Previous Article | Next Article ![]()
Mol Cell Biol, May 1998, p. 2502-2513, Vol. 18, No. 5
Molecular Genetics Program, Wadsworth Center
& School of Public Health, State University of New York at Albany,
Albany, New York 12201-2002,1 and
Gene
Regulation and Chromosome Biology Laboratory, National Cancer
Institute-Frederick Cancer Research and Development Center,
ABL-Basic Research Program, Frederick, Maryland
21702-12012
Received 21 October 1997/Returned for modification 24 December
1997/Accepted 27 January 1998
Ty1 retrotransposons in Saccharomyces cerevisiae are
maintained in a state of transpositional dormancy. We isolated a
mutation, rtt100-1, that increases the transposition of
genomic Ty1 elements 18- to 56-fold but has little effect on the
transposition of related Ty2 elements. rtt100-1 was shown
to be a null allele of the FUS3 gene, which encodes a
haploid-specific mitogen-activated protein kinase. In fus3
mutants, the levels of Ty1 RNA, protein synthesis, and proteolytic
processing were not altered relative to those in FUS3
strains but steady-state levels of TyA, integrase, and reverse
transcriptase proteins and Ty1 cDNA were all increased. These findings
suggest that Fus3 suppresses Ty1 transposition by destabilizing
viruslike particle-associated proteins. The Fus3 kinase is activated
through the mating-pheromone response pathway by phosphorylation at
basal levels in naive cells and at enhanced levels in pheromone-treated
cells. We demonstrate that suppression of Ty1 transposition in naive
cells requires basal levels of Fus3 activation. Substitution of
conserved amino acids required for activation of Fus3 derepressed Ty1
transposition. Moreover, epistasis analyses revealed that components of
the pheromone response pathway that act upstream of Fus3, including
Ste4, Ste5, Ste7, and Ste11, are required for the posttranslational
suppression of Ty1 transposition by Fus3. The regulation of Ty1
transposition by Fus3 provides a haploid-specific mechanism through
which environmental signals can modulate the levels of
retrotransposition.
Retroviruses and endogenous
retrovirus-like elements are ubiquitous in the eucaryotic kingdom and
have been involved in the formation of a significant portion of the
typical eucaryotic genome (45). Hence, eucaryotes have
evolved many types of regulatory mechanisms to control the replication
and mobility of retroelements. However, only a few host genes that
control retroviral replication in vertebrates have been identified. A
recent example is the mouse Fv1 gene, whose product is
derived from the gag domain of an endogenous retroelement
and is postulated to inhibit murine leukemia virus replication by
interacting with the viral capsid protein (4).
Aside from the infectivity of the retroviral particle, the steps of
retrotransposition are analogous to retroviral replication. A
well-characterized model system to study host regulation of retrovirus-like elements is the Ty1 retrotransposon in the yeast Saccharomyces cerevisiae (8, 50). Ty1 elements
have two long terminal repeats (LTRs) surrounding a central region
consisting of two overlapping open reading frames: TyA, which encodes a
structural capsid protein, and TyB, which encodes protease (PR),
integrase (IN), and reverse transcriptase (RT) activities. Replication
of Ty1 occurs in the following sequence of events: a chromosomal Ty1
element is transcribed from LTR to LTR by RNA polymerase II into a
terminally redundant RNA that is polyadenylated and transported to the
cytoplasm. TyA and TyA-TyB fusion protein are synthesized from the
full-length transcript, the latter requiring a translational frameshift
event that occurs with about 3% efficiency (37). Subsequently, both Ty1 proteins associate with the Ty1 transcript to
form viruslike particles (VLPs). The VLP is the site of proteolytic maturation of TyA protein and processing of TyB into separate PR, IN,
and RT proteins. Ty1 protein processing is performed by PR and is
essential for transposition (57). Reverse transcription of
the Ty1 RNA into a full-length linear duplex cDNA occurs in the VLP,
using tRNA-Met(i) as a primer (11, 23). The Ty1 cDNA is then
transported into the nucleus of the same cell, where nonhomologous integration is catalyzed by the IN protein. In the absence of IN, Ty1
cDNA is used as a template for gene conversion of preexisting Ty1
elements or LTRs (51).
Most of the 25 to 30 copies of Ty1 in the haploid yeast genome are
competent for transposition and highly transcribed; however, individual
elements transpose in only 1 of 105 to 107
cells per generation (15, 17). This "transpositional
dormancy" is overcome when a Ty1 element is expressed at high levels
from the inducible GAL1 promoter, which increases the
efficiency of Ty1 transposition at a posttranslational step, perhaps by
overwhelming or evading a host-encoded inhibitor (30, 50).
One type of inhibition may occur at the level of maturation of Ty1
proteins in the VLP, which is very inefficient in normal yeast cells
and greatly enhanced by induction of GAL1-Ty1 expression
(16). Since the formation of mature VLPs is an essential
step in transposition, inhibition of VLP formation or VLP instability
in normal yeast cells could account for the low levels of
transposition.
The FUS3 gene encodes a haploid-specific mitogen-activated
protein (MAP) kinase that is activated through a conserved signal transduction cascade in response to mating pheromone. Pheromone secreted by cells of one of the two mating types of haploid yeast, either a or Multiple MAP kinase cascades function in haploid yeast cells, and the
components of these pathways can be used in different MAP kinase
modules to respond to different extracellular signals. For example, the
signalling pathway that triggers invasive growth in haploid cells
utilizes Ste20, Ste7, Ste11, and Ste12 (48). Upon activation
of the invasive growth pathway, the MAP kinase Kss1 is phosphorylated
by Ste7, which switches Kss1 from an inhibitor to an activator of
invasive growth (13, 41). Activation of Kss1 leads to the
binding of Ste12 in combination with Tec1 to genes containing a
Ste12/Tec1 composite binding site, referred to as a filamentous and
invasive growth response element (FRE) (3, 40, 43).
Subsequent expression of genes that contain FREs is required for
invasive growth. Interestingly, the promoter of Ty1 contains an FRE,
and Ty1 RNA levels are decreased by mutations in components of the
invasive growth pathway (3, 22, 28, 40). Recently,
Madhani et al. (41) have shown that in the absence of Fus3,
the invasive growth pathway MAP kinase Kss1 is inappropriately
activated by the mating signalling pathway, leading to transcription of
both mating-specific genes and invasive growth genes. Hence, Fus3 has a
kinase-independent function as a negative regulator of invasive growth.
Here we describe the isolation of a mutation, rtt100-1, that
results in high levels of retrotransposition of genomic Ty1 elements. We identify the rtt100-1 mutation as a null allele of the
FUS3 gene and show that Fus3 acts at a posttranslational
step in the retrotransposition cycle after processing of Ty1 proteins
in the maturing VLP. Our results indicate that the stability of Ty1
proteins in VLPs is increased in fus3 mutants and that this
increase leads to elevated levels of Ty1 cDNA and increased
transpositional integration of Ty1 cDNA. Furthermore, we demonstrate
that activation of Fus3 by the basal activity of the mating pathway in
vegetative cells is required to fully suppress Ty1 transposition.
Hence, the modulation of Ty1 transposition by Fus3 links
retrotransposition to environmental signals through evolutionarily
conserved signal transduction cascades. Since the mating pathway is
specific to haploid cells, we propose that this regulatory mechanism is
one way in which haploid yeast cells limit insertional mutagenesis by
Ty1 transposition.
Plasmids.
Plasmid YIpFUS3 was generated by subcloning the
3.7-kb BamHI-HindIII fragment from
plasmid pYEE81 (provided by G. Fink) into the yeast integrating vector,
pRS406. Plasmid pFUS3 Yeast strains.
Yeast strains are described in Table
1. Strain JC297 is a
trp1::hisG derivative of a strain containing the genomic
Ty1his3AI-270 element, which was isolated following
induction of transposition from plasmid pGTy1-H3his3AI
(17) in strain DG733 (20). The trp1::hisG allele was introduced as described by Alani
et al. (1). Strain JC358, which has a URA3 gene
integrated between the MATa and cry1 loci,
is an ascospore derived by crossing strain JC297 to strain GRY340 and
then backcrossing a selected ascospore to strain JC297 twice. Strains
JC297 and JC358 are congenic.
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Posttranslational Regulation of Ty1
Retrotransposition by Mitogen-Activated Protein Kinase Fus3
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, is bound by a serpentine receptor on the surface of cells of the opposite mating type. Pheromone binding triggers the activation of a heterotrimeric G-protein consisting of
Ste4, Ste18, and Gpa1, which transmits the signal to the Ste20 kinase
(39). In turn, Ste20 activates a MAP kinase module
consisting of Ste11 (a MAP kinase kinase kinase [MEK kinase]), Ste7
(a MAP kinase kinase [MEK]), and Fus3 (a MAP kinase) (24, 29,
44). The module is held together by interaction with the LIM
domain containing protein Ste5 (12). Once activated, Fus3
phosphorylates the cyclin-dependent kinase inhibitor Far1, which
mediates G1 arrest (10, 26, 46). In addition,
Fus3 activates the transcription factor Ste12, which binds to pheromone
response elements of mating-specific genes and induces their
transcription (26, 27). The products of mating-specific
genes are required for morphological changes that lead to cell fusion
and formation of the a/
diploid cell.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
HIS3, containing the HIS3 gene fused
to nucleotide 584 of FUS3 (25), was created by
inserting the SmaI-EcoRV fragment of pGEM-HIS3
(16) in place of the HpaI fragment in YIpFUS3.
Plasmid pFUS3
carries a fus3
::hisG-URA3-hisG allele, which has a deletion of FUS3 nucleotides 500 to 849. The oligomer AX032 (TAGCTAGCTAGATCTGC) containing a
BglII site was inserted into the SacII site
(nucleotide 500) of FUS3 in YIpFUS3. The resulting plasmid
was digested with BglII, and the 3.8-kb BamHI-BglII fragment of pNKY51 (1) was
inserted. The 6.0-kb BamHI-EcoRI fragment of this
plasmid, containing fus3
::hisG-URA3-hisG, was
subcloned into pBST-KS(+) (Stratagene) to create pFUS3
.
TABLE 1.
Yeast strains used in this study
ura3-167 his3
200
trp1::hisG), as described previously (17).
The fus3
::hisG allele in strains JC1510, JC1515, and
JC1516 was introduced by single-step gene disruption with the 6.0-kb BamHI-EcoRI fragment of plasmid pFUS3
,
followed by selection for FOAr derivatives of
Ura+ transformants. The fus3
::HIS3 allele
in strain JC1038 was introduced by gene disruption of strain JC515 with
a 1.5-kb fragment containing the 5' end of the FUS3 open
reading frame (nucleotides 1 to 584), the HIS3 gene, and the
last 55 nucleotides of the FUS3 open reading frame
(nucleotides 1008 to 1062). The fus3
::HIS3 fragment
was generated by PCR from the template DNA pFUS3
HIS3 with oligomers LFUS3INT (ATGCCAAAGAGAATTGTATAC) and
R2FUSHIS (CTAACTAAATATTTCGTTCCAAATGAGTTTCTTGAGGTCTTTCGT CGTTAGTGCTCTTGGCCTCCTCTAGTA). rad52::hisG-URA3-hisG strains JC980 and JC1065 were constructed by single-step gene disruption with plasmid
pRAD52-GB (15).
Strains JC1430 and JC1566 are leu2::hisG derivatives of
JC242 and JC1516, respectively, constructed with plasmid pNKY85
(provided by N. Kleckner). The ste11
6::URA3 allele
was introduced into JC1430 and JC1566 by using plasmid pNC202, the
ste5
102::URA3 allele was introduced by
using plasmid pJB221, and the ste4
::LEU2 allele was introduced by using plasmid pDJ154. (All three plasmids were
provided by H. Madhani and G. Fink.) The ste7
3::URA3
allele was introduced into strains JC1430 and JC1566 by using plasmid pNC149 (a gift of B. Errede). All transformants were verified by
Southern analysis.
Media were prepared as described by Rose et al. (49).
Synthetic dropout mixtures were obtained from Bio 101, Inc. Glucose (2%) was used as the carbon source except where stated.
Isolation of the rtt100-1 mutant. Strain JC358 was mutagenized with EMS (49). EMS-treated cells, diluted and plated onto yeast extract-peptone-dextrose (YPD) medium, were grown for 5 days at 20°C. Subsequently, colonies were replicated to synthetic complete medium lacking histidine (SC-His) plates and incubated at 30°C for 3 days. Colonies with more than three His+ papillae (the parental strain yields zero or one papilla per colony) were clonally purified and retested. The rtt100-1 strain 18-6A had a significant increase in the number of His+ papillae when pregrown at 20°C but no significant increase when grown at 30°C.
Strain 18-6A was crossed to the unmutagenized strain JC297. Following tetrad dissection, an
-factor-resistant spore with a
hypertransposition phenotype, JC801, was backcrossed to strain JC358
twice. The hypertransposition phenotype segregated 2:2 in 39 of 39 tetrads from the third backcross, as indicated by growing each
ascospore as a patch, approximately 2 cm2, on YPD plates at
20°C for 3 to 5 days, replicating the patch to SC-His plates, and
scoring His+ papillae after 3 days of growth at 30°C.
Cosegregation of a bilateral mating defect with the Rtt
phenotype was demonstrated by genetic selection for diploid formation. Strain 18-6A and all a ascospores were tested for resistance to
-factor-induced growth inhibition in a halo assay
(31).
Because Ty1 and RTT100 (FUS3 [see below]) are
haploid-specific genes whose expression is down-regulated in
a/
diploids, dominance of the rtt100-1
mutation was tested in
/
diploid strains. The
MATa-URA3 allele in the rtt100-1
strain 18-6A and the RTT100 strain JC358 was used to make
the MAT loci homozygous in diploids following mating to
JC297 (RTT100). MATa-URA3/
diploids were grown on 5-fluoroorotic acid medium to select derivatives that had lost the URA3 marker. Derivatives that became
/
at the MAT locus were identified by their ability to
mate to a MATa tester strain. His+
prototroph formation in the rtt100-1/RTT100 diploids was
tested and compared to the RTT100/RTT100 control strain by
the patch test described above.
The genetic distance between rtt100-1 and pet9
was determined by tetrad analysis of a cross between strains JC801 and
L1451 (provided by G. Fink). The rtt100-1 mutation was
scored in tetrads by a failure to form diploids when ascospores were
mated to a known rtt100-1 mutant of the opposite mating
type. Genetic distance was calculated from the results of 26 tetrads
(19 parental ditypes, 0 nonparental ditypes, and 7 tetratypes)
(49). Complementation of the rtt100-1 mutation by
FUS3 was performed by integrative transformation of strains
JC953 and JC984 with plasmid YIpFUS3 linearized with EcoRI.
DNA sequencing.
A 1.2-kb PCR fragment including the
FUS3 transcription unit from positions
114 to +1062 was
generated from genomic DNA of strain JC953 and cloned into plasmid
pBST-KS(+). Two independent clones were sequenced with Sequenase
version 2.0 (U.S. Biochemicals).
Tyhis3AI and Tyade2AI element transposition assays. The rate of transposition in strains harboring a chromosomal Ty1his3AI, Ty2his3AI, or Ty1ade2AI element was determined by the maximum-likelihood method (38) as described previously (17, 21).
The frequency of Ty1his3AI-242 transposition in the fus3
::hisG strain JC1566 transformed with the
LEU2-CEN vector pRS415 or with the LEU2-CEN
plasmid pRS315 carrying FUS3, fus3-T180D, or
fus3-Y182E alleles (plasmids pJB236, pJB290 and pJB291
respectively; provided by H. Madhani and G. Fink) was determined as
follows. Four independent transformants of each plasmid were grown
overnight in SC-Leu medium at 30°C and then diluted 1:100 into YPD
medium and grown for 2 days at 20°C. Aliquots of each culture were
plated on SC-Leu to determine the frequency of Leu+ cells
and on SC-Leu-His to determine the frequency of His+
prototrophs.
Ty1 integration in the CAN1 locus. The rate of canavanine resistance in strains JC297 and JC801 was determined by the maximum-likelihood method (38). Strains were grown overnight in YPD medium at 30°C. Approximately 500 cells were used to start 2-ml cultures of YPD, which were grown to saturation at 20°C. The titers of four cultures were determined by plating on YPD medium, and the number of canavanine-resistant (Canr) cells was determined by plating each culture on SC-Arg+canavanine medium (49).
One Canr colony was picked from each of 40 SC-Arg+canavanine plates, and genomic DNA was prepared. PCR analysis was performed on 250 ng of genomic DNA. Each reaction mixture also contained 10 mM Tris (pH 8.3), 50 mM KCl, 2.5 mM MgCl2 250 µM each deoxynucleoside triphosphate, 2 U of Taq polymerase (Boehringer Mannheim), and 250 ng of each of two DNA oligomers. The reaction conditions were 30 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min in a Perkin-Elmer 9600 thermocycler. CAN1-specific oligomers AX016 (GAAAATTTCGAGGAAGACGATAAGG) and AX019 (CAAATGCTTCTACTCCGTCTGC) were used to amplify a 2,265-bp sequence of the CAN1 gene. DNA samples that failed to amplify the CAN1 gene in this PCR were subjected to two additional PCR amplifications with the CAN1-specific oligomer AX016 or AX019 and a Ty1 LTR-specific oligomer, AX015 (GCCTTTATCAACAATGGAATCCC) to amplify a Ty1:can1 junction fragment, if present.Northern analysis. Northern hybridization of approximately 20 µg of total cellular RNA from each strain was performed as described previously (19). [32P]RNA probes were synthesized by in vitro transcription with SP6 or T7 polymerase, using the following DNA templates: plasmid pGEM-PYK1 for synthesis of antisense PYK1 RNA; plasmid pGEM-TyA1 for synthesis of the antisense Ty1 RNA probe; pGEM-HIS3 for synthesis of a sense strand HIS3 RNA to detect the Ty1his3AI transcript (16); and pSPADE2 for synthesis of a sense strand ADE2 RNA to detect the Ty1ade2AI transcript (21). Quantitation of hybridization bands was performed either by scanning densitometry with a Howtek Scanmaster 3+ and Scanalytics software or by phosphorimage analysis with a Molecular Dynamics PhosphorImager and ImageQuant Software.
Immunoprecipitation of 35S-labeled TyA protein. Labeling of cells with [35S]Met, chasing with excess unlabeled Met, and immunoprecipitation of 35S-TyA from denatured cell lysates were performed as described previously (16), except that TyA1 antiserum was used in place of VLP antiserum. TyA1 antiserum to a TrpE-TyA fusion protein, which was synthesized from a pATH-TrpE expression vector carrying nucleotides 1032 to 1317 of Ty1-H3, was raised in rabbits as described by Garfinkel et al. (33).
Western analysis of Ty1 proteins. Strains were grown overnight at 30°C in YPD broth and then diluted 20-fold in fresh YPD broth and grown for 4 h at 20°C. Total-cell proteins were extracted from a 1-ml sample of each culture by trichloroacetic acid precipitation (55). Equal amounts of protein (as determined by Coomassie blue staining) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a polyvinylidene difluoride membrane (Bio-Rad) with a Semi-dry Horizontal Transfer Cell (Bio-Rad), and probed with TyA1 antibody.
VLP-enriched cell fractions were obtained as follows. Yeast strains were grown in YPD broth overnight at 30°C. The cultures were diluted 50-fold in YPD broth and grown overnight at 20°C and then diluted 5-fold in YPD broth again and grown at 20°C to an optical density at 600 nm of 1.25. VLPs from a 1-liter culture were fractionated on a sucrose step gradient as described by Eichinger and Boeke (23) with the following modifications. Cells were resuspended and disrupted in buffer A (10 mM HEPES-KOH [pH 7.8], 15 mM KCl, 5 mM EDTA) containing 30 mM dithiothreitol, 2 mM phenylmethylsulfonyl fluoride, 10 µg of aprotinin per ml, and 5 µg of leupeptin per ml. The lysate was centrifuged, and the resulting supernatant was loaded onto a sucrose step gradient composed of 5 ml of 75% sucrose in buffer A, 3 ml of 45% sucrose in buffer A, 5 ml of 30% sucrose in buffer A, and 12 ml of 20% sucrose in buffer A. The gradients were centrifuged for 3 h at 25,000 rpm in a Beckman SW28 rotor at 4°C, and the 45% layer containing VLPs was removed (~5 ml) and diluted twofold in buffer A. VLP-enriched fractions were concentrated by ultracentrifugation in a Beckman NVt90 rotor at 55,000 rpm for 30 min at 4°C. Pellets were resuspended in 500 µl of VLP storage buffer (20 mM HEPES-KOH [pH 7.6], 140 mM KCl, 1 mM EDTA, 10% glycerol). The protein concentration of VLP-enriched fractions was determined with the Bio-Rad Dc protein assay system. Protein samples (25 µg) were subject to SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and probed with TyA1, TyB2 (57), and TyB8 (33) antisera. Immune complexes were detected with the enhanced chemiluminescence Western blot detection system (Amersham). Scanning densitometry was performed with a Howtek Scanmaster 3+ and Scanalytics software.Southern blot analysis of total cellular Ty1 DNA.
For each
strain analyzed, a single colony grown on YPD medium at 20°C was used
to inoculate a 10-ml culture of YPD broth and the cultures were grown
to saturation at 20°C. Spheroplasts were prepared from each culture
by incubating yeast cells for 30 min at 37°C in 0.9 M sorbitol-0.1 M
EDTA containing 1 µl of
-mercaptoethanol per ml and 0.6 mg of
Zymolyase 100T (Seikagu) per ml, and then total cellular DNA was
prepared with the G NOME kit (Bio 101). DNA samples were digested with
PvuII, subjected to electrophoresis on a 1% SeaKem Gold
(FMC) agarose gel, and transferred to a Hybond N+ nylon membrane
(Amersham) in 0.4 N NaOH. The filter was probed with a 934-bp
HindIII-BglII fragment of Ty1-H3 (nucleotides
4627 to 5561 [6]), radiolabeled with High Prime DNA
labeling mix (Boehringer Mannheim) as specified by the manufacturer.
Hybridization bands were quantitated by scanning densitometry with a
Howtek Scanmaster 3+ and Scanalytics software.
| |
RESULTS |
|---|
|
|
|---|
Isolation of hypertransposition mutants. Transposition of a single genomic Ty1 element under the control of its native promoter can be detected when the element is marked with the retrotransposition indicator gene his3AI (17) or ade2AI (21). These indicator genes contain an artificial intron (AI) cloned in an antisense orientation into the coding sequences of HIS3 or ADE2, respectively. The marker genes are contained in the 3' untranslated region of a genomic Ty1 element, such that the transcriptional orientations of Ty1 and his3AI (or ade2AI) are opposed. In this orientation, the antisense strand of the marker gene is transcribed as part of Ty1 RNA and the AI can be spliced from the Ty1 transcript. Use of the spliced Ty1 RNA as a template for cDNA synthesis and genomic integration results in the formation of a Ty1 element containing a functional HIS3 (or ADE2) gene. Hence, the rate of transposition of a Ty1his3AI or Ty1ade2AI element is proportional to the rate of His+ or Ade+ prototroph formation, respectively.
To identify genes that are involved in the maintenance of Ty1 transpositional dormancy, we performed a genetic screen for mutations that increased the transposition of the Ty1his3AI-270 element in strain JC358. Yeast cells were mutagenized with EMS, and colonies were screened to identify rtt (regulator of Ty1 transposition) mutants with an elevated level of His+ papillation following nonselective growth on YPD at 20°C, a permissive temperature for retrotransposition. Chromosomal Ty1 element transposition is inhibited at 30°C, but His+ prototrophs can arise by homologous recombination of a Ty1HIS3 cDNA with Ty1 elements in the genome. To eliminate mutants with increased homologous recombination of Ty1HIS3 cDNA, only those that increased His+ papillation at 20°C but not at 30°C were selected. One mutation identified, rtt100-1, segregated 2:2 through three backcrosses to a congenic wild-type strain containing Ty1his3AI-270. The Rtt
phenotype is recessive
in
/
diploids that are heterozygous for rtt100-1. The
transposition rate of Ty1his3AI-270 was determined in the
wild-type strain JC297 and compared to that in JC953, a congenic
rtt100-1 ascospore from the third backcross of the 18-6A mutant. The rtt100-1 mutant had a 39-fold increase in the
rate of His+ prototroph formation per generation (Table
2).
|
Identification of RTT100 as FUS3.
A second
phenotype was found to cosegregate with the hypertransposition
phenotype in tetrad analysis of rtt100-1 mutants: failure to
form diploids in bilateral mutant crosses. Microscopic analysis of
rtt100-1 × rtt100-1 mating mixtures showed
defects in conjugation typical of cell fusion mutants, which were not observed in rtt100-1 × RTT100 mixtures. In
addition, haploid MATa rtt100-1 strains were
found to be resistant to
-factor-induced arrest of growth. The
bilateral mating defect and the failure to undergo pheromone-induced
arrest in rtt100-1 mutants were reminiscent of phenotypes
observed in fus3 and far1 mutants (10,
25). The rtt100-1 mutation was mapped and shown to be
located 13.5 centimorgans (cM) from pet9 on chromosome II,
which is the same distance reported for FUS3
(25).
::HIS3 allele, in
which sequences coding for the carboxy-terminal 158 amino acids of Fus3
are deleted, was introduced into a strain that harbors the chromosomal
element, Ty1ade2AI-515. The rate of Ade+
prototroph formation in the fus3
::HIS3 strain JC1038
was 56-fold higher than that in the isogenic FUS3 strain
JC515 (Table 2). We also tested a fus3
::hisG
allele in strain JC242, which contains a different
Ty1his3AI element from the one in the mutagenesis strains JC297 and JC358. The fus3
::hisG allele
has a deletion of sequences encoding amino acids 167 to 284 of
Fus3. The rate of His+ prototroph formation was increased
18-fold in the fus3
::hisG strain JC1516 relative to
the isogenic wild-type strain, JC242 (Table 2). Both the
fus3
::HIS3 and fus3
::hisG strains
were mating defective in bilateral mutant crosses, and
fus3
::hisG has been shown to be defective in blocking
Kss1-dependent mating activity relative to the catalytic-site mutation,
fus3-K42R (41). In summary, fus3 null
mutants have an 18- to 56-fold increase in the rate of
transposition of a single chromosomal Ty1 element.
We further determined whether the frequency of transposition of a
Ty1ade2AI element expressed from the GAL1
promoter was affected by a fus3 null mutation. After
galactose induction of plasmid pGTy1ade2AI in strain JC418
for 24 h (21), the frequency of Ade+
prototrophs was 3.1 × 10
3, whereas two independent
fus3
::HIS3 derivatives had frequencies of 1.4 × 10
3 and 5.2 × 10
3 Ade+
prototrophs. Perhaps these data, which demonstrate that pGTy1 transposition is not increased in fus3
mutants, indicate
that the high levels of Ty1 protein processing and VLP accumulation in
cells expressing pGTy1 (16, 32) are able to overcome the negative effect of Fus3 on transposition.
The effect of fus3 is specific for the Ty1
retrotransposon.
Regulatory mechanisms for one type of
retrotransposon may be shared by other classes of transposons. In
Drosophila virilis, a host-mediated hybrid dysgenesis that
causes mobility of the Ulysses retrotransposon also
mobilizes four other classes of transposons (47). To
determine if FUS3 regulates other retrotransposons in yeast,
we examined the effect of a fus3 mutation on the
transposition of Ty2 elements, which are highly related to Ty1
elements. The fus3
::hisG allele was introduced into
two strains containing independent chromosomal Ty2his3AI
elements, and the rate of His+ prototroph formation was
determined (Table 2). Compared to isogenic wild-type strains,
transposition of the Ty2his3AI-1 element was increased approximately fivefold and that of the
Ty2his3AI-19 element was increased threefold in
fus3
derivatives. Hence, fus3
causes a
small increase in Ty2 retrotransposition, but the effect is
significantly lower than the 18- to 56-fold effect of fus3 null mutations on Ty1 transposition. In contrast, expression of a
pGTy1 element causes trans activation of both genomic
Ty1his3AI and Ty2his3AI elements to equivalent
levels (18). Our findings indicate that expression of a
pGTy1 element and expression of the fus3 mutation overcome
transpositional dormancy by different mechanisms, the latter of which
is more specific for Ty1 retrotransposition.
Transpositional integration of Ty1 cDNA is increased in fus3-187 mutants. Ty1 cDNA can enter the genome by two distinct pathways. The transposition pathway, mediated by IN, results in integration of Ty1 at nonhomologous sites and generates a 5-bp target duplication. A second pathway is the RAD52-dependent gene conversion of Ty1 elements or LTRs in the genome. Although cDNA-mediated gene conversion is normally rare, it is stimulated by conditions that negatively affect Ty1 IN-mediated integration (51). Either pathway could be stimulated in fus3 mutants, giving rise to increased His+ prototroph formation. To determine if the increase in His+ prototroph formation in fus3 mutants is dependent on RAD52, a rad52 mutation was introduced into the fus3-187 strain JC953 and the FUS3 strain JC297. The 39-fold increase in transposition in a fus3-187 mutant was not abolished by introduction of the rad52 mutation but instead was slightly enhanced, resulting in a 55-fold increase in transposition relative to the wild-type strain JC297 (Table 2). The data demonstrate that His+ prototroph formation in a fus3-187 strain is RAD52 independent. The rad52 mutation by itself increases Ty1his3AI-270 transposition about 15-fold, in agreement with previous results (15), and transposition in the fus3-187 rad52 double mutant is about 4-fold higher than in the rad52 mutant. The findings clearly argue that the RAD52-independent process of transposition is responsible for the increase in His+ prototrophs in fus3 mutants.
To confirm our hypothesis that transposition into de novo targets is increased, we quantitated transposition events that inactivate a selectable target gene, CAN1, in the FUS3 strain, JC297 and a congenic fus3-187 strain, JC801 (Table 3). Loss-of-function mutations in the CAN1 gene result in resistance of the strain to growth inhibition in the presence of canavanine. The rate of canavanine resistance was similar in the FUS3 and fus3-187 strains, but the fraction of independent Canr colonies that sustained a Ty1 insertion into the CAN1 gene was increased eightfold in the fus3-187 strain relative to the FUS3 strain (Table 3), yielding an overall increase of sixfold in the rate of Ty1 insertion into CAN1 in the fus3-187 mutant. The relatively smaller increase in Ty1 transposition into CAN1 compared to the increase in Ty1his3AI and Ty1ade2AI transposition into the whole genome is probably because open reading frames of RNA polymerase II genes are relatively poor targets for Ty1 transposition (36). Taken together, the data show that the fus3-187 mutation significantly increases de novo integration of Ty1.
|
The Ty1 RNA level is not increased in fus3
mutants.
To understand how FUS3 regulates Ty1
transposition in normal cells, we analyzed different steps in the
retrotransposition process in fus3 mutants.
Hypertransposition could be caused by an increase in the amount of Ty1
RNA; therefore, RNA prepared from cells in the log phase of growth was
analyzed by Northern blotting to quantitate Ty1his3AI-270
and Ty1ade2AI-515 transcripts from individual elements and
from Ty1 elements collectively, relative to a control transcript,
PYK1 RNA (Fig. 1). The level
of Ty1his3AI RNA in the fus3-187 strain JC953 was
not significantly increased relative to that in the congenic
FUS3 strain JC297. Similarly, the level of
Ty1ade2AI RNA in the fus3
strain JC1038 was
not increased relative to that in the isogenic FUS3 strain
JC515. Total Ty1 RNA levels were also not significantly altered as a result of either the fus3-187 or
fus3
::HIS3 mutation. Although both minor increases
and decreases in the level of RNA from individual Ty1 elements occur in
fus3 mutants relative to isogenic or congenic FUS3 strains, a consistent increase in the Ty1 RNA level
that could explain the 18- to 56-fold increase in Ty1 transposition has
not been observed. In addition, Northern analysis of RNA from cells in
the stationary phase showed no change in the levels of Ty1,
Ty1his3AI or Ty1ade2AI RNA (normalized to
PYK1 RNA) in fus3 mutants relative to
FUS3 strains (data not shown). The data indicate that
derepression of Ty1 transposition in fus3 mutants occurs at
the posttranscriptional level.
|
Posttranslational regulation of Ty1 transposition by
FUS3.
To determine if the efficiency of Ty1 protein
synthesis is increased in fus3 mutants, cells were labeled
for 1 h with [35S]Met and TyA protein was
immunoprecipitated from denatured cell lysates (Fig.
2A). The levels of unprocessed p58-TyA
and processed p54-TyA were equivalent in the fus3-187 strain
JC953 and the wild-type strain JC297. Similarly, the levels of
pulse-labeled TyA proteins in the fus3
strain JC1038
showed no difference from those in the isogenic FUS3 strain,
JC515. Therefore, the higher levels of retrotransposition in
fus3 mutants cannot be attributed to an increase in the
synthesis of TyA protein.
|
mutants JC1038 and JC1516
relative to the isogenic FUS3 strains (data not shown).
Since neither an increase in TyA protein synthesis nor an increase in
TyA processing was detected, the data argue that the stability of
p54-TyA is increased in fus3 mutants.
The levels of VLP-associated Ty1 proteins and total Ty1 cDNA are
increased in fus3 mutants.
The preferential
accumulation of the processed form of TyA in fus3 mutants
suggested that Ty1 proteins were stabilized after the formation of
VLPs. Therefore, a cell fractionation procedure developed to isolate
VLPs from cells expressing a GAL1:Ty1 element (transposition-induced cells) was used to obtain a cytoplasmic fraction
that was enriched for VLPs from uninduced cells. Although Ty1 proteins
are not a major component of this sucrose gradient fraction prepared
from uninduced cells as they are when prepared from
transposition-induced cells (33), the VLPs were
significantly concentrated to allow both TyA and TyB proteins to be
detected by Western analysis (Fig. 3).
Equal amounts (25 µg) of protein from VLP-enriched cell fractions
were analyzed by immunoblotting with TyA1, TyB2, and TyB8 antibodies
against the TyA, IN, and RT domains, respectively (Fig. 3). TyA
proteins p58 and p54 were five- to sevenfold more abundant in VLP
fractions from the fus3 strains JC953, JC1038, and JC1516
than in those from the FUS3 control strains JC297, JC515,
and JC242, respectively (Fig. 3, bottom panel). A more significant
increase in the level of processed TyB proteins from VLP-enriched
fractions of fus3 strains was observed. The level of p90-IN
was 21- to 43-fold higher (Fig. 3, top panel) and the level of p60-RT
was >14- to 200-fold higher (Fig. 3, center panel) in fus3
mutants than in FUS3 strains. In addition, processing intermediates p140, p160, and p190 are detected in strain JC515 by the
B2 antibody, and the level of these proteins in VLP fractions is also
increased in the isogenic fus3
strain JC1038 (Fig. 3, top
panel). In summary, TyA and TyB proteins that cosediment with VLPs are
significantly more abundant in fus3 mutants. Taken together, the data argue that the stability of VLP-associated proteins is enhanced in fus3 mutants. Alternatively, the assembly of Ty1
proteins into VLPs could be increased in fus3 mutants, which
might enhance their stability relative to Ty1 proteins not associated
with VLPs.
|
|
strain JC1038
had a 10-fold increase relative to the isogenic FUS3 strain JC515. The data demonstrate that higher levels of Ty1 transposition are
correlated with an increase in total cellular Ty1 cDNA levels in
fus3 mutants.
Fus3 is activated by the mating-pheromone response pathway in
vegetative cells.
In response to mating pheromone, Fus3 is rapidly
phosphorylated on threonine-180 and tyrosine-182 residues, and this
phosphorylation is required for activation of Fus3 to mediate the
mating response (34). During vegetative growth, Fus3 kinase
is partially activated by the basal activity of the mating-pheromone
response pathway (52). We investigated the role of
activation of Fus3 in suppression of Ty1 transposition in vegetative
cells by examining the ability of phosphorylation site
substitution alleles fus3-T180D and
fus3-Y182E to suppress transposition in a
fus3
strain. The fus3-T180D and fus3-Y182E alleles are completely unable to rescue the
mating defect of a fus3
kss1
double mutant (data not
shown), indicating that these alleles cannot be activated. The
frequency of His+ prototroph formation from the genomic
Ty1his3AI-242 element was determined for each allele (Table
4). FUS3 lowered transposition 74-fold compared to the LEU2-CEN vector pRS415 alone, while
the fus3-T180D and fus3-Y182E alleles decreased
transposition 15- and 9-fold, respectively. Hence, the activity of the
fus3-T180D and fus3-Y182E alleles in suppressing
Ty1 transposition is significantly lower than that of FUS3.
These findings argue that basal levels of Fus3 phosphorylation are
involved in maintaining normal levels of suppression of Ty1
transposition.
|
,
ste7
, ste4
, and ste5
mutations were introduced into the FUS3 strain JC1430 or the
isogenic fus3
strain JC1566 to allow a comparison of
ste fus3
double mutants to single ste mutants
(Fig. 5B). The rate of Ty1his3AI-242 transposition in a
ste11
fus3
mutant was equivalent to that in
a ste11
mutant. Similarly, Ty1his3AI-242
transposition was increased less than threefold in the ste7
fus3
mutant relative to the ste7
mutant. This
small increase may be because Fus3 is present in a complex with Ste7 in
naive cells (2) and hence may have increased access to its
targets in the absence of Ste7. In addition, transposition was not
increased in ste4
fus3
or ste5
fus3
double mutants relative to ste4
or ste5
mutants, respectively. The level of total Ty1 RNA or
Ty1his3AI-242 RNA was the same in each ste
fus3
mutant relative to the corresponding single ste
mutant (Fig. 5C), indicating that the absence of an increase in
transposition in ste fus3
double mutants is not a
consequence of lower Ty1 RNA levels. Hence, deletion of FUS3
is insufficient to derepress transposition in the absence of upstream
components of the mating pathway.
|
strain, the rate
of Ty1his3AI-242 transposition was reduced
513-fold in a ste11
mutant, 385-fold in a
ste7
mutant, 118-fold in a ste4
mutant, and
50-fold in a ste5
mutant (Fig. 5B). One explanation is
that the production of Ty1 RNA is dependent on components of the mating
pathway. We found a 2-fold reduction in the level of Ty1 RNA in
ste11
mutants and a 10-fold reduction in
ste7
mutants (Fig. 5C, center panel, lanes 7 and 9).
However, RNA from the Ty1his3AI-242 element was reduced
ten-fold in both ste11
and ste7
mutants
(Fig. 5C, top panel, lanes 7 and 9). The levels of Ty1 RNA were
equivalent to the wild-type level in ste4
mutants and
70% of the wild-type level in ste5
mutants (Fig. 5C,
center panel, lanes 3 and 5). The ste4
and
ste5
mutations had a more significant effect on
Ty1his3AI-242 RNA, reducing it to 50 and 30% of the
level in wild-type strains, respectively (Fig. 5C, top panel, lanes 3 and 5). The pattern of regulation for total Ty1 RNA is consistent with
previous results (22, 28) and with the idea that
transcription of many Ty1 elements is at least partially under the
control of the invasive growth pathway. The invasive growth pathway
uses Ste11 and Ste7 proteins but does not use Ste4 and Ste5 proteins,
which are unique to the mating pathway. Hence, the finding that
Ty1his3AI-242 RNA shows some degree of dependence on all
four components of the mating pathway indicates that individual Ty1
elements may also be regulated as mating-specific genes.
The absence of Ste4 or Ste5 has a small effect on Ty1 RNA levels but
significantly reduces Ty1his3AI-242 transposition. These findings argue that fus3
is not epistatic to these
ste mutations for the regulation of transposition.
(Likewise, fus3
is not epistatic to ste
mutations in the mating response.) In ste mutants, neither Fus3 nor Kss1 can activate mating-specific gene expression but Kss1 can
substitute for the activation of mating-specific genes in the absence
of Fus3 (24, 41). Therefore, ste4
and
ste5
mutants may not have the same hypertransposition
phenotype as fus3
mutants because they lose expression of
a mating-specific gene whose product activates Ty1 transposition at the
posttranscriptional level.
Kss1 is not redundant with Fus3 in regulating Ty1
transposition.
To determine if Kss1 is redundant with Fus3 in
regulating transposition, we examined the effect of a
kss1
mutation on Ty1 transposition. The rate of
transposition of the Ty1his3AI-242 element was
2.0 × 10
8 in a kss1
mutant, which is
fourfold lower than in the isogenic wild-type strain (Fig. 5B). Ty1 RNA
levels are also reduced about twofold in a kss1
mutant
relative to the isogenic wild-type strain (data not shown). These data
demonstrate that Kss1 is not redundant with Fus3 in repressing Ty1
transposition. The rate of transposition in a kss1
fus3
double mutant was 1.0 × 10
9, which is
similar to that in the ste7
and ste11
mutants. There is a concomitant decrease in the level of Ty1 RNA in the
kss1
fus3
double mutant to a level similar to that in
a ste7
mutant (data not shown). The regulation of
transpositional dormancy by Fus3 but not by Kss1 is consistent with two
models: (i) Ty1 transposition in fus3
mutants is
increased because the invasive growth response is activated, resulting
in increased expression of an invasive growth gene whose product is an
activator of Ty1 transposition; and (ii) transposition is increased in
fus3
mutants by the loss of a negative regulatory
interaction between the Fus3 kinase and a Ty1-encoded target protein.
| |
DISCUSSION |
|---|
|
|
|---|
The yeast MAP kinase Fus3 is a specific negative regulator of Ty1 transposition. Transpositional dormancy of Ty1 elements in yeast results from multiple levels of regulation that affect Ty1 transcription, protein synthesis, VLP formation and maturation, cDNA synthesis, and integration (5, 8, 16, 30, 50, 51). We have used a his3AI-based assay for transposition of individual genomic Ty1 elements to screen for host regulators of transpositional dormancy. The hypertransposition mutant rtt100-1 was isolated in this screen, and RTT100 was shown to be allelic with FUS3 (25). Null mutations in FUS3 increase the transposition rates of individual Ty1his3AI and Ty1ade2AI elements 18- to 56-fold, depending on the individual chromosomal Ty1 element that is assayed (Table 2). The increase in His+ prototroph formation in fus3 mutants occurs independently of the RAD52 gene and therefore cannot be attributed to elevated levels of homologous recombination of Ty1HIS3 cDNA (Table 2). Moreover, Ty1 integration into the CAN1 gene is elevated in fus3 mutants (Table 3). These results demonstrate that integration of Ty1 into de novo targets is increased by null mutations in the FUS3 gene.
In contrast, the fus3
mutation increases the
transposition of Ty2his3AI elements only three- to fivefold
(Table 2). One interpretation of this data is that Fus3 interacts
directly or indirectly with a Ty gene product that is divergent in Ty1
and Ty2 elements. These elements have two regions of sequence
divergence, one encompassing TYA and the PR domain of
TYB and the other including the carboxy-terminal domain of
IN encoded within TYB. There is 50% identity and 66%
similarity in the primary amino acid sequence of the TYA
product between Ty1 and Ty2 elements, whereas the corresponding TYB gene products have 77% identity and 86% similarity in
the primary amino acid sequence. Hence, the specificity of Fus3 for the
regulation of Ty1 transposition may suggest that TyA1 is the target of
the Fus3 kinase.
Null mutations in FUS3 increase stability of
VLP-associated Ty1 proteins.
Our analysis of Ty1 RNA levels
suggests that hypertransposition in fus3 mutants does not
result from increases in Ty1 RNA synthesis or stability. Steady-state
levels of Ty1 RNA were not detectably increased in fus3-187
or fus3
strains relative to those in congenic or isogenic
control strains (Fig. 1 and 5). Similarly, the RNA level from
marked Ty1his3AI and Ty1ade2AI elements was
not consistently increased in fus3 mutants. The simplest
explanation of this data is that Ty1 transposition is regulated at a
posttranscriptional step by Fus3. However, we cannot rule out the
possibility of small increases in the Ty1 RNA level that were not
detected in our Northern analyses and that lead to significant
increases in the rate of genomic Ty1 element transposition. However,
this possibility seems quite unlikely, given that increasing the copy
number of Ty1 does not derepress the transposition of Ty1 elements
(7, 17). Moreover, a 25% increase in the total Ty1 RNA
level created when a Ty1ade2AI element on a high-copy-number
plasmid is maintained in the cell actually decreases the transposition
of the genomic Ty1his3AI-242 element (14).
The pheromone response pathway activates Fus3 to mediate the
suppression of Ty1 transposition.
Our results indicate that basal
activation of Fus3 is required to suppress Ty1 transposition at the
posttranslational level. Alleles of FUS3 with amino acid
substitutions in the activating residues, fus3-T180D and
fus3-Y182E, were significantly less active than wild-type
FUS3 in complementing Ty1 hypertransposition in a
fus3
strain, suggesting that phosphorylation of Fus3 is
involved in mediating the repression of Ty1 transposition in vegetative cells (Table 4). The fus3-T180D and fus3-Y182E
alleles did exhibit a low level of activity in suppressing
transposition. This activity could result from these alleles having
retained the kinase-independent inhibitory function of Fus3 whereas
null fus3
alleles lack this function (41).
kss1
double mutant. Since ste4
and ste5
mutants
had nearly wild-type levels of Ty1 RNA, this finding suggests that an
activator of Ty1 transposition is encoded by a mating-specific gene,
whose expression would be blocked in ste and kss1
fus3
mutants but not in a fus3
mutant. Despite
this possibility, the rate of transposition remains sufficiently high
in ste4
and ste5
mutants (6.5- and 2.7-fold
lower than in an isogenic wild-type strain, respectively [Fig. 5B])
that the postulated activator must not be absolutely required for Ty1
transposition and the effect of deleting FUS3 could be
easily detected if it occurred in the absence of activation by upstream
components of the pheromone response pathway.
Complex regulation of Ty1 RNA levels by components of the pheromone
response and invasive growth pathways.
The promoter of Ty1
contains an FRE that is bound by Ste12 and Tec1 and is responsive to
conditions that stimulate invasive growth genes (3, 40, 43).
Mutations in components of the invasive growth pathway, including
Ste11, Ste7, Ste12, and Tec1, abolish the expression of an
FRE(Ty1)::lacZ reporter. However, components specific to the mating pathway, including Ste4 or Ste5, do
not affect the expression of
FRE(Ty1)::lacZ (40,
43). In general agreement with these findings, we have found that
Ty1 RNA levels are reduced in ste7
and
ste11
mutants, slightly lowered in a ste5
mutant, and unaltered in a ste4
mutant (Fig. 5B). However, our findings suggest that Ty1 promoters in their native context may not all be regulated identically to
FRE(Ty1)::lacZ. For example,
FRE(Ty1)::lacZ expression was
abolished in a ste11
mutant (40), but we found
that the Ty1 RNA level was reduced only twofold in ste11
mutants. Second, while
FRE(Ty1)::lacZ expression in a
fus3
kss1
double mutant is similar to that in a
wild-type strain, Ty1 RNA levels decrease dramatically in a
fus3
kss1
double mutant (data not shown), which
is more characteristic of mating-specific genes than of invasive growth
genes. These differences might be attributable to a
posttranscriptional effect on Ty1 RNA levels, since we are measuring
steady-state levels of Ty1 RNA rather than promoter activity.
Alternatively, there might be heterogeneous regulation of individual
Ty1 promoters. The effect of ste mutations on RNA from the
marked Ty1his3AI-242 element is consistent with the
possibility that at least some Ty1 elements are regulated with
characteristics of mating-specific genes. The Ty1his3AI-242 RNA level was lowered three- and twofold in ste5
and
ste4
mutants, respectively, which is a more significant
decrease than that of the total Ty1 RNA level in these strains (Fig.
5B). Hence, the expression of individual Ty1 elements may be affected
to different extents by the mating and invasive growth pathways.
Direct or indirect interaction of Fus3 with Ty1? TyA is a phosphoprotein (42, 56) whose steady-state levels are elevated in fus3 mutants (Fig. 2C and 3). Therefore, a simple hypothesis to explain the repression of transposition by Fus3 is that TyA is phosphorylated by the Fus3 kinase and that this modification targets TyA for degradation. Fus3 has multiple targets (26), and TyA has several MAP kinase consensus sites (S/T-P), but the phosphorylation sites in TyA that are used in vivo have not been identified. Xu and Boeke (56) found that when cells were exposed to mating pheromone, thereby activating Fus3, transposition of a pGTy1 element was inhibited. Moreover, TyA was hyperphosphorylated and VLP-associated p90-IN and Ty1 cDNA levels were reduced. Taken together with the results presented here, these findings are consistent with the hypothesis that Fus3 phosphorylates TyA and that this modification decreases the stability of VLPs and reduces transposition levels. An intermediate protein that is phosphorylated by Fus3 and in turn affects the phosphorylation state of TyA and the stability of VLP-associated proteins would also explain these observations.
Another mechanism by which Fus3 might mediate the posttranslational regulation of Ty1 is through its role in activating Ste12, which in turn promotes the expression of mating-specific genes. In this scenario, Fus3 would suppress transposition by stimulating the expression of a mating-specific gene that encodes an inhibitor of Ty1 transposition. Several observations argue against this interpretation. First, mating-specific genes are still expressed in a fus3 mutant, because Kss1 can substitute for Fus3 in the activation of Ste12 (24, 41). Second, the large decrease in Ty1his3AI-242 transposition in ste4
and
ste5
mutants relative to that in a fus3
mutant (Fig. 5B) suggests that there is an activator of transposition
encoded by a mating-specific gene, rather than an inhibitor. Third, the
fact that Kss1 is not redundant with Fus3 for the suppression of
Ty1his3AI-242 transposition suggests that transpositional
dormancy is not regulated via an inhibitor encoded by a mating-specific
gene.
A third scenario by which Fus3 might regulate transposition is via its
role as a negative regulator of invasive growth and FRE-dependent gene
expression (40, 48). Fus3 has a kinase-independent inhibitory activity that prevents the inappropriate activation of
invasion by the mating cascade; therefore, Kss1 can be erroneously activated by the mating pathway in fus3
mutants,
resulting in stimulation of both mating-specific and invasive-growth
gene expression (41). Hence, Fus3 may inhibit the expression
of an invasive growth gene that encodes an activator of Ty1
transposition. Several of our observations are consistent with this
hypothesis. Unactivable alleles of Fus3, fus3-T180D and
fus3-Y182E, retain some ability to suppress transposition
(Table 4), consistent with the expectation that they retain the
kinase-independent function of blocking the invasive-growth pathway. A
second relevant observation is that Ty1 transposition is dramatically
reduced in ste11
mutants even though the total Ty1 RNA
level is reduced by only twofold (Fig. 5). Similarly, invasive growth
and FRE-dependent gene expression are completely blocked in
ste11
mutants (40, 48). In contrast, transposition is only slightly reduced in kss1
mutants,
even though Ty1 RNA levels are comparable to those in
ste11
mutants. This is consistent with the moderate
reduction in FRE-dependent gene expression and weak invasion defect in
kss1
mutants that results from loss of both positive and
negative regulation of invasion by Kss1 (13, 40, 41).
Further experiments will be needed to determine whether the Fus3 kinase
interacts directly with Ty1 proteins or whether it acts through the
invasive growth pathway to mediate the posttranslational suppression of
Ty1 transposition.
Significance of regulating Ty1 transposition through conserved signal transduction cascades. Because insertional mutations caused by Ty1 transposition can be deleterious in haploids, the haploid-specific Fus3 kinase may have been adapted to specifically repress transposition during the haploid stage of the yeast life cycle. This mechanism of regulation also provides flexibility for the host cell to modulate transposition in response to environmental signals. We have demonstrated that Ty1 transposition is regulated not only by Fus3 but also by Ste4, Ste5, Ste11, Ste7, and Kss1. Therefore, transposition is potentially responsive to environmental signals in both haploid and diploid yeasts. The inhibition of transposition upon exposure of cells to mating pheromone is likely to be a direct effect of activating the Fus3 kinase. The fact that the Ty1 promoter is regulated as a filamentous or invasive growth gene predicts that environmental conditions that promote invasive growth will also activate Ty1 transposition, potentially in both haploids and diploids. Furthermore, the activity of Fus3 can be repressed by activation of other signal transduction cascades, such as the osmoregulatory pathway (35). Therefore, growth in high-osmolarity medium could increase Ty1 transposition in haploids. Although transposition is potentially deleterious, yeast cells might encounter severe conditions in which it is advantageous to activate transposition because of the ability of Ty1 to cause adaptive mutations by altering the regulation of target genes (53). Hence, under conditions of stress (such as conditions that induce invasive growth) where survival is threatened, Ty1 could be activated to induce genetic change, thereby providing a means for the cell to adapt to its environment.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to B. Faiola and W.-Y. Hu for their assistance at an early stage in this project, to H. Madhani for helpful suggestions and for sharing results prior to publication, to M. Bryk and R. Zitomer for helpful comments on the manuscript, and to the Molecular Genetics Core Facility for oligomer synthesis.
This work was funded by National Institutes of Health grant GM52072 to M.J.C. The research of D.J.G. was sponsored by the National Cancer Institute, DHHS, under contract with ABL.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Molecular Genetics Program, Wadsworth Center & School of Public Health, SUNY at Albany, P.O. Box 22002, Albany, NY 12201-2002. Phone: (518) 473-6078. Fax: (518) 474-3181. E-mail: joan.curcio{at}wadsworth.org.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545 |
| 2. | Bardwell, L., J. G. Cook, E. C. Chang, B. R. Cairns, and J. Thorner. 1996. Signaling in the yeast pheromone response pathway: specific and high-affinity interaction of the mitogen-activated protein (MAP) kinases Kss1 and Fus3 with the upstream MAP kinase kinase Ste7. Mol. Cell. Biol. 16:3637-3650[Abstract]. |
| 3. | Baur, M., R. K. Esch, and B. Errede. 1997. Cooperative binding interactions required for function of the Ty1 sterile responsive element. Mol. Cell. Biol. 17:4330-4337[Abstract]. |
| 4. | Best, S., P. Letissier, G. Towers, and J. P. Stoye. 1996. Positional cloning of the mouse retrovirus restriction gene Fv1. Nature 382:826-829[Medline]. |
| 5. | Boeke, J. D., and V. G. Corces. 1989. Transcription and reverse transcription of retrotransposons. Annu. Rev. Microbiol. 43:403-434[Medline]. |
| 6. |
Boeke, J. D.,
D. Eichinger,
D. Castrillon, and G. R. Fink.
1988.
The Saccharomyces cerevisiae genome contains functional and nonfunctional copies of transposon Ty1.
Mol. Cell. Biol.
8:1432-1442 |
| 7. | Boeke, J. D., D. J. Eichinger, and G. Natsoulis. 1991. Doubling Ty1 element copy number in Saccharomyces cerevisiae: host genome stability and phenotypic effects. Genetics 129:1043-1052[Abstract]. |
| 8. | Boeke, J. D., and S. B. Sandmeyer. 1991. Yeast transposable elements, p. 193-262. In J. R. Broach, J. Pringle, and E. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces, vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 9. | Braiterman, L. T., G. M. Monokian, D. J. Eichinger, S. L. Merbs, A. Gabriel, and J. D. Boeke. 1994. In-frame linker insertion mutagenesis of yeast transposon Ty1: phenotypic analysis. Gene 139:19-26[Medline]. |
| 10. | Chang, F., and I. Herskowitz. 1990. Identification of a gene necessary for cell cycle arrest by a negative growth factor of yeast: FAR1 is an inhibitor of a G1 cyclin, CLN2. Cell 63:999-1011[Medline]. |
| 11. |
Chapman, K. B.,
A. S. Bystrom, and J. D. Boeke.
1992.
Initiator methionine tRNA is essential for Ty1 transposition in yeast.
Proc. Natl. Acad. Sci. USA
89:3236-3240 |
| 12. | Choi, K. Y., B. Satterberg, D. M. Lyons, and E. A. Elion. 1994. Ste5 tethers multiple protein kinases in the MAP kinase cascade required for mating in S. cerevisiae. Cell 78:499-512[Medline]. |
| 13. | Cook, J. G., L. Bardwell, and J. Thorner. 1997. Inhibitory and activating functions for MAPK Kss1 in the S. cerevisiae filamentous-growth signalling pathway. Nature 360:85-88. |
| 14. | Curcio, M. J. Unpublished results. |
| 15. | Curcio, M. J., and D. J. Garfinkel. 1994. Heterogeneous functional Ty1 elements are abundant in the Saccharomyces cerevisiae genome. Genetics 136:1245-1259[Abstract]. |
| 16. |
Curcio, M. J., and D. J. Garfinkel.
1992.
Posttranslational control of Ty1 retrotransposition occurs at the level of protein processing.
Mol. Cell. Biol.
12:2813-2825 |
| 17. |
Curcio, M. J., and D. J. Garfinkel.
1991.
Single-step selection for Ty1 element retrotransposition.
Proc. Natl. Acad. Sci. USA
88:936-940 |
| 18. | Curcio, M. J., and D. J. Garfinkel. Unpublished results. |
| 19. | Curcio, M. J., A. M. Hedge, J. D. Boeke, and D. J. Garfinkel. 1990. Ty RNA levels determine the spectrum of retrotransposition events that activate gene expression in Saccharomyces cerevisiae. Mol. Gen. Genet. 220:213-221[Medline]. |
| 20. |
Curcio, M. J.,
N. J. Sanders, and D. J. Garfinkel.
1988.
Transpositional competence and transcription of endogenous Ty elements in Saccharomyces cerevisiae: implications for regulation of transposition.
Mol. Cell. Biol.
8:3571-3581 |
| 21. | Dalgaard, J. Z., M. Banerjee, and M. J. Curcio. 1996. A novel Ty1-mediated fragmentation method for native and artificial yeast chromosomes reveals that the mouse Steel gene is a hotspot for Ty1 integration. Genetics 143:673-683[Abstract]. |
| 22. | Dubois, E., E. Jacobs, and J.-C. Jauniaux. 1982. Expression of the ROAM mutations in Saccharomyces cerevisiae: involvement of trans-acting regulatory elements and relation with the Ty1 transcription. EMBO J. 1:1133-1139[Medline]. |
| 23. | Eichinger, D. J., and J. D. Boeke. 1988. The DNA intermediate in yeast Ty1 element transposition copurifies with virus-like particles: cell-free Ty1 transposition. Cell 54:955-966[Medline]. |
| 24. |
Elion, E. A.,
J. A. Brill, and G. R. Fink.
1991.
Functional redundancy in the yeast cell cycle: FUS3 and KSS1 have both overlapping and unique functions.
Cold Spring Harbor Symp. Quant. Biol.
56:41-49 |
| 25. |
Elion, E. A.,
P. L. Grisafi, and G. R. Fink.
1990.
FUS3 encodes a cdc2+/CDC28 related kinase required for the transition from mitosis into conjugation.
Cell
60:649-664[Medline].
|
| 26. | Elion, E. A., B. Satterberg, and J. E. Kranz. 1993. FUS3 phosphorylates multiple components of the mating signal transduction cascade: evidence for STE12 and FAR1. Mol. Biol. Cell 4:495-510[Abstract]. |
| 27. |
Errede, B., and G. Ammerer.
1989.
STE12, a protein involved in cell-type-specific transcription and signal transduction in yeast, is part of protein-DNA complexes.
Genes Dev.
3:1349-1361 |
| 28. | Errede, B., T. S. Cardillo, F. Sherman, E. Dubois, J. Deschamps, and J. M. Wiame. 1980. Mating signals control expression of mutations resulting from insertion of a transposable repetitive element adjacent to diverse yeast genes. Cell 22:427-436[Medline]. |
| 29. | Errede, B., A. Gartner, Z. Zhou, K. Nasmyth, and G. Ammerer. 1993. MAP kinase-related FUS3 from S. cerevisiae is activated by STE7 in vitro. Nature 362:261-264[Medline]. |
| 30. |
Farabaugh, P. J.
1995.
Post-transcriptional regulation of transposition by Ty retrotransposons of Saccharomyces cerevisiae.
J. Biol. Chem.
270:10361-10364 |
| 31. |
Fink, G. R., and C. A. Styles.
1972.
Curing of a killer factor in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
69:2846-2849 |
| 32. | Garfinkel, D. J., J. D. Boeke, and G. R. Fink. 1985. Ty element transposition: reverse transcriptase and virus-like particles. Cell 42:507-517[Medline]. |
| 33. |
Garfinkel, D. J.,
A. M. Hedge,
S. D. Youngren, and T. D. Copeland.
1991.
Proteolytic processing of pol-TYB proteins from the yeast retrotransposon Ty1.
J. Virol.
65:4573-4581 |
| 34. |
Gartner, A.,
K. Nasmyth, and G. Ammerer.
1992.
Signal transduction in Saccharomyces cerevisiae requires tyrosine and threonine phosphorylation of FUS3 and KSS1.
Genes Dev.
6:1280-1292 |
| 35. | Hall, J. P., V. Cherkasova, E. Elion, M. C. Gustin, and E. Winter. 1996. The osmoregulatory pathway represses mating pathway activity in Saccharomyces cerevisiae: isolation of a FUS3 mutant that is insensitive to the repression mechanism. Mol. Cell. Biol. 16:6715-6723[Abstract]. |
| 36. | Ji, H., D. P. Moore, M. A. Blomberg, L. T. Braiterman, D. F. Voytas, G. Natsoulis, and J. D. Boeke. 1993. Hotspots for unselected Ty1 transposition events on yeast chromosome III are near tRNA genes and LTR sequences. Cell 73:1007-1018[Medline]. |
| 37. | Kawakami, K., S. Pande, B. Faiola, D. P. Moore, J. D. Boeke, P. J. Farabaugh, J. N. Strathern, Y. Nakamura, and D. J. Garfinkel. 1993. A rare tRNA-Arg(CCU) that regulates Ty1 element ribosomal frameshifting is essential for Ty1 retrotransposition in Saccharomyces cerevisiae. Genetics 135:309-320[Abstract]. |
| 38. | Lea, D. E., and C. A. Coulson. 1949. The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-285. |
| 39. | Leberer, E., D. Dignard, D. Harcus, D. Y. Thomas, and M. Whiteway. 1992. The protein kinase homologue Ste20p is required to link the yeast pheromone response G-protein beta gamma subunits to downstream signalling components. EMBO J. 11:4815-4824[Medline]. |
| 40. |
Madhani, H. D., and G. R. Fink.
1997.
Combinatorial control required for the specificity of yeast MAPK signaling.
Science
275:1314-1317 |
| 41. | Madhani, H. D., C. A. Styles, and G. R. Fink. 1997. MAP kinases with distinct inhibitory functions impart signaling specificity during yeast differentiation. Cell 91:673-684[Medline]. |
| 42. |
Mellor, J.,
A. M. Fulton,
M. J. Dobson,
N. A. Roberts,
W. Wilson,
A. J. Kingsman, and S. M. Kingsman.
1985.
The Ty transposon of Saccharomyces cerevisiae determines the synthesis of at least three proteins.
Nucleic Acids Res.
13:6249-6263 |
| 43. |
Mosch, H. U.,
R. L. Roberts, and G. R. Fink.
1996.
Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5352-5356 |
| 44. |
Neiman, A. M., and I. Herskowitz.
1994.
Reconstitution of a yeast protein kinase cascade in vitro: activation of the yeast MEK homologue STE7 by STE11.
Proc. Natl. Acad. Sci. USA
91:3398-3402 |
| 45. | Nouvel, P. 1994. The mammalian genome shaping activity of reverse transcriptase. Genetica 93:191-201[Medline]. |
| 46. |
Peter, M., and I. Herskowitz.
1994.
Direct inhibition of the yeast cyclin-dependent kinase Cdc28-Cln by Far1.
Science
265:1228-1231 |
| 47. |
Petrov, D. A.,
J. L. Schutzman,
D. L. Hartl, and E. R. Lozovskaya.
1995.
Diverse transposable elements are mobilized in hybrid dysgenesis in Drosophila virilis.
Proc. Natl. Acad. Sci. USA
92:8050-8054 |
| 48. |
Roberts, R. L., and G. R. Fink.
1994.
Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth.
Genes Dev.
8:2974-2985 |
| 49. | Rose, M. D., F. Winston, and P. Hieter. 1990. In Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 50. | Sandmeyer, S. B. 1992. Yeast retrotransposons. Curr. Opin. Genet. Dev. 2:705-711[Medline]. |
| 51. |
Sharon, G.,
T. J. Burkett, and D. J. Garfinkel.
1994.
Efficient homologous recombination of Ty1 element cDNA when integration is blocked.
Mol. Cell. Biol.
14:6540-6551 |
| 52. | Sprague, G. F., and J. W. Thorner. 1992. Pheromone response and signal transduction during the mating process of Saccharomyces cerevisiae, p. 657-744. In E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 53. | Wilke, C. M., and J. Adams. 1992. Fitness effects of Ty transposition in Saccharomyces cerevisiae. Genetics 131:31-42[Abstract]. |
| 54. | Winston, F., K. J. Durbin, and G. R. Fink. 1984. The SPT3 gene is required for normal transcription of Ty elements in S. cerevisiae. Cell 39:675-682[Medline]. |
| 55. | Wright, A. P., M. Bruns, and B. S. Hartley. 1989. Extraction and rapid inactivation of proteins from Saccharomyces cerevisiae by trichloroacetic acid precipitation. Yeast 5:51-53[Medline]. |
| 56. |
Xu, H., and J. D. Boeke.
1991.
Inhibition of Ty1 transposition by mating pheromones in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:2736-2743 |
| 57. |
Youngren, S. D.,
J. D. Boeke,
N. J. Sanders, and D. J. Garfinkel.
1988.
Functional organization of the retrotransposon Ty from Saccharomyces cerevisiae: Ty protease is required for transposition.
Mol. Cell. Biol.
8:1421-1431 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»