Previous Article | Next Article 
Mol Cell Biol, April 1998, p. 2344-2359, Vol. 18, No. 4
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Requirement for Both Shc and Phosphatidylinositol
3' Kinase Signaling Pathways in Polyomavirus Middle T-Mediated
Mammary Tumorigenesis
Marc A.
Webster,1,2
John N.
Hutchinson,1,2
Michael J.
Rauh,1,3
Senthil K.
Muthuswamy,1,2
Martina
Anton,3
Christopher G.
Tortorice,1,2
Robert D.
Cardiff,4,5
Frank L.
Graham,1,2,3
John A.
Hassell,1,2,3,4 and
William J.
Muller1,2,3,4,5,*
Cancer Research Group, Institute for Molecular Biology and
Biotechnology,1 and
Departments of
Biology,2
Biochemistry,4 and
Pathology,3 McMaster University,
Hamilton, Ontario, Canada L8S 4K1, and
Department of
Pathology, School of Medicine, University of California at Davis,
Davis California, 956165
Received 6 August 1997/Returned for modification 25 September
1997/Accepted 26 December 1997
 |
ABSTRACT |
Transgenic mice expressing the polyomavirus (PyV) middle T antigen
(MT) develop multifocal mammary tumors which frequently metastasize to
the lung. The potent transforming activity of PyV MT is correlated with
its capacity to activate and associate with a number of signaling
molecules, including the Src family tyrosine kinases, the 85-kDa Src
homology 2 subunit of the phosphatidylinositol 3' (PI-3') kinase, and
the Shc adapter protein. To uncover the role of these signaling
proteins in MT-mediated mammary tumorigenesis, we have generated
transgenic mice that express mutant PyV MT antigens decoupled from
either the Shc or the PI-3' kinase signaling pathway. In contrast to
the rapid induction of metastatic mammary tumors observed in the
strains expressing wild-type PyV MT, mammary epithelial cell-specific
expression of either mutant PyV MT resulted in the induction of
extensive mammary epithelial hyperplasias. The mammary epithelial
hyperplasias expressing the mutant PyV MT defective in recruiting the
PI-3' kinase were highly apoptotic, suggesting that recruitment of
PI-3' kinase by MT affects cell survival. Whereas the initial
phenotypes observed in both strains were global mammary epithelial
hyperplasias, focal mammary tumors eventually arose in all female
transgenic mice. Genetic and biochemical analyses of tumorigenesis in
the transgenic strains expressing the PyV MT mutant lacking the Shc
binding site revealed that a proportion of the metastatic tumors
arising in these mice displayed evidence of reversion of the mutant Shc
binding site. In contrast, no evidence of reversion of the PI-3' kinase
binding site was noted in tumors derived from the strains expressing
the PI-3' kinase binding site MT mutant. Tumor progression in both
mutant strains was further correlated with upregulation of the
epidermal growth factor receptor family members which are known to
couple to the PI-3' kinase and Shc signaling pathways. Taken together,
these observations suggest that PyV MT-mediated tumorigenesis requires
activation of both Shc and PI-3' kinase, which appear to be required
for stimulation of cell proliferation and survival signaling pathways,
respectively.
 |
INTRODUCTION |
Mammary epithelial cell-specific
expression of the polyomavirus (PyV) middle T (MT) oncogene in
transgenic mice results in the induction of multifocal metastatic
mammary tumors involving 100% of the transgene carriers
(19). The potent oncogenic properties of the PyV MT are due
to its ability to associate with and activate a number of cellular
signaling proteins. One class of cellular enzymes activated by PyV MT
consists of members of the Src family tyrosine kinases (c-Src and
c-Yes) (8, 12, 27, 30). Expression of PyV MT in mammary
glands of Src-deficient mice rarely results in the induction of mammary
tumors (20), suggesting that activation of Src by PyV MT is
required for mammary tumorigenesis. Whereas activation of c-Src is
required for the rapid induction of mammary tumors, this event is not
sufficient, because expression of a constitutively active version of
Src in the mammary glands of transgenic mice rarely leads to
tumorigenesis. Instead, activated c-Src induces mammary epithelial
hyperplasias that rarely progress to full malignancy (53).
One possible explanation for these observations is that in addition to
activation of the Src tyrosine kinase, PyV MT must recruit additional
cellular signaling pathways to effect malignant transformation of the
mammary epithelial cell. Indeed, PyV MT is known to physically
associate with and influence the activity of other cellular proteins
known to be involved in proliferative signal transduction. In
particular, PyV MT can associate with the 85-kDa regulatory subunit of
the phosphaditylinositol 3' (PI-3') kinase, resulting in its enzymatic
activation (11, 54). The association of PI-3' kinase with
PyV MT is thought to occur through the binding of p85 Src homology 2 domains with specific tyrosine phosphorylation sites (tyrosine residues
315 and 322) located in PyV MT (11, 54). More recently,
specific complexes between the Shc adapter protein and PyV MT antigen
have been reported (5, 14). These protein complexes occur
through the binding of the Shc protein phosphotyrosine binding (PTB)
domain to the tyrosine-phosphorylated NPTY motif located in PyV
MT-coding sequences (MT residues 247 to 250). The importance of these
PyV MT protein complexes in cellular transformation is supported by the
observation that mutations that affect either tyrosine residue 250 or
315 and 322 in PyV MT-coding sequences interfere with binding of Shc or
PI-3' kinase, respectively, and result in a dramatic impairment of the
transforming potential of the PyV MT oncogene in vitro (31).
In addition to these PyV MT-associated proteins, stable complexes
between protein phosphatase 2A (regulatory), protein phosphatase 2C
(catalytic), phospholipase
C (PLC
), and 14-3-3 proteins have
also been observed (36, 37, 47, 52). However, the
significance of these associated proteins in PyV MT-mediated transformation is not known.
Previous studies with PyV MT mutants defective in their capacity to
couple with either the Shc or PI-3' kinase have indicated that
recruitment of both of these signaling proteins is required for
efficient transformation of established fibroblasts in vitro (31). Association of Shc with PyV MT results in tyrosine
phosphorylation of Shc at tyrosine residues 239, 240, and 317, which in
turn allows Shc to couple to a number of downstream signaling molecules
(18, 50). In particular, tyrosine phosphorylation of Shc on
tyrosine 317 leads to the recruitment of the Grb-2-SOS-Ras complex
(42). Indeed, it has been demonstrated that activation of
Ras is required for PyV MT-mediated transformation (22).
Although tyrosine phosphorylation of Shc on tyrosines 239 and 240 also
results in the recruitment of Grb-2, it has also been implicated in
binding several other distinct tyrosine-phosphorylated proteins
(50). In this regard, it has recently been reported that
phosphorylation of Shc on tyrosines 239 and 240 may be involved in
activating an antiapoptotic pathway acting independently of the Ras
signaling pathway (18). However, the identities of these
Shc-associated tyrosine-phosphorylated proteins are unclear
(50).
Whereas binding of PyV MT to the Shc adapter protein leads to
activation of the Ras signaling pathway, the interaction of PyV MT with
the PI-3' kinase through PyV MT tyrosine residues 315 and 322 results
in stimulation of PI-3' kinase activity, leading to the generation of
3'-phosphinositide lipid second messengers (11, 54).
Moreover, activation of the PI-3' kinase by PyV MT appears to be
critical for tumorigenesis, since viral mutants lacking the MT PI-3'
kinase binding site are severely debilitated in their capacity to
induce tumors in animals (16, 49). Recent studies have
demonstrated that these phosphoinositide lipids lead to specific
activation of Akt and S6 serine kinases, which may provide an important
cell survival signal (13, 23, 26, 29). In addition, there is
also evidence to suggest that activation of the PI-3' kinase may lead
to downstream activation of the Rac GTP binding protein
(41). Therefore, activation of the PI-3' kinase by PyV MT
ultimately may influence cellular transformation by affecting both
actin cystoskeleton and cell survival pathways (23, 24, 29, 41,
55).
Given that the role of certain signaling pathways, such as the c-Src
pathway, is highly dependent on the tissue context (20, 25),
the function of the PI-3' kinase and Shc signaling molecules in PyV
MT-mediated mammary tumorigenesis remains to be elucidated. To
investigate the role of the PyV MT-coupled PI-3' kinase or Shc
signaling molecules in mammary tumorigenesis, transgenic mice carrying
mutant PyV MT antigens decoupled from either Shc or PI-3' kinase
signaling molecules under the transcriptional control of the mouse
mammary tumor virus (MMTV) long terminal repeat (LTR) were derived.
Mammary gland-specific expression of either mutant PyV MT cDNA resulted
in the induction of widespread mammary epithelial hyperplasias.
Interestingly, the mammary epithelial hyperplasias derived from the
mutant PyV MT defective in its ability to associate with the PI-3'
kinase are highly apoptotic. Although the initial phenotype exhibited
by both classes of transgenic mice was global mammary epithelial
hyperplasia, focal mammary tumors eventually arose in both PyV MT
mutant strains with 100% penetrance. In a subset of mammary tumors
arising in transgenic mice expressing the PyV MT Shc binding mutant,
tumorigenesis involves reversion of the defective Shc binding site in
the mutant PyV MT to its wild-type configuration. In contrast,
tumorigenesis in transgenic mice expressing the PyV MT mutant decoupled
from the PI-3' kinase did not occur through reversion of the introduced
mutations in the transgene. The progression of the mammary epithelial
hyperplasias to tumors was also frequently associated with upregulation
of both the ErbB-2 and ErbB-3 receptor tyrosine kinases, which also recruit the PI-3' kinase and Shc signaling pathways. Taken together, these observations suggest that activation of Shc and PI-3' kinase plays a critical role in mammary tumor progression by modulating both
cell proliferation and apoptosis.
 |
MATERIALS AND METHODS |
DNA constructions.
To construct the MMTV/MT-Y315/22F mutant,
PyV MT cDNA derived from plasmid pMMTV/MT was subcloned into the
HindIII and EcoRI sites of Bluescript KS and
subjected to standard M13 mutagenesis with oligonucleotides AB1712
(TTGGCATGAACTCCTCC) and AB1713 (TGTCCAAAAACAGATCC), resulting in conversion of wild-type MT tyrosine residues 315 and
322 to phenylalanine residues. The mutant sequences were confirmed by
automated DNA sequence analyses. The mutant cDNA was subsequently cloned directionally into the HindIII-EcoRI
sites of the MMTV expression vector (19).
To construct the pMMTV/MT-Y250F mutant, oligonucleotides AB3705
(CCAGCGGTTCTGCAGAATGCC), AB3706 (TCATAACAGAAAAGGTCGGG),
AB3595 (GCCTAAGACTGCCGAGTCTTCTGAGCAACCCGACCTTTTCTGTTATG),
and AB3596 (ATGAGCCCTCTGCAAATCCCGAAGAATCAGACCCTCCCATGG)
were employed in a PCR-based strategy to generate a
tyrosine-to-phenylalanine residue substitution at amino acid residue
250 of the PyV MT sequence. Briefly, matched sets of oligonucleotides
harboring the necessary nucleotide changes were used to amplify
sequences upstream (AB3705-AB3706) and downstream (AB3595-AB3596) of
the target mutation site. These PCR products overlap and were
subsequently PCR amplified with oligonucleotides AB3705 and AB3596 to
generate a PCR product bearing the desired mutation. Automated DNA
sequence analyses confirmed the presence of the nucleotide substitution
allowing for the coding of a phenylalanine residue at MT site 250. Moloney murine leukemia virus (Mo-MuLV)-based MT and MT mutant
expression cassettes were generated by subcloning the desired MT cDNA
from the MMTV-derived plasmids via unique HindIII and
EcoRI sites into the corresponding site of Mo-MuLV-based
expression cassette pJ4-
(a gift from B. Rowley).
The PyV MT antigen and PGK-1 ribonucleotide protection probe
(riboprobe) pSP65mT (MTR) were generous gifts from M. Rudnicki and J. Hassell (19). The MTsn301 riboprobe used to distinguish between MT mutants MT-Y315/22F and MT-Y250F contains a 513-nucleotide fragment (bounded by nucleotides 727 to 1240) in the SphI
and NcoI sites of plasmid vector pSL301 (Promega). The
simian virus 40 (SV40) polyadenylation-specific riboprobe (SPA)
contains the SV40 polyadenylation signals (SV40 nucleotides 2536 to
2773 and 4103 to 4713) in the BamHI and
HindIII sites of Bluescript KS (Stratagene). After
cleavage of MTR and SPA with HindIII, PGK-1 with
EcoNI, and MTsn301 with XbaI, the antisense
riboprobes was generated in vitro as described previously
(34). All oligonucleotide syntheses and automated DNA
sequencing were performed by Dinsdale Gooden and Brian Allore of the
MOBIX Main Central Facility, McMaster University.
Generation and identification of transgenic mice.
DNA was
prepared for microinjection by digestion with 4 U of SalI
and SpeI per µg for 1.5 h. The DNA was
electrophoresed through a 1% agarose gel and purified as described
previously (43). Superovoluated FVB/N female mice (Taconic
Farms, Germantown, Pa.) were mated with FVB/N males the night before
injection. After isolation of the fertilized one-cell mouse embryos,
the pronuclei of these zygotes were injected with 0.5 to 1 pl of DNA
solution (5 µg/ml). Following microinjection, viable eggs were
transferred to the oviducts of pseudopregnant Swiss-Webster mice
(Taconic Farms).
To identify transgenic progeny, genomic DNA was extracted from 1.5-cm
tail clippings as described by Muller et al. (34). The
nucleic acid pellet was resuspended in 100 µl of distilled water at
approximately 1 µg/ml, and 15 µl of the DNA solution was digested
with 30 U of BamHI for 1.5 h. Following gel
electrophoresis and Southern blot transfer (45) to
GeneScreen filters (Dupont), the filters were hybridized with transgene
radiolabeled with [
-32P]dCTP (Dupont) by random
priming. Radiolabeled probes derived from the PyV MT cDNA were used to
identify both MMTV/MT transgenic strains.
RNA analysis.
RNA was isolated from various tissues by using
the guanidium isothiocyanate modification of CsCl gradient
sedimentation described by Chirgwin et al. (10). Tissue was
flash frozen in liquid nitrogen and stored at
80°C or immediately
homogenized in 3 ml of guanidine isothiocyanate (GIT) (Bethesda
Research Laboratories) solution (4 M GIT, 25 mM sodium citrate, and 0.1 M
-mercaptoethanol). The homogenate was layered onto 4 ml of 5.7 M
CsCl containing 25 mM sodium acetate (pH 5.2), and RNA was pelleted by
ultracentrifugation at 32,000 rpm and 20°C with an SW41Ti rotor
(Beckman) for 24 h. GIT and CsCl layers were aspirated off, and
the RNA pellet was resuspended in 500 µl of sterile water plus 300 mM
sodium acetate (pH 5.2) and precipitated with 2 volumes of ice-cold
ethanol. The RNA yield was determined by UV absorption at 260 nm (1 optical density unit = 40 mg of RNA per ml).
RNase protection assays were performed as described by Melton et al.
(33), using 20 µg of total cellular RNA per tissue (except
where noted) incubated with 1 ml of hybridization buffer [80%
formamide, 40 mM
piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.4), 1 mM EDTA (pH 8.0), and 400 mM NaCl] at 85°C for 5 min. The hybridization reaction mixture was then allowed to anneal for
at least 8 h at 50°C and subjected to RNase digestion as
described previously (34). To detect pyrimidine mismatches or deletions, the hybridization reaction mixtures were digested with
120 mg of RNase A per ml in the absence of RNase T1 for 30 min at 37°C. Digests were terminated by addition of 20 to 30 µg of
RNase-free tRNA and 500 µl of phenol-chloroform (1:1) followed by
ethanol precipitation. RNA pellets were dried for 10 min under vacuum,
resuspended in 10 µl of formamide loading buffer (80% formamide, 10 mM EDTA [pH 8.0], 1 mg of xylene cyanol FF per ml, 1 mg of
bromophenol blue per ml) boiled for 7 min at 95°C, and resolved in a
6% urea-polyacrylamide gel (40% acrylamide-2%
N,N'-methylene-bisacrylamide, 7 M urea, 0.001%
ammonium persulfate, and 0.0005%
N,N,N',N'-tetramethylethylenediamine [TEMED]) electrophoresed at 60 to 80 A in 1× TBE running buffer (0.1 M Tris, 0.08 M boric acid, 0.002 M EDTA, pH 8.0). The gel was dried and
exposed at
70°C to Kodak XAR-5 film in the presence of intensifying
screens.
Antibodies.
Antibodies used include mouse monoclonal
antibody pAb762 and rat monoclonal antibody pAb701 for PyV MT (a
generous gift from S. Dilworth, ICRF London), rabbit polyclonal
antibody N16 (Transduction Laboratories), and mouse monoclonal antibody
7D10 (Quality Biotech) for Src. Also used in these studies were
antibodies specific for Shc (rabbit polyclonal and mouse monoclonal)
(Transduction Laboratories), the p85 subunit of PI-3' kinase (rabbit
polyclonal) (Transduction Laboratories), and PLC
1 (mouse monoclonal)
(Upstate Biotechnology Inc.). Antibodies specific for ErbB-2 and ErbB-3
were obtained from Oncogene Sciences (AB-3) and Santa Cruz
Biotechnology (C-17), respectively.
Protein extract preparation.
Tissue samples were flash
frozen in liquid nitrogen and ground to a fine powder with a chilled
mortar and pestle. Cells were lysed on ice for 30 min in TNE lysis
buffer (20 mM Tris [pH 8.0], 150 mM NaCl, 1% Nonidet P-40, 2.5 mM
EDTA, 1 mM sodium orthovanadate, 10 mM sodium fluoride, 10 µg of
aprotinin per ml, and 10 µg leupeptin per ml) with constant
agitation. Lysates were cleared by two consecutive centrifugations at
13,000 × g for 5 min each time. Supernatants were
removed, and their protein concentrations were determined with the
Bradford assay kit (Bio-Rad).
Immunoblot analyses.
Unless otherwise specified, a total of
100 µg of total protein lysate was used for each sample analyzed. An
equal volume of 2× protein sample loading buffer (62.5 mM Tris [pH
6.8], 2% sodium dodecyl sulfate, 10% glycerol, 5%
-mercaptoethanol, 0.02% bromophenol blue) was added, and mixtures
were boiled for 10 min at 95°C. Proteins were resolved in sodium
dodecyl sulfate-polyacrylamide gels and transferred electrophoretically
onto polyvinylidine difluoride membranes (Immobilon-P; Millipore).
Membranes were incubated overnight in 3% powdered skim milk in TBS (20 mM Tris [pH 7.5], 150 mM NaCl, 5 mM KCl) or 3% bovine serum albumin
(Sigma) in TBS for antiphosphotyrosine immunoblots. Membranes were
subsequently incubated for 2 h at room temperature with antibodies
(1:1,000 for all monoclonal antibody preparations and 1:250 for all
polyclonal antibody preparations). After being washed four times (10 min each time) in TBS plus 0.01% Tween 20, membranes were incubated
for 1 h at room temperature with the appropriate secondary
antibody conjugated to horseradish peroxidase (Biocan Scientific) at
1:2,500. The membranes were washed four more times in TBS plus 0.01%
Tween 20, and proteins were detected by using the enhanced
chemiluminescence detection system (ECL; Amersham).
Immunoprecipitations.
Immunoprecipitations were performed by
preincubating antigen-specific antibody (1 to 2 µg for monoclonal; 5 to 10 µg for polyclonal) with 30 to 40 µl of protein G-Sepharose
Fast Flow (Pharmacia) in 800 µl of 1× phosphate-buffered saline (140 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM
KH2PO4) for 2 to 12 h at 4°C on a rotating platform. Antibody-bound beads were washed once with 1 ml of
phosphate-buffered saline and once with 1 ml of lysis buffer. Total
protein lysate (500 µg to 1 mg) was added to a total volume of 700 µl and incubated with the prebound beads for 1 to 5 h at 4°C
on a rotating platform. The beads were subsequently washed five times
in lysis buffer, following which bound antigen could be analyzed.
Histological evaluation and in situ apoptosis assays.
Complete autopsies were performed, and both gross and microscopic
examinations were done. Five mice from each time point (4, 8, 12, and
16 weeks) from transgenic strains MMTV/MT, MMTV/MT-Y250F, and
MMTV/MT-Y315/22F and nontransgenic strain FVB/N were analyzed. Upper
left mammary fat pad tissues were fixed in 4% paraformaldehyde, blocked in paraffin, sectioned at 5 µm, stained with hematoxylin and
eosin, and examined. Whole-mount preparations were prepared with the
upper right mammary fat pad as described by Vonderhaar and Greco
(51). Briefly, resected tissue was spread out on glass slides and allowed to air dry overnight. After drying, the mammary glands were fixed by overnight incubation in acetone. The glands were
then squeezed between glass slides and placed in fresh acetone the next
morning. Harris modified hematoxylin was added for overnight staining
of the glands. Destain solution (1% concentrated HCl in 75% ethanol)
was added and discarded until the epithelial component of the mammary
gland was seen in sharp contrast to the light background of the fat
pad. The stain was fixed with a 30-s wash in 0.002% ammonium
hydroxide. Slides were then transferred to 75% ethanol for 5 min and
then to 100% ethanol for 3 h. Glands were cleared overnight in
xylenes and mounted in Permount. In situ apoptosis assays were
performed with the Apopttag In Situ Apoptosis Detection Kit (Oncor) as
described previously (17). Analyses of apoptotic cell death
in the 1A2 PyV MT-expressing mammary tumor cell line (1) was
performed 72 h after exposure of the cells to either control
adenoviral beta-galactosidase or Cre expression vectors (multiplicity
of infection [MOI], 100).
 |
RESULTS |
Isolation and characterization of transgenic mice expressing PyV MT
mutants defective in their ability to associate with either the PI-3'
kinase or Shc adapter molecule.
Although previous studies
suggested that the association of either PI-3' kinase or Shc proteins
with PyV MT was crucial in inducing cellular transformation in
established fibroblasts (31), the role of these signaling
molecules in PyV MT-mediated mammary tumorigenesis is unclear. To
assess the relative contributions of these signaling molecules to
tumorigenesis effected by PyV MT, transgenic mice expressing a mutant
lacking either the Shc binding site (MT-Y250F) or the PI-3' kinase
binding sites (MT-Y315/322F) in the mammary epithelium were generated.
To accomplish this, the MT-Y315/322F and MT-Y250F mutant MT cDNAs were
placed under the transcriptional control of the MMTV promoter-enhancer
(Fig. 1A and C) and microinjected into
one-cell mouse zygotes. This resulted in the generation of seven
MT-Y315/322F transgenic and eight MT-Y250F transgenic founder animals.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Tissue specificity of transgene expression in
MMTV/MT-Y250F transgenic mice. (A and C) Structures of the
MMTV/MT-Y315/322F (A) and MMTV/MT-Y250F (C) transgenes. The Bluescript
vector backbone is represented by a thin line on either side of the
expression cassette, with the cross-hatched region corresponding to the
MMTV LTR derived from plasmid pA9, the stippled portion corresponding
to the MT-Y250F cDNA with phenylalanine substitutions at amino acids
positions 315 and 322 or amino acid position 250, and the solid region
corresponding to the transcriptional processing sequences derived from
the SV40 early transcription unit. The transcription start site is
indicated by the arrow. (B and D) RNA transcripts corresponding to the
MMTV/MT-Y315/322F (B) and MMTV/MT-Y250F (D) transgenes in various
organs of the MT-Y315/322F transgenic strain as assessed by RNase
protection. Tissues were derived from a virgin tumor-bearing female, a
virgin female, and a male. The antisense probe used in this RNase
protection analysis (MTR) is complementary to a 203-nucleotide fragment
corresponding to the amino terminus of PyV MT and is marked by
MT-315/322F and an arrow. Also shown is an RNase protection analysis
with identical RNA samples and an antisense probe directed against PGK,
which protects a 124-nucleotide fragment indicated by PGK and an arrow.
M.Gl., mammary gland.
|
|
To examine expression of the transgene in these strains, 20 µg of
total cellular RNA was isolated from a variety of tissues and analyzed
by RNase protection assays with an antisense riboprobe spanning the
first 203 nucleotides of the PyV early region (19). Results
from these analyses are summarized in Table
1 for MT-Y250F strains and in Table
2 for MT-Y315/322F strains. Results of
representative RNase protection assays from the best-characterized
lines from MT-Y315/322F (Db-5) and MT-Y250F (250-5) are shown in Fig.
1B and D, respectively. Consistent with previous studies with
MMTV-driven transgenes (6), the highest levels of transgene
transcript were detected in the mammary glands or mammary tumors (Fig.
1B, lanes 10 and 16, respectively, and Fig. 1D, lanes 1 and 15, respectively). However, lower levels of transgene expression could be
detected in the salivary glands and male reproductive organs,
particularly the epididymis and seminal vesicles (Fig. 1D, lanes 11, 12, and 14, for MT-Y250F strain 5a; Table 2 for MT-Y315/22 strain
Db-5).
Female transgenic mice expressing elevated levels of either mutant PyV
MT transgene (MT-Y250F or MT-Y315/322F) in the mammary epithelium were
incapable of nursing their young. To examine whether this lactation
defect was due to aberrant epithelial development, whole-mount analyses
was conducted on 12-week-old virgin mammary fat pads derived from
FVB/N, MMTV/MT-Y315/322F, and MMTV/MT-Y250F strains (Fig.
2). In contrast to the multifocal mammary
tumors arising in the MMTV/wild-type MT strains (19),
mammary gland expression of either the MT-Y315/322F or MT-Y250F
transgene in 12-week-old virgin animals resulted in the global
induction of mammary epithelial hyperplasias (Fig. 2). However, the
mammary epithelial hyperplasias present in the MT-Y315/322F strains
differed in several aspects from those exhibited by the MT-Y250F
strains. For example, the MT-Y250F strains had well-defined alveolar
hyperplasias, which resembled those exhibited by MMTV/transforming
growth factor
strains (Fig. 2C and D) (32). In contrast,
the mammary epithelial hyperplasias in the MT-Y315/322F strains were
extremely cystic and dilated without defined alveolar structures (Fig.
2E and F).

View larger version (163K):
[in this window]
[in a new window]
|
FIG. 2.
Histological analyses of mammary glands from FVB/N,
MMTV/MT-Y250F, and MMTV/MT-Y315/22F transgenic animals.
Photomicrographs comparing the histological (A, C, and E)
(magnification, ×100) and whole-mount (B, D, and F) (magnification,
×10) appearances of virgin female FVB (A and B), MTY250F (C and D),
and MT-Y315/322F (E and F) mice 12 weeks after birth are shown. Note
that the mammary tree from the MT-Y250F mouse (C and D) has extensive
formation of side buds along the major ducts. The MT-Y315/322F mammary
tree has fewer side buds and a more dilated ductal system (E and F)
with multilayered epithelium (hyperplasia) (E) and the formation of
solid nests of dysplastic cells (F, arrow).
|
|
Mammary epithelial hyperplasias induced by the mutant PyV
MT-Y315/322F transgene are highly apoptotic.
One unusual
histological feature of the mammary epithelial hyperplasias derived
from the MT-Y315/322F strains was the distended ductal development,
which histologically exhibited features of apoptotic cell death. To
test whether decoupling of the PI-3' kinase from the mutant PyV MT
resulted in increased rates of apoptosis, histological samples from
age-matched 8-week-old transgenic animals were subjected to an in situ
apoptosis assay, which scores for cells displaying extensive DNA
fragmentation, a characteristic of cells undergoing apoptotic
cell death (TUNEL [terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling] assay) (17, 48). The results of these analyses revealed that mammary epithelial hyperplasias expressing the mutant PyV MT-Y315/322F protein displayed extensive apoptotic cell death (Fig. 3A). In
contrast, comparable age-matched mammary epithelial samples from either
normal FVB/N, PyV MT-Y250F, or wild-type MT tissues failed to exhibit
significant levels of apoptotic cell death (Fig. 3). Consistent with
these analyses, similar elevated rates of apoptotic cell death were
noted in mammary samples derived from another independently derived
transgenic strain expressing the MT-Y315/322F mutant transgene
(53a).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 3.
Activation of the PI-3' kinase by PyV MT is involved in
mammary tumor progression. (A) A panel of slide-mounted Mayer's
hematoxylin-stained mammary tissue sections from age-matched mice from
nontransgenic FVB/N or transgenic MMTV-Y250F, MMTV/MT-Y315/322F, and
wild-type MT strains. Cells were analyzed for apoptotic cell death as
described previously (46). Digoxigenin-labeled DNA ends were
detected with horseradish peroxidase-conjugated antidigoxigenin
antibodies. Note the multiple apoptotic cells in the epithelial
hyperplasias derived from the MT-Y315/322F strain and lack of
comparable staining in mammary tissues from FVB/N, MT-Y250F, and
wild-type MT mice. (B) Structure of Cre-inducible expression cassette
carrying the dominant negative p85 inhibitor. The dark shaded box
indicates the Mo-MuLV LTR; the arrows flanking the PGK-Neo cassette
represent the LOX recombination sites. The unshaded box indicates the
cDNA encoding the mutant p85 subunit of the PI-3' kinase. (C) In situ
apoptosis analyses (TUNEL) conducted with PyV MT mammary tumor cells
infected with either a control adenovirus expressing a
beta-galactosidase reporter (MT-LacZ) or an adenovirus vector
expressing the Cre recombinase (MT-Cre). TUNEL analyses with PyV MT
tumor cells possessing the inducible dominant negative p85 inhibitor
infected with either the LacZ (MT 85nl-LacZ) or Cre adenovirus
(MT 85nl-Cre) are also shown. Both sets of cells were infected at an
MOI of 100. Note the presence of numerous cells undergoing apoptotic
cell death in the Cre infection panel.
|
|
To further test the importance of the PI-3' kinase signaling pathway in
modulating apoptotic cell death, we derived several independent cell
lines that inducibly express a dominant negative inhibitor of the PI-3'
kinase in an established mammary tumor cell line expressing the
wild-type PyV MT antigen (1). The basis for the dominant
negative action of the mutant PI-3' kinase derives from a specific
mutation in the Src homology 2-bearing p85 subunit, which prevents its
association with the 110-kDa catalytic subunit. As a consequence of
this mutation, the dominant negative inhibitor can occupy its binding
site but is catalytically inert (28). Because stable
expression of the p85 dominant negative mutant may not be compatible
with cell viability, we isolated an inducible expression cassette in
which the expression of the dominant negative inhibitor p85 can be
activated by the Cre recombinase (Fig. 3B). The basis for the inducible
nature of this mutant p85 derives from the presence of a
phosphoglycerate kinase (PGK) promoter-neomycin expression
transcription unit between the Mo-MuLV promoter and the p85-coding
sequences. Because of the strong polyadenylation termination sequence
in the PGK-Neo cassette upstream of the p85-coding sequence,
transcription through p85-coding sequences will be substantially reduced. However, due to the presence of LOX recombination sites flanking the PGK-Neo cassette, this interfering sequence can be excised
by transiently expressing Cre recombinase, leading to the expression of
the dominant p85 inhibitor (Fig. 3B) (53a).
To test whether elevated expression of the p85 dominant negative
inhibitor in these mammary tumor cells could induce apoptotic cell
death, we derived several independent PyV MT mammary tumor cell lines
that carried the inducible p85 dominant negative mutant. To induce
expression of this dominant negative mutant, p85 dominant negative
mutant-carrying cell lines were infected with either an adenovirus-Cre
or control adenovirus-beta-galactosidase expression vector at an MOI
of 100 (2) and subjected to TUNEL analyses. These
experiments revealed that transient expression of Cre in the
p85-carrying cells resulted in the extensive induction of apoptotic
cell death (Fig. 3C, MT-
85nl-Cre). In contrast, transfection of the
control adenovirus-LacZ expression vector failed to induce significant
apoptosis in these cell lines (Fig. 3C, MT-
85nl-LacZ). In addition,
adenoviral expression of either Cre recombinase or LacZ in the parental
MT cells failed to induce a comparable apoptotic response (Fig. 3C,
MT-LacZ and MT-Cre). Transient transfection of the Cre expression
plasmid resulted in similar induction of apoptotic cell death, albeit
at lower levels, which directly correlated with lower transfection
efficiencies (53a). Thus, abrogation of the PI-3' kinase
signaling pathway in PyV MT-transformed mammary tumor cells results in
the induction of apoptotic cell death. Taken together with the TUNEL
analyses with the MT-Y315/322F transgenic strains, these data suggest
that activation of the PI-3' kinase by PyV MT may be required to
prevent apoptotic cell death during mammary tumor progression.
Biochemical characterization of mammary tumors expressing the
mutant PyV MT antigens.
Transgenic mice expressing the wild-type
PyV MT rapidly develop multifocal mammary tumors without evidence of a
hyperplastic precursor lesion (median age at which tumors were palpable
[T50] = 53 days [Fig.
4]) (19). In contrast,
transgenic mice expressing either of the mutant PyV MTs developed
extensive mammary epithelial hyperplasias. However, both of these
strains eventually developed mammary tumors with 100% penetrance (Fig.
4). Indeed, whole-mount analyses of the mammary glands derived from
12-week virgin animals revealed the presence of focal dysplastic
lesions in the MT-Y315/322F strains arising next to the mammary
epithelial tissues (Fig. 2F). Comparison of the onset of palpable
tumors for wild-type MT relative to those for the mutants (Fig. 4)
revealed that there was a significant delay in the ability of both MT
mutants to induce tumors in vivo. The MT-Y250F-bearing mice
demonstrated the longest delay in tumor formation, with a
T50 of 145 days, whereas the MT-Y315/22F strain developed mammary tumors at a slightly earlier age
(T50 = 123 days). In addition, the tumors that
arose in these strains were focal in origin, in contrast to the global
multifocal phenotype displayed by the strains expressing wild-type PyV
MT (19). Histological examination of these tumors revealed
gross differences in both the cellular architecture and differentiation
status of the tumors (Fig. 4). Tumors derived from the
MMTV/MT-Y315/322F strains appeared to be less differentiated than
tumors expressing either wild-type PyV MT or MT-Y250F oncogenes (Fig.
4). The tumors derived from the MT-Y250F strains possessed a large
stromal component which resembled that of the primary tumors expressing
an activated c-src gene (Fig. 4B) (53),
suggesting the possibility that these tumor cells may be acting in a
paracrine manner to stimulate stromal cell proliferation.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 4.
Kinetics of mammary tumor occurrence and histopathology
of mammary tumors derived from MMTV/wild-type MT, MMTV/MT-Y250F, and
MMTV/MT-Y315/22F transgenic animals. (A to D) Photomicrographs
comparing the histology of invasive malignancies from a wild-type PyV
MT (A), an MT-Y250F tumor (B), and an MT-Y315/322F tumor (D)
(magnification, ×250) with that of a noninvasive dysplasia (C)
(magnification, ×100). The preinvasive MT-Y315/322F dysplastic nodule
(C) is found at the end of dialated ducts but is a more extreme form of
the hyperplasia observed in Fig. 2E and represents the solid nest in
Fig. 2F. (E) Age at which a mammary tumor is first palpable in each
transgenic strain. Also shown are the number of animals analyzed for
each strain (n) and the median age at which tumors are palpable
(T50).
|
|
Because association of PyV MT with Src family members is critical in
effecting transformation (20), it was important to assess
whether either PyV MT mutant was impaired in its associated kinase
activity. To this end, tumor extracts from both wild-type MT and MT
mutants were immunoprecipitated with PyV MT-specific antisera, and in
vitro kinase activity was assessed by utilizing acid-denatured enolase
as an exogenous substrate (Fig. 5A).
Although the levels of PyV MT protein differed between tumors (as
measured by 125I immunoblot analysis), careful
quantitation of the data indicated that associated kinase activities of
the mutant PyV MT proteins were comparable to that of wild-type MT
(Fig. 5B). Taken together, these observations strongly argue that the
delayed tumorigenesis observed in both mutant PyV MT transgenic strains
was not a consequence of the inability to complex and functionally
activate c-Src tyrosine kinase family members.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
PyV MT-associated in vitro kinase activities in mammary
tumors of the various PyV MT mutants. (A) PyV MT-associated tyrosine
kinase activity in tumors induced in the MT-Y315/322F, MT-Y250F, and
wild-type MT strains. Mammary tumor lysates derived from MT-Y315/322F,
MT-Y250F, wild-type MT, and control MMTV/Neu (N202) (20)
strains were subjected to immunoprecipitation with PyV MT-specific
antisera and incubated with -32P-labeled ATP in the
presence of exogenous enolase substrate. (B) Phosphorimager
quantitation of enolase phosphorylation, is normalized to the levels of
PyV MT protein. (C) PyV MT-associated PI-3' kinase activity in tumors
induced in the MT-Y315/322F, MT-Y250F, and wild-type MT strains.
Mammary tumor lysates derived from MT-Y315/322F, MT-Y250F, wild-type
MT, and control MMTV/Neu (N202) strains (21) were subjected
immunoprecipitation with PyV MT-specific antisera and incubated with
-32P-labeled ATP in the presence of exogenous PI lipid.
(D) Phosphorimager quantitation of the phosphorylated PI-3' lipid,
normalized to the levels of PyV MT protein.
|
|
In addition to activation of the Src family tyrosine kinases by PyV MT,
the activity of PI-3' kinase is dramatically elevated following
formation of specific complexes of the PI-3' kinase with PyV MT
(11, 54). To ascertain whether the various mutant MT
antigens expressed in the mammary tumors were still capable of
activating the PI-3' kinase, tumor extracts were subjected to
immunoprecipitation analyses with PyV MT-specific antisera. The
immunoprecipitates were then incubated in vitro with PI lipid and
[
-32P]ATP, and the phosphorylated lipid products were
subjected to thin-layer chromatography (Fig. 5C). After normalization
for the levels of PyV MT protein in the tumor lysates, quantitative
analyses revealed that the levels of PyV MT-associated PI-3' kinase
activity were severely impaired in tumor lysates derived from the
MT-Y315/322F strains compared to tumor lysates derived from the
wild-type MT strains (Fig. 5D). Interestingly, the level of PI-3'
MT-associated kinase activity observed in the MT-Y250F-derived tumors
was also reduced, albeit only twofold.
To ascertain whether the levels of PyV MT PI-3' kinase-associated
activities correlated with the capacity of PyV MT to associate with the
85-kDa subunit of the PI-3' kinase, tumor extracts were subjected to
reciprocal immunoprecipitation-immunoblot analyses with PyV MT-specific
antisera and antibodies specific to the PI-3' kinase p85 regulatory
subunit (Fig. 6B). The results of these analyses revealed that the 85-kDa PI-3' kinase subunit could be detected in PyV MT immunoprecipitates of extracts of the MT-Y250F- and
wild-type MT-derived tumor tissues (Fig. 6B, lanes 2 to 6, 9, and 10).
In contrast, the mutant PyV MT derived from the MT-Y315/322F tumor
lysates bound the mutant PyV MT antigen poorly (Fig. 6B, lanes 7 and
8). The observed differences in p85 binding between the various mutant
PyV MTs were not due to differences in the levels of PyV MT, because
immunoblot analyses revealed comparable levels of PyV MT protein in the
samples (Fig. 6C). Interestingly, these analyses revealed that two of
the MT-Y250F tumor samples were expressing a PyV MT protein that
migrated with faster mobility than wild-type MT protein (Fig. 6C, lanes
5 and 6). Taken together, these observations suggest that the defect in
MT-associated PI-3' kinase activity observed in the MT-Y315/322F tumors
is due to the inability of this mutant to bind the 85-kDa subunit of
the PI-3' kinase.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
Binding properties of Shc and the p85 subunit of the
PI-3' kinase with the various mutant PyV MTs expressed in mammary
tumors. (A) Shc immunoblot analysis of MT-specific immunoprecipitates
(IP) isolated from MT-Y250F (lanes 2 to 4), reverted MT-Y250F (dl MT)
(lanes 5 and 6), MT-Y315/22F (lanes 7 and 8), and wild-type MT (lanes 9 and 10) mammary tumors. As a nonspecific control, a protein lysate
derived from an MMTV/Neu mammary tumor (lane 1) was also included. The
MT-associated 52-kDa Shc protein is indicated by the arrow. (B) The
same PyV MT immunoprecipitates were subjected to p85 immunoblot
analyses. As a nonspecific control, a protein lysate from an MMTV/Neu
tumor (lane 1) was also included (18). The p85 kDa subunit
of the PI-3' kinase is indicated by the arrow. (C) PyV MT immunoblot
analysis of MT-specific immunoprecipitates isolated from the same sets
of mammary tumor samples. As a nonspecific control, mammary tumor
protein lysate derived from an MMTV/Neu tumor was included. Indicated
by the arrows are the wild-type 56-kDa PyV MT and deleted MT (dlMT)
mutant proteins.
|
|
Tyrosine phosphorylation of MT residue 250 creates a high-affinity
binding site for the PTB domain of Shc (38). To determine whether Shc binding was affected in the tumors induced by the MT-Y250F
transgene, immunoprecipitation-immunoblot analyses with either PyV MT
or Shc-specific antisera were conducted on tumor lysates derived from
both mutant and wild-type MT strains. As expected, complexes of Shc and
PyV MT were detected in tumor lysates derived from either the mutant
MT-Y315/322F or wild-type MT lysates (Fig. 6A, lanes 7 to 10). However,
no detectable complexes between PyV MT and Shc were observed in the
tumor lysates from three MT-Y250F lysates (Fig. 6A, lanes 2 to 4).
However, coimmunoprecipitation analyses of two other MT-Y250F tumor
samples that expressed the altered PyV MT (Fig. 6C, lanes 5 and 6)
revealed PyV MT-associated Shc (Fig. 6A, lanes 5 and 6). Reprobing of
the same blot with MT-specific antibody pAB701 revealed that the
differences in Shc binding between these samples could not be due to
differences in the levels of PyV MT (Fig. 6C). These observations argue
that in certain cases the mutant PyV MT-Y250F protein has reacquired the capacity to associate with Shc, perhaps through the occurrence of
somatic mutations in PyV MT-coding sequences.
Tumor progression in the MT-Y250F strains involves the
reacquisition of a functional Shc binding site.
Our biochemical
and genetic analyses of tumors derived from the MT-Y250F strains
revealed that the PyV MTs of certain tumors were capable of binding to
Shc (Fig. 6A, lanes 5 and 6), seemingly as a result of a deletion
occurring in PyV MT-coding sequences (Fig. 6C, lanes 5 and 6). Because
somatic mutation and consequent reversion of the transgene could
potentially account for the ability of PyV MT to bind to Shc, we
designed a method with which to screen large numbers of mammary tumors
and derived lung metastases for potential reversion of the mutant PyV
MT cDNAs. To accomplish this, an RNase protection probe corresponding
to this region of wild-type PyV MT-coding sequences was created, and
RNase protection conditions were modified so as to allow the detection
of single-base-pair mismatches or deletions (see Materials and
Methods). Due to the stringent RNase digestion conditions used in these
assays, multiple protected fragments (Fig.
7A, MT-Y250F) were observed, rather than
just the two expected protected fragments corresponding to the cleavage
at the single-nucleotide mismatch at the phenylalanine substitution at
tyrosine residue 250. As shown in Fig. 7A, these RNase protection
analyses revealed that two of the seven primary MT-Y250F mammary tumors
exhibited a pattern of protected fragments that differed from the other
MT-Y250F tumor samples (lanes 5 and 7). One set of protected fragments
migrated at a position expected for wild-type MT (Fig. 7A, lane 7)
whereas the other sets of protected fragments were consistent with the
occurrence of a deletion in MT-Y250F-coding sequences (Fig. 7A, lane
5). Of the 57 primary tumor RNA samples analyzed by this approach, a
total of four samples exhibited RNase protection patterns corresponding
to either wild-type or deleted forms of PyV MT (Fig. 7B).
Interestingly, animals displaying these altered transcripts developed
extensive lung metastases which also gave protected species
characteristic of the primary tumors (Fig. 7A, lanes 8 and 11).
Analyses of further sets of metastatic mammary tumors from different
MT-Y250F animals demonstrated that an additional lung metastasis also
displayed an RNase-protected fragment characteristic of the wild-type
PyV MT transgene (Fig. 7A, lane 10). Using a similar RNase protection
approach, we also tested whether a comparable number of MT-Y315/322F
tumors displayed any evidence for reversion. In contrast to the case
for the MT-Y250F samples, RNase protection analyses of the MT-Y315/322F
tumor RNA samples failed to exhibit evidence for reversion of the
mutant PI-3' kinase binding site (53a).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
Restoration of Shc binding in the MT-Y250F mutant can
occur through somatic mutations in the transgene during tumor
progression. (A) Stringent RNase protection analyses on RNA samples
derived from either primary mammary tumors (lanes 1 to 7) or lung
metastases (lanes 8 to 13) arising in the MT-Y250F strains. Thirty
micrograms of total RNA was hybridized with an antisense riboprobe
(MTsn301) spanning the wild-type MT Shc binding site. The arrows
indicate the expected protected bands for a wild-type MT (MT) or
MT-Y250F transcript. Also shown is expected cleavage occurring at
tyrosine residue 250. Note that the 1760 RNA sample (lane 5) displays
an RNase protection profile that is deleted relative to the expected
MT-Y250F pattern. (B) DNA sequence analyses of the transcripts detected
in the MT-Y250F samples. Sequence analysis of cloned RT-PCR products
from these tumors confirmed the presence of a phenylalanine residue
substitution at site 250 for RNA tumor samples exhibiting the expected
MT-Y250F RNase protection profile (lanes 1 to 4, 6, 9, 12, and 13 in
panel A). DNA sequence analyses of the tumor samples derived from tumor
samples displaying wild-type MT RNase protection profile (lanes 7, 10, and 11 in panel A) revealed the presence of a T-to-A mutation leading
to conversion of the phenylalanine to tyrosine. Sequence analyses of
the RT-PCR product derived from deleted transcript revealed the
presence of an 18-nucleotide in-frame deletion spanning the binding
site tyrosine residue (nucleotides 730 to 783). Also indicated are
critical amino acid residues implicated in Shc and 14-3-3 binding. Note
that the 18-nucleotide deletion restores the Shc binding consensus
NPXY. The relative incidence of either the point mutation (WT MT) or
the deletion (dlMT) is indicated in both primary tumors (BT) and lung
metstases (LUNG METS).
|
|
To investigate the precise structures of these altered transcripts, RNA
samples derived from these tissues were subjected to reverse
transcription-PCR (RT-PCR) with oligonucleotides flanking this region
of the PyV MT cDNA followed by direct DNA sequence analyses. The
results of these experiments revealed that the altered transcripts
encoded either a wild-type MT-coding sequence as a result of a single
nucleotide substitution or a deletion that removed the phenylalanine
residue at position 250 and five adjacent amino acids (Fig. 7B). The
union of DNA following the deletion creates a tyrosine residue
regenerating the Shc binding core sequence NPTY (Fig. 7B). A similar
analysis of metastatic tumors in arising in these strains revealed that
36% (n = 11) of these had acquired either one of these
reversions (Fig. 7B).
To further test the possibility that the MT deletion was responsible
for the induction of the mammary tumor metastases, the corresponding
deletion (dlMT) was engineered into a wild-type MT cDNA in mammalian
expression cassette J4-
, and its transforming activity was assessed
in Rat-1 fibroblasts. The results revealed that the dlMT mutant
displayed a transforming activity comparable to that of wild-type PyV
MT (93.4% ± 11.6% of that of wild-type MT). In contrast, neither of
the parental PyV MT mutants was able to efficiently transform Rat-1
cells (53a). These observations suggest that tumorigenesis
in the MT-Y250F strain in certain tumors involves the occurrence of
somatic mutations in the transgene that restore Shc binding.
Tumor progression in the mutant PyV MT strains involves the
coordinate upregulation of ErbB-2 and ErbB-3 growth factor receptor
tyrosine kinases.
Whereas reversion of the Shc binding site can
account for tumorigenesis in 7% of the primary tumors in the MT-Y250F
strains, the majority of the tumors that arise in either mutant PyV MT strain appear to retain the mutant transgene configuration. One possible explanation for these observations is that tumor progression in these strains involves the indirect recruitment of the PI-3' kinase
and Shc signaling pathways through activation of specific growth factor
receptors. For example, for both murine and human mammary tumors there
is compelling evidence to suggest that elevated expression of the
ErbB-2 and ErbB-3 members of the epidermal growth factor receptor
(EGFR) family are functionally involved in tumor induction
(6). Significantly, this heterodimer combination of EGFR
family members has been demonstrated to result in the recruitment and
activation of both the PI-3' kinase and Shc signaling molecules
(39, 44). To explore this possibility, we examined the
levels of ErbB-2 and ErbB-3 receptor tyrosine kinases in both hyperplasias and tumors from either the MT-Y315/322F or MT-Y250F strains with antibodies specific to either ErbB-2 or ErbB-3. As shown
in Fig. 8, comparison of the levels of
ErbB-2 and ErbB-3 in tumors derived from the MT-Y315/322F strain
revealed a dramatic upregulation in the levels of both ErbB-2 and
ErbB-3 proteins in three of the four tumors compared to those in
mammary epithelial hyperplasias (Fig. 8A, compare lanes 6 to 8 with
lanes 1 to 4). Analyses of a larger sample of tumors derived from these
strains (n = 10) revealed that 80% of the tumors
expressed elevated levels of both of these EGFR family members. The
differences in levels of expression of ErbB-2 and ErbB-3 between the
hyperplasias and the tumors could not be accounted for by differences
in transgene expression, since both hyperplasias and tumors expressed
equivalent amounts of PyV MT transcript (Fig. 1B, compare lanes 10 and
16; Fig. 1D, compare lanes 1 and 15). These observations suggest that the progression of the mammary epithelial hyperplasias to tumors in the
MT-Y315/322F strains is correlated with the upregulation of ErbB-2 and
ErbB-3 expression.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8.
Elevation of ErbB-2 and ErbB-3 expression during tumor
progression in the mutant PyV MT strains. (A) Immunoblot analyses of
mammary epithelial hyperplasias (HP) or breast tumors (BT) from the
MT-Y315/322F strain. One hundred micrograms of total protein lysate for
four different hyperplasias (2480, 7184, 8786, and 8789) and tumors
(7450, 7887, 8673, and 8064) was subjected to immunoblot analyses with
either ErbB-2- or ErbB-3-specific antibodies. (B) Immunoblot analyses
of mammary epithelial hyperplasias or breast tumors from the MT-Y250F
strain. Sixty micrograms of total protein lysate for four different
hyperplasias (8137, 8814, 8458, and 9086) or breast tumors (8809, 8566, 6879, and 9687) was subjected to immunoblot analyses with either ErbB-2
or ErbB-3.
|
|
To determine whether elevated expression of ErbB-2 and ErbB-3 could
also be detected in the tumors derived from the MT-Y250F strains,
protein extracts derived from either mammary epithelial hyperplasias or
mammary tumors were subjected to immunoblot analyses with either
ErbB-2- or ErbB-3-specific antisera (Fig. 8B). The tumors derived from
these sets of samples failed to display any evidence of reversion of
the mutant Shc binding site. The results of these analyses revealed
that like the MT-Y315/322F-derived tumors, the MT-Y250F-derived tumors
expressed elevated levels of both the ErbB-2 and ErbB-3 growth factor
receptors compared to those in hyperplastic mammary epithelium. Taken
together, these observations argue that upregulation of these growth
factor receptor signaling pathways plays an important role in tumor
progression in both of these mutant PyV MT transgenic strains.
 |
DISCUSSION |
The PyV MT oncogene provides an excellent model to allow
identification of the important signaling pathways involved in mammary tumorigenesis. Given the potent transforming activity of the PyV MT
oncogene in the mammary epithelia of transgenic mice (19, 20), we sought to exploit this system to elucidate the relative contributions of the PyV MT coupled signaling pathways in PyV MT-mediated mammary tumorigenesis. To elucidate the roles of Shc and
PI-3' kinase in PyV MT-mediated tumorigenesis, we have derived transgenic mice that express mutant PyV MT oncogenes defective in their
capacity to bind to these signaling proteins. Consistent with previous
studies of MMTV-driven transgenes, analyses of the tissue-specific
patterns of expression of both PyV mutant MT cDNAs revealed that the
primary site of expression was the mammary gland, with secondary sites
noted in the male reproductive tissues and salivary glands (Fig. 1 and
Tables 1 and 2). In both sets of transgenic strains, the initial
phenotype exhibited by female mice was the inability to lactate.
Whole-mount analyses of the mammary epithelia of virgin females from
either the MT-Y250F or MT-Y315/322F strains showed that they displayed
extensive epithelial hyperplasias that were histologically distinct
(Fig. 2).
The observation that the mammary epithelial hyperplasias derived from
the MT-Y315/322F strains exhibit elevated rates of apoptosis (Fig. 3A)
suggests that activation of PI-3' kinase plays a critical role in
promoting cell survival. Moreover, expression of a dominant negative
inhibitor of PI-3' kinase in mammary tumor cells expressing wild-type
PyV MT resulted in the rapid induction of programmed cell death (Fig.
3C). These observations are consistent with the emerging concept that
activation of the PI-3' kinase signaling pathway is involved in the
regulation of apoptosis in a number of different cell types. For
example, abrogation of growth factor-mediated activation of the PI-3'
kinase signaling pathway through administration of either specific
PI-3' kinase inhibitors or expression of mutant growth factor receptors
decoupled from the PI-3' kinase in a number cell types results in the
induction of apoptotic cell death (23, 55). More recently,
it has been demonstrated that activation of the PI-3' kinase blocks
c-Myc- or UVB-induced apoptosis in fibroblasts (23, 29). In
addition, recent studies demonstrate that activation of the Akt kinase,
which is immediately downstream of the PI-3' kinase (15),
can also prevent c-Myc-induced apoptosis (23, 29). Taken
together with our observations, these data suggest that activation of
the PI-3' kinase signaling pathway may be required to promote cell
survival.
Although the initial phenotypes observed with the PyV MT mutant strains
were mammary epithelial hyperplasias, females derived from several
independent strains developed mammary tumors with 100% penetrance.
However, in contrast to parental wild-type PyV MT strains, which
developed multifocal mammary tumors, the tumors in the mutant PyV MT
mutant strains were focal in origin, arising adjacent to hyperplastic
mammary tissue (Fig. 2 and 4). Moreover, the tumors arose with delayed
onset in comparison to the case for wild-type strains (Fig. 4).
Measurement of associated tyrosine kinase activity of mutant PyV MT
species isolated from mammary hyperplasias or tumors revealed that
association with and consequent activation of c-Src was unaffected
compared to that for wild-type PyV MT (Fig. 5). Thus, the increased
latency with which mammary tumors arise in both PyV MT mutant
transgenic strains is not due to an inability to complex with and
activate the Src family of tyrosine kinases. Although recent studies
have suggested that tyrosine 322 in PyV MT is also capable of binding
PLC
in certain cell types (47), we and others have failed
to detect evidence of comparable complexes of murine PyV MT and PLC
in tumors induced by the PyV MT oncogene (3, 53a). Although
we cannot formally preclude the potential involvement of other PTB
domain- or SH2-containing signaling molecules in these mutant PyV
phenotypes, the failure of PyV MT to bind the corresponding associated
cellular protein (i.e., Shc in MT-Y250F mice and PI-3' kinase in
MT-Y315/322F transgenic mice) is likely responsible for the delayed
onset of mammary tumors observed in these mutant PyV MT strains.
The data generated suggest that expression of the PyV MT mutants is not
sufficient for mammary tumorigenesis and requires additional genetic
events. In contrast to these observations, it has recently been
reported that inactivation of the Shc binding site does not interfere
with the ability of PyV to induce a variety of tumors in animals
(4). More recently, another independent group reported that
an Shc binding site PyV mutant displayed an altered tumor spectrum
(56). However, in both these reports the incidence of
mammary tumors was unaffected by the introduction of the Shc binding
site mutant. The difference between these observations and ours may be
due to the fact that in the other studies a functional PyV large T
antigen is also expressed (4, 56) and may compensate for
inability of PyV MT to associate with and activate Shc. Alternatively, unlike that of other tissues, transformation of the mammary epithelial cell may require activation of Shc. Indeed, it has been demonstrated that the requirement for Src in PyV MT-mediated tumorigenesis is highly
dependent on the tissue context (20, 25). Whatever the
explanation, our observations strongly suggest that activation of Shc
is required for PyV MT-mediated mammary tumorigenesis.
One important clue to the nature of these additional events derives
from observations that in 7% of the tumors arising in the MT-Y250F
strains, the mutant PyV MT had reacquired the capacity to bind Shc
through somatic mutations occurring in the transgene. DNA sequence
analyses of these alterations revealed that restoration of Shc binding
can occur either through simple point mutation at the substituted
phenylalanine codon or through an in-frame deletion of 18 bp occurring
immediately downstream of the phenylalanine codon (Fig. 7B). Another
interesting aspect of these reversions is that they occurred at a much
higher frequency in lung metastases (Fig. 7B). Indeed, of the 11 metastatic lesions examined, 36% possessed either reversion event,
suggesting that there is a selective pressure for restoration of Shc
binding during PyV MT-mediated metastatic progression. Because Shc can
recruit the Grb-2-Sos-Ras complex to PyV MT (14, 42, 50),
the selection for Shc binding during metastasis reflects an essential
role for activation of the Ras pathway during metastatic progression.
In this regard, we have recently demonstrated that ectopic expression
of Grb-2 in the mammary epithelium of the MT-Y250F strains can result
in dramatic acceleration of growth of mammary tumors (40).
Alternatively, the requirement for Shc binding may reflect its ability
to recruit other signaling pathways. Indeed, it has recently been
demonstrated that tyrosine phosphorylation of tyrosine residues 239 and
240 in Shc is involved in the generation of an antiapoptotic signal involving activation of the Myc transcription factor (17).
Determination of the prevalent signaling pathways involved in this
phenotype will provide important insight into the molecular basis of
metastatic progression.
In contrast to those from MT-Y250F transgenic animals, tumors derived
from the MT-Y315/322F strains failed to demonstrate reversion at either
tyrosine phosphorylation site in the transgene responsible for binding
the p85 subunit of the PI-3' kinase. It is conceivable that
tumorigenesis in these mutant strains requires recruitment of PI-3'
kinase but that this occurs in an indirect manner. Activation of growth
factor receptors in an autocrine or paracrine manner during tumor
progression in these strains could lead to the indirect recruitment of
the PI-3' kinase signaling pathway. In this regard, we have
demonstrated that the ErbB-3 and ErbB-2 EGFR family member which
specifically couples to the PI-3' kinase and Shc signaling pathways
(39, 44) is upregulated during the transition of mammary
epithelial hyperplasias to the tumor phenotype in both these mutant
strains (Fig. 8). Consistent with these observations, other studies
have demonstrated that recruitment of PI-3' kinase by activated growth
factors such as platelet-derived growth factor and insulin growth
factor-2 is required to provide a survival signal to prevent cells from
undergoing apoptosis (35, 55). However, the identification
of potential signaling pathways that may be involved in tumor
progression in these mutant MT strains awaits further investigation.
Activation of PI-3' kinase-coupled growth factor receptors during tumor
progression in these various transgenic strains may reflect the
requirement for the generation of an antiapoptotic signal (Fig. 3).
Indeed, in the insulin promoter-SV40 large T antigen transgenic mice
there is suppression of apoptotic cell death during tumor progression
(35). In addition to suppressing apoptotic cell death,
activation of the PI-3' kinase by PyV MT may influence other important
steps involved in tumor progression. In this regard, we and our
collaborators have recently demonstrated that mammary tumor cells
expressing the MT-Y315/322F mutant showed a marked decrease in the
induction of angiogenic blood supply that was further correlated with a
10-fold decrease in metastatic potential compared to that for a mammary
tumor cell line expressing wild-type PyV MT (9). Consistent
with these observations, we have found that only 36% of tumor-bearing
female animals carrying the mutant MT-Y315/322F develop metastatic
lesions (53a), whereas 100% of those carrying the parental
wild-type MT strains develop lung mestastases (19). More
recently, a transforming homolog of the PI-3' kinase has been
described, suggesting that activation of the PI-3' kinase can directly
result in the induction of tumors (7). Taken together, these
observations suggest that recruitment of the PI-3' kinase by PyV MT may
play multiple roles in tumor progression.
Given that activation of Ras appears to be a common component of
receptor tyrosine kinase signaling cascades, the observation that the
PyV MT mutant defective in its capacity to associate with Shc-Grb-2 is
also impaired in its ability to induce tumors suggests that direct
recruitment of the Ras pathway is critical for tumor progression.
Indeed, it has been demonstrated that PyV MT requires Ras function to
transform fibroblasts in vitro (22). However, despite the
defect in tumor induction, expression of the MT-Y250F mutant is still
capable of inducing extensive epithelial hyperplasias. It is
conceivable that the mitogenic response of mammary epithelial cells to
the PyV MT-Y250F mutant reflects its capacity to signal in a
Ras-independent fashion. Indeed, the Raf serine kinase can be activated
by c-Src through a Ras-independent mechanism (46).
Alternatively, the MT-Y250F mutant may stimulate cell proliferation by
indirectly activating the Ras signaling pathway.
The studies described above have important implications in elucidating
the molecular basis for the oncogene-mediated induction of metastatic
mammary tumors. Our studies suggest that recruitment of both Shc and
PI-3' kinase signaling molecules to PyV MT plays a critical role in the
transition from mammary hyperplasias to metastatic mammary tumors.
These observations further argue that mammary tumorigenesis in these
transgenic mouse models is dependent on the concerted activation of
both cell-proliferative and survival-coupled pathways. The results of
this study also have general implications with respect to the roles
that growth factor receptor-coupled signal transduction pathways play
in tumor progression. Because tumor progression in these mutant PyV MT
strains is dependent on the genetic events that complement the defects
in these signaling pathways, these transgenic tumor models can serve as
a powerful genetic system to dissect the importance of various
signaling molecules in mammary tumor progression. Further studies with
these mutant PyV MT transgenic mice will provide important insight into the nature of events involved in the progression of mammary epithelial hyperplasias to metastatic mammary tumors.
 |
ACKNOWLEDGMENTS |
This work was supported by a Canadian Breast Cancer Initiative
grant awarded to W.J.M. This work was also partially supported by
grants from the Medical Research Council of Canada, by National Cancer
Institute of Canada (NCIC) awards to F.L.G. and J.A.H., and by National
Cancer Institute grant RO1-CA S4285 awarded to R.D.C. M.A.W. and
C.G.T. were supported by studentships from the Cancer Research Society,
and J.N.H. and M.J.R. were supported by studentships from the National
Science and Engineering Research Council (NSERC). W.J.M. is a Medical
Research Council of Canada Scientist. F.L.G. is a Terry Fox Research
Scientist of the NCIC.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Cancer Research
Group, Departments of Biology and Pathology, McMaster University, 1280 Main St. W., Hamilton, Ontario, Canada L8S 4K1. Phone: (905)
521-9140, ext. 27306. Fax: (905) 521-2955. E-mail:
mullerw{at}mcmail.mcmaster.ca.
 |
REFERENCES |
| 1.
|
Addison, C.,
T. Braciak,
R. Ralston,
W. Muller,
J. Gauldie, and F. L. Graham.
1995.
Intratumoral injection of an adenovirus expressing interleukin-2 induces regression and immunity in a murine breast cancer model.
Proc. Natl. Acad. Sci. USA
92:8522-8526[Abstract/Free Full Text].
|
| 2.
|
Anton, M., and F. Graham.
1995.
Site-specific recombination mediated by an adenovirus vector expressing the Cre recombinase protein: a molecular switch for control of gene expression.
J. Virol.
69:4600-4606[Abstract].
|
| 3.
|
Brizuela, L.,
E. T. Ulug,
M. A. Jones, and S. A. Courtneidge.
1995.
Induction of interleukin-2 transcription by the hamster polyoma virus middle T antigen: a role for Fyn in T cell signal transduction.
Eur. J. Immunol.
25:385-393[Medline].
|
| 4.
|
Bronson, R.,
C. Dawe,
J. Carrol, and T. Benjamin.
1997.
Tumor induction by a transformation-defective polyoma virus mutant blocked in signaling through Shc.
Proc. Natl. Acad. Sci. USA
94:7954-7958[Abstract/Free Full Text].
|
| 5.
|
Campbell, K. S.,
E. Ogris,
B. Burke,
W. Su,
K. R. Auger,
B. J. Druker,
B. S. Schaffhausen,
T. M. Roberts, and D. C. Pallas.
1994.
Polyoma middle tumor antigen interacts with SHC protein via the NPTY (Asn-Pro-Thr-Tyr) motif in middle tumor antigen.
Proc. Natl. Acad. Sci. USA
91:6344-6348[Abstract/Free Full Text].
|
| 6.
|
Cardiff, R. D., and W. J. Muller.
1993.
Transgenic mouse models of mammary tumorigenesis.
Cancer Surv.
16:97-113[Medline].
|
| 7.
|
Chang, H. W.,
M. Akoi,
D. Fruman,
K. R. Auger,
A. Bellacosa,
P. N. Tsi,
L. W. Cantley,
T. M. Roberts, and P. K. Vogt.
1997.
Transformation of chicken cells by the gene encoding the catalytic subunit of PI-3-kinase.
Science
276:1848-1850[Abstract/Free Full Text].
|
| 8.
|
Cheng, S. H.,
R. Harvey,
P. C. Espino,
K. Semba,
T. Yamamota,
K. Toyoshima, and A. E. Smith.
1988.
Peptide antibodies to the human c-fyn gene product demonstrate pp59 c-fyn is capable of complex formation with the middle-T antigen of polyomavirus.
EMBO J.
7:3845-3855[Medline].
|
| 9.
|
Cheung, A. T. W.,
L. J. T. Young,
C. Y. Chao,
P. C. Y. Chien,
A. Ndoye,
P. A. Barry,
W. J. Muller, and R. D. Cardiff.
1997.
Microcirculation and metstasis in a new mouse mammary tumor model system.
Int. J. Oncol.
11:69-77.
|
| 10.
|
Chirgwin, J. M.,
A. E. Przybyla,
R. J. MacDonald, and W. J. Rutter.
1979.
Isolation of biologically active ribonucleic acid from sources rich in ribonuclease.
Biochemistry
18:5294-5299[Medline].
|
| 11.
|
Courtneidge, S. A., and A. Hebner.
1987.
An 81 kDa protein complexed with middle T antigen and pp60c-src: a possible phosphatidylinositol kinase.
Cell
50:1031-1037[Medline].
|
| 12.
|
Courtneidge, S. A., and A. E. Smith.
1983.
Polyomavirus transforming protein associates with the product of the c-src cellular gene.
Nature
303:435-439[Medline].
|
| 13.
|
Dahl, J.,
R. Freund,
J. Blenis, and T. J. Benjamin.
1996.
Studies of partially transforming polyomavirus mutants establish a role for the phosphaditylinositol-3'-kinase in activation of the pp70 S6 kinase.
Mol. Cell. Biol.
16:2728-2735[Abstract].
|
| 14.
|
Dilworth, S. M.,
C. E. P. Brewster,
M. D. Jones,
L. Lanfrancone,
G. Pelicci, and P. G. Pelicci.
1994.
Transformation by polyomavirus middle T-antigen involves the binding and tyrosine phosphorylation of Shc.
Nature
367:87-90[Medline].
|
| 15.
|
Franke, T. F.,
S.-I. Yang,
T. O. Chan,
K. Datta,
A. Kazlauskas,
D. K. Morrison,
D. R. Kaplan, and P. N. Tsichlis.
1995.
The protein encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase.
Cell
81:727-736[Medline].
|
| 16.
|
Freund, R.,
C. J. Dawe,
J. P. Carrol, and T. L. Benjamin.
1992.
Changes in frequency, morphology and behaviour of tumors induced in mice by a Polyomavirus mutant with a specifically altered oncogene.
Am. J. Pathol.
141:1409-1425[Abstract].
|
| 17.
|
Gaviereli, Y. S., and S. A. Ben-Sasson.
1992.
Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation.
J. Cell Biol.
119:493-501[Abstract/Free Full Text].
|
| 18.
|
Gotoh, N.,
A. Tojo, and M. Shibuya.
1996.
A novel pathway from phosphorylation of tyrosine residues 239/240 of Shc, contributing to suppress apoptosis by IL-3.
EMBO J.
15:6197-6204[Medline].
|
| 19.
|
Guy, C. T.,
R. D. Cardiff, and W. J. Muller.
1992.
Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease.
Mol. Cell. Biol.
12:954-961[Abstract/Free Full Text] |