhibitory domain could suppress wild-type

PAK
activation, we used purified wild-type

PAK and

PAK
expressed in
COS-7 cells, which are recovered in forms exhibiting
basal kinase
activity (
34). Excess GST/

PAK
83-149 was
highly effective in inhibiting

PAK and

PAK activation in
vitro by
GTP-Cdc42, whereas GST/

PAK
83-131 was not (Fig.
5A). However,
GST/

PAK
83-149 did not inhibit kinase activity of
E. coli-expressed active wild-type
(autophosphorylated)
GST/

PAK or GST/

PAK (Fig.
5B). This finding
suggests that the
inhibitory domain functions primarily by preventing
autophosphorylation
(Fig.
4A) and consequential activation of
the kinase. Replacing D126
with R resulted in substantial loss
of the inhibitory function of

PAK
83-148 (Fig.
5C; compare lanes 4 and 5). The
inhibitor was highly potent
in vitro, with an apparent
Ki of 90 nM (Fig.
5D). When a cDNA
encoding
GST/

PAK
83-149 was cotransfected with

PAK and
Cdc42
G12V into COS-7 cells, it completely blocked PAK
activation (Fig.
5E; compare lanes 3 and 4), while the equivalent D126R
mutant
was ineffective (lane 5). This was evident in terms of both

PAK
mobility and its activity toward MBP (as quantified at the
bottom
of Fig.
5E). The GST/inhibitor construct was detected as a
single
35-kDa band, indicating its stability under in vivo expression
conditions.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
Specific inhibition of PAK and PAK activation by
the GST/ PAK83-149 polypeptide. (A) In each assay, 0.2 µg of PAK or PAK purified from COS-7 cells was assayed for
kinase activity toward MBP in the absence (lane 1) or presence of 2 µg of GTP S-Cdc42 (lanes 2 to 6) and 2 µg of indicated
PAK-derived polypeptides (lanes 4 to 6). GST was used as a control
(lane 3). Kinase reactions were carried out with 10 µM
[ -33P]ATP and 10 µg of MBP in a final volume of 30 µl; half of the reaction was analyzed on 12% polyacrylamide gels.
The MBP region of the autoradiograph is shown. (B) Bacterially
expressed (active) GST/ PAK (1 µg) and GST/ PAK (1 µg) were
assayed for MBP kinase activity (as described above) in the absence
(lanes 1 and 3) or presence (lanes 2 and 4) of 5 µg of
GST/ PAK83-149. (C) A mutation (D126R) in
GST/ PAK83-148 interferes with its inhibitory activity.
Top, Coomassie blue-stained gel (12%); bottom, corresponding
autoradiograph of the MBP region. Each reaction was carried out with
0.2 µg of PAK which was activated in the presence of 2 µg of
Cdc42-GTP S. Lanes 4 and 5 contained 1.5 µg of
GST/ PAK83-148 or GST/ PAK83-148(D126R), a
level ~15-fold higher than the calculated Ki
of the wild-type inhibitor (D). GST alone has no effect on activation
(the larger GST form contains attached polylinker-derived sequence).
Kinase reactions were as for panel A. (D) Concentration dependence of
PAK inhibition was determined by using 50 ng of kinase (=18 nM)
under activation conditions as for panel A while varying the
GST/ PAK83-148 concentration. MBP phosphorylation was
quantified on a PhosphorImager. For reference, the data of MBP
phosphorylation is shown in the inset. (E) Inhibition of PAK
activation by coexpression of GST/ PAK83-149 in COS-7
cells. Cells (in 100-mm-diameter dishes) were transfected with 3 µg
of FLAG- PAK (lanes 2 to 5) with or without 3 µg of
HA-Cdc42G12V expression plasmid as indicated. Expression of
GST, GST/ PAK83-149, or the mutant (D126R) version (6 µg of plasmid per dish) was detected in the total extract by using
anti-GST antibodies. The activity of the anti-FLAG immunoprecipitates,
recovering equivalent amounts of the kinase (top), was determined by
phosphorylation of MBP (counts quantified at the bottom).
|
|
PAK inhibitor prevents certain cytoskeletal rearrangements induced
by Cdc42 and Rac1.
In HeLa cells, expression of
Cdc42G12V induces formation of filopodia and cell
retraction (34); stress fibers and Rho-dependent focal
adhesions disappear with production of new peripheral FCs. Rac1G12V-expressing cells, which are characterized by cell
flattening, membrane ruffling, and formation of bead-like FCs at the
cell periphery, also lose stress fibers (39). In (human)
HeLa cells,
PAK represents the predominant form corresponding to
hPAK65 (36). Injection of a plasmid expressing the
PAK83-149 inhibitor sequence had no effect on the
morphology of HeLa cells; the inhibitor was cytosolic, and its
disposition was apparently unaffected by Cdc42 or Rac (data not shown).
However, its expression dramatically affects cytoskeletal
reorganization elicited by Cdc42 and Rac1 (Fig.
6). In each field, we show a typical
p21-injected cell, a cell doubly injected with p21 plus PAK inhibitor,
and uninjected control cells. Compared with HA-Cdc42G12V
injection alone (Fig. 6a and b), cells coinjected with plasmid encoding
PAK83-149 did not exhibit a clear reorganization of
actin to the periphery 2 h after injection. Peripheral actin
microspikes were always absent in the doubly injected cells. Typically
both Cdc42G12V- and Rac1G12V-injected cells
coexpressing
PAK83-149 (Fig. 6c and d) retained internal
Rho-type FCs while forming peripherally located FCs. With
Cdc42G12V plus
PAK83-149, these peripheral
complexes were clearly larger than with Cdc42G12V alone
(Fig. 6c). The formation of these new FCs indicates that the p21s are
functional in the presence of the kinase inhibitor and that PAK kinase
activity is not required for FC formation. We monitored the behavior of
cells to 4 h postinjection (Fig. 6e to h); over this time period,
coexpression of
PAK83-149 still prevented the production
of peripheral actin microspikes in Cdc42G12V-expressing
cells (Fig. 6e and f) but did not block membrane ruffles due to
RacG12V (Fig. 6g and h). This lack of effect on ruffles,
seen here as a stained and wavy outline, was also observed on
phase-contrast microscopy (data not shown). PAK inhibition also
prevented the loss of actin stress fibers in both
Cdc42G12V- and Rac1G12V-expressing cells (Fig.
6f and h).

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 6.
Morphological effects of Cdc42 and Rac are blocked by
inhibitory PAK83-149. HeLa cells were examined 2 h (a
to d) or 4 h (e to h) after plasmid microinjection. In each case,
a constitutively active mutant (G12V) form of Cdc42 or Rac1 was used.
The top panels show that coinjection of the PAK inhibitor (arrowheads)
blocks the reorganization of actin stress fibers normally seen with
Cdc42 (arrows). Analysis of FCs by paxillin staining (c and d) shows
production of peripherally located FCs to occur in the presence of the
PAK inhibitor (arrowheads), but the resultant structures are thicker
and there is no apparent loss of the existing internal focal adhesions.
Even after 4 h, Cdc42G12V-expressing cells (e) do not
form filopodia or retraction fibers when injected with the PAK
inhibitor: with both Cdc42G12V and RacG12V, PAK
inhibition leads to an overall increase in the intensity of stress
fiber staining (f and h).
|
|
Expression of
PAK83-149 blocks PAK function in
vivo.
We then tested whether
PAK83-149 could block
the morphological effects of
PAK itself. Certain mutant forms of
PAK require no binding of Cdc42 to be fully activated in cultured
cells, and their expression results in loss of actin stress fibers and
focal adhesions and in the concomitant retraction of peripheral
membranes (34). We found that
PAKL107F
(6) has greater activity when recovered from COS-7
cells than HA
PAKEQ116/117KK (M7) and
HA-
PAKD126R (M9) proteins (data not shown) or the
chimeric PAK-CC that we reported previously (34). Injection
of a plasmid encoding
PAKL107F elicited rapid changes in
cell morphology, in line with our previous observations. HeLa cells
injected with plasmid encoding
PAKL107F (Fig.
7) behaved very differently from those
coinjected with an
PAKL107F plasmid and with a plasmid
encoding the inhibitory
PAK83-149. Notably, the
coinjected cells did not undergo the characteristic retraction (Fig.
7a), nor was there any evident loss of stress fibers or focal adhesions
(Fig. 7b and c), although both cells clearly expressed
PAKL107F (Fig. 7a). Injection with plasmid encoding
HA-
PAK83-149 showed that expression of the inhibitor by
itself led to no distinct changes in actin or vinculin staining (data
not shown). These results show that inhibitory
PAK83-149
is able to block PAK activity in vivo. The inhibitor presumably interferes with intracellular activation of kinase, since
PAKL107F recovered from COS-7 cells displayed the
retardation in mobility characteristic of hyperphosphorylated and
activated PAK only when the inhibitor was not coexpressed (data not
shown).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 7.
The PAK inhibitor can block effects of constitutively
active PAK in vivo. The effects of microinjected
PAKL107F on HeLa cells (arrows) include cell retraction
(a) seen in cells stained for expressed PAK, loss of actin stress
fibers (b), and dissolution of paxillin-stained focal adhesions (c).
All three effects could be blocked by coinjection of an expression
construct encoding PAK83-149 (arrowheads).
|
|
 |
DISCUSSION |
Activation of PAK.
PAK kinases can be directly and potently
activated by the GTP-bound forms of Cdc42 and Rac1, unlike Rho-binding
kinases such as ROK or PKN, which are activated only weakly on binding
to Rho-GTP (13, 25, 37, 59). Our results indicate that the
PAK N-terminal PAN motif integrates two functions, p21 binding and
kinase inhibition. Binding of Cdc42/Rac initiates release of a negative
constraint embodied in sequences immediately C terminal of the binding
site to allow autophosphorylation and kinase activation. The
autoinhibitory sequence, like the kinase domain, is highly conserved
among PAKs from yeasts to humans but is absent from other Cdc42
effectors, including ACK (31) and WASP (1, 18,
53). Native purified PAKs are regulatable kinases with low
intrinsic activity (4, 32); however, for reasons that are
not apparent, wild-type PAKs are constitutively active when expressed
in E. coli (34). This precludes use of
recombinant protein for regulatory studies unless a suitable derivative
such as
PAKL404S is employed. Use of this attenuated
kinase, which undergoes autophosphorylation identical to that of the
wild type upon Cdc42 activation in vitro (34), revealed that
amino acid substitutions in the autoinhibitory sequence produce
activated kinases (Fig. 3). PAK1L107F (6) and
mPAK3, containing mutations equivalent to positions F96, G98, and P100
in
PAK (2), are similarly active. The effects of
mutations dispersed throughout
PAK83-131 suggest that
they act by altering the conformation of the inhibitory region. The
behavior of the H83/86L mutant may reflect overlapping of p21-binding
and inhibitory domains. The data suggest a model in which the
inhibitory region forms a complex with the kinase domain, rendering it
inactive, but does not do so when the domain is already activated (with
phosphorylated T422).
Other studies have pointed to a role for N-terminal regions of
PAK-related proteins in negatively regulating kinase activity.
Expression of PAK1 (

PAK) lacking the first 231 amino acids, but
not
of full-length PAK1, yielded active kinase (
45). S6/H4
(

PAK-like)
kinase can be proteolytically cleaved in vitro to yield
an activated
catalytic fragment (~40 kDa) (
4).
Caspase-mediated cleavage
of PAK2 (

PAK) at position 212 during
apoptosis activates the
kinase (
49) and may play an
important part in the morphological
changes seen during cell death. By
specifically inhibiting PAK,
it should be possible to dissect the role
of PAK in apoptosis.
Many protein kinases are regulated by autoinhibition in which
substrate-like sequences complex with the catalytic site to
block
substrate binding and in some cases autophosphorylation.
Binding of an
allosteric activator can disrupt conformation in
the autoinhibitory
domain (
16,
52). Residues 580 to 595 in
myosin light-chain
kinase resemble a consensus substrate site
and constitute an
autoinhibitory domain (
10,
14); a corresponding
synthetic
peptide inactivates the proteolytically activated kinase
(
17). The N-terminally located autoinhibitory domain of
protein
kinase C (PKC) is well documented (
9,
12,
42). In
these
cases, the pseudosubstrate inhibitory domain primarily blocks
phosphorylation of exogenous substrates. In contrast, the

PAK
inhibitor sequence (83 to 149) cannot inhibit active
(autophosphorylated)
forms of

PAK and

PAK (Fig.
5C). Its
mechanism of action therefore
probably involves blocking
autophosphorylation events. If a pseudosubstrate-like
peptide exists
within PAK
83-149, its conformation must be stabilized by
flanking sequences since
we cannot derive a smaller inhibitory peptide
(Fig.
3). The PAK
autoinhibitory domain may partially overlap and be
stabilized
by the p21-binding domain (Fig.
4), resembling yeast PKC1,
where
the Rho1-binding domain lies within a pseudosubstrate sequence
(
40).
Morphological roles for PAK downstream of Cdc42 and Rac.
The
finding that PAK83-149 can potently inhibit PAK kinase
activity has allowed us to assess PAK function without overexpressing the kinase itself or mutant forms. Larger N-terminal regions of PAK or
kinase-dead full-length PAK have been used as dominant negatives in
cotransfection experiments (2, 60). Use of these larger
constructs is compromised by their potential to sequester Cdc42/Rac and
by the PAK N-terminal protein itself acting as an adapter potentially
recruiting proteins such as Nck (3, 5, 11, 29). Expression
of the PAK inhibitor in Cdc42G12V-expressing HeLa cells
blocked both cell retraction and rounding and the induction of
peripheral actin microspikes (Fig. 6) normally seen in epithelial,
fibroblastic, and neuroblastoma cells (20, 34, 39). Similar
effects of the PAK inhibitor were observed with Swiss 3T3 cells (data
not shown) in terms of both reorganization of FCs and production
of peripheral actin microspikes. Since coexpression of
PAK83-149 completely blocks Cdc42-mediated
activation of cotransfected PAK (Fig. 5), endogenous PAK must be
similarly affected. The ability of the inhibitor to block the
phenotypic effects of
PAKL107F further confirms this
conclusion.
Although PAK is clearly involved in Cdc42- and Rac-type morphological
changes (
34,
50), studies using effector mutants
of Rac1 and
Cdc42 that fail to interact with PAK (primarily substitutions
at Y40)
have been interpreted as showing that PAK is not necessary
for
Rac-driven membrane ruffling (
15,
57) or for Cdc42 to
form
filopodia (
21). From our results, we suggest the PAK
activity
is required to generate filopodia. One can reconcile these
apparently
contradictory observations because under some circumstances
(Fig.
2), direct binding to Cdc42 is not essential for PAK recruitment
to membrane-apposed Cdc42-driven focal complexes. This process
does
require its interaction with the focal complex protein PIX
(
35). Upon translocation to the plasma membrane, there is
consequential
activation of PAK (
29). This model is
supported by our data
showing that PIX, the ubiquitous Rac guanine
nucleotide exchange
factor tightly associated with PAK, can mediate
kinase activation
by Cdc42(Y40C), which does not directly bind the
kinase (
35).
The identification of this PAK-associated
guanine nucleotide exchange
factor might also explain the Rac-like
phenotypes seen with microinjected
PAK (
50).
We previously showed that expression of constitutionally active PAK can
antagonize Rho function. In this study, we demonstrate
that PAK does
indeed play such a role downstream of Cdc42 (Fig.
8). The recent identification of a
ROK-like kinase lying downstream
of Cdc42 termed MRCK (
26)
provides a Cdc42 target that promotes
focal complex formation. MRCK and
PAK apparently play synergistic
roles in promoting filopodia and
dynamic FC structures. Cdc42
G12V-expressing HeLa cells form
peripheral actin microspikes and become
devoid of intracellular stress
fibers (Fig.
6b and f), but cells
coexpressing the PAK inhibitor show
no such formation of microspikes
and display an increased stress fiber
content. In the case of
Rac1
G12V expression, it is clear
that blocking PAK prevents the loss of
stress fibers, but otherwise we
do not observe any perturbation
to the Rac-induced phenotype (cell
spreading and ruffling). Thus,
we conclude that the primary
morphological role of PAK is to facilitate
turnover of actin stress
fibers and dissolve focal adhesions and
that Cdc42 requires PAK kinase
activity for production of filopodia
and for cell rounding and
retraction (Fig.
8).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
A model of PAK function in relation to known effectors
of Rho-p21s. The targets of Cdc42, Rac, and Rho which have known
morphological roles are shown. MRCK is the myotonin kinase-related
Cdc42-binding kinase (26); p140mDia is the mammalian homolog
of Drosophila diaphanous (58); the other
Rho-binding kinase, PKN (59), has no known morphological
function. PAK acts downstream of both Cdc42 and Rac to break down actin
cytoskeletal structures and focal adhesions (FAs). This function could
be particularly important in remodeling the cytoskeleton to allow
dynamic events such as filopodial extension and subsequent formation of
lamellipodia, ultimately leading to cell migration or growth cone
extension (20). MLC, myosin light chain; MLCK, myosin
light-chain kinase.
|
|
 |
ACKNOWLEDGMENT |
This work was supported by the Glaxo Singapore Research Fund.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Glaxo-IMCB
Group, Institute of Molecular & Cell Biology, 30 Medical Dr., Singapore 117609, Singapore. Phone: (65) 874-6167. Fax: (65) 774-0742. E-mail: L.Lim{at}ion.ucl.ac.uk.
 |
REFERENCES |
| 1.
|
Aspenstrom, P.,
U. Lindberg, and A. Hall.
1995.
Two GTPases, Cdc42 and Rac, bind directly to a protein implicated in the immunodeficiency disorder Wiskott-Aldrich syndrome.
Curr. Biol.
6:70-75.
|
| 2.
|
Bagrodia, S.,
B. Derijard,
R. J. Davis, and R. A. Cerione.
1995.
Cdc42 and PAK-mediated signalling leads to JNK and p38 mitogen-activated protein kinase activation.
J. Biol. Chem.
270:27995-27998[Abstract/Free Full Text].
|
| 3.
|
Bagrodia, S.,
S. J. Taylor,
C. L. Creasy,
J. Chernoff, and R. A. Cerione.
1995.
Identification of a mouse p21cdc42/rac activated kinase.
J. Biol. Chem.
270:22731-22737[Abstract/Free Full Text].
|
| 4.
|
Benner, G. E.,
P. B. Dennis, and R. A. Masaracchia.
1995.
Activation of an S6/H4 kinase (PAK 65) from human placenta by intramolecular and intermolecular autophosphorylation.
J. Biol. Chem.
270:21121-21128[Abstract/Free Full Text].
|
| 5.
|
Bokoch, G. M.,
Y. Wang,
B. P. Bohl,
M. A. Sells,
L. A. Quilliam, and U. G. Knaus.
1996.
Interaction of the Nck adapter protein with p21-activated kinase (PAK1).
J. Biol. Chem.
271:25746-25749[Abstract/Free Full Text].
|
| 6.
|
Brown, J. L.,
L. Stowers,
M. Baer,
J. A. Trejo,
S. Coughlin, and J. Chant.
1996.
Human Ste20 homologue hPAK1 links GTPases to the JNK MAP kinase pathway.
Curr. Biol.
6:598-605[Medline].
|
| 7.
|
Burbelo, P. D.,
D. Drechsel, and A. Hall.
1995.
A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rac GTPases.
J. Biol. Chem.
270:29071-29074[Abstract/Free Full Text].
|
| 8.
|
Coso, O. A.,
M. Chiariello,
J. C. Yu,
H. Teramoto,
P. Crespo,
N. Xu,
T. Miki, and J. S. Gutkind.
1995.
The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signalling pathway.
Cell
81:1137-1146[Medline].
|
| 9.
|
Coussens, L.,
P. J. Parker,
L. Rhee,
T. L. Yang-Feng,
E. Chen,
M. D. Waterfield,
U. Francke, and A. Ullrich.
1986.
Multiple, distinct forms of bovine and human protein kinase C suggest diversity in cellular signalling pathways.
Science
233:859-866[Abstract/Free Full Text].
|
| 10.
|
Edelman, A. M.,
K. Takio,
D. K. Blumenthal,
R. S. Hansen,
K. A. Walsh,
K. Titani, and E. G. Krebs.
1985.
Characterization of the calmodulin-binding and catalytic domains in skeletal muscle myosin light chain kinase.
J. Biol. Chem.
260:11275-11285[Abstract/Free Full Text].
|
| 11.
|
Galisteo, M. L.,
J. Chernoff,
Y.-C. Su,
E. Y. Skolnik, and J. Schlessinger.
1996.
The adaptor protein Nck links receptor tyrosine kinases with the serine-threonine kinase Pak1.
J. Biol. Chem.
271:20997-21000[Abstract/Free Full Text].
|
| 12.
|
House, C., and B. E. Kemp.
1987.
Protein kinase C contains a pseudosubstrate prototype in its regulatory domain.
Science
238:1726-1728[Abstract/Free Full Text].
|
| 13.
|
Ishizaki, T.,
M. Maekawa,
K. Fujisawa,
K. Okawa,
A. Iwamatsu,
A. Fujita,
N. Watanabe,
Y. Saito,
A. Kakizuka,
N. Morii, and S. Narumiya.
1996.
The small GTP-binding protein Rho binds to and activates a 160 kda Ser/Thr protein kinase homologous to myotonic dystrophy kinase.
EMBO J.
15:1885-1893[Medline].
|
| 14.
|
Ito, M.,
V. Guerriero, Jr.,
X. M. Chen, and D. J. Hartshorne.
1991.
Definition of the inhibitory domain of smooth muscle myosin light chain kinase by site-directed mutagenesis.
Biochemistry
30:3498-3503[Medline].
|
| 15.
|
Joneson, T.,
M. McDonough,
D. Bar-Sagi, and L. Van Aelst.
1996.
RAC regulation of actin polymerization and proliferation by a pathway distinct from Jun kinase.
Science
274:1374-1376[Abstract/Free Full Text].
|
| 16.
|
Kemp, B. E.,
M. W. Parker,
S. Hu,
T. Tiganis, and C. House.
1994.
Substrate and pseudosubstrate interactions with protein kinases: determinants of specificity.
Trends Biochem. Sci.
19:440-444[Medline].
|
| 17.
|
Kennelly, P. J.,
A. M. Edelman,
D. K. Blumenthal, and E. G. Krebs.
1987.
Rabbit skeletal muscle myosin light chain kinase. The calmodulin binding domain as a potential active site-directed inhibitory domain.
J. Biol. Chem.
262:11958-11963[Abstract/Free Full Text].
|
| 18.
|
Kolluri, R.,
K. F. Tolias,
C. L. Carpenter,
F. S. Rosen, and T. Kirchhausen.
1996.
Direct interaction of the Wiskott-Aldrich syndrome protein with the GTPase Cdc42.
Proc. Natl. Acad. Sci. USA
93:5615-5618[Abstract/Free Full Text].
|
| 19.
|
Kozma, R.,
S. Ahmed,
A. Best, and L. Lim.
1995.
The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts.
Mol. Cell. Biol.
15:1942-1952[Abstract].
|
| 20.
|
Kozma, R.,
S. Sarner,
S. Ahmed, and L. Lim.
1997.
Rho family GTPases and neuronal growth cone remodelling: relationship between increased complexity induced by Cdc42Hs, Rac1, and acetylcholine and collapse induced by RhoA and lysophosphatidic acid.
Mol. Cell. Biol.
17:1201-1211[Abstract].
|
| 21.
|
Lamarche, N.,
N. Tapon,
L. Stowers,
P. D. Burbelo,
P. Aspenstrom,
T. Bridges,
J. Chant, and A. Hall.
1996.
Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade.
Cell
87:519-529[Medline].
|
| 22.
|
Leberer, E.,
D. Dignard,
D. Harcus,
D. Y. Thomas, and M. Whiteway.
1992.
The protein kinase homologue Steo20p is required to link the yeast pheromone response G-protein  subunits to downstream signalling components.
EMBO J.
11:4815-4824[Medline].
|
| 23.
|
Leberer, E.,
C. Wu,
T. Leeuw,
A. Fourest-Lieuvin,
J. E. Segall, and D. Y. Thomas.
1997.
Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase.
EMBO J.
16:83-97[Medline].
|
| 24.
|
Leung, T.,
E. Manser,
L. Tan, and L. Lim.
1995.
A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes.
J. Biol. Chem.
270:29051-29054[Abstract/Free Full Text].
|
| 25.
|
Leung, T.,
X.-Q. Chen,
E. Manser, and L. Lim.
1996.
The p160 RhoA-binding kinase ROK is a member of a kinase family and is involved in the reorganization of the cytoskeleton.
Mol. Cell. Biol.
16:5313-5327[Abstract].
|
| 26.
|
Leung, T.,
X.-Q. Chen,
I. Tan,
E. Manser, and L. Lim.
1998.
Myotonic dystrophy kinase-related Cdc42-binding kinase acts as a Cdc42 effector in promoting cytoskeletal reorganization.
Mol. Cell. Biol.
18:130-140[Abstract/Free Full Text].
|
| 27.
|
Lim, L.,
E. Manser,
T. Leung, and C. Hall.
1996.
Regulation of phosphorylation pathways by p21 GTPases.
Eur. J. Biochem.
242:171-185[Medline].
|
| 28.
|
Liu, H.,
C. Styles, and G. R. Fink.
1993.
Elements of the yeast pheromone response pathway required for filamentous growth of diploids.
Science
262:1741-1744[Abstract/Free Full Text].
|
| 29.
|
Lu, W.,
S. Katz,
R. Gupta, and B. J. Mayer.
1997.
Activation of Pak by membrane localization mediated by an SH3 domain from the adaptor protein Nck.
Curr. Biol.
7:85-94[Medline].
|
| 30.
|
Manser, E.,
T. Leung,
C. Monfries,
M. Teo,
C. Hall, and L. Lim.
1992.
Diversity and versatility of GTPase activating proteins for the p21rho subfamily of ras G proteins detected by a novel overlay assay.
J. Biol. Chem.
267:16025-16028[Abstract/Free Full Text].
|
| 31.
|
Manser, E.,
T. Leung,
H. Salihuddin,
L. Tan, and L. Lim.
1993.
A non-receptor tyrosine kinase that inhibits the GTPase activity of p21cdc42.
Nature
363:364-367[Medline].
|
| 32.
|
Manser, E.,
T. Leung,
H. Salihuddin,
Z.-S. Zhao, and L. Lim.
1994.
A brain serine/threonine protein kinase activated by Cdc42 and Rac1.
Nature
367:40-46[Medline].
|
| 33.
|
Manser, E.,
C. Chong,
Z.-S. Zhao,
T. Leung,
G. Michael,
C. Hall, and L. Lim.
1995.
Molecular cloning of a new member of the p21-Cdc42/Rac-activated kinase (PAK) family.
J. Biol. Chem.
270:25070-25078[Abstract/Free Full Text].
|
| 34.
|
Manser, E.,
H.-Y. Huang,
T.-H. Loo,
X.-Q. Chen,
J.-M. Dong,
T. Leung, and L. Lim.
1997.
Expression of constitutively active -PAK reveals effects of the kinase on actin and focal complexes.
Mol. Cell. Biol.
17:1129-1143[Abstract].
|
| 35.
|
Manser, E.,
T.-H. Loo,
C.-G. Koh,
Z.-S. Zhao,
I. Tan,
T. Leung, and L. Lim.
1998.
A family of guanine nucleotide exchange factors (PIXs) is directly coupled to the p21(Cdc42 and Rac)-activated kinase PAK.
Mol. Cell
1:183-192[Medline].
|
| 36.
|
Martin, G. A.,
G. Bollag,
F. A. McCormick, and A. Abo.
1995.
A novel serine kinase activated by rac/Cdc42Hs-dependent autophosphorylation is related to PAK65 and Ste20.
EMBO J.
14:1970-1978[Medline].
|
| 37.
|
Matsui, T.,
M. Amano,
T. Yamamoto,
K. Chilhara,
M. Nakafuku,
M. Ito,
T. Nakano,
K. Okawa,
A. Iwamamatsu, and K. Kaibuchi.
1996.
Rho-associated kinase, a novel serine threonine kinase, as a putative target for the small GTP-binding protein Rho.
EMBO J.
15:2208-2216[Medline].
|
| 38.
|
Minden, A.,
A. Lin,
F.-X. Claret,
A. Abo, and M. Karin.
1995.
Selective activation of the JNK signalling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs.
Cell
81:1147-1157[Medline].
|
| 39.
|
Nobes, C. D., and A. Hall.
1995.
Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibres, lamellipodia, and filopodia.
Cell
81:53-62[Medline].
|
| 40.
|
Nonaka, H.,
K. Tanaka,
H. Hirano,
T. Fujiwara,
H. Kohno,
M. Umikawa,
A. Mino, and Y. Takai.
1995.
A downstream target of RHO1 small GTP-binding protein is PKC1, a homolog of protein kinase C, which leads to activation of the MAP kinase cascade in Saccharomyces cerevisiae.
EMBO J.
14:5931-5938[Medline].
|
| 41.
|
Olson, M. F.,
A. Ashworth, and A. Hall.
1995.
An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1.
Science
269:1270-1272[Abstract/Free Full Text].
|
| 42.
|
Parker, P. J.,
L. Coussens,
N. Totty,
L. Rhee,
S. Young,
E. Chen,
S. Stabel,
M. D. Waterfield, and A. Ullrich.
1986.
The complete primary structure of protein kinase C the major phorbol ester receptor.
Science
233:853-859[Abstract/Free Full Text].
|
| 43.
|
Peppelenbosch, M. P.,
R.-G. Qiu,
A. M. M. de Vries-Smits,
L. G. J. Tertoolen,
S. W. de Laat,
F. McCormick,
A. Hall,
M. H. Symons, and J. L. Bos.
1995.
Rac mediates growth factor-induced arachidonic acid release.
Cell
81:849-856[Medline].
|
| 44.
|
Peter, M.,
A. M. Neiman,
H.-O. Park,
M. van Lohuizen, and I. Herskowitz.
1996.
Functional analysis of the interaction between the small GTP binding protein Cdc42 and the Ste20 protein kinase in yeast.
EMBO J.
15:7046-7059[Medline].
|
| 45.
|
Polverino, A.,
J. Frost,
P. Yang,
M. Hutchison,
A. M. Neiman,
M. H. Cobb, and S. Marcus.
1995.
Activation of mitogen-activated protein kinase cascades by p21-activated protein kinases in cell-free extracts of Xenopus oocytes.
J. Biol. Chem.
270:26067-26070[Abstract/Free Full Text].
|
| 46.
|
Ridley, A. J., and A. Hall.
1992.
The small GTP-binding protein Rho regulates the assembly of focal adhesions and actin stress fibres in response to growth factors.
Cell
70:389-399[Medline].
|
| 47.
|
Ridley, A. J.,
H. F. Paterson,
C. L. Johnston,
D. Diekmann, and A. Hall.
1992.
The small GTP-binding protein Rac regulates growth factor-induced membrane ruffling.
Cell
70:401-410[Medline].
|
| 48.
|
Rudel, T., and G. M. Bokoch.
1997.
Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2.
Science
276:1571-1574[Abstract/Free Full Text].
|
| 49.
|
Sells, M. A., and J. Chernoff.
1997.
Emerging from the Pak: the p21-activated protein kinase family.
Trends Cell Biol.
7:162-167.
|
| 50.
|
Sells, M. A.,
U. G. Knaus,
S. Bagrodia,
D. M. Ambrose,
G. M. Bokoch, and J. Chernoff.
1997.
Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells.
Curr. Biol.
7:202-210.
|
| 51.
|
Simon, M. N.,
C. Devirgilio,
B. Souza,
J. R. Pringle,
A. Abo, and S. I. Reed.
1995.
Role for the Rho-family GTPase Cdc42 in yeast mating pheromone signal pathway.
Nature
376:702-705[Medline].
|
| 52.
|
Soderling, T. R.
1990.
Protein kinases. Regulation by autoinhibitory domains.
J. Biol. Chem.
265:1823-1826[Free Full Text].
|
| 53.
|
Symons, M.,
J. M. J. Derry,
B. Karlak,
S. Jiang,
V. Lemahieu,
F. McCormick,
U. Francke, and A. Abo.
1996.
Wiskott-Aldrich syndrome protein, a novel effector for the GTPase Cdc42Hs, is implicated in actin polymerization.
Cell
84:723-734[Medline].
|
| 54.
|
Tapon, N., and A. Hall.
1997.
Rho, Rac and Cdc42 GTPases regulate the organization of the actin cytoskeleton.
Curr. Opin. Cell Biol.
9:86-92[Medline].
|
| 55.
|
Teo, M.,
E. Manser, and L. Lim.
1995.
Identification and molecular cloning of a p21cdc42/rac1-activated serine/threonine kinase that is rapidly activated by thrombin in platelets.
J. Biol. Chem.
270:26690-26697[Abstract/Free Full Text].
|
| 56.
|
Van Aelst, L.,
T. Joneson, and D. Bar-Sagi.
1996.
Identification of a novel Rac1-interacting protein involved in membrane ruffling.
EMBO J.
15:3778-3786[Medline].
|
| 57.
|
Watanabe, G.,
Y. Saito,
P. Madaule,
T. Ishizaki,
K. Fujisawa,
N. Morii,
H. Mukai,
Y. Ono,
A. Kakizuka, and S. Narumiya.
1996.
Protein kinase N (PKN) and PKN-related protein rhophilin as targets of the small GTPase Rho.
Science
271:645-648[Abstract].
|
| 58.
|
Watanabe, N.,
P. Madaule,
T. Reid,
T. Ishizaki,
G. Watanabe,
A. Kakizuka,
Y. Saito,
K. Nakao,
B. M. Jockusch, and S. Narumiya.
1997.
p140mDia, a mammalian homolog of Drosophila diaphanous, is a target protein for Rho small GTPase and is a ligand for profilin.
EMBO J.
16:3044-3056[Medline].
|
| 59.
|
Westwick, J. K.,
Q. T. Lambert,
G. J. Clarke,
M. Symons,
L. Van Aelst,
R. G. Pestell, and C. J. Der.
1997.
Rac regulation of transformation, gene expression, and actin organization by multiple, PAK-independent pathways.
Mol. Cell. Biol.
17:1324-1335[Abstract].
|
| 60.
|
Zhang, S.,
J. Han,
M. A. Sells,
J. Chernoff,
U. G. Knaus,
R. J. Ulevitch, and G. M. Bokoch.
1995.
Rho family GTPases regulate p38 mitogen-activated protein kinase through the downstream mediator Pak1.
J. Biol. Chem.
270:23934-23936[Abstract/Free Full Text].
|
| 61.
|
Zhao, Z.-S.,
T. Leung,
E. Manser, and L. Lim.
1995.
Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24.
Mol. Cell. Biol.
15:5246-5257[Abstract].
|
| 62.
|
Ziman, M.,
J. M. O'Brien,
L. A. Ouellette,
W. R. Church, and D. I. Johnson.
1991.
Mutational analysis of CDC42Sc, a Saccharomyces cerevisiae gene that encodes a putative GTP-binding protein involved in the control of cell polarity.
Mol. Cell. Biol.
11:3537-3544[Abstract/Free Full Text].
|
Mol Cell Biol, April 1998, p. 2153-2163, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Parrini, M. C., Camonis, J., Matsuda, M., de Gunzburg, J.
(2009). Dissecting Activation of the PAK1 Kinase at Protrusions in Living Cells. J. Biol. Chem.
284: 24133-24143
[Abstract]
[Full Text]
-
Van den Broeke, C., Radu, M., Deruelle, M., Nauwynck, H., Hofmann, C., Jaffer, Z. M., Chernoff, J., Favoreel, H. W.
(2009). Alphaherpesvirus US3-mediated reorganization of the actin cytoskeleton is mediated by group A p21-activated kinases. Proc. Natl. Acad. Sci. USA
106: 8707-8712
[Abstract]
[Full Text]
-
Hsu, Y.-H., Johnson, D. A., Traugh, J. A.
(2008). Analysis of Conformational Changes during Activation of Protein Kinase Pak2 by Amide Hydrogen/Deuterium Exchange. J. Biol. Chem.
283: 36397-36405
[Abstract]
[Full Text]
-
Chan, P. M., Lim, L., Manser, E.
(2008). PAK Is Regulated by PI3K, PIX, CDC42, and PP2C{alpha} and Mediates Focal Adhesion Turnover in the Hyperosmotic Stress-induced p38 Pathway. J. Biol. Chem.
283: 24949-24961
[Abstract]
[Full Text]
-
Parsons, M., Adams, J. C.
(2008). Rac regulates the interaction of fascin with protein kinase C in cell migration. J. Cell Sci.
121: 2805-2813
[Abstract]
[Full Text]
-
Hasegawa, Y., Tribble, G. D., Baker, H. V., Mans, J. J., Handfield, M., Lamont, R. J.
(2008). Role of Porphyromonas gingivalis SerB in Gingival Epithelial Cell Cytoskeletal Remodeling and Cytokine Production. Infect. Immun.
76: 2420-2427
[Abstract]
[Full Text]
-
Lozano, E., Frasa, M. A. M., Smolarczyk, K., Knaus, U. G., Braga, V. M. M.
(2008). PAK is required for the disruption of E-cadherin adhesion by the small GTPase Rac. J. Cell Sci.
121: 933-938
[Abstract]
[Full Text]
-
Ayala, I., Baldassarre, M., Giacchetti, G., Caldieri, G., Tete, S., Luini, A., Buccione, R.
(2008). Multiple regulatory inputs converge on cortactin to control invadopodia biogenesis and extracellular matrix degradation. J. Cell Sci.
121: 369-378
[Abstract]
[Full Text]
-
Rendon, B. E., Roger, T., Teneng, I., Zhao, M., Al-Abed, Y., Calandra, T., Mitchell, R. A.
(2007). Regulation of Human Lung Adenocarcinoma Cell Migration and Invasion by Macrophage Migration Inhibitory Factor. J. Biol. Chem.
282: 29910-29918
[Abstract]
[Full Text]
-
Kreis, P., Thevenot, E., Rousseau, V., Boda, B., Muller, D., Barnier, J.-V.
(2007). The p21-activated Kinase 3 Implicated in Mental Retardation Regulates Spine Morphogenesis through a Cdc42-dependent Pathway. J. Biol. Chem.
282: 21497-21506
[Abstract]
[Full Text]
-
Partridge, M. A., Marcantonio, E. E.
(2006). Initiation of Attachment and Generation of Mature Focal Adhesions by Integrin-containing Filopodia in Cell Spreading. Mol. Biol. Cell
17: 4237-4248
[Abstract]
[Full Text]
-
Moldovan, L., Mythreye, K., Goldschmidt-Clermont, P. J., Satterwhite, L. L.
(2006). Reactive oxygen species in vascular endothelial cell motility. Roles of NAD(P)H oxidase and Rac1. Cardiovasc Res
71: 236-246
[Abstract]
[Full Text]
-
ten Klooster, J. P., Jaffer, Z. M., Chernoff, J., Hordijk, P. L.
(2006). Targeting and activation of Rac1 are mediated by the exchange factor {beta}-Pix. JCB
172: 759-769
[Abstract]
[Full Text]
-
Jung, J.-H., Traugh, J. A.
(2005). Regulation of the Interaction of Pak2 with Cdc42 via Autophosphorylation of Serine 141. J. Biol. Chem.
280: 40025-40031
[Abstract]
[Full Text]
-
Martyn, K. D., Kim, M.-J., Quinn, M. T., Dinauer, M. C., Knaus, U. G.
(2005). p21-activated kinase (Pak) regulates NADPH oxidase activation in human neutrophils. Blood
106: 3962-3969
[Abstract]
[Full Text]
-
Li, C., Beal, M. F.
(2005). Leucine-rich repeat kinase 2: A new player with a familiar theme for Parkinson's disease pathogenesis. Proc. Natl. Acad. Sci. USA
102: 16535-16536
[Full Text]
-
Beeser, A., Jaffer, Z. M., Hofmann, C., Chernoff, J.
(2005). Role of Group A p21-activated Kinases in Activation of Extracellular-regulated Kinase by Growth Factors. J. Biol. Chem.
280: 36609-36615
[Abstract]
[Full Text]
-
Webb, B. A., Eves, R., Crawley, S. W., Zhou, S., Cote, G. P., Mak, A. S.
(2005). PAK1 induces podosome formation in A7r5 vascular smooth muscle cells in a PAK-interacting exchange factor-dependent manner. Am. J. Physiol. Cell Physiol.
289: C898-C907
[Abstract]
[Full Text]
-
He, H., Pannequin, J., Tantiongco, J.-P., Shulkes, A., Baldwin, G. S.
(2005). Glycine-extended gastrin stimulates cell proliferation and migration through a Rho- and ROCK-dependent pathway, not a Rac/Cdc42-dependent pathway. Am. J. Physiol. Gastrointest. Liver Physiol.
289: G478-G488
[Abstract]
[Full Text]
-
Cau, J., Hall, A.
(2005). Cdc42 controls the polarity of the actin and microtubule cytoskeletons through two distinct signal transduction pathways. J. Cell Sci.
118: 2579-2587
[Abstract]
[Full Text]
-
Callow, M. G., Zozulya, S., Gishizky, M. L., Jallal, B., Smeal, T.
(2005). PAK4 mediates morphological changes through the regulation of GEF-H1. J. Cell Sci.
118: 1861-1872
[Abstract]
[Full Text]
-
Yang, Z., Rayala, S., Nguyen, D., Vadlamudi, R. K., Chen, S., Kumar, R.
(2005). Pak1 Phosphorylation of Snail, a Master Regulator of Epithelial-to-Mesenchyme Transition, Modulates Snail's Subcellular Localization and Functions. Cancer Res.
65: 3179-3184
[Abstract]
[Full Text]
-
Alberts, A. S., Qin, H., Carr, H. S., Frost, J. A.
(2005). PAK1 Negatively Regulates the Activity of the Rho Exchange Factor NET1. J. Biol. Chem.
280: 12152-12161
[Abstract]
[Full Text]
-
de la Roche, M., Mahasneh, A., Lee, S.-F., Rivero, F., Cote, G. P.
(2005). Cellular Distribution and Functions of Wild-Type and Constitutively Activated Dictyostelium PakB. Mol. Biol. Cell
16: 238-247
[Abstract]
[Full Text]
-
Koeppel, M. A., McCarthy, C. C., Moertl, E., Jakobi, R.
(2004). Identification and Characterization of PS-GAP as a Novel Regulator of Caspase-activated PAK-2. J. Biol. Chem.
279: 53653-53664
[Abstract]
[Full Text]
-
Pulkkinen, K., Renkema, G. H., Kirchhoff, F., Saksela, K.
(2004). Nef Associates with p21-Activated Kinase 2 in a p21-GTPase-Dependent Dynamic Activation Complex within Lipid Rafts. J. Virol.
78: 12773-12780
[Abstract]
[Full Text]
-
Lee, S., Rivero, F., Park, K. C., Huang, E., Funamoto, S., Firtel, R. A.
(2004). Dictyostelium PAKc Is Required for Proper Chemotaxis. Mol. Biol. Cell
15: 5456-5469
[Abstract]
[Full Text]
-
Zhou, G., Boomer, J. S., Tan, T.-H.
(2004). Protein Phosphatase 4 Is a Positive Regulator of Hematopoietic Progenitor Kinase 1. J. Biol. Chem.
279: 49551-49561
[Abstract]
[Full Text]
-
Turner, L. J., Nicholls, S., Hall, A.
(2004). The Activity of the Plexin-A1 Receptor Is Regulated by Rac. J. Biol. Chem.
279: 33199-33205
[Abstract]
[Full Text]
-
Chu, P. C., Wu, J., Liao, X. C., Pardo, J., Zhao, H., Li, C., Mendenhall, M. K., Pali, E., Shen, M., Yu, S., Taylor, V. C., Aversa, G., Molineaux, S., Payan, D. G., Masuda, E. S.
(2004). A Novel Role for p21-Activated Protein Kinase 2 in T Cell Activation. J. Immunol.
172: 7324-7334
[Abstract]
[Full Text]
-
Stofega, M. R., Sanders, L. C., Gardiner, E. M., Bokoch, G. M.
(2004). Constitutive p21-activated Kinase (PAK) Activation in Breast Cancer Cells as a Result of Mislocalization of PAK to Focal Adhesions. Mol. Biol. Cell
15: 2965-2977
[Abstract]
[Full Text]
-
Loo, T.-H., Ng, Y.-W., Lim, L., Manser, E.
(2004). GIT1 Activates p21-Activated Kinase through a Mechanism Independent of p21 Binding. Mol. Cell. Biol.
24: 3849-3859
[Abstract]
[Full Text]
-
Wild, A. C., Yu, J. W., Lemmon, M. A., Blumer, K. J.
(2004). The p21-activated Protein Kinase-related Kinase Cla4 Is a Coincidence Detector of Signaling by Cdc42 and Phosphatidylinositol 4-Phosphate. J. Biol. Chem.
279: 17101-17110
[Abstract]
[Full Text]
-
Chen, W., Yazicioglu, M., Cobb, M. H.
(2004). Characterization of OSR1, a Member of the Mammalian Ste20p/Germinal Center Kinase Subfamily. J. Biol. Chem.
279: 11129-11136
[Abstract]
[Full Text]
-
Ke, Y., Wang, L., Pyle, W. G., de Tombe, P. P., Solaro, R. J.
(2004). Intracellular Localization and Functional Effects of P21-Activated Kinase-1 (Pak1) in Cardiac Myocytes. Circ. Res.
94: 194-200
[Abstract]
[Full Text]
-
Wu, R. F., Gu, Y., Xu, Y. C., Mitola, S., Bussolino, F., Terada, L. S.
(2004). Human Immunodeficiency Virus Type 1 Tat Regulates Endothelial Cell Actin Cytoskeletal Dynamics through PAK1 Activation and Oxidant Production. J. Virol.
78: 779-789
[Abstract]
[Full Text]
-
Balasenthil, S., Sahin, A. A., Barnes, C. J., Wang, R.-A., Pestell, R. G., Vadlamudi, R. K., Kumar, R.
(2004). p21-activated Kinase-1 Signaling Mediates Cyclin D1 Expression in Mammary Epithelial and Cancer Cells. J. Biol. Chem.
279: 1422-1428
[Abstract]
[Full Text]
-
Hoshino, M., Nakamura, S.
(2003). Small GTPase Rin induces neurite outgrowth through Rac/Cdc42 and calmodulin in PC12 cells. JCB
163: 1067-1076
[Abstract]
[Full Text]
-
Zhou, G.-L., Zhuo, Y., King, C. C., Fryer, B. H., Bokoch, G. M., Field, J.
(2003). Akt Phosphorylation of Serine 21 on Pak1 Modulates Nck Binding and Cell Migration. Mol. Cell. Biol.
23: 8058-8069
[Abstract]
[Full Text]
-
Wu, H., Wang, Z.-X.
(2003). The Mechanism of p21-activated Kinase 2 Autoactivation. J. Biol. Chem.
278: 41768-41778
[Abstract]
[Full Text]
-
Fournes, B., Farrah, J., Olson, M., Lamarche-Vane, N., Beauchemin, N.
(2003). Distinct Rho GTPase Activities Regulate Epithelial Cell Localization of the Adhesion Molecule CEACAM1: Involvement of the CEACAM1 Transmembrane Domain. Mol. Cell. Biol.
23: 7291-7304
[Abstract]
[Full Text]
-
Cai, D., Iyer, A., Felekkis, K. N., Near, R. I., Luo, Z., Chernoff, J., Albanese, C., Pestell, R. G., Lerner, A.
(2003). AND-34/BCAR3, a GDP Exchange Factor Whose Overexpression Confers Antiestrogen Resistance, Activates Rac, PAK1, and the Cyclin D1 Promoter. Cancer Res.
63: 6802-6808
[Abstract]
[Full Text]
-
Zhan, Q., Ge, Q., Ohira, T., Van Dyke, T., Badwey, J. A.
(2003). p21-Activated Kinase 2 in Neutrophils Can Be Regulated by Phosphorylation at Multiple Sites and by a Variety of Protein Phosphatases. J. Immunol.
171: 3785-3793
[Abstract]
[Full Text]
-
Carton, I., Hermans, D., Eggermont, J.
(2003). Hypotonicity induces membrane protrusions and actin remodeling via activation of small GTPases Rac and Cdc42 in Rat-1 fibroblasts. Am. J. Physiol. Cell Physiol.
285: C935-C944
[Abstract]
[Full Text]
-
Hood, J. D., Frausto, R., Kiosses, W. B., Schwartz, M. A., Cheresh, D. A.
(2003). Differential {alpha}v integrin-mediated Ras-ERK signaling during two pathways of angiogenesis. JCB
162: 933-943
[Abstract]
[Full Text]
-
McPhie, D. L., Coopersmith, R., Hines-Peralta, A., Chen, Y., Ivins, K. J., Manly, S. P., Kozlowski, M. R., Neve, K. A., Neve, R. L.
(2003). DNA Synthesis and Neuronal Apoptosis Caused by Familial Alzheimer Disease Mutants of the Amyloid Precursor Protein Are Mediated by the p21 Activated Kinase PAK3. J. Neurosci.
23: 6914-6927
[Abstract]
[Full Text]
-
Alavi, A., Hood, J. D., Frausto, R., Stupack, D. G., Cheresh, D. A.
(2003). Role of Raf in Vascular Protection from Distinct Apoptotic Stimuli. Science
301: 94-96
[Abstract]
[Full Text]
-
Wittmann, T., Bokoch, G. M., Waterman-Storer, C. M.
(2003). Regulation of leading edge microtubule and actin dynamics downstream of Rac1. JCB
161: 845-851
[Abstract]
[Full Text]
-
Quadri, S. K., Bhattacharjee, M., Parthasarathi, K., Tanita, T., Bhattacharya, J.
(2003). Endothelial Barrier Strengthening by Activation of Focal Adhesion Kinase. J. Biol. Chem.
278: 13342-13349
[Abstract]
[Full Text]
-
Tran, N. H., Frost, J. A.
(2003). Phosphorylation of Raf-1 by p21-activated Kinase 1 and Src Regulates Raf-1 Autoinhibition. J. Biol. Chem.
278: 11221-11226
[Abstract]
[Full Text]
-
Rousseau, V., Goupille, O., Morin, N., Barnier, J.-V.
(2003). A New Constitutively Active Brain PAK3 Isoform Displays Modified Specificities toward Rac and Cdc42 GTPases. J. Biol. Chem.
278: 3912-3920
[Abstract]
[Full Text]
-
Xu, B.-e, Min, X., Stippec, S., Lee, B.-H., Goldsmith, E. J., Cobb, M. H.
(2002). Regulation of WNK1 by an Autoinhibitory Domain and Autophosphorylation. J. Biol. Chem.
277: 48456-48462
[Abstract]
[Full Text]
-
Gallagher, E. D., Xu, S., Moomaw, C., Slaughter, C. A., Cobb, M. H.
(2002). Binding of JNK/SAPK to MEKK1 Is Regulated by Phosphorylation. J. Biol. Chem.
277: 45785-45792
[Abstract]
[Full Text]
-
Shin, E.-Y., Shin, K.-S., Lee, C.-S., Woo, K.-N., Quan, S.-H., Soung, N.-K., Kim, Y. G., Cha, C. I., Kim, S.-R., Park, D., Bokoch, G. M., Kim, E.-G.
(2002). Phosphorylation of p85 beta PIX, a Rac/Cdc42-specific Guanine Nucleotide Exchange Factor, via the Ras/ERK/PAK2 Pathway Is Required for Basic Fibroblast Growth Factor-induced Neurite Outgrowth. J. Biol. Chem.
277: 44417-44430
[Abstract]
[Full Text]
-
Wells, C. M., Abo, A., Ridley, A. J.
(2002). PAK4 is activated via PI3K in HGF-stimulated epithelial cells. J. Cell Sci.
115: 3947-3956
[Abstract]
[Full Text]
-
Rodriguez-Pachon, J. M., Martin, H., North, G., Rotger, R., Nombela, C., Molina, M.
(2002). A Novel Connection between the Yeast Cdc42 GTPase and the Slt2-mediated Cell Integrity Pathway Identified through the Effect of Secreted Salmonella GTPase Modulators. J. Biol. Chem.
277: 27094-27102
[Abstract]
[Full Text]
-
Connolly, J. O., Simpson, N., Hewlett, L., Hall, A.
(2002). Rac Regulates Endothelial Morphogenesis and Capillary Assembly. Mol. Biol. Cell
13: 2474-2485
[Abstract]
[Full Text]
-
Lamson, R. E., Winters, M. J., Pryciak, P. M.
(2002). Cdc42 Regulation of Kinase Activity and Signaling by the Yeast p21-Activated Kinase Ste20. Mol. Cell. Biol.
22: 2939-2951
[Abstract]
[Full Text]
-
Brown, M. C., West, K. A., Turner, C. E.
(2002). Paxillin-dependent Paxillin Kinase Linker and p21-Activated Kinase Localization to Focal Adhesions Involves a Multistep Activation Pathway. Mol. Biol. Cell
13: 1550-1565
[Abstract]
[Full Text]
-
Tian, D., Litvak, V., Toledo-Rodriguez, M., Carmon, S., Lev, S.
(2002). Nir2, a Novel Regulator of Cell Morphogenesis. Mol. Cell. Biol.
22: 2650-2662
[Abstract]
[Full Text]
-
Kiosses, W. B., Hood, J., Yang, S., Gerritsen, M. E., Cheresh, D. A., Alderson, N., Schwartz, M. A.
(2002). A Dominant-Negative p65 PAK Peptide Inhibits Angiogenesis. Circ. Res.
90: 697-702
[Abstract]
[Full Text]
-
Kissil, J. L., Johnson, K. C., Eckman, M. S., Jacks, T.
(2002). Merlin Phosphorylation by p21-activated Kinase 2 and Effects of Phosphorylation on Merlin Localization. J. Biol. Chem.
277: 10394-10399
[Abstract]
[Full Text]
-
Callow, M. G., Clairvoyant, F., Zhu, S., Schryver, B., Whyte, D. B., Bischoff, J. R., Jallal, B., Smeal, T.
(2002). Requirement for PAK4 in the Anchorage-independent Growth of Human Cancer Cell Lines. J. Biol. Chem.
277: 550-558
[Abstract]
[Full Text]
-
Lee, S. R., Ramos, S. M., Ko, A., Masiello, D., Swanson, K. D., Lu, M. L., Balk, S. P.
(2002). AR and ER Interaction with a p21-Activated Kinase (PAK6). Mol. Endocrinol.
16: 85-99
[Abstract]
[Full Text]
-
KIM, D., KIM, S., KOH, H., YOON, S.-O., CHUNG, A.-S., CHO, K. S., CHUNG, J.
(2001). Akt/PKB promotes cancer cell invasion via increased motility and metalloproteinase production. FASEB J.
15: 1953-1962
[Abstract]
[Full Text]
-
Buchwald, G., Hostinova, E., Rudolph, M. G., Kraemer, A., Sickmann, A., Meyer, H. E., Scheffzek, K., Wittinghofer, A.
(2001). Conformational Switch and Role of Phosphorylation in PAK Activation. Mol. Cell. Biol.
21: 5179-5189
[Abstract]
[Full Text]
-
West, K. A., Zhang, H., Brown, M. C., Nikolopoulos, S. N., Riedy, M.C., Horwitz, A. F., Turner, C. E.
(2001). The LD4 motif of paxillin regulates cell spreading and motility through an interaction with paxillin kinase linker (PKL). JCB
154: 161-176
[Abstract]
[Full Text]
-
Xia, C., Ma, W., Stafford, L. J., Marcus, S., Xiong, W.-C., Liu, M.
(2001). Regulation of the p21-activated kinase (PAK) by a human Gbeta -like WD-repeat protein, hPIP1. Proc. Natl. Acad. Sci. USA
98: 6174-6179
[Abstract]
[Full Text]
-
Lian, J. P., Toker, A., Badwey, J. A.
(2001). Phosphorylation of the Activation Loop of {{gamma}} p21-Activated Kinase ({{gamma}}-Pak) and Related Kinases (MSTs) in Normal and Stressed Neutrophils. J. Immunol.
166: 6349-6357
[Abstract]
[Full Text]
-
Tan, I., Seow, K. T., Lim, L., Leung, T.
(2001). Intermolecular and Intramolecular Interactions Regulate Catalytic Activity of Myotonic Dystrophy Kinase-Related Cdc42-Binding Kinase {alpha}. Mol. Cell. Biol.
21: 2767-2778
[Abstract]
[Full Text]
-
Renkema, G. H., Manninen, A., Saksela, K.
(2001). Human Immunodeficiency Virus Type 1 Nef Selectively Associates with a Catalytically Active Subpopulation of p21-Activated Kinase 2 (PAK2) Independently of PAK2 Binding to Nck or {beta}-PIX. J. Virol.
75: 2154-2160
[Abstract]
[Full Text]
-
Sells, M. A., Pfaff, A., Chernoff, J.
(2000). Temporal and Spatial Distribution of Activated Pak1 in Fibroblasts. JCB
151: 1449-1458
[Abstract]
[Full Text]
-
Roig, J., Tuazon, P. T., Zipfel, P. A., Pendergast, A. M., Traugh, J. A.
(2000). Functional interaction between c-Abl and the p21-activated protein kinase gamma -PAK. Proc. Natl. Acad. Sci. USA
97: 14346-14351
[Abstract]
[Full Text]
-
Jimenez, C., Portela, R. A., Mellado, M., Rodriguez-Frade, J. M., Collard, J., Serrano, A., Martinez-A, C., Avila, J., Carrera, A. C.
(2000). Role of the Pi3k Regulatory Subunit in the Control of Actin Organization and Cell Migration. JCB
151: 249-262
[Abstract]
[Full Text]
-
Moskow, J. J., Gladfelter, A. S., Lamson, R. E., Pryciak, P. M., Lew, D. J.
(2000). Role of Cdc42p in Pheromone-Stimulated Signal Transduction in Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 7559-7571
[Abstract]
[Full Text]
-
Vikis, H. G., Li, W., He, Z., Guan, K.-L.
(2000). The semaphorin receptor plexin-B1 specifically interacts with active Rac in a ligand-dependent manner. Proc. Natl. Acad. Sci. USA
10.1073/pnas.220421797v1
[Abstract]
[Full Text]
-
Dharmawardhane, S., Schürmann, A., Sells, M. A., Chernoff, J., Schmid, S. L., Bokoch, G. M.
(2000). Regulation of Macropinocytosis by p21-activated Kinase-1. Mol. Biol. Cell
11: 3341-3352
[Abstract]
[Full Text]
-
Zhao, Z.-s., Manser, E., Loo, T.-H., Lim, L.
(2000). Coupling of PAK-Interacting Exchange Factor PIX to GIT1 Promotes Focal Complex Disassembly. Mol. Cell. Biol.
20: 6354-6363
[Abstract]
[Full Text]
-
Adams, J. C., Schwartz, M. A.
(2000). Stimulation of Fascin Spikes by Thrombospondin-1 Is Mediated by the Gtpases Rac and Cdc42. JCB
150: 807-822
[Abstract]
[Full Text]
-
Zhao, Z.-s., Manser, E., Lim, L.
(2000). Interaction between PAK and Nck: a Template for Nck Targets and Role of PAK Autophosphorylation. Mol. Cell. Biol.
20: 3906-3917
[Abstract]
[Full Text]
-
Bock, B. C., Vacratsis, P. O., Qamirani, E., Gallo, K. A.
(2000). Cdc42-induced Activation of the Mixed-Lineage Kinase SPRK in Vivo. REQUIREMENT OF THE Cdc42/Rac INTERACTIVE BINDING MOTIF AND CHANGES IN PHOSPHORYLATION. J. Biol. Chem.
275: 14231-14241
[Abstract]
[Full Text]
-
Royal, I., Lamarche-Vane, N., Lamorte, L., Kaibuchi, K., Park, M.
(2000). Activation of Cdc42, Rac, PAK, and Rho-Kinase in Response to Hepatocyte Growth Factor Differentially Regulates Epithelial Cell Colony Spreading and Dissociation. Mol. Biol. Cell
11: 1709-1725
[Abstract]
[Full Text]
-
Coghlan, M. P., Chou, M. M., Carpenter, C. L.
(2000). Atypical Protein Kinases Clambda and -zeta Associate with the GTP-Binding Protein Cdc42 and Mediate Stress Fiber Loss. Mol. Cell. Biol.
20: 2880-2889
[Abstract]
[Full Text]
-
Adam, L., Vadlamudi, R., Mandal, M., Chernoff, J., Kumar, R.
(2000). Regulation of Microfilament Reorganization and Invasiveness of Breast Cancer Cells by Kinase Dead p21-activated Kinase-1. J. Biol. Chem.
275: 12041-12050
[Abstract]
[Full Text]
-
Fackler, O. T., Lu, X., Frost, J. A., Geyer, M., Jiang, B., Luo, W., Abo, A., Alberts, A. S., Peterlin, B. M.
(2000). p21-Activated Kinase 1 Plays a Critical Role in Cellular Activation by Nef. Mol. Cell. Biol.
20: 2619-2627
[Abstract]
[Full Text]
-
Schürmann, A., Mooney, A. F., Sanders, L. C., Sells, M. A., Wang, H. G., Reed, J. C., Bokoch, G. M.
(2000). p21-Activated Kinase 1 Phosphorylates the Death Agonist Bad and Protects Cells from Apoptosis. Mol. Cell. Biol.
20: 453-461
[Abstract]
[Full Text]
-
Mira, J.-P., Benard, V., Groffen, J., Sanders, L. C., Knaus, U. G.
(2000). Endogenous, hyperactive Rac3 controls proliferation of breast cancer cells by a p21-activated kinase-dependent pathway. Proc. Natl. Acad. Sci. USA
97: 185-189
[Abstract]
[Full Text]
-
Kiosses, W. B., Daniels, R. H., Otey, C., Bokoch, G. M., Schwartz, M. A.
(1999). A Role for P21-Activated Kinase in Endothelial Cell Migration. JCB
147: 831-844
[Abstract]
[Full Text]
-
Holly, S. P., Blumer, K. J.
(1999). Pak-Family Kinases Regulate Cell and Actin Polarization Throughout the Cell Cycle of Saccharomyces cerevisiae. JCB
147: 845-856
[Abstract]
[Full Text]
-
Zenke, F. T., King, C. C., Bohl, B. P., Bokoch, G. M.
(1999). Identification of a Central Phosphorylation Site in p21-activated Kinase Regulating Autoinhibition and Kinase Activity. J. Biol. Chem.
274: 32565-32573
[Abstract]
[Full Text]
-
Roig, J., Traugh, J. A.
(1999). p21-activated Protein Kinase gamma -PAK Is Activated by Ionizing Radiation and Other DNA-damaging Agents. SIMILARITIES AND DIFFERENCES TO alpha -PAK. J. Biol. Chem.
274: 31119-31122
[Abstract]
[Full Text]
-
Burbelo, P. D., Snow, D. M., Bahou, W., Spiegel, S.
(1999). MSE55, a Cdc42 effector protein, induces long cellular extensions in fibroblasts. Proc. Natl. Acad. Sci. USA
96: 9083-9088
[Abstract]
[Full Text]
-
Daniels, R. H., Zenke, F. T., Bokoch, G. M.
(1999). alpha Pix Stimulates p21-activated Kinase Activity through Exchange Factor-dependent and -independent Mechanisms. J. Biol. Chem.
274: 6047-6050
[Abstract]
[Full Text]
-
Johnson, D. I.
(1999). Cdc42: An Essential Rho-Type GTPase Controlling Eukaryotic Cell Polarity. Microbiol. Mol. Biol. Rev.
63: 54-105
[Abstract]
[Full Text]
-
Brzeska, H., Young, R., Knaus, U., Korn, E. D.
(1999). Myosin I heavy chain kinase: Cloning of the full-length gene and acidic lipid-dependent activation by Rac and Cdc42. Proc. Natl. Acad. Sci. USA
96: 394-399
[Abstract]
[Full Text]
-
Fukata, M, Nakagawa, M, Kuroda, S, Kaibuchi, K
(1999). Cell adhesion and Rho small GTPases. J. Cell Sci.
112: 4491-4500
[Abstract]
-
Tu, H., Wigler, M.
(1999). Genetic Evidence for Pak1 Autoinhibition and Its Release by Cdc42. Mol. Cell. Biol.
19: 602-611
[Abstract]
[Full Text]
-
Huang, R., Lian, J. P., Robinson, D., Badwey, J. A.
(1998). Neutrophils Stimulated with a Variety of Chemoattractants Exhibit Rapid Activation of p21-Activated Kinases (Paks): Separate Signals Are Required for Activation and Inactivation of Paks. Mol. Cell. Biol.
18: 7130-7138
[Abstract]
[Full Text]